debian/0000755000000000000000000000000012252541666007177 5ustar debian/clustalw.manpages0000644000000000000000000000002212252541625012537 0ustar debian/clustalw.1 debian/control0000644000000000000000000000264612252541625010605 0ustar Source: clustalw Maintainer: Debian Med Packaging Team Uploaders: Steffen Moeller , Charles Plessy , Andreas Tille Section: science Priority: optional Build-Depends: debhelper (>= 9), autotools-dev Standards-Version: 3.9.5 Vcs-Browser: http://anonscm.debian.org/gitweb/?p=debian-med/clustalw.git Vcs-Git: git://anonscm.debian.org/debian-med/clustalw.git Homepage: http://www.clustal.org/clustal2/ Package: clustalw Architecture: any Depends: ${shlibs:Depends}, ${misc:Depends} Suggests: clustalx, seaview Enhances: bioperl-run, emboss, t-coffee Description: global multiple nucleotide or peptide sequence alignment This program performs an alignment of multiple nucleotide or amino acid sequences. It recognizes the format of input sequences and whether the sequences are nucleic acid (DNA/RNA) or amino acid (proteins). The output format may be selected from in various formats for multiple alignments such as Phylip or FASTA. Clustal W is very well accepted. . The output of Clustal W can be edited manually but preferably with an alignment editor like SeaView or within its companion Clustal X. When building a model from your alignment, this can be applied for improved database searches. The Debian package hmmer creates such in form of an HMM. debian/clustalw.10000644000000000000000000003463212252541625011122 0ustar '\" t .\" Title: CLUSTALW .\" Author: Des Higgins .\" Generator: DocBook XSL Stylesheets v1.75.2 .\" Date: 12/28/2010 .\" Manual: Clustal Manual .\" Source: Clustal 2.1 .\" Language: English .\" .TH "CLUSTALW" "1" "12/28/2010" "Clustal 2.1" "Clustal Manual" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" clustalw \- Multiple alignment of nucleic acid and protein sequences .SH "SYNOPSIS" .HP \w'\fBclustalw\fR\ 'u \fBclustalw\fR [\fB\-infile\fR] \fIfile\&.ext\fR [\fBOPTIONS\fR] .HP \w'\fBclustalw\fR\ 'u \fBclustalw\fR [\fB\-help\fR | \fB\-fullhelp\fR] .SH "DESCRIPTION" .PP Clustal\ \&W is a general purpose multiple alignment program for DNA or proteins\&. .PP The program performs simultaneous alignment of many nucleotide or amino acid sequences\&. It is typically run interactively, providing a menu and an online help\&. If you prefer to use it in command\-line (batch) mode, you will have to give several options, the minimum being \fB\-infile\fR\&. .SH "OPTIONS" .SS "DATA (sequences)" .PP \fB \-infile=\fR\fB\fIfile\&.ext\fR\fR\fB \fR .RS 4 Input sequences\&. .RE .PP \fB \-profile1=\fR\fB\fIfile\&.ext\fR\fR\fB and \-profile2=\fR\fB\fIfile\&.ext\fR\fR\fB \fR .RS 4 Profiles (old alignment) .RE .SS "VERBS (do things)" .PP \fB\-options\fR .RS 4 List the command line parameters\&. .RE .PP \fB\-help or \-check\fR .RS 4 Outline the command line params\&. .RE .PP \fB\-fullhelp\fR .RS 4 Output full help content\&. .RE .PP \fB\-align\fR .RS 4 Do full multiple alignment\&. .RE .PP \fB\-tree\fR .RS 4 Calculate NJ tree\&. .RE .PP \fB\-pim\fR .RS 4 Output percent identity matrix (while calculating the tree)\&. .RE .PP \fB \-bootstrap\fR\fB\fI=n\fR\fR\fB \fR .RS 4 Bootstrap a NJ tree (\fIn\fR= number of bootstraps; def\&. = 1000)\&. .RE .PP \fB\-convert\fR .RS 4 Output the input sequences in a different file format\&. .RE .SS "PARAMETERS (set things)" .sp .it 1 an-trap .nr an-no-space-flag 1 .nr an-break-flag 1 .br .ps +1 \fBGeneral settings:\fR .RS 4 .PP \fB\-interactive\fR .RS 4 Read command line, then enter normal interactive menus\&. .RE .PP \fB\-quicktree\fR .RS 4 Use FAST algorithm for the alignment guide tree\&. .RE .PP \fB\-type=\fR .RS 4 \fIPROTEIN\fR or \fIDNA\fR sequences\&. .RE .PP \fB\-negative\fR .RS 4 Protein alignment with negative values in matrix\&. .RE .PP \fB\-outfile=\fR .RS 4 Sequence alignment file name\&. .RE .PP \fB\-output=\fR .RS 4 \fIGCG\fR, \fIGDE\fR, \fIPHYLIP\fR, \fIPIR\fR or \fINEXUS\fR\&. .RE .PP \fB\-outputorder=\fR .RS 4 \fIINPUT\fR or \fIALIGNED\fR .RE .PP \fB\-case\fR .RS 4 \fILOWER\fR or \fIUPPER\fR (for GDE output only)\&. .RE .PP \fB\-seqnos=\fR .RS 4 \fIOFF\fR or \fION\fR (for Clustal output only)\&. .RE .PP \fB\-seqnos_range=\fR .RS 4 \fIOFF\fR or \fION\fR (NEW: for all output formats)\&. .RE .PP \fB\-range=\fR\fB\fIm\fR\fR\fB,\fR\fB\fIn\fR\fR .RS 4 Sequence range to write starting \fIm\fR to \fIm\fR+\fIn\fR\&. .RE .PP \fB\-maxseqlen=\fR\fB\fIn\fR\fR .RS 4 Maximum allowed input sequence length\&. .RE .PP \fB\-quiet\fR .RS 4 Reduce console output to minimum\&. .RE .PP \fB\-stats=\fR\fB\fIfile\fR\fR .RS 4 Log some alignments statistics to \fIfile\fR\&. .RE .RE .sp .it 1 an-trap .nr an-no-space-flag 1 .nr an-break-flag 1 .br .ps +1 \fBFast Pairwise Alignments:\fR .RS 4 .PP \fB\-ktuple=\fR\fB\fIn\fR\fR .RS 4 Word size\&. .RE .PP \fB\-topdiags=\fR\fB\fIn\fR\fR .RS 4 Number of best diags\&. .RE .PP \fB\-window=\fR\fB\fIn\fR\fR .RS 4 Window around best diags\&. .RE .PP \fB\-pairgap=\fR\fB\fIn\fR\fR .RS 4 Gap penalty\&. .RE .PP \fB\-score\fR .RS 4 \fIPERCENT\fR or \fIABSOLUTE\fR\&. .RE .RE .sp .it 1 an-trap .nr an-no-space-flag 1 .nr an-break-flag 1 .br .ps +1 \fBSlow Pairwise Alignments:\fR .RS 4 .PP \fB\-pwmatrix=\fR .RS 4 :Protein weight matrix=\fIBLOSUM\fR, \fIPAM\fR, \fIGONNET\fR, \fIID\fR or \fIfilename\fR .RE .PP \fB\-pwdnamatrix=\fR .RS 4 DNA weight matrix=\fIBLOSUM\fRIUB, \fIBLOSUM\fRCLUSTALW or \fIBLOSUM\fRfilename\&. .RE .PP \fB\-pwgapopen=\fR\fB\fIf\fR\fR .RS 4 Gap opening penalty\&. .RE .PP \fB\-pwgapext=\fR\fB\fIf\fR\fR .RS 4 Gap extension penalty\&. .RE .RE .sp .it 1 an-trap .nr an-no-space-flag 1 .nr an-break-flag 1 .br .ps +1 \fBMultiple Alignments:\fR .RS 4 .PP \fB\-newtree=\fR .RS 4 File for new guide tree\&. .RE .PP \fB\-usetree=\fR .RS 4 File for old guide tree\&. .RE .PP \fB\-matrix=\fR .RS 4 Protein weight matrix=\fIBLOSUM\fR, \fIPAM\fR, \fIGONNET\fR, \fIID\fR or \fIfilename\fR\&. .RE .PP \fB\-dnamatrix=\fR .RS 4 DNA weight matrix=\fIIUB\fR, \fICLUSTALW\fR or \fIfilename\fR\&. .RE .PP \fB\-gapopen=\fR\fB\fIf\fR\fR .RS 4 Gap opening penalty\&. .RE .PP \fB\-gapext=\fR\fB\fIf\fR\fR .RS 4 Gap extension penalty\&. .RE .PP \fB\-engaps\fR .RS 4 No end gap separation pen\&. .RE .PP \fB\-gapdist=\fR\fB\fIn\fR\fR .RS 4 Gap separation pen\&. range\&. .RE .PP \fB\-nogap\fR .RS 4 Residue\-specific gaps off\&. .RE .PP \fB\-nohgap\fR .RS 4 Hydrophilic gaps off\&. .RE .PP \fB\-hgapresidues=\fR .RS 4 List hydrophilic res\&. .RE .PP \fB\-maxdiv=\fR\fB\fIn\fR\fR .RS 4 Percent identity for delay\&. .RE .PP \fB\-type=\fR .RS 4 \fIPROTEIN\fR or \fIDNA\fR .RE .PP \fB\-transweight=\fR\fB\fIf\fR\fR .RS 4 Transitions weighting\&. .RE .PP \fB\-iteration=\fR .RS 4 \fINONE\fR or \fITREE\fR or \fIALIGNMENT\fR\&. .RE .PP \fB\-numiter=\fR\fB\fIn\fR\fR .RS 4 Maximum number of iterations to perform\&. .RE .RE .sp .it 1 an-trap .nr an-no-space-flag 1 .nr an-break-flag 1 .br .ps +1 \fBProfile Alignments:\fR .RS 4 .PP \fB\-profile\fR .RS 4 Merge two alignments by profile alignment\&. .RE .PP \fB\-newtree1=\fR .RS 4 File for new guide tree for profile1\&. .RE .PP \fB\-newtree2=\fR .RS 4 File for new guide tree for profile2\&. .RE .PP \fB\-usetree1=\fR .RS 4 File for old guide tree for profile1\&. .RE .PP \fB\-usetree2=\fR .RS 4 File for old guide tree for profile2\&. .RE .RE .sp .it 1 an-trap .nr an-no-space-flag 1 .nr an-break-flag 1 .br .ps +1 \fBSequence to Profile Alignments:\fR .RS 4 .PP \fB\-sequences\fR .RS 4 Sequentially add profile2 sequences to profile1 alignment\&. .RE .PP \fB\-newtree=\fR .RS 4 File for new guide tree\&. .RE .PP \fB\-usetree=\fR .RS 4 File for old guide tree\&. .RE .RE .sp .it 1 an-trap .nr an-no-space-flag 1 .nr an-break-flag 1 .br .ps +1 \fBStructure Alignments:\fR .RS 4 .PP \fB\-nosecstr1\fR .RS 4 Do not use secondary structure\-gap penalty mask for profile 1\&. .RE .PP \fB\-nosecstr2\fR .RS 4 Do not use secondary structure\-gap penalty mask for profile 2\&. .RE .PP \fB\-secstrout=\fR\fB\fISTRUCTURE\fR\fR\fB or \fR\fB\fIMASK\fR\fR\fB or \fR\fB\fIBOTH\fR\fR\fB or \fR\fB\fINONE\fR\fR .RS 4 Output in alignment file\&. .RE .PP \fB\-helixgap=\fR\fB\fIn\fR\fR .RS 4 Gap penalty for helix core residues\&. .RE .PP \fB\-strandgap=\fR\fB\fIn\fR\fR .RS 4 Gap penalty for strand core residues\&. .RE .PP \fBloopgap=\fR\fB\fIn\fR\fR .RS 4 Gap penalty for loop regions\&. .RE .PP \fB\-terminalgap=\fR\fB\fIn\fR\fR .RS 4 Gap penalty for structure termini\&. .RE .PP \fB\-helixendin=\fR\fB\fIn\fR\fR .RS 4 Number of residues inside helix to be treated as terminal\&. .RE .PP \fB\-helixendout=\fR\fB\fIn\fR\fR .RS 4 Number of residues outside helix to be treated as terminal\&. .RE .PP \fB\-strandendin=\fR\fB\fIn\fR\fR .RS 4 Number of residues inside strand to be treated as terminal\&. .RE .PP \fB\-strandendout=\fR\fB\fIn\fR\fR .RS 4 Number of residues outside strand to be treated as terminal\&. .RE .RE .sp .it 1 an-trap .nr an-no-space-flag 1 .nr an-break-flag 1 .br .ps +1 \fBTrees:\fR .RS 4 .PP \fB\-outputtree=\fR\fB\fInj\fR\fR\fB OR \fR\fB\fIphylip\fR\fR\fB OR \fR\fB\fIdist\fR\fR\fB OR \fR\fB\fInexus\fR\fR .RS 4 .RE .PP \fB\-seed=\fR\fB\fIn\fR\fR .RS 4 Seed number for bootstraps\&. .RE .PP \fB\-kimura\fR .RS 4 Use Kimura\*(Aqs correction\&. .RE .PP \fB\-tossgaps\fR .RS 4 Ignore positions with gaps\&. .RE .PP \fB\-bootlabels=\fR\fB\fInode\fR\fR .RS 4 Position of bootstrap values in tree display\&. .RE .PP \fB\-clustering=\fR .RS 4 NJ or UPGMA\&. .RE .RE .SH "BUGS" .PP The Clustal bug tracking system can be found at \m[blue]\fB\%http://bioinf.ucd.ie/bugzilla/buglist.cgi?quicksearch=clustal\fR\m[]\&. .SH "SEE ALSO" .PP \fBclustalx\fR(1)\&. .SH "REFERENCES" .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG\&. (2007)\&. \m[blue]\fBClustal W and Clustal X version 2\&.0\&.\fR\m[]\&\s-2\u[1]\d\s+2 Bioinformatics, 23, 2947\-2948\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD\&. (2003)\&. \m[blue]\fBMultiple sequence alignment with the Clustal series of programs\&.\fR\m[]\&\s-2\u[2]\d\s+2 Nucleic Acids Res\&., 31, 3497\-3500\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ\&. (1998)\&. \m[blue]\fBMultiple sequence alignment with Clustal X\fR\m[]\&\s-2\u[3]\d\s+2\&. Trends Biochem Sci\&., 23, 403\-405\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG\&. (1997)\&. \m[blue]\fBThe CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools\&.\fR\m[]\&\s-2\u[4]\d\s+2 Nucleic Acids Res\&., 25, 4876\-4882\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Higgins DG, Thompson JD, Gibson TJ\&. (1996)\&. \m[blue]\fBUsing CLUSTAL for multiple sequence alignments\&.\fR\m[]\&\s-2\u[5]\d\s+2 Methods Enzymol\&., 266, 383\-402\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Thompson JD, Higgins DG, Gibson TJ\&. (1994)\&. \m[blue]\fBCLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position\-specific gap penalties and weight matrix choice\&.\fR\m[]\&\s-2\u[6]\d\s+2 Nucleic Acids Res\&., 22, 4673\-4680\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Higgins DG\&. (1994)\&. \m[blue]\fBCLUSTAL V: multiple alignment of DNA and protein sequences\&.\fR\m[]\&\s-2\u[7]\d\s+2 Methods Mol Biol\&., 25, 307\-318 .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Higgins DG, Bleasby AJ, Fuchs R\&. (1992)\&. \m[blue]\fBCLUSTAL V: improved software for multiple sequence alignment\&.\fR\m[]\&\s-2\u[8]\d\s+2 Comput\&. Appl\&. Biosci\&., 8, 189\-191\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Higgins,D\&.G\&. and Sharp,P\&.M\&. (1989)\&. \m[blue]\fBFast and sensitive multiple sequence alignments on a microcomputer\&.\fR\m[]\&\s-2\u[9]\d\s+2 Comput\&. Appl\&. Biosci\&., 5, 151\-153\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} Higgins,D\&.G\&. and Sharp,P\&.M\&. (1988)\&. \m[blue]\fBCLUSTAL: a package for performing multiple sequence alignment on a microcomputer\&.\fR\m[]\&\s-2\u[10]\d\s+2 Gene, 73, 237\-244\&. .RE .SH "AUTHORS" .PP \fBDes Higgins\fR .RS 4 Copyright holder for Clustal\&. .RE .PP \fBJulie Thompson\fR .RS 4 Copyright holder for Clustal\&. .RE .PP \fBToby Gibson\fR .RS 4 Copyright holder for Clustal\&. .RE .PP \fBCharles Plessy\fR <\&plessy@debian\&.org\&> .RS 4 Prepared this manpage in DocBook XML for the Debian distribution\&. .RE .SH "COPYRIGHT" .br Copyright \(co 1988\(en2010 Des Higgins, Julie Thompson & Toby Giboson (Clustal) .br Copyright \(co 2008\(en2010 Charles Plessy (This manpage) .br .PP This program is free software: you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version\&. .PP This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE\&. See the GNU Lesser General Public License for more details\&. .PP You should have received a copy of the GNU Lesser General Public License along with this program\&. If not, see http://www\&.gnu\&.org/licenses/, or on Debian systems, /usr/share/common\-licenses/LGPL\-3\&. .PP This manual page and its XML source can be used, modified, and redistributed as if it were in public domain\&. .sp .SH "NOTES" .IP " 1." 4 Clustal W and Clustal X version 2.0. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/17846036 .RE .IP " 2." 4 Multiple sequence alignment with the Clustal series of programs. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/12824352 .RE .IP " 3." 4 Multiple sequence alignment with Clustal X .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/9810230 .RE .IP " 4." 4 The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/9396791 .RE .IP " 5." 4 Using CLUSTAL for multiple sequence alignments. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/8743695 .RE .IP " 6." 4 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/7984417 .RE .IP " 7." 4 CLUSTAL V: multiple alignment of DNA and protein sequences. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/8004173 .RE .IP " 8." 4 CLUSTAL V: improved software for multiple sequence alignment. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/1591615 .RE .IP " 9." 4 Fast and sensitive multiple sequence alignments on a microcomputer. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/2720464 .RE .IP "10." 4 CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. .RS 4 \%http://www.ncbi.nlm.nih.gov/pubmed/3243435 .RE debian/reference0000644000000000000000000000114212252541625011051 0ustar @article{M.A.Larkin11012007, author = {Larkin, M.A. and Blackshields, G. and Brown, N.P. and Chenna, R. and McGettigan, P.A. and McWilliam, H. and Valentin, F. and Wallace, I.M. and Wilm, A. and Lopez, R. and Thompson, J.D. and Gibson, T.J. and Higgins, D.G.}, title = {{Clustal W and Clustal X version 2.0}}, journal = {Bioinformatics}, volume = {23}, number = {21}, pages = {2947-2948}, doi = {10.1093/bioinformatics/btm404}, year = {2007}, }, URL = {http://bioinformatics.oxfordjournals.org/cgi/content/abstract/23/21/2947}, eprint = {http://bioinformatics.oxfordjournals.org/cgi/reprint/23/21/2947.pdf} } debian/CHANGELOG.upstream0000644000000000000000000002200512252541625012242 0ustar ---------------------------------------------------------------------- Version 2.1 ---------------------------------------------------------------------- * Fixed bug 196 "clustalx: user feedback about use of secondary structure printed to console" - secondary structure is now used if specified in Alignment -> Alignment Parameters -> Secondary Structure Parameters UserParameters->getGui() should be used when ClustalW code needs to know if a function has been called from ClustalX * Fixed bug 204 "Nexus alignment format contain invalid line" - the amino acid alphabet line has been removed * Missing/corrupted file names in ClustalX status messages have been fixed * Fixed bug 175 "msf/pileup files cannot be read if sequences names are all numbers" - this happened if a line such as 528244 .......... .......... .......... .......... .......... was present in the first block of the file * Fixed bug 192 "Alignment in Phylip Format broken for big Alignments" * Fixed bug 198 "Warning about divergent sequences gets printed to console in ClustalX" * Fixed bug 151 "clustalx doesn't switch to profile alignment mode when profile12 is given on cmdline" ---------------------------------------------------------------------- Version 2.0.12 ---------------------------------------------------------------------- * Fixed bug 189 "Fixed filename used for iteration": Now Creating temporary file and added error check * Fixed bug 180 "Pairwise NJ tree: final bracket missing" * Fixed bug 178 "Seg-fault on 64bit when -quicktree -upgma for sequences with high identity": Using relative error now to avoid unsafe comparison which led to incorrect branching * Fixed Bug 176 "iteration doesn't iterate if -usetree is used as well" * Fixed bug 162 "percent identity file option in clustalW not working": Added -pim as command line option. See help * Fixed bug 155 "upgma trees cannot be read" * Fixed bug 147 "report duplicate sequences": "ClustalW/X now report offending sequences which are empty, duplicates etc * Fixed bug 134 "Exit when encountering unrecognized cmdline params": ClustalW now exits when encountering invalid values for command line arguments instead of just reverting to default values * Fixed bug 185 "clustal alignments differ between interactive and commandline mode" window-gap and ktuple initialisation now fixed and made the same between commandline and interactive mode * Fixed bug 184 "error messages are send to stdout" * Fixed bug when weights are 0, and nseq > INT_SCALE_FACTOR in UPGMA code (see RootedGuideTree.cpp) * General code cleanup - Introduced return values where control reached end of non-void function - Removed unused variables - Removed comparison between signed and unsigned integer expressions - Removed deprecated conversion from string constant to char* ---------------------------------------------------------------------- Version 2.0.11 ---------------------------------------------------------------------- * fixed file extension bug 166 in interactive mode * Fixed bug 169, memory violation for DNA/RNA k-tuple * Cut down distance calculation, symmetric matrix ---------------------------------------------------------------------- Version 2.0.10 ---------------------------------------------------------------------- * Fixed g++-4.3 compilation errors * Added new -quiet command line flag * Added new -stats= command line flag * Fixed bug 142: command separator can now be mixed "/" and "-" on all platforms * Fixed bug 141: profile merging and saving failed * Fixed bug 139: saving of column quality scores * Updated help files (new flags, new colour parameter format) ---------------------------------------------------------------------- Version 2.0.9 ---------------------------------------------------------------------- * GUI now responding and giving feedback during alignment * automatic automake os detection * new OS_ define (set by clustalw/configure clustalx/clustalx.pro) * got rid of qt3 dependencies * removed QScrollArea bug workaround (fixed in Qt 4.3) * Fixed bug 135: Last sequence and last residue not displayed on MacOSX * Fixed bug 123: secondary structure profile alignment in clustalX on Mac * Fixed g++-4.3 build error (include climits.h) ---------------------------------------------------------------------- Version 2.0.8 ---------------------------------------------------------------------- * Implemented maxseqlen cmdline switch * Updated help-file * Fixed Bug 123: loading profile using gap penalties (ClustalX, Mac) * Fixed bug 133: providing profiles on command line fails (ClustalX) * Fixed bug 125: Angle bracket inside sequence * Fixed bug 129: Early exit on empty sequence * Fixed a couple of possible memory leaks ---------------------------------------------------------------------- Version 2.0.7 ---------------------------------------------------------------------- * Fixed bug 121: CRLF in sequence names (Pearson) are not trimmed * Fixed bug 122: convert option broken * Fixed reopened bug 114: profile alignment input didn't work with new getSeqRange routines * Fixed bug 119: build with g++ 4.3 ---------------------------------------------------------------------- Version 2.0.6 ---------------------------------------------------------------------- * Fixed bug 77: fasta input performance issue * Fixed bug 114: segfault while doing profile alignment with secondary structure mask * Removed unncessary id console output in EMBLFileParser.cpp * Fixed Bugs 108 and 109 and allowed mixed-case command line options ---------------------------------------------------------------------- Version 2.0.5 ---------------------------------------------------------------------- * Fixed bug 105: Disallowed combination of "Reset Gaps" and Iteration in GUI * Fixed bug 104 "reset all gaps doesn't work" * Changed command line separator for Mac to hyphen instead slash * Fixed full command line parsing for ClustalX after help flag ---------------------------------------------------------------------- Version 2.0.4 ---------------------------------------------------------------------- * Updated URLs in help files * Fixed bug 96: error message when loading alignment with identical sequence names * Made console output look more like 1.83 * Fixed bug 100: "Scores in clustalw2.0 don't match clustalw1.83" getMatrix was called with wrong scaling factor * Fixed bug 99: "stars in input not ignored" Asterisks were changed to gaps in alignment * New command line option: -fullhelp which dumps the built-in help file content. * Quickfix for bug 94 "quicktree seqfault" ---------------------------------------------------------------------- <= Version 2.0.3 ---------------------------------------------------------------------- * Added LICENSE file to distribution This file contains the information about commercial licensing of clustal as well as FAQ for licensing issues * Added README file to distribution This is the file that lists the files and directories on the Clustal FTP site. It also includes acknowledgements of people who have contributed binaries * Removed .pro Qt file from the distribution pro-file should be generated anew using qmake and modified according to build requirements, i.e. no need for version control. * Fixed bug where ClustalX2 was not processing command line args * Fixed Segfault on opening helpfile. Happened on Linux only with -O2 and when calling binary directly, not using the wrapper * Added debian packaging files * Added support for help command line flag GUI/xmenus version When requesting help file, graphical version of command line help is displayed (1.83 tried to open clustalw help) * Added complete automake (configure etc) system according to the following websites: - http://www.openismus.com/documents/linux/automake/automake.shtml - http://www.bioinf.uni-freiburg.de/~mmann/HowTo/automake.html * clustalw files source files have been moved to subdir * Fixed bug #53 change MAXNAMESTODISPLAY back to 10 from 30. This fixes problem of large amount of space between sequence name and actual alignment in clustal output files * This solves bug #72 with long lines (5000+) in fasta files changed code to use strings rather than arrays. Needed to add delim parameter to getline in order to read files formatted for different OSs on different platforms. * Fixed Bug 79: "The count of amino acids in the ClustalX Postscript output not correct" Off-by-one issue * ClustalX and ClustalW version numbers are now the same and defined in ClustalW code (automake) * Fixed problem with compilation of ClustalX2 with gcc3 avoiding gcc3 error message: cannot declare member function QDir::currentPath' * Target now clustalw2 instead of clustalw * Fixed Bug 46 added in aminoacid code O for pyrrolysine * Fixed bug 89 changed clustalw2.0 to conform to 1.83 behaviour for width of sequence ID and alignment * Fixed bug 90 changed clustalw2.0 to conform to 1.83 behaviour leading spaces are stripped from FASTA identifiers. * Fixed bug 91 Clustalw2.0 now handles pseudo-FASTA/MoST format files. Strips out numbers and spaces. debian/README.debian0000644000000000000000000000146512252541625011301 0ustar Clustal W for Debian ──────────────────── Since version 2.1, Clustal is free software. The upstream archives have been updated in December 2010 to clarify that, but their version number was not changed. Because the Debian archive does not support this, the Debian package's version is 2.1+lgpl. Charles Plessy Sat, 29 Jan 2011 19:59:40 +0900 The packaging of ClustalW and ClustalX has been split to better reflect the handling of upstream and thus reduce our effort. The name of the binary remains clustalw instead of upstream's clustalw2. If there are any problems with this approach, then please inform us about it. Andreas Tille , Mon, 29 Oct 2001 21:40:20 +0100 Steffen Moeller Sun, 17 Feb 2008 15:43:42 +0100 debian/clustalw.menu0000644000000000000000000000030112252541625011710 0ustar ?package(clustalw):needs="text"\ section="Applications/Science/Biology"\ title="ClustalW"\ command="/usr/bin/clustalw"\ hints="Global multiple nucleotide or peptide sequence alignment" debian/rules0000755000000000000000000000114712252541625010255 0ustar #!/usr/bin/make -f %: dh $@ --with autotools_dev override_dh_installchangelogs: dh_installchangelogs debian/CHANGELOG.upstream override_dh_install: dh_install # We have to ask upstream if it is important for them that the binary is named clustalw2 mv $(CURDIR)/debian/clustalw/usr/bin/clustalw2 $(CURDIR)/debian/clustalw/usr/bin/clustalw # That is a bit ugly and should be better investigated. rmdir $(CURDIR)/debian/clustalw/usr/share/aclocal/ get-upstream-changelog: # Get upstream changelog cd debian; wget -N --output-document=CHANGELOG.upstream http://www.clustal.org/download/current/CHANGELOG debian/watch0000644000000000000000000000015612252541625010225 0ustar version=3 opts=dversionmangle=s/\+lgpl// \ http://www.clustal.org/download/current/clustalw-([\.\d]*).tar.gz debian/upstream0000644000000000000000000000145112252541625010756 0ustar Bugs: http://bioinf.ucd.ie/bugzilla/buglist.cgi?quicksearch=clustal Contact: clustalw@ucd.ie Homepage: http://www.clustal.org/ Reference: author: Larkin, M. A. and Blackshields, G. and Brown, N. P. and Chenna, R. and McGettigan, P. A. and McWilliam, H. and Valentin, F. and Wallace, I.M. and Wilm, A. and Lopez, R. and Thompson, J. D. and Gibson, T. J. and Higgins, D. G. title: Clustal W and Clustal X version 2.0 journal: Bioinformatics volume: 23 number: 21 pages: 2947-2948 year: 2007 PMID: 17846036 DOI: 10.1093/bioinformatics/btm404 URL: http://bioinformatics.oxfordjournals.org/cgi/content/abstract/23/21/2947 eprint: http://bioinformatics.oxfordjournals.org/cgi/reprint/23/21/2947.pdf Webservice: - http://www.ebi.ac.uk/Tools/clustalw2/ - http://www.ch.embnet.org/software/ClustalW.html debian/clustalw.install0000644000000000000000000000004312252541625012415 0ustar clustalw_help usr/share/clustalw debian/copyright0000644000000000000000000000405312252541625011127 0ustar Format: http://www.debian.org/doc/packaging-manuals/copyright-format/1.0/ Upstream-Name: ClustalQ Source: http://www.clustal.org/download/current/clustalw-2.1.tar.gz Files: * Copyright: © Des Higgins, Julie Thompson and Toby Gibson License: LGPL-3+ This program is free software: you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. . This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more details. . You should have received a copy of the GNU Lesser General Public License along with this program. If not, see . Comment: On Debian systems, you can read the full text of the GNU Lesser General Public License in ‘/usr/share/common-licenses/LGPL-3’. Files: debian/* Copyright: © 1998-1999 Stephane Bortzmeyer © 2001 Dr. Guenter Bechly © 2001 Adrian Bunk © 2001-2013 Andreas Tille © 2006 Kai Hendry © 2007 Nelson A. de Oliveira © 2003-2008 Steffen Möller © 2007-2010 Charles Plessy © 2008 David Paleino License: DFSG_free The licence of the earlier works was never stated. Some works have been obsoleted by release of version 2.0 — the lesstif migration for instance — but authors are left in the list of copyright holders by courtesy. The work of Charles Plessy and Steffen Möller can be treated as if it were public domain. Files: debian/clustalw.1.xml debian/clustalw.1 Copyright: © 2008–10 Charles Plessy License: PD The manual page and its XML source can be used, modified, and redistributed as if it were in public domain. debian/source/0000755000000000000000000000000012252541625010472 5ustar debian/source/format0000644000000000000000000000001412252541625011700 0ustar 3.0 (quilt) debian/clustalw.1.xml0000644000000000000000000007727612252541625011734 0ustar ]> &dhtitle; &dhproduct; &dhrelease; Des Higgins Copyright holder for &dhproduct;. Julie Thompson Copyright holder for &dhproduct;. Toby Gibson Copyright holder for &dhproduct;. &dhfirstname; &dhsurname; Prepared this manpage in DocBook XML for the Debian distribution.
&dhemail;
1988–2010 Des Higgins, Julie Thompson & Toby Giboson (&dhproduct;) 2008–2010 &dhusername; (This manpage) This program is free software: you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more details. You should have received a copy of the GNU Lesser General Public License along with this program. If not, see http://www.gnu.org/licenses/, or on Debian systems, /usr/share/common-licenses/LGPL-3. This manual page and its XML source can be used, modified, and redistributed as if it were in public domain. &dhucpackage; &dhsection; &dhpackage; Multiple alignment of nucleic acid and protein sequences &dhpackage; file.ext &dhpackage; DESCRIPTION Clustal W is a general purpose multiple alignment program for DNA or proteins. The program performs simultaneous alignment of many nucleotide or amino acid sequences. It is typically run interactively, providing a menu and an online help. If you prefer to use it in command-line (batch) mode, you will have to give several options, the minimum being . OPTIONS DATA (sequences) Input sequences. Profiles (old alignment) VERBS (do things) List the command line parameters. Outline the command line params. Output full help content. Do full multiple alignment. Calculate NJ tree. Output percent identity matrix (while calculating the tree). Bootstrap a NJ tree (n= number of bootstraps; def. = 1000). Output the input sequences in a different file format. PARAMETERS (set things) General settings: Read command line, then enter normal interactive menus. Use FAST algorithm for the alignment guide tree. PROTEIN or DNA sequences. Protein alignment with negative values in matrix. Sequence alignment file name. GCG, GDE, PHYLIP, PIR or NEXUS. INPUT or ALIGNED LOWER or UPPER (for GDE output only). OFF or ON (for Clustal output only). OFF or ON (NEW: for all output formats). Sequence range to write starting m to m+n. Maximum allowed input sequence length. Reduce console output to minimum. Log some alignments statistics to file. Fast Pairwise Alignments: Word size. Number of best diags. Window around best diags. Gap penalty. PERCENT or ABSOLUTE. Slow Pairwise Alignments: :Protein weight matrix=BLOSUM, PAM, GONNET, ID or filename DNA weight matrix=BLOSUMIUB, BLOSUMCLUSTALW or BLOSUMfilename. Gap opening penalty. Gap extension penalty. Multiple Alignments: File for new guide tree. File for old guide tree. Protein weight matrix=BLOSUM, PAM, GONNET, ID or filename. DNA weight matrix=IUB, CLUSTALW or filename. Gap opening penalty. Gap extension penalty. No end gap separation pen. Gap separation pen. range. Residue-specific gaps off. Hydrophilic gaps off. List hydrophilic res. Percent identity for delay. PROTEIN or DNA Transitions weighting. NONE or TREE or ALIGNMENT. Maximum number of iterations to perform. Profile Alignments: Merge two alignments by profile alignment. File for new guide tree for profile1. File for new guide tree for profile2. File for old guide tree for profile1. File for old guide tree for profile2. Sequence to Profile Alignments: Sequentially add profile2 sequences to profile1 alignment. File for new guide tree. File for old guide tree. Structure Alignments: Do not use secondary structure-gap penalty mask for profile 1. Do not use secondary structure-gap penalty mask for profile 2. Output in alignment file. Gap penalty for helix core residues. Gap penalty for strand core residues. Gap penalty for loop regions. Gap penalty for structure termini. Number of residues inside helix to be treated as terminal. Number of residues outside helix to be treated as terminal. Number of residues inside strand to be treated as terminal. Number of residues outside strand to be treated as terminal. Trees: Seed number for bootstraps. Use Kimura's correction. Ignore positions with gaps. Position of bootstrap values in tree display. NJ or UPGMA. BUGS The &dhproduct; bug tracking system can be found at . SEE ALSO clustalx 1 . REFERENCES Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. (2007). Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947-2948. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. (2003). Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res., 31, 3497-3500. Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. (1998). Multiple sequence alignment with Clustal X. Trends Biochem Sci., 23, 403-405. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res., 25, 4876-4882. Higgins DG, Thompson JD, Gibson TJ. (1996). Using CLUSTAL for multiple sequence alignments. Methods Enzymol., 266, 383-402. Thompson JD, Higgins DG, Gibson TJ. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22, 4673-4680. Higgins DG. (1994). CLUSTAL V: multiple alignment of DNA and protein sequences. Methods Mol Biol., 25, 307-318 Higgins DG, Bleasby AJ, Fuchs R. (1992). CLUSTAL V: improved software for multiple sequence alignment. Comput. Appl. Biosci., 8, 189-191. Higgins,D.G. and Sharp,P.M. (1989). Fast and sensitive multiple sequence alignments on a microcomputer. Comput. Appl. Biosci., 5, 151-153. Higgins,D.G. and Sharp,P.M. (1988). CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene, 73, 237-244. debian/clustalw.examples0000644000000000000000000000002612252541625012566 0ustar debian/tests.clustalw debian/changelog0000644000000000000000000003310012252541625011041 0ustar clustalw (2.1+lgpl-4) unstable; urgency=medium * use dh_autotools-dev to update config.{sub,guess} (Thanks for the patch to Adam Conrad ) Closes: #729789 * Standards-Version: 3.9.5 (no changes needed) -- Andreas Tille Fri, 13 Dec 2013 09:18:40 +0100 clustalw (2.1+lgpl-3) unstable; urgency=low * debian/upstream: very small fix to prevent bibcheck warning * debian/control: - cme fix dpkg-control - update direct link to homepage - debhelper 9 - canonical Vcs URLs - remove cdbs from Build-Depends * debian/rules: use dh * debian/copyright: DEP5 -- Andreas Tille Thu, 14 Nov 2013 09:07:02 +0100 clustalw (2.1+lgpl-2) unstable; urgency=low * Removed obsolete comment in debian/copyright. -- Charles Plessy Mon, 07 Feb 2011 12:08:53 +0900 clustalw (2.1+lgpl-1) unstable; urgency=low * New upstream archive, that makes clear the relicensing to LGPL-3+. - Mangled debian version name in debian/watch. - Explained why ‘+lgpl’ in debian/README.Debian. - Removed XS-Autobuild field from debian/control. - Changed archive area in debian/control. - Updated license in debian/copyright and debian/clustalw.1* - Removed obsoleted lintian override (debian/clustalw.lintian-overrides). - Removed Commercial field in debian/upstream-metadata.yaml. * Removed un-needed documentation (debian/clustalw.docs). * Source package hosted in a Git repository (debian/control). * Use debhelper 8 (debian/control, debian/compat). -- Charles Plessy Sat, 29 Jan 2011 19:59:40 +0900 clustalw (2.1-1) unstable; urgency=low * New upstream version * Added myself to uploaders * Standards-Version: 3.9.1 (no changes needed) * debian/rules: added get-upstream-changelog target and used it to obtain upstream changelog in debian/CHANGELOG.upstream * debian/source/format: 3.0 (quilt) -- Andreas Tille Wed, 24 Nov 2010 14:07:24 +0100 clustalw (2.0.12-1) unstable; urgency=low * New upstream release fixing many bugs (see /usr/share/doc/clustalw/CHANGELOG). * Updated debian/watch to latest upstream names (Closes: #550895). * debian/control: - Added ${misc:Depends} substitition variable. - Incremented Standards-Version to reflect conformance with Policy 3.8.3 (no changes needed). - Removed the citation information from the package long description. * Manpages debian/clustalw.1* refreshed. * Updated debian/copyright to the latest experimentation on the format. * Added various Upstream informations in debian/upstream-metadata.yaml. * Moved the upstream changelog and the test data to the debian directory. (debian/rules, debian/clustalw.examples). -- Charles Plessy Wed, 14 Oct 2009 13:47:28 +0900 clustalw (2.0.10-1) unstable; urgency=low * New upstream release: - New -quiet and -stats= command line flags. - command separator can now be mixed "/" and "-" on all platforms. * debian/clustalw.1*: - added new option and incremented version number. - using Docbook 4.5. * Added bibliographic information in BibTeX format in debian/reference. * Using Debhelper 7 (debian/control, debian/compat). * Enhances: bioperl-run (it has a wrapper for clustalw). * debian/overrides/clustalw renamed debian/clustalw.lintian-overrides, and is not anymore installed by dh_install (dh_lintian, called by CDBS, takes care of it). -- Charles Plessy Sun, 07 Dec 2008 19:37:06 +0900 clustalw (2.0.9-1) unstable; urgency=low * New upstream release. * debian/patches/to_build_with_g++-4.3.patch was accepted upstream and therefore removed here. * debian/copyright: added a disclaimer clarifying that this package is not part of the Debian operating system (requirement of Policy 3.8.0). * debian/control: - Updated Standards-Version to 3.8.0. - Enhances: emboss (EMBOSS has a wrapper for clustalw, `emma'.) * debian/clustaw.1*: incremented version number. -- Charles Plessy Tue, 24 Jun 2008 13:28:22 +0900 clustalw (2.0.8-1) unstable; urgency=low * New upstream release. - Implemented maxseqlen cmdline switch. - Updated help-file. - Fixed various bugs and possible memory leaks (see /usr/share/doc/clustalw/CHANGELOG) * debian/clustalw.1*: - Added new option; - incremented version number. * debian/copyright lifted to the latest draft format version. * debian/patches/to_build_with_g++-4.3.patch. (Submitted and accepted upstream for 2.0.9). -- Charles Plessy Wed, 04 Jun 2008 18:04:17 +0900 clustalw (2.0.7-1) unstable; urgency=low * New upstream release. - Fixes bug 121: CRLF in sequence names (Pearson) are not trimmed. - Fixes bug 122: convert option broken. - Fixes reopened bug 114: profile alignment input didn't work with new getSeqRange routines. - Fixes bug 119: build with g++ 4.3. * Removed debian/patches/bug_119_gpp4.3-autoptr.patch, obsoleted by the above correction. * Incremented version number in debian/clustalw.1* * Uptated debian/copyright to the latest draft of the format. -- Charles Plessy Wed, 14 May 2008 09:07:26 +0900 clustalw (2.0.6-1) unstable; urgency=low [Charles Plessy] * New upstream release: - Bugs fixed (fasta input performance, segfault with secondary structure mask) - Allows mixed-case command line options. - Removed unncessary id console output in EMBLFileParser.cpp * Updated my email address (debian/control, debian/copyright, debian/clustaw.1*). * debian/patches/bug_119_gpp4.3-autoptr.patch: upstream patch to build clustalw with g++-4.3. [Morten Kjeldgaard] * debian/clustalw.1*: restored the introduction from Stéphane Bortzmeyer original manpage. * debian/copyright: updated information about the manpage. -- Charles Plessy Fri, 02 May 2008 10:38:25 +0900 clustalw (2.0.5-1) unstable; urgency=low * New upstream release (fixes problems with gaps). * debian/copyright: Added a X-Non-Free-Autobuild field to fullfill requirements from http://lists.debian.org/msgid-search/20061129152824.GT2560@mails.so.argh.org * Updated CHANGELOG from http://www.clustal.org/download/current/CHANGELOG * debian/clustalw.1.xml, rewritten from scratch. * debian/clustalw.q: updated from the DocBook sources (Closes: #463591). -- Charles Plessy Thu, 20 Mar 2008 15:42:38 +0900 clustalw (2.0.4-1) unstable; urgency=low [ Steffen Moeller ] * New upstream release - Includes new code for UPGMA guide trees. (v. 2.0.0) - Includes iterative alignment facility. (v. 2.0.0) - fixed bug where Pseudo -FASTA format files were not being processed as previously in v1.83 (v. 2.0.3) - fixed other bugs to behave more like 1.83, and introduced a new '-fullhelp' option. (v 2.0.4) * updated debian/watch * moved clustalw.1 into debian folder (easier to work with svn-buildpackage) * removed README and LICENSE from svn since these are now distributed with the upstream sources [ Charles Plessy ] * debian/copyright made machine-readable. * Clustal X is now built in a separate source package. (Closes: #469442, #469443) * Switched to CDBS. * Added lintian override for the presence of /usr/share/doc/clustalw/LICENSE. * debian/control: - Allowed upload by Debian maintainers. - Checked conformance with Policy 3.7.3 (no changes needed). [ David Paleino ] * debian/control: - fixed Debian capitalisation (see bug #456582) -- Charles Plessy Sun, 09 Mar 2008 22:28:10 +0900 clustalw (1.83-3) unstable; urgency=low [ Nelson A. de Oliveira ] * Added watch file, debian/rules get-orig-source should be used to download the orig.tar.gz, not uscan. [ Charles Plessy ] * Build-depend on libncbi6-dev instead of ncbi-tools6-dev. [ Steffen Moeller ] * Added dependency to later version lesstif2 (Closes:#429480). * The recompilation against libvibrant6 was probably already fixed in an earlier version, certainly it is now (Closes:#378483). -- Charles Plessy Wed, 12 Sep 2007 16:50:37 +0900 clustalw (1.83-2) unstable; urgency=low [ Steffen Moeller ] * Help now works in ClustalX (Closes:#215414). * debian/control: - removed [biology] tag and improved debtags - better formatting/wording - suggesting alignment pretty-printers [ Charles Plessy ] * Add Subversion repository URL to debian/control. * FreeDesktop menu added (Closes: #380715) * Acknowledge NMU, thanks to Kai and Fabio. (Closes: #374241, #359712) * Collaborative maintainance: the maintainer is a mailing list, Steffen Moëller and Charles Plessy are uploaders. * Upgraded to debhelper 5. * Modified the copyright file to mention that it is not disallowed to use autobuilders to create binary packages. * Debian Menu transition: Apps/Science becomes Applications/Science/Biology. * Fixed a typo in clustalw.menu (Closes: #428518) * Updated Steffen's email adress. * Using quilt to manage the changes to the sources. -- Charles Plessy Sun, 12 Aug 2007 23:06:39 +0900 clustalw (1.83-1.2) unstable; urgency=high * Non-maintainer upload. * No changes, let's try to trigger again the builders. -- Fabio Tranchitella Fri, 10 Nov 2006 09:16:45 +0100 clustalw (1.83-1.1) unstable; urgency=low * Non-maintainer upload. * lesstif1 is deprecated, transition to lesstif2 (Closes: #374241) * Dead link in the package description (Closes: #359712) * Updated standards version, binary-indep rule required -- Kai Hendry Mon, 10 Jul 2006 11:04:05 +0900 clustalw (1.83-1) unstable; urgency=low * New upstream version * New maintainer * Reapplied patches from 1.82-3 * Removed calls to insecure gets * Cosmetics to makefile * Extension of description * Standards-Version: 3.5.10 * Increased version of debhelper: Build-Depends: debhelper (>= 4) * Used debian/compat for debhelper version * Replaces *.files by *.install, *.docs, *.manpages and used the apropriate tools in debian/rules * Moved clustalx to /usr/bin because it does not *belong* to the X11 system * Moved the manpage clustalx.1x to clustalx.1 accordingly. * Removed debian/dirs * Added menu entries -- Steffen Moeller Mon, 23 Jun 2003 19:26:29 +0100 clustalw (1.82-3) unstable; urgency=low * "My-wifes-Katrin-Birthday"-release (even if I doubt that she is very interested in Debian packaging details) * Fix a buffer override closes: #135255 -- Andreas Tille Wed, 27 Feb 2002 07:26:29 +0100 clustalw (1.82-2) unstable; urgency=low * also compile GUI clustalx which is included in the sources now -- Andreas Tille Sat, 3 Nov 2001 14:41:50 +0100 clustalw (1.82-1) unstable; urgency=low * New maintainer closes: #100213 * New upstream version closes: #40904 * Standards-Version: 3.5.6 * Moved help file to /usr/share/clustalw/clustalw_help because it is architecture independend * Added URL to the package description because I consider this as "good style" to have an upstream link without installing the package * Fixed a typo in the examples Makefile which was shiped with the Debian package: clustalw -profile -profile1=nuc.aln -profile2=nuc2.aln -outfile=profile.aln ^ this 2 was missing -- Andreas Tille Mon, 29 Oct 2001 21:40:20 +0100 clustalw (1.7-9) unstable; urgency=low * Maintainer set to Debian QA Group . -- Adrian Bunk Fri, 24 Aug 2001 21:09:56 +0200 clustalw (1.7-8) unstable; urgency=low * Adopted by new maintainer; closes: #92790 * Updated to latest standards version and added Build-Depends (changed makefile, control, dirs, docs, and rules); closes: #91132, #91411 * Deleted empty README.Debian file. * Corrected doc path in manpage. * Moved package to section non-free/science, because it is a tool that is exclusively useful for molecular biologists. -- Dr. Guenter Bechly Fri, 20 Apr 2001 19:08:00 +0200 clustalw (1.7-7) unstable; urgency=low * Better extended description. Closes #31475. * Manual page. Closes #31382. -- Stephane Bortzmeyer Wed, 31 Mar 1999 10:50:02 +0200 clustalw (1.7-6) unstable; urgency=low * Yet another attempt to get past rejection :-) Licence is now included in the copyright file. -- Stephane Bortzmeyer Sat, 19 Dec 1998 15:29:40 +0100 clustalw (1.7-5) unstable; urgency=low * A LICENCE is now included, non-free unfortunately. -- Stephane Bortzmeyer Thu, 17 Dec 1998 14:48:43 +0100 clustalw (1.7-4) unstable; urgency=low * Compiles with -mieee on the Alpha: otherwise, floating exception since ClustalW divides by zero (yuck!) -- Stephane Bortzmeyer Wed, 2 Dec 1998 16:16:02 +0100 clustalw (1.7-3) unstable; urgency=low * Tests and samples added * On line help file added -- Stephane Bortzmeyer Tue, 1 Dec 1998 15:57:50 +0100 clustalw (1.7-2) unstable; urgency=low * Switch to dh_make * First public release -- Stephane Bortzmeyer Tue, 1 Dec 1998 15:25:13 +0100 clustalw (1.7-1) unstable; urgency=low * Initial Release. -- Stephane Bortzmeyer Fri, 28 Aug 1998 16:09:48 +0200 debian/tests.clustalw/0000755000000000000000000000000012252541625012171 5ustar debian/tests.clustalw/nuc2.data0000644000000000000000000000176512252541625013704 0ustar >seq10 200 residues AAGCTTTATTTTTCCATCTCTTTTACATTCAATGATTCTATTCATTTGTAAGAGAAGTAA GCANNNNNNACTCCAAGTGGTTAGAAAGTCAGACTGATTAAACAGGTNNACCAAACACGT AAATGTTTTTGNAGAAGGAAGTTGGNAACTCTTGAGCCCGCAGAGGTGCACAGGCTNNNT AGAGACAGCAGTGTCAGTCC >seq11 209 residues TATGCAGACAATTATGATTACATGGGGTAAAAATACTCCAAGATAGTATTCAGTTCTCAA GGGTTCATCACATTTGAAGTTTTTTTTTCTACCATAAAATTCCCCACCAATCCATTTATG TATAGAGTTGATAGTTAACAGAGATCGGAAATGGCCATTGCATCTTTAGTCTGGATTTCC TGAGACCTTTGGTTTATTTCTAGGGCTGC >seq12 121 residues GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGG GTCGGGCCTGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTT T >seq13 120 residues NNNNATACTCTGGTTTCTCTTGATCGTAAATAAATCTTTCCCCTTTCANCAAAGATTTCC GTGGAGAGGAATAACTCTGAGTCTTAAGCTAATTTTTTGAGCCTTGCTCCGACAAGGCTA >seq14 21 residues AGCCTTGTTCCGACAAGGCTA >seq15 120 residues NNNNATACTCTGGTTTCTCTTCAGATCGCATAAATCTTTCCCCTTTCANCAAAGATTTCC GTGGAGAGGAACAACTCTGAGTCTTAACCCAATTTTTTGAGCCTTGCCTTGGCAAGGCTA debian/tests.clustalw/Makefile0000644000000000000000000000105012252541625013625 0ustar # WARNING: you should run this Makefile with the # '-i' option since Clustalw's return codes are random... # Makefile, tests directory and samples by Catherine Letondal test: align tree profile align: clustalw -infile=nuc.data clustalw -infile=nuc.data -output=PHYLIP clustalw -infile=nuc.data -tree tree: align clustalw -infile=nuc.data -usetree=nuc.dnd profile: align clustalw -infile=nuc2.data clustalw -profile -profile1=nuc.aln -profile2=nuc2.aln -outfile=profile.aln clean: /bin/rm -f *.dnd *.aln *.ph *.phy debian/tests.clustalw/nuc.data0000644000000000000000000000175712252541625013623 0ustar >seq1 200 residues AAGCTTTATTTTTCCATCTCTTTTACATTCAATGATTCTATTCATTTGTAAGAGAAGTAA GCANNNNNNACTCCAACAGTGGAGAAAGTCAGACTGATTAAACAGGTNNACCAAACACGT AAATGTTTTTGNAGAAGGAAGGGNAACTCTGGTGAGCCCGCAGAGGTGCACAGGCTNNNT AGAGACAGCAGTGTCAGTCC >seq2 209 residues TATGCAGACAATTATGATTACATGGGGTAAAAATACTCCAAGATAGTATTCAGTTCTCAA GATGGTTCATCACATTTGCCAAGTTTTTCTACCATAAAATTCCCCACCAATCCATTTATG TATAGAGTTGATAGTTAACAGAGATCGGAAATGGCCATTGCATCTTTAGTCTGGATTTCC TGAGACCTTTGGTTTATTTCTAGGGCTGC >seq3 121 residues GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGG GTCGGGCCTGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTT T >seq4 120 residues NNNNATACTCTGGTTTCTCTTCAGATCGTATAAATCTTTCCCCTTTCANCAAAGATTTCC GTGGAGAGGAATAACTCTGAGTCTTAAGCTAATTTTTTGAGCCTTGCTCCGACAAGGCTA >seq5 21 residues AGCCTTGTTCCGACAAGGCTA >seq6 120 residues NNNNATACTCTGGTTTCTCTTCAGATCGCATAAATCTTTCCCCTTTCANCAAAGATTTCC GTGGAGAGGAACAACTCTGAGTCTTAACCCAATTTTTTGAGCCTTGCCTTGGCAAGGCTA debian/tests.clustalw/seq0000644000000000000000000000023512252541625012704 0ustar >seq20 120 residues NNNNAXACTCTGGTTTCTCTTCAGATCGCATAAATCTTTCCCCTTTCANCAAAGATTTCC GTGGAGAGGTACAACTCTGAGTCTTAACCCAATTTTTTGAGCCTTGCCTTGGCAAGGCTA debian/compat0000644000000000000000000000000212252541625010370 0ustar 9 debian/docs0000644000000000000000000000000712252541625010042 0ustar README