gawk-doc-4.0.1+ds.orig/0000755000175000017500000000000011744006117013574 5ustar schotschotgawk-doc-4.0.1+ds.orig/doc/0000755000175000017500000000000011744222345014344 5ustar schotschotgawk-doc-4.0.1+ds.orig/doc/lflashlight-small.xpic0000644000175000017500000000044707215354275020653 0ustar schotschot#! /usr/X11R6/bin/xpic 80 48 160 80 8 1 75 144 48 160 56 0 0 2 160 48 144 56 1 76 112 48 136 56 0 0 2 112 56 136 48 1 77 112 72 136 80 0 0 2 112 72 136 80 5 78 128 48 144 80 0 0 136 64 8 16 3 79 80 56 112 72 0 0 1 80 144 64 160 64 0 0 2 144 64 160 64 1 81 144 72 160 80 0 0 2 144 72 160 80 gawk-doc-4.0.1+ds.orig/doc/ChangeLog0000644000175000017500000000362011734667134016127 0ustar schotschot2012-03-28 Arnold D. Robbins * 4.0.1: Release tar ball made. 2012-02-10 Arnold D. Robbins * gawk.texi, awkcard.in: Bump patch level. * texinfo.tex: Updated from Texinfo CVS. 2011-12-06 Arnold D. Robbins * gawk.texi: Various typo fixes from mailing list. 2011-11-10 Arnold D. Robbins * gawk.1: Fix some .BR to be .B. 2011-11-08 Arnold D. Robbins * gawk.texi: Further improvement in the discussion of sorted array traversal. Some sections reordered and text edited to suit. 2011-11-06 Arnold D. Robbins * gawk.texi: Try to improve discussion of sorted array traversal. 2011-09-24 Arnold D. Robbins * gawk.1: Fix some spelling errors. Thanks to Jeroen Schot . * gawk.texi: Some minor fixes. 2011-07-28 Arnold D. Robbins * gawk.texi (Gory Details): Restore text on historical behavior etc. and add explanation on gawk 4.0.x. 2011-07-17 Arnold D. Robbins * gawk.texi: Add reference in node Expressions to node Precedence, based on suggestion from Dan Jacobson dated 4 Jun 2001. 2011-07-17 Paul Eggert * gawk.texi: Warn up-front (indirectly) that plain gawk is not compatible with SVR4 awk and with POSIX awk. Describe how gawk differs from the GNU standard in its interpretation of POSIXLY_CORRECT. (From mail dated 15 May 2001). 2011-06-24 Arnold D. Robbins * Makefile.am (EXTRA_DIST): Add ChangeLog.0. * 4.0.0: Remake the tar ball. 2011-06-23 Arnold D. Robbins * ChangeLog.0: Rotated ChangeLog into this file. * ChangeLog: Created anew for gawk 4.0.0 and on. * 4.0.0: Release tar ball made. gawk-doc-4.0.1+ds.orig/doc/lflashlight.pdf0000644000175000017500000000163211463242060017334 0ustar schotschot%PDF-1.3 %쏢 6 0 obj <> stream xUA! E=EOn51P)D$[l;p >3~ E*XpZ)IwZyBȚljFB3fIaV HTMV*RjowU4E Imt>1Ҫ O>endstream endobj 7 0 obj 168 endobj 5 0 obj <> /Contents 6 0 R >> endobj 3 0 obj << /Type /Pages /Kids [ 5 0 R ] /Count 1 >> endobj 1 0 obj <> endobj 4 0 obj <> endobj 8 0 obj <> endobj 2 0 obj <>endobj xref 0 9 0000000000 65535 f 0000000471 00000 n 0000000617 00000 n 0000000412 00000 n 0000000519 00000 n 0000000272 00000 n 0000000015 00000 n 0000000253 00000 n 0000000588 00000 n trailer << /Size 9 /Root 1 0 R /Info 2 0 R >> startxref 667 %%EOF gawk-doc-4.0.1+ds.orig/doc/rflashlight.pdf0000644000175000017500000000164111463242060017342 0ustar schotschot%PDF-1.3 %쏢 6 0 obj <> stream xEQ 9'pBQ+eYR%'(] a5ZaU fOyFzDESH|FN),hS?iWk*ڞ%H!FЮM\m 2m tgHXTR쬊>@2{MWV'Eendstream endobj 7 0 obj 175 endobj 5 0 obj <> /Contents 6 0 R >> endobj 3 0 obj << /Type /Pages /Kids [ 5 0 R ] /Count 1 >> endobj 1 0 obj <> endobj 4 0 obj <> endobj 8 0 obj <> endobj 2 0 obj <>endobj xref 0 9 0000000000 65535 f 0000000478 00000 n 0000000624 00000 n 0000000419 00000 n 0000000526 00000 n 0000000279 00000 n 0000000015 00000 n 0000000260 00000 n 0000000595 00000 n trailer << /Size 9 /Root 1 0 R /Info 2 0 R >> startxref 674 %%EOF gawk-doc-4.0.1+ds.orig/doc/statist.jpg0000644000175000017500000004766011463242060016550 0ustar schotschotJFIFSoftware::XV Version 3.10a Rev: 12/29/94 (PNG patch 1.2) Software::gnuplot Linux version 3.7 patchlevel 0.1 CREATOR: XV Version 3.10a Rev: 12/29/94 (PNG patch 1.2) Quality = 75, Smoothing = 0 C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?( +^dpyoq2Gm w#3m'P$#h!Q|?qsiYGp™Ʈ5'$.snQ\^oLp]5su HLrv"FChڥY[q"b gP+T3\_G$: (SsYE&k(HuO5eCЙ/H!?L?$Q Bf": +T3\_G$: (SsYE&k(HuO5eCЙ/H!?L?$Q Bf": +T3\_U|_w]xG\68A,^GXqqݙGy:+T3\_G$: (SsYE&k(HuO5eCЙ/H!?L?$Q Bf": +T3\_G$: (SsYE&k(HuO5eCЙ/H!?L?$Q Bf": +T3\_Tqm89(3~j_P Oya=RIg۸yU5(d_|=8$w;x牷G"F24-~T( ((((((wl7Zuĭ { qR0X$Xn:mEQEt6GTE:iR񲫲 ~t o7pc-D' : mY$)+ȭ'U[e~Q sҡ-짵W}}* UBrG#|7fOkKy PDc8 Zt'bQ$Ƌ36 g#$x1+/υۃpQ5A$Bg-!IUE-sfE}Pjː4h`0J@~U4#鯩Zv|*:gw}սbKBv‚}2j (biY7Ȅp0(j(Iy~?CsI'Rj{^g(ni?rkd,qVnBI'5v5~J`i]sPo_J3(((Oj+P6G$YÌ#bOZV6Jxh+ KM2.Q%̡/96.?wѳ+~:&v33Ɣѥ)(7Ԟ}͞tK&?OM;(QE((((((((((((((+*FWA\=W6Ҁ: ( ( +:Uan"u%YȎ!+|sSE æZ]HZ\C$ JdǠ{>-TIF7LV qfla#VJRm9B2UϷf$,v p{> ح1Š(PQEQEQEQEQEQEQEQEQEQEQEQEQEW?y%FU(z7mtQEQEQEIu w$Ŀ M@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@"tyc$S#$ydM~i;\5m3኿Sk|VQEQUeIby"=" IJ}>KkI "=~c7J|%сVVɣY4(VB- 0>jPD?~w>`7i_#YP? /o)~~5=WV %;,ľtR9~_bEeu 2A"(((((((((((((+*FWA\=W6Ҁ: ( ( ( w$Ŀ M]s;y_]覠(((((((((((((((*zѻ,Xʜ60{@ݕʄynhҟ:`lǵ_$Qq( N++(w@ BDž7evg&dpI31YCq)%QBz SAYk0M-w mb!]b$"_ğPz}Ւ Q@ ԁ=7{.襯4{_пEU?w';<AUS $m>>f{(@((((((((((((~J`i]sPo_J(((ǷoV}M=ԗg S":3|lDMM+k vy"׵k%q 2ʑ+͐FOҀ:Jw$Ŀ M\o?\Jj7 nc  h+*E5tV^>-.l%^PyضGZc<5(((((((((((((((Ζuz 98Bv)&  A^}8lkGkEUV#k~QEYF<{czQ-Zj?֟,EfT5?n܆w _Z;^R3L" 2|KcJ?IлE5%dрee9u31D$LHWR#iZX~pvf{Ra?q0?2;}%L^씾_e(((((((((((((+*FVeIH{'o6/=/ZUKǸLtI3(((O_Gbgd\tf% m/tk !'_пEU~xE+>[8YIzcCձ>5չVi0*( 7ˤ)l;f _j2  L~=Sk|m* c2!$푑S̚cce$CpO4kߠAYuv(I7aEUQEQEQEQEQEQEQEQEQEQEQECѿm+~J`i@Q@Q@Q@s;y_]覮,ඌHcXԷRVw?rkGQ45~nk-)_~QK[.FBO%VqD>NGDKMz,ynܖlcs}I5%SI%dRI+ )(cnsF'9P=y=|kp>7Qm|㊿Rhz2},QEQZ\C8I=?q4ɢYhؐuAGMGp@Æ5 I5i6-QVhQEQEQEQEQEQEQEQEQEQEQECѿm+~J`i@Q@Q@Q@s;y_]覮jEmCl\,2jZ-5"j7{* ( ( _E7<_qɺO~b<msZZ˗ؿEUQ@~[ OVj߹|E'Vj!gOE_p*(((((((((((z7mnN&kyVH㜡]U*$gF}Erv|Cn_yd{}wJ; ( ( ( w$Ŀ M]s;y_]覠(((((((((((((('@HXp3F~i_~3.:T#(yON^H_/Zo\%G3a`HQu'6&XI=-_)?yןrZ((((*tB&b@#5 6[N{:y2*q#VjnzM$A'~v.JnoQE31F8*FxHs,gcSqSissO? ڢZ>og?u}חrQVhQEQEQEQEQEQEQEQEQEQECѿm+~J`i@Q@Q@Q@s;y_]覮`5by 'O<\{Q{j]YrAGKϬ1~LqZM5 u8o#m^EUQEQEQEQEPF`yYd\{QP[ݴ9e1xe={)ql V2cWu<=V^Y*$k,O=AQCW 93znSSDRHrGp}t2Ь :tȋc袊Š((((((((((z7mtCѿm((((ONI?RjH"d]fp7A;4E2AqGY˞AEUQEQEQEQEQEBo-@\lr㴙 |'vxc Wtr)G\ I (v{QU!Hf[[Tp{G#[t'qJ.,(dVS0U!np͚*dLpa8Dgɏ;t %@ Х}]:((((((((((+*FWA\=W6Ҁ: ( ( ( w$Ŀ M\SiEp7ih;Z?@-1 !s zǀDfGxsQ_) nU^ſo.o~34Umo~e[߆y+?̳EV{?6^ſo.g04Umo~e[߆y+?̳EV{?6^ſo.g04Umo~e[߆y+?̳EV{?6^ſo.g04Umo~e[߆y+?̳EV{?6^ſo.g04Umo~e[߆y+?̳Egj5( s]ګ\_?NrWuWzUoK?MVd9յ149K"b'k[#EQK1 dpn݄ATGsM+8rG$;N~4D54TEUT`:(^eI>m/n/%Xr"r1pIݜm1¥c@R}I}Sv6\(Q@Q@Q@Q@Q@Q@Q@ wR> Ar<9y6\]+xb(tӕs~MYm#2[\E:NSUk>A,ՙIYza=ϭC*wF:&RLYM+i~sA7G5^fz|}6l;}EK|))R9V<:+V/;G*0K"o2/ ??8[5DYZlRKCZɈ?[~?mEEceޏsek$yfdpH셱5`kvWR6(kG5 CK_acb_ju9>~~-u\_f\_e* Ѳ~-ts?<Yl]/7G3Ws_e* Ѳ~-ts?<Yl]/7G3Ws_e* Ѳ~-ts?<Y~J`iZ/7X_BrS^dUW͵9?.F0x9R}/o QVXQEQEW?'%Uj+*E5tQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQECѿm+~J`i@Q@Q@Q@s;y_]覮ͭ@`Dq FѸ]  _@|- 6;"[{BE!n;8: [2s*ԀYA=Z*E5Gue?,m7QIeŬb7,E bOtB@edeL$`%u[/w ^y N'iHm:'%4ydJv[ v%qrk^_2]nQC699,2 B(7/|1uX.K}!Ban.p979*VZ8fWh[$a9S#Wi+Ruc}UV7 d~Tep!g,o!%ߴLq`p<  ghA}>3n7cuSw$կ)n91uX6cA(lm wv]^.Offfq#U( !5&g&imbp<tӜc韼=kZ ]RKT5:n 2&X컙n1/^Zl_kԮo^y:w¸-!lЇ;( ( ( ( ( ? ѶtB@edeL$`j_\iVHf1ve,PK6$^X}+0il/ڬp;{Th׶>dWҥuuCl;#HPl^cQB]9 B,\,snrU;=[M.. Kep̮жHÀr*F{];ZMR d6v$ܤnr@ܑےE-En-4J /&1![KP eor ;;'+yc P`O \=] 7*!I@%Xi_Z/u{{m2D7]:<"cDۧ0| L"=[}|A$vVb <s~vȊ /#\nCgqysg ]ZD) /ܣgGsiV7zZK%Uab)!Ѐ=Eq&kH7.' 1W? .bd @nnFf0 l QuWDk "DnZ^@Ր/IdEm8#@65/:5ޛc; u"b# 1g7tmPiszlZuAhHlm NF9Ȭ-M;MЯIIrHV; ́ cq> 9PApsĪ_; j[ic3eU 1{nAnK vI+!I8>O kV漴9%6eDi"h摅 pU\BNwNllJ5-NKi!V/(D@O#-uNQln,`\p{F`Nz [MΩi.ݤ\;NxNDXmWy";]=2@*m#j)Mܖ.)U{ jR|#-6E|rW.T3z4Jh*Y t$dtMI@Q@Q@Q@Q@Q@sPo_Jܞ6Xi wB,aK!# =ANNYԷW~֐/m3*41rQEQEQEW?'%Uj+*E5tQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQECѿm+~J`i@Q@Q@Q@s;y_]覮e?'PG|ӻ<`b(((((((( ii%ޛy59\X(I$m9r:J($R V=bH\j6bd %`Uk S*0 ( ( ( ( ( ( ( ( ?:kAmw%$K5DtiXue]# 'Q@Q@Q@Q@Q@Q@Q@Q@Q@yߎٵm~Hl7.դ; x4Lm>`Q@Q@Q@Q@Q@Q@Q@Q@Q@#ӮdQNZ*<Q0#F+f%ŽAr5n?2܂0'X0;ޙEs  =ڤΑq4+3NV! Y f''gawk-doc-4.0.1+ds.orig/doc/lflashlight.eps0000644000175000017500000000776111463242060017363 0ustar schotschot%! %%Creator: arnold@skeeve (Aharon Robbins) %%Title: rflashlight.small.xpic (xpic) %%CreationDate: Tue Dec 12 09:51:27 2000 %%Pages: 1 %%BoundingBox: 0 0 72 28.8 % (in inches) at 0 0, width 1, height 0.4 %%EndComments % Prolog for xpic to PostScript converter % Author: Mark Moraes % $Header: x2ps.pro,v 1.2 88/03/19 16:50:09 moraes Exp % %d D - change style SOLID, DOTTED, SHORT-DASH, LONG-DASH, DOT-DASH % %s F - change font to fontname % %d S - change size (font size in points) % (%s) rj %d t - text right just. (%d is TOPLINE, MIDLINE, BOTLINE) % (%s) lj %d t - text left just. (%d is TOPLINE, MIDLINE, BOTLINE) % (%s) ce %d t - text centered (%d is TOPLINE, MIDLINE, BOTLINE) % %d %d l - lineto % %d %d m - moveto % %d %d s - spline segment % x - flush line, spline % b - box % e - ellipse % %d ss - setscale % %d W - change linewidth % getpagesize - gets the values of PAGEHEIGHT and PAGEWIDTH % %d %d flip - translate by %d, PAGEHEIGHT - %d (this % transforms to X windows coordinates) save 50 dict begin /xpic exch def /StartXpic {newpath 0 0 moveto [] 0 setdash 0 setgray 1 setlinecap} def % Set defaults /fontname /Times-Roman def /ptsize 12 def % halign has the values for MIDLINE, TOPLINE, BOTLINE /halign 3 array def /s {rcurveto} def /x {stroke} def /l {lineto} def /m {moveto} def /b { /ury exch def /urx exch def /lly exch def /llx exch def llx lly moveto urx lly lineto urx ury lineto llx ury lineto llx lly lineto stroke } def /mtrx matrix def /e { /yc exch def /xc exch def /yrad exch def /xrad exch def xc xrad add yc moveto /savematrix mtrx currentmatrix def xc yc translate xrad yrad scale 0 0 1 0 360 arc savematrix setmatrix stroke } def % The next three take the text string, and moveto the right horiz. position % leaving the string on the stack. /lj {} def /rj {dup stringwidth pop neg 0 rmoveto} def /ce {dup stringwidth pop 2 div neg 0 rmoveto} def % And this is invoked after one of the three above, and % computes the vert. pos, and then displays the string. /t {halign exch get 0 exch rmoveto show newpath} def % Store an array of patterns in /styles - a pattern is an array consisting % of an array and an offset. Corresp to xpic patterns % solid, dotted, short-dashed, long-dashed, dot-dashed /styles [ [] 0 ] [ [1 3] 0 ] [ [4 4] 0 ] [ [8 4] 0 ] [ [1 4 4 4] 0 ] 5 array astore def % change style to arg. /D {stroke styles exch get aload pop setdash newpath} def /W {stroke 0.5 mul setlinewidth newpath} def % fontbox takes a fontname off the stack, and returns an array % containing the values of the bottom line of the bounding box, the % mid line of the bounding box, and the top line of the bounding box % of that font, taken from the baseline, scaled to a font of size 1 /fontbox { findfont dup /FontMatrix get /fm exch def /FontBBox get aload pop /ytop exch def pop /ybot exch def pop /ymid ytop ybot sub 2 div def 0 ybot fm dtransform exch pop % botline dup neg exch % midline - this works better than (ytop-ybot)/2! 0 ytop fm dtransform exch pop exch %topline % now in the order midline, topline, botline. 3 array astore } def % select font /F { dup /fontname exch def fontbox /thisfontbox exch def SF } def % set point size /S {/ptsize exch def SF} def % actually set font /SF { fontname findfont ptsize curscale div scalefont setfont thisfontbox aload pop 1 1 3 { pop ptsize mul curscale div neg 3 1 roll } for halign astore pop } def % sets the scale to 72 / n, where n is on the stack, and stores the value % in curscale for font scaling /curscale 1 def /getpagesize{newpath clippath pathbbox /pageheight exch def /pagewidth exch def pop pop newpath} def /flip{pageheight exch sub translate} def /ss {/curscale exch 72 exch div dup dup scale def} def /land {90 rotate} def StartXpic %%EndProlog 80 ss 0.5 W 0 D 80 32 m 64 24 l x 32 24 m 56 32 l x 32 8 m 56 0 l x 8 16 56 16 e 0 24 32 8 b 64 16 m 80 16 l x 64 8 m 80 0 l x %%Trailer showpage % Trailer for xpic to PostScript converter % $Header: x2ps.tra,v 1.2 89/07/02 15:59:53 moraes Exp $ xpic end restore gawk-doc-4.0.1+ds.orig/doc/process-flow.eps0000644000175000017500000001237211511377120017477 0ustar schotschot%!PS-Adobe-2.0 EPSF-2.0 %%Title: process-flow.fig %%Creator: fig2dev Version 3.2 Patchlevel 5c %%CreationDate: Thu Jan 6 17:25:09 2011 %%BoundingBox: 0 0 367 174 %Magnification: 1.0000 %%EndComments %%BeginProlog /$F2psDict 200 dict def $F2psDict begin $F2psDict /mtrx matrix put /col-1 {0 setgray} bind def /col0 {0.000 0.000 0.000 srgb} bind def /col1 {0.000 0.000 1.000 srgb} bind def /col2 {0.000 1.000 0.000 srgb} bind def /col3 {0.000 1.000 1.000 srgb} bind def /col4 {1.000 0.000 0.000 srgb} bind def /col5 {1.000 0.000 1.000 srgb} bind def /col6 {1.000 1.000 0.000 srgb} bind def /col7 {1.000 1.000 1.000 srgb} bind def /col8 {0.000 0.000 0.560 srgb} bind def /col9 {0.000 0.000 0.690 srgb} bind def /col10 {0.000 0.000 0.820 srgb} bind def /col11 {0.530 0.810 1.000 srgb} bind def /col12 {0.000 0.560 0.000 srgb} bind def /col13 {0.000 0.690 0.000 srgb} bind def /col14 {0.000 0.820 0.000 srgb} bind def /col15 {0.000 0.560 0.560 srgb} bind def /col16 {0.000 0.690 0.690 srgb} bind def /col17 {0.000 0.820 0.820 srgb} bind def /col18 {0.560 0.000 0.000 srgb} bind def /col19 {0.690 0.000 0.000 srgb} bind def /col20 {0.820 0.000 0.000 srgb} bind def /col21 {0.560 0.000 0.560 srgb} bind def /col22 {0.690 0.000 0.690 srgb} bind def /col23 {0.820 0.000 0.820 srgb} bind def /col24 {0.500 0.190 0.000 srgb} bind def /col25 {0.630 0.250 0.000 srgb} bind def /col26 {0.750 0.380 0.000 srgb} bind def /col27 {1.000 0.500 0.500 srgb} bind def /col28 {1.000 0.630 0.630 srgb} bind def /col29 {1.000 0.750 0.750 srgb} bind def /col30 {1.000 0.880 0.880 srgb} bind def /col31 {1.000 0.840 0.000 srgb} bind def end /cp {closepath} bind def /ef {eofill} bind def /gr {grestore} bind def /gs {gsave} bind def /sa {save} bind def /rs {restore} bind def /l {lineto} bind def /m {moveto} bind def /rm {rmoveto} bind def /n {newpath} bind def /s {stroke} bind def /sh {show} bind def /slc {setlinecap} bind def /slj {setlinejoin} bind def /slw {setlinewidth} bind def /srgb {setrgbcolor} bind def /rot {rotate} bind def /sc {scale} bind def /sd {setdash} bind def /ff {findfont} bind def /sf {setfont} bind def /scf {scalefont} bind def /sw {stringwidth} bind def /tr {translate} bind def /tnt {dup dup currentrgbcolor 4 -2 roll dup 1 exch sub 3 -1 roll mul add 4 -2 roll dup 1 exch sub 3 -1 roll mul add 4 -2 roll dup 1 exch sub 3 -1 roll mul add srgb} bind def /shd {dup dup currentrgbcolor 4 -2 roll mul 4 -2 roll mul 4 -2 roll mul srgb} bind def /$F2psBegin {$F2psDict begin /$F2psEnteredState save def} def /$F2psEnd {$F2psEnteredState restore end} def /pageheader { save newpath 0 174 moveto 0 0 lineto 367 0 lineto 367 174 lineto closepath clip newpath -161.1 355.1 translate 1 -1 scale $F2psBegin 10 setmiterlimit 0 slj 0 slc 0.06299 0.06299 sc } bind def /pagefooter { $F2psEnd restore } bind def %%EndProlog pageheader % % Fig objects follow % % % here starts figure with depth 50 % Polyline 0 slj 0 slc 7.500 slw n 4819 3540 m 5460 4181 l 6101 3540 l 5460 2899 l 4819 3540 l cp gs col0 s gr % Polyline gs clippath 4634 3585 m 4785 3585 l 4785 3525 l 4634 3525 l 4634 3525 l 4754 3555 l 4634 3585 l cp eoclip n 3960 3555 m 4770 3555 l gs col0 s gr gr % arrowhead n 4634 3585 m 4754 3555 l 4634 3525 l 4634 3585 l cp gs 0.00 setgray ef gr col0 s % Polyline gs clippath 6839 3585 m 6990 3585 l 6990 3525 l 6839 3525 l 6839 3525 l 6959 3555 l 6839 3585 l cp eoclip n 6165 3555 m 6975 3555 l gs col0 s gr gr % arrowhead n 6839 3585 m 6959 3555 l 6839 3525 l 6839 3585 l cp gs 0.00 setgray ef gr col0 s % Polyline n 2644 3240 m 2569 3240 2569 3802 75 arcto 4 {pop} repeat 2569 3877 3835 3877 75 arcto 4 {pop} repeat 3910 3877 3910 3315 75 arcto 4 {pop} repeat 3910 3240 2644 3240 75 arcto 4 {pop} repeat cp gs col0 s gr % Polyline n 7095 3240 m 7020 3240 7020 3806 75 arcto 4 {pop} repeat 7020 3881 8294 3881 75 arcto 4 {pop} repeat 8369 3881 8369 3315 75 arcto 4 {pop} repeat 8369 3240 7095 3240 75 arcto 4 {pop} repeat cp gs col0 s gr % Polyline gs clippath 5460 4904 m 5460 5055 l 5520 5055 l 5520 4904 l 5520 4904 l 5490 5024 l 5460 4904 l cp eoclip n 5490 4230 m 5490 5040 l gs col0 s gr gr % arrowhead n 5460 4904 m 5490 5024 l 5520 4904 l 5460 4904 l cp gs 0.00 setgray ef gr col0 s % Polyline n 5028 5067 m 4953 5067 4953 5550 75 arcto 4 {pop} repeat 4953 5625 5905 5625 75 arcto 4 {pop} repeat 5980 5625 5980 5142 75 arcto 4 {pop} repeat 5980 5067 5028 5067 75 arcto 4 {pop} repeat cp gs col0 s gr % Polyline gs clippath 4305 3736 m 4305 3585 l 4245 3585 l 4245 3736 l 4245 3736 l 4275 3616 l 4305 3736 l cp eoclip n 4905 5355 m 4275 5355 l 4275 3600 l gs col0 s gr gr % arrowhead n 4305 3736 m 4275 3616 l 4245 3736 l 4305 3736 l cp gs 0.00 setgray ef gr col0 s /Times-Roman ff 180.00 scf sf 5265 3375 m gs 1 -1 sc (More) col0 sh gr /Times-Roman ff 180.00 scf sf 5265 3630 m gs 1 -1 sc (Data) col0 sh gr /Times-Roman ff 180.00 scf sf 5265 3885 m gs 1 -1 sc ( ?) col0 sh gr /Times-Roman ff 180.00 scf sf 6210 3465 m gs 1 -1 sc (No) col0 sh gr /Times-Roman ff 180.00 scf sf 5535 4455 m gs 1 -1 sc (Yes) col0 sh gr /Times-Roman ff 180.00 scf sf 2745 3645 m gs 1 -1 sc (Initialization) col0 sh gr /Times-Roman ff 180.00 scf sf 7290 3600 m gs 1 -1 sc (Clean Up) col0 sh gr /Times-Roman ff 180.00 scf sf 5130 5400 m gs 1 -1 sc (Process) col0 sh gr % here ends figure; pagefooter showpage %%Trailer %EOF gawk-doc-4.0.1+ds.orig/doc/process-flow.pdf0000644000175000017500000001463611511377120017466 0ustar schotschot%PDF-1.4 %쏢 5 0 obj <> stream xVMoG[ SH`qc4kR~}^M̰FA}ة7UTWWm i+wW&}yI9ojȳ7hrL+ʜ %rғbvl,iLaAx&YS_!D[Њޤ\Lxɔ L4iA& Ѓ~dg@d]g᩾V~~ \q&*zǸHIg!4^Pp`҃lDlOθ2WobϚBрQiTCUV8XV &~qiO!=4⓬f٭fvs-8!؆6=9NPVV#QI)Ho{B1! 2a dZvNz(,6IbGB+GECsT΄!o&LLd@C,FɃ]Og4 3und')ENN!5$daIΰ ԁ҅>eld9ې5ޛ}yQ^YHS>Լ~o^TnL6^|R 8Y| %i7O6_a"޼Vg/'3_q/:& >G.G}q7ߤLeqտkqc#Mvt,Ns=_7Y}GQ<Tendstream endobj 6 0 obj 866 endobj 4 0 obj <> /Contents 5 0 R >> endobj 3 0 obj << /Type /Pages /Kids [ 4 0 R ] /Count 1 >> endobj 1 0 obj <> endobj 7 0 obj <>endobj 10 0 obj <> endobj 11 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 12 0 obj <>stream xmU{XS>1$ߙE֑4Iֵ+FЩ`)rkA1Bj K!WHE!BB1hTEi"^Jk }Vgmm]C{?9||}cAs$͓H|/YԂ9B6y3f6qqy̆skŽ_bR6Jsrŋ-Yl(ϊ8FR$/b^ O_{q4[&fsdeEJ/oʤrxqU+Ҽ%EŻQ8q$DWx*_]SXTcvj$A,o"Y%9bD$KD A+m*b''Xc8#q7'bN/AAqqLO*07z=,>T2ZHп qʯ_r2z!ye惇< |&>w0d8g.1͞3O˕ZG%PӿOӋqt-FBK|]-F'=MoE`"x̉VkZ#Ex1Vb dff~ՃI AW`G5)uPѴ xIs »b՝%7ge[bvmAqe $fxǗ+ApܹdX2gQ!WC?%j!R O62D &H͈J\mwH zc8 $_,ݓY)LɊ\mJn{/~0&ivDgThbVf!Zd&y2%G]> M$]~f@]\%h->ϯK 'M=2R_ҭ2[gBGb}4n V Y3EtTq moP ߙ G-fC]bis)\1i\$Gd )0u.*¥u^n}~^skj*U 0^9KJ_ ߘǗ=.zS" 2S2[)T^!HXY^0tWu{[^h]yt O╮Q*jf:~27n.$Z`+LF$)+M&y>T4Ԑooq{F<}BmPe(!u;":M}  r0fcrVq'j(]J@pnldM[x!TJӞ˟xoP4:b}X!5=%,g+J<.wc&Qn{p;?Y,IIF q!϶Hb($t`蕟AfP4 gDƆxcw(N/=6 %tߦ?d-iwuu9ҜLvHO}o =nӼ:YGϦ"ؠn439#;QnleKGkt9UϡӔO6l%g"xV`b菍.Gqe/5ˢp~Y!TU 4*iE OB.vSK8mZ]e[ȥK8jjbV  p@*Jϧ\;mvq NUm.%ISJI= r6Rgv3>,j9Oߔ !7JـfB_} eiƁbj?i!=[&N8x5o@ };1$ïaGqg} endstream endobj 13 0 obj <>stream 2011-01-06T17:25:03+02:00 2011-01-06T17:25:03+02:00 fig2dev Version 3.2 Patchlevel 5c process-flow.fig endstream endobj 2 0 obj <>endobj xref 0 14 0000000000 65535 f 0000001180 00000 n 0000005933 00000 n 0000001121 00000 n 0000000970 00000 n 0000000015 00000 n 0000000951 00000 n 0000001245 00000 n 0000001346 00000 n 0000001727 00000 n 0000001286 00000 n 0000001316 00000 n 0000002010 00000 n 0000004514 00000 n trailer << /Size 14 /Root 1 0 R /Info 2 0 R /ID [<7795783BB2DC1F89E46EADF75E242E86><7795783BB2DC1F89E46EADF75E242E86>] >> startxref 6125 %%EOF gawk-doc-4.0.1+ds.orig/doc/statist.pdf0000644000175000017500000001230111463242060016521 0ustar schotschot%PDF-1.3 %쏢 6 0 obj <> stream xF {=:(!9Ҹ}]p#-ҮFv%F9ֲZ'~?\7~@Y]`{ajY/KCqA%o`@_tҦ/˟ʆw,>*q -?#LޤPkY!3nq ͥNP0]?\x%&2#7oZ+N&5]?]t"*_G ٪ڳ BX.u>mܬݾ6հw9]w}ھ6z?~\=zv49Af]:tc:ڰovX-`Wdl$ Te0 PS9Tl#uӕ&+oOg\Խ,זnձ1fRk,Z:Szz[ܰ=g, ,rrV5լE\}? !~vLL9S< E[gVπRr[( v(4t+z^pp..n9;4upK_\ U5wpFLK&ԙ\׮y6w+U=Um .ke%en-e0 p1\X\j.Q*IKtWvpgSMp\Mpqh]4^=սyzq~ ;iC2F1٣"-${zm6Duendstream endobj 7 0 obj 1034 endobj 5 0 obj <> /Contents 6 0 R >> endobj 3 0 obj << /Type /Pages /Kids [ 5 0 R ] /Count 1 >> endobj 1 0 obj <> endobj 4 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 9 0 obj <> endobj 8 0 obj <>stream xUT Tg!d_2ALVN5 O1HxH"juVeY\" B+ + U)BIUkWstN={9{Iގ IrNd 򵆌jэw!vBހk*I%^H(+ΪZ0sa[$ J7e<<=g o/|V-_,l򵺜,ma|NC+MVcsW봙 ]FnnN}gFfdmߣǩr_sX!_e> _!BD"6\bӉy 'b>!!‘ $E ҃TIloH$m b >*r% j0KL镎?hņm8TÖ&} c`SanSlJ#c90w`sgD0֠'KFE)8Ģ2FWx /^:o feVR0V4O[xGw"!~ޫ,3a%l[xYF$LV#]j-?VCQ'X(4r{Sj_ s9T3RϽ+ٛKeB*dVP;Rxx)ݧX+-(b !Jk2]se7wDf(2&qt%{y6cvr&]}/(N~Y{фr=(=@<@CydJ3^w~Z!( UҿpPٗgmߟ O8˙'.ђBE1}6G H^NG3?a2`;v]фێB[ZWYPݎhuY=qU1-D!+ᆥJ¾8%&@aEpod^)b 8A? ,E8Se2< [&,=KvCJp)`&aN%@d6r3;YE|d";eGOQW^!5hgPr`ҙS9r_7(r|wxACY۹ $F]a㨉,yBc^&kԐuXg]{MY{[gKf7&hXmTS(-txMkoTĪ@USKg!^T +ϩ:2ޔ~Maba2x~ˌ5T_ "vsX^vyJ#Z9_XX'46'_pWθwVFD}1> endobj 2 0 obj <>endobj xref 0 14 0000000000 65535 f 0000001358 00000 n 0000004905 00000 n 0000001299 00000 n 0000001406 00000 n 0000001139 00000 n 0000000015 00000 n 0000001119 00000 n 0000001878 00000 n 0000001537 00000 n 0000003882 00000 n 0000001475 00000 n 0000001505 00000 n 0000003861 00000 n trailer << /Size 14 /Root 1 0 R /Info 2 0 R >> startxref 4955 %%EOF gawk-doc-4.0.1+ds.orig/doc/general-program.eps0000644000175000017500000001025211511377120020131 0ustar schotschot%!PS-Adobe-2.0 EPSF-2.0 %%Title: general-program.fig %%Creator: fig2dev Version 3.2 Patchlevel 5c %%CreationDate: Thu Jan 6 17:36:07 2011 %%BoundingBox: 0 0 269 58 %Magnification: 1.0000 %%EndComments %%BeginProlog /$F2psDict 200 dict def $F2psDict begin $F2psDict /mtrx matrix put /col-1 {0 setgray} bind def /col0 {0.000 0.000 0.000 srgb} bind def /col1 {0.000 0.000 1.000 srgb} bind def /col2 {0.000 1.000 0.000 srgb} bind def /col3 {0.000 1.000 1.000 srgb} bind def /col4 {1.000 0.000 0.000 srgb} bind def /col5 {1.000 0.000 1.000 srgb} bind def /col6 {1.000 1.000 0.000 srgb} bind def /col7 {1.000 1.000 1.000 srgb} bind def /col8 {0.000 0.000 0.560 srgb} bind def /col9 {0.000 0.000 0.690 srgb} bind def /col10 {0.000 0.000 0.820 srgb} bind def /col11 {0.530 0.810 1.000 srgb} bind def /col12 {0.000 0.560 0.000 srgb} bind def /col13 {0.000 0.690 0.000 srgb} bind def /col14 {0.000 0.820 0.000 srgb} bind def /col15 {0.000 0.560 0.560 srgb} bind def /col16 {0.000 0.690 0.690 srgb} bind def /col17 {0.000 0.820 0.820 srgb} bind def /col18 {0.560 0.000 0.000 srgb} bind def /col19 {0.690 0.000 0.000 srgb} bind def /col20 {0.820 0.000 0.000 srgb} bind def /col21 {0.560 0.000 0.560 srgb} bind def /col22 {0.690 0.000 0.690 srgb} bind def /col23 {0.820 0.000 0.820 srgb} bind def /col24 {0.500 0.190 0.000 srgb} bind def /col25 {0.630 0.250 0.000 srgb} bind def /col26 {0.750 0.380 0.000 srgb} bind def /col27 {1.000 0.500 0.500 srgb} bind def /col28 {1.000 0.630 0.630 srgb} bind def /col29 {1.000 0.750 0.750 srgb} bind def /col30 {1.000 0.880 0.880 srgb} bind def /col31 {1.000 0.840 0.000 srgb} bind def end /cp {closepath} bind def /ef {eofill} bind def /gr {grestore} bind def /gs {gsave} bind def /sa {save} bind def /rs {restore} bind def /l {lineto} bind def /m {moveto} bind def /rm {rmoveto} bind def /n {newpath} bind def /s {stroke} bind def /sh {show} bind def /slc {setlinecap} bind def /slj {setlinejoin} bind def /slw {setlinewidth} bind def /srgb {setrgbcolor} bind def /rot {rotate} bind def /sc {scale} bind def /sd {setdash} bind def /ff {findfont} bind def /sf {setfont} bind def /scf {scalefont} bind def /sw {stringwidth} bind def /tr {translate} bind def /tnt {dup dup currentrgbcolor 4 -2 roll dup 1 exch sub 3 -1 roll mul add 4 -2 roll dup 1 exch sub 3 -1 roll mul add 4 -2 roll dup 1 exch sub 3 -1 roll mul add srgb} bind def /shd {dup dup currentrgbcolor 4 -2 roll mul 4 -2 roll mul 4 -2 roll mul srgb} bind def /$F2psBegin {$F2psDict begin /$F2psEnteredState save def} def /$F2psEnd {$F2psEnteredState restore end} def /pageheader { save newpath 0 58 moveto 0 0 lineto 269 0 lineto 269 58 lineto closepath clip newpath -194.8 247.1 translate 1 -1 scale $F2psBegin 10 setmiterlimit 0 slj 0 slc 0.06299 0.06299 sc } bind def /pagefooter { $F2psEnd restore } bind def %%EndProlog pageheader % % Fig objects follow % % % here starts figure with depth 50 % Polyline 0 slj 0 slc 7.500 slw n 4961 3021 m 4706 3467 l 4965 3911 l 5478 3908 l 5733 3462 l 5474 3018 l cp gs col0 s gr % Polyline gs clippath 4544 3495 m 4695 3495 l 4695 3435 l 4544 3435 l 4544 3435 l 4664 3465 l 4544 3495 l cp eoclip n 4095 3465 m 4680 3465 l gs col0 s gr gr % arrowhead n 4544 3495 m 4664 3465 l 4544 3435 l 4544 3495 l cp gs 0.00 setgray ef gr col0 s % Polyline gs clippath 6164 3495 m 6315 3495 l 6315 3435 l 6164 3435 l 6164 3435 l 6284 3465 l 6164 3495 l cp eoclip n 5805 3465 m 6300 3465 l gs col0 s gr gr % arrowhead n 6164 3495 m 6284 3465 l 6164 3435 l 6164 3495 l cp gs 0.00 setgray ef gr col0 s % Polyline n 6405 3150 m 6330 3150 6330 3704 75 arcto 4 {pop} repeat 6330 3779 7274 3779 75 arcto 4 {pop} repeat 7349 3779 7349 3225 75 arcto 4 {pop} repeat 7349 3150 6405 3150 75 arcto 4 {pop} repeat cp gs col0 s gr % Polyline n 3165 3195 m 3105 3195 3105 3719 60 arcto 4 {pop} repeat 3105 3779 3992 3779 60 arcto 4 {pop} repeat 4052 3779 4052 3255 60 arcto 4 {pop} repeat 4052 3195 3165 3195 60 arcto 4 {pop} repeat cp gs col0 s gr /Times-Roman ff 180.00 scf sf 6525 3510 m gs 1 -1 sc (Results) col0 sh gr /Times-Roman ff 180.00 scf sf 3375 3510 m gs 1 -1 sc (Data) col0 sh gr /Times-Roman ff 180.00 scf sf 4860 3510 m gs 1 -1 sc (Program) col0 sh gr % here ends figure; pagefooter showpage %%Trailer %EOF gawk-doc-4.0.1+ds.orig/doc/general-program.fig0000644000175000017500000000133111511377120020105 0ustar schotschot#FIG 3.2 Produced by xfig version 3.2.5b Landscape Center Metric A4 100.00 Single -2 1200 2 2 3 0 1 0 7 50 -1 -1 0.000 0 0 0 0 0 7 4961 3021 4706 3467 4965 3911 5478 3908 5733 3462 5474 3018 4961 3021 2 1 0 1 0 7 50 -1 -1 0.000 0 0 -1 1 0 2 1 1 1.00 60.00 120.00 4095 3465 4680 3465 2 1 0 1 0 7 50 -1 -1 0.000 0 0 -1 1 0 2 1 1 1.00 60.00 120.00 5805 3465 6300 3465 2 4 0 1 0 7 50 -1 -1 0.000 0 0 5 0 0 5 7349 3779 7349 3150 6330 3150 6330 3779 7349 3779 2 4 0 1 0 7 50 -1 -1 0.000 0 0 4 0 0 5 4052 3779 4052 3195 3105 3195 3105 3779 4052 3779 4 0 0 50 -1 0 12 0.0000 4 150 630 6525 3510 Results\001 4 0 0 50 -1 0 12 0.0000 4 150 420 3375 3510 Data\001 4 0 0 50 -1 0 12 0.0000 4 195 750 4860 3510 Program\001 gawk-doc-4.0.1+ds.orig/doc/ChangeLog.00000644000175000017500000010311011575462403016253 0ustar schotschotMon Jun 13 22:28:02 2011 Arnold D. Robbins * gawk.texi: Document that POSIX now says [a-z] is undefined outside the C and POSIX locales, so gawk treats it as the Good Lord intended in all cases. Thanks to Paul Eggert for letting me know about this and providing URLs to cite. Fri May 27 09:59:38 2011 Arnold D. Robbins * gawk.1, gawk.texi: Minor edits w.r.t. the bug reporting address. Wed May 25 22:03:53 2011 Arnold D. Robbins * gawk.1, gawk.texi: Straighten out owners of the different Windows ports. Thu May 19 17:52:46 2011 Arnold D. Robbins * gawk.texi: Igawk, have pathto check for "-". Thanks to Steffen Schuler , from email dated 27, December 2008. Thu May 19 16:57:28 2011 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: Revised to reflect the reality that -d and -p don't allow a space before the file name. Thanks to Pat Rankin. Mon May 16 16:40:50 2011 Arnold D. Robbins * gawk.texi: Remove last vestiges of old PROCINFO sorting description. Mon May 9 15:58:33 2011 Arnold D. Robbins * gawk.texi: Finish array sorting and do a spell check. Fri May 6 13:21:20 2011 Arnold D. Robbins * gawk.texi: Finish edits after full read through. * gawk.1: Update array sorting information. Wed May 4 23:39:09 2011 Arnold D. Robbins * gawk.texi: Start at revamping array sorting doc. Still needs work. Wed Apr 27 21:49:23 2011 Arnold D. Robbins * gawk.1: Minor edit. * awkcard.in: Document third arg to asort and asorti. Thu Apr 7 21:55:27 2011 Arnold D. Robbins * gawk.texi (Nextfile Function): Removed, along with all references, since only gawk and MKS awk allow next from a function, so this function was useless for most people. Strange that noone noticed. I wonder who really reads the doc? Lots of other fixes have been going in too. Sun Mar 27 21:10:55 2011 Pat Rankin * gawk.texi (Builit-in Variables: PROCINFO array, Scanning All Elements of an Array: `for' statement): Update the documentation for PROCINFO["sorted_in"]; add "ascending index number", "descending index string", "ascending value", and "descending value" as supported sort orderings. * gawk.1 (PROCINFO array): Update PROCINFO["sorted_in"] to reflect that the value matters, and list the supported sort orders. Tue Feb 15 17:11:26 2011 Pat Rankin * gawk.texi (Builit-in Variables: PROCINFO array, Scanning All Elements of an Array: `for' statement): Document that the value of PROCINFO["sorted_in"] matters; sort orders "ascending index string", "descending index string", and "unsorted" are supported. Sun Feb 13 19:58:35 2011 Arnold D. Robbins * awkcard.in, gawk.1, gawk.texi, gawkinet.texi: Fix typos and spelling errors. Thu Feb 10 21:48:18 2011 Pat Rankin * gawk.texi: Update VMS section. Thu Feb 10 21:31:36 2011 Andreas Buening * gawk.texi: Update OS/2 information. Thu Feb 10 21:06:14 2011 Arnold D. Robbins * lflashlight-small.xpic: Renamed from lflashlight.small.xpic. * rflashlight-small.xpic: Renamed from rflashlight.small.xpic. * Makefile.am (EXTRA_DIST): Adjusted. Tue Feb 1 10:21:22 2011 Arnold D. Robbins * gawk.texi, awkcard.in, gawk.1: Document isarray function, magic string in PROCINFO for array sorting. Needs a little more work in gawk.texi. Mon Jan 10 21:52:21 2011 Arnold D. Robbins * lflashlight.small.xpic, rflashlight.small.xpic: Original source files for flashlight files from xpic tool. It only took over 10 years to put them into the dist. * Makefile.am (EXTRA_DIST): Add the new files. Thu Jan 6 22:13:11 2011 Arnold D. Robbins * gawk.texi: Replace xpic figures in Appendix D with figures from xfig. * general-program.eps, general-program.fig, general-program.pdf, process-flow.eps, process-flow.fig, process-flow.pdf: New files. * Makefile.am (EXTRA_DIST): Add the new files. Wed Jan 5 14:33:51 2011 Arnold D. Robbins * Makefile.am: Sanitize making of different PDF files. Sun Jan 2 20:30:37 2011 Arnold D. Robbins * texinfo.tex: Update to latest from texinfo CVS repository. Tue Dec 28 21:46:21 2010 Arnold D. Robbins * README.DGAWK: Removed, since there is now a chapter on the debugger. * Makefile.am (EXTRA_DIST): Remove README.DGAWK. Tue Dec 28 07:13:20 2010 John Haque * gawk.texi: Update dgawk examples. Document condition command without an expression. Fix a typo. Tue Dec 21 10:06:05 2010 Arnold D. Robbins * Makefile.am (pdf): Renamed from `all-pdf'. Much more logical and easier to remember. Sat Dec 18 20:14:58 2010 Eli Zaretskii * gawk.texi (DOS Quoting): Fix a typo. (Top, PC Installation): Remove "PC Dynamic" from the menus. (PC Installation, PC Compiling, PC Using): Remove obsolete stuff. Fix whitespace between sentences. Add indexing. (PC Testing): New node, stuff moved from "PC Compiling". (PC Dynamic): Node removed. (Cygwin): Fix wording. (MSYS): Fix whitespace between sentences. Thu Dec 9 22:27:53 2010 Arnold D. Robbins * awkcard.in, gawk.1, gawk.texi, gawkinet.texi: Remove discussion of raw option in making sockets, since it was never implemented. Wed Dec 1 21:39:15 2010 Arnold D. Robbins * awkcard.in, gawk.1: Document arrays of arrays. * gawk.texi: General progress. Mon Nov 8 22:24:21 2010 Arnold D. Robbins * gawk.1: Minor fix from Jari Aalto to help Emacs fontification. Tue Nov 2 12:15:56 2010 Arnold D. Robbins * awkcard.in, gawk.1, gawk.texi: --lint --> -L, --lint-old --> -t. Mon Nov 1 22:01:26 2010 Arnold D. Robbins * awkcard.in, gawk.1, gawk.texi: -l renamed -t. Sat Oct 30 05:53:25 2010 John Haque * gawk.texi: Added section on Array of Arrays. Sat Oct 23 20:36:58 2010 Arnold D. Robbins * awkcard.in: Updated, cleaned up. * gawk.1: Updated, some clean up. Wed Sep 22 05:29:43 2010 Arnold D. Robbins * gawk.texi: Added section on @include files. Wed Aug 18 22:14:19 2010 Arnold D. Robbins * gawk.texi: Minor edits. * Makefile.am (LN): Use `ln -f' when installing link for pgawk.1. Thanks to Peter Breitenlohner . Thu Jul 1 21:29:25 2010 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: Document `/inet4' and `/inet6'. Sun Jun 27 21:58:47 2010 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: Document all short options. Wed Jun 2 22:06:22 2010 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: Document FPAT variable and patsplit function. Fri Jun 12 13:28:24 2009 Arnold D. Robbins * gawk.texi, gawk.1: Remove --disable-directories-fatal configuration option. Thu Feb 26 20:36:18 2009 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: Document BEGINFILE and ENDFILE. Mon Feb 16 21:53:22 2009 Arnold D. Robbins * gawk.texi: Document switch statements as always available. * gawk.1: Ditto. * awkcard.in: Ditto. Thu Feb 12 22:36:32 2009 Arnold D. Robbins * gawk.texi: Document that interval expressions are now on by default. Also that --gen-po is now --gen-pot. * gawk.1: Ditto. * awkcard.in: Ditto. Sat Jan 17 20:03:43 2009 Arnold D. Robbins * gawk.texi: Document indirect function calls. * gawk.1: Ditto. * awkcard.in: Ditto. Tue Dec 30 22:22:04 2008 Assaf Gordon * gawk.texi: Document new --sandbox option. * gawk.1: Ditto. * awkcard.in: Ditto. Tue Dec 30 22:21:11 2008 Arnold D. Robbins * gawk.texi: Change --binary to --characters-as-bytes, per Karl Berry. * gawk.1: Ditto. * awkcard.in: Ditto. Thu Dec 18 05:30:13 2008 Steffen Schuler * gawk.texi: Documented fourth parameter of split(). * gawk.1: Ditto. * awkcard.in: Ditto. Thu Dec 18 05:16:48 2008 Arnold D. Robbins * gawk.texi: Minimally document `-b' / --binary. * gawk.1: Ditto. * awkcard.in: Ditto. Sun Nov 16 22:03:50 2008 Arnold D. Robbins * gawk.texi: Fully documented `-r' as synonym for --re-interval. * gawk.1: Ditto. * awkcard.in: Ditto. Tue Aug 3 13:35:15 2004 Arnold D. Robbins * gawk.texi: Document that gawk now uses the 2001 POSIX rules for `sub' and `gsub'. Wed Dec 26 22:15:05 2001 Arnold D. Robbins * gawk.texi: Documented that process special files are gone. * gawk.1: Ditto. * awkcard.in: Ditto. Thu May 6 20:55:14 2010 Arnold D. Robbins * Release 3.1.8: Release tar file made. Tue Apr 20 11:48:31 2010 Arnold D. Robbins * texinfo.tex: Update to latest from texinfo git repository. * gawk.texi, gawk.1, awkcard.in: Update version and copyright dates. Thu Mar 25 21:51:58 2010 Arnold D. Robbins * gawk.1: Clarify the socket timeout environment variables. Wed Mar 10 21:28:12 2010 Arnold D. Robbins * gawk.texi: Reworded 'index in array' so that there's no chance of someone using 'index' as a real subscript. Thanks to Hermann Peifer for the push. Thu Feb 4 20:54:48 2010 Arnold D. Robbins * gawk.texi: Multiple cleanups and bringing of things up to date. * gawk.1: Ditto, only not as much. * Makefile.am: New `all-pdf' target to make PDF files of manpage and reference card. Tue Aug 4 06:07:35 2009 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: Document that 0 flag in printf applies only to the numeric formats. Tue Aug 4 05:58:52 2009 Arnold D. Robbins * texinfo.tex: Updated to current version. Tue Jul 21 22:28:56 2009 Arnold D. Robbins * Release 3.1.7: Release tar file made. Tue Jul 21 22:20:25 2009 Arnold D. Robbins * gawk.texi, awkcard.in: Update mawk site information now that Thomas Dickey is maintaining it. Mon Jul 13 07:53:32 2009 Arnold D. Robbins * Makefile.am (SEDME2): New macro, used in making awkcard.ps, removes last empty page. Finally! Fri Jul 10 10:35:29 2009 Arnold D. Robbins * awkcard.in: Rearrange items for better formatting and organization. * gawk.texi (Exit Status): New node to document exit values. (Exit Statement): Give portability advice about exit value. Wed Jul 8 08:55:50 2009 Arnold D. Robbins * awkcard.in: Really fix table option for --verbose. Other fixes and improvements, including document %'d flag. Tue Jul 7 09:13:02 2009 Arnold D. Robbins * awkcard.in: Fix table option for --verbose. Mon Jun 8 00:40:26 2009 Tommi Vainikainen * gawk.1: Bug fix to restore space between paragraphs at entry for "--". Thu May 21 21:09:59 2009 Arnold D. Robbins * gawk.1, awkcard.in: Document new -O / --optimize option. * gawk.texi (Options): Likewise. Fri May 15 14:34:37 2009 Arnold D. Robbins * gawk.texi (User-defined): Document that you can't use the name of a built-in variable as a function parameter. Sat May 2 23:36:10 2009 Arnold D. Robbins * gawk.texi (Other Versions): Add Quiktrim awk. (How to Contribute): Change things to point to awk.info. Mon Apr 6 22:29:47 2009 Arnold D. Robbins * awkcard.in: Bell Labs awk also supports fflush() and fflush(""). Thanks to Steffen Schuler . Mon Mar 30 21:26:04 2009 Arnold D. Robbins * gawk.texi (Simple Server): Fix bug since 3.1.0 where error message from typo was in the middle of the HandleGet function. Thanks to Tim Menzies for catching this. Mon Feb 9 22:11:16 2009 Arnold D. Robbins * gawk.texi (Translate Program): Bug fix in stranslate function from Steffen Schuler . Tue Feb 3 22:06:10 2009 Arnold D. Robbins * gawk.texi (Regexp Field Splitting): Documented dark corner of ^ in FS. Sat Jan 17 20:37:12 2009 Arnold D. Robbins * gawk.texi (Plain Getline): Bug fix in code. Thanks to Steffen Schuler . Mon Jan 5 22:47:42 2009 Arnold D. Robbins * gawk.1, awkcard.in: Document that getline returns 1 on sucess. Thanks to Paolo for the report. Fri Dec 26 14:45:39 2008 Arnold D. Robbins * gawk.texi, gawkinet.texi: Update to FDL 1.3. Mon Dec 1 21:20:39 2008 Arnold D. Robbins * gawk.texi (File Checking): Correct the text at the end; getline isn't fatal, period, not related to POSIX. Thanks to Seb for pointing this out. (Round-Function): Change initial return when equal to return ival, which lops off any digits, e.g. if given 121.0. Thanks to Timothy J. Stefanski . Fri Aug 1 17:34:55 2008 Arnold D. Robbins * gawk.texi (Signature Program): Added new subsection. Thu Jul 31 21:38:08 2008 Arnold D. Robbins * gawk.texi (Variable Typing): Document that array elements created by `match' also get strnum attribute. Mon Jun 2 22:47:08 2008 Arnold D. Robbins * gawk.texi (Control Letters): Add a note about %c only taking values from 0 to 255. (DOS Quoting): New node. Thu Jan 31 16:17:27 2008 Arnold D. Robbins * gawk.texi, gawkinet.texi: Updated the Back-Cover text per latest from the FSF. Fri Jan 25 12:13:39 2008 Dave Pitts * gawk.texi (pwcat.c, grcat.c): Added ZOS_USS changes. Mon Jan 14 05:30:16 2008 Arnold D. Robbins * gawk.texi: Add maintainer contact info for z/OS. Mon Oct 22 08:49:05 2007 Arnold D. Robbins * Release 3.1.6: Release tar file made. Fri Oct 19 04:13:33 2007 Arnold D. Robbins * gawk.1: Add length(array) to list of extensions at end. Revise date. Thu Oct 18 08:40:59 2007 Arnold D. Robbins * texinfo.tex: Updated to version from Texinfo 4.11. Sun Oct 14 20:37:59 2007 Arnold D. Robbins * awkcard.in: Fix version numbers and copyright info, minor cleanups to format nicely. Sun Sep 30 22:30:05 2007 Arnold D. Robbins * gawk.texi (Conversion): Add table describing locale decimal point versus period. Sat Sep 8 23:53:46 2007 Arnold D. Robbins * gawk.texi: A number of minor fixes based on suggestions from Jack Kelley . Sat Aug 11 22:46:14 2007 Arnold D. Robbins * gawk.texi (Copying): Move to GPL 3. Wed May 30 17:11:19 2007 Arnold D. Robbins * Makefile.am (CLEANFILES): Added, so that even "make distclean" will do the right thing. (clean): Removed, let automake to do it. Tue May 29 22:49:16 2007 Arnold D. Robbins * gawk.texi: Document --use-lc-numeric. Document that some VMS systems come with an old version of gawk. Mon May 28 08:21:51 2007 Arnold D. Robbins * gawk.1, awkcard.in: Document --use-lc-numeric. Tue May 15 13:27:38 2007 Arnold D. Robbins * gawk.texi, gawk.1: Documented --disable-directories-fatal configure option. Wed May 9 21:50:44 2007 Arnold D. Robbins * gawk.1: Reviewed and updated, minor typos fixed. * awkcard.in: Added mention of %F. Wed May 2 19:55:02 2007 Arnold D. Robbins * gawk.texi: Cleaned up discussion of string concatenation where needed, including a note about the mixed treatment of `"echo " "date" | getline'. Sigh. Sun Apr 29 13:33:27 2007 Arnold D. Robbins * gawk.texi (Time Functions): Update description of strftime for third utc-flag argument. Other minor fixes. * gawk.1, awkcard.in: Same. Tue Apr 3 22:47:40 2007 Arnold D. Robbins * gawk.texi (New Ports): Update list of files for all of regex that should not be messed with lightly. Wed Mar 21 09:02:53 2007 Arnold D. Robbins * gawk.texi: Removed last vestiges of arnold@gnu.org email address. Wed Mar 7 13:06:31 2007 Arnold D. Robbins * gawk.texi (Getopt Function): Add a note that user level code must clear out ARGV from 1 to Optind. Thanks to Matthew.Hall1@VerizonWireless.com, from mail dated Tue, 02 Aug 2005 09:04:37 -0700. Wed Mar 7 08:48:02 2007 Arnold D. Robbins * gawk.texi: Fix my personal email address. Sheesh. Thanks again to Sahak Petrosyan . Tue Mar 6 09:13:38 2007 Arnold D. Robbins * gawk.texi: Fix link to online version of the manual. Thanks to Sahak Petrosyan . Wed Feb 14 19:40:33 2007 Arnold D. Robbins * gawk.texi: Add discussion of magic values for Inf, NaN, and hexadecimal floating point in appendix on numbers. Other minor updates for date, trademarks, etc. Sun Jan 21 12:59:33 2007 "Ennio-(Sr)" * gawk.1: Add note that locale settings can influence the choice of decimal point character. Sat Jan 13 22:43:39 2007 Ralf Wildenhues * gawk.texi: Fix some typos. * gawkinet.texi: Likewise. Sat Jan 13 21:25:28 2007 Ralf Wildenhues * awkcard.in: next is POSIX. * gawk.texi: V7/SVR3.1: Mention assignable `$0', `var in index' as expression. Specify `FS' limitation. Fri Jan 12 12:28:51 2007 Arnold D. Robbins * texinfo.tex: Updated upon move to current autotools. Thu Jan 4 19:56:45 2007 Arnold D. Robbins * gawk.1: Applied patch from Eric Raymond to stop his stupid automated email kvetching about the wonders of docbook. 2006-07-29 Paul Eggert * gawk.texi: Document that `$$0++--' isn't valid even though it is unambiguous according to the Awk grammar. This is in response to Open Group XCU ERN 86 . Fri Oct 21 12:50:19 2005 Arnold D. Robbins Better support for PDF, thanks to Marty Leisner for the prodding. * Makefile.am: Add lflashlight.pdf, rflashlight.pdf, statist.pdf to EXTRADIST and add gawk.pdf and gawkinet.pdf to list of files to remove for `clean'. * lflashlight.pdf, rflashlight.pdf, statist.pdf: New files, created with `epstopdf foo.eps > foo.pdf'. Tue Jul 26 21:46:16 2005 Arnold D. Robbins * Release 3.1.5: Release tar file made. Sun Jun 26 16:24:07 2005 Arnold D. Robbins * gawk.texi: Document `length(array)'. * gawk.1: Ditto. * awkcard.in: Ditto. Mon May 23 20:56:32 2005 Arnold D. Robbins * gawk.texi: Removed references to `--with-included-gettext'. Fri Apr 1 06:25:30 2005 Arnold D. Robbins * texinfo.tex: Updated to version 2005-01-30.17. Wed Feb 9 11:39:38 2005 Arnold D. Robbins * Makefile.am: Per Stepan Kasal, removed html rules, since Automake does it for us. Tue Jan 4 18:47:34 2005 Arnold D. Robbins * texinfo.tex: Updated to version 2004-11-25.16. Mon Jan 3 14:09:57 2005 Arnold D. Robbins * texinfo.tex: Updated to version 2004-10-31.06. Wed Sep 22 11:40:06 2004 Arnold D. Robbins * gawk.1, gawk.texi, awkcard.in: Documented new --exec option. Mon Aug 2 12:18:15 2004 Arnold D. Robbins * Release 3.1.4: Release tar file made. Wed Jul 28 17:03:16 2004 Arnold D. Robbins * Makefile.am (TROFF): Add -U flag to invocation. Makes it possible to format ref card from a build directory that isn't the source directory. (distclean): Removed target. Let automake handle it. Tue Jun 15 12:21:09 2004 Arnold D. Robbins * texinfo.tex: Updated to version 2004-06-14.14. * gawk.texi (Dynamic Extensions): Text revised to follow current implementation: new APIs, info on `n->param_cnt' fixed. Also in all index entries where comma does not separate primary, secondary or tertiary terms, replaced the comma with @comma{} and removed the corresponding comments. Mon May 31 09:11:01 2004 Arnold D. Robbins * ad.block, awkcard.in, cardfonts, colors, no.colors: Change old email address to current one. Mon May 3 09:54:46 2004 Arnold D. Robbins * texinfo.tex: Updated to version from Automake 1.8.4. Mon Mar 22 10:53:13 2004 Arnold D. Robbins * texinfo.tex: Updated. Tue Jan 6 17:38:40 2004 Arnold D. Robbins * texinfo.tex: Updated. * gawk.texi: All @strong{Note:} changed to `@quotation NOTE'. Mon Jul 7 11:01:43 2003 Arnold D. Robbins * Release 3.1.3: Release tar file made. Mon Jun 9 16:06:30 2003 Arnold D. Robbins * gawk.texi: Set automatic-xref-title and change all cross references to be of the single-argument type. Made all @node lines have just the node name. Should have done both of these years ago. Sun May 11 16:08:58 2003 Arnold D. Robbins * Makefile.am (html, gawk.html, gawkinet.html): New targets. Mon Mar 31 17:15:23 2003 Arnold D. Robbins * Makefile.am (install-data-hook, uninstall-hook): Added code to hard link gawk.1 to pgawk.1 upon install and remove pgawk.1 upon uninstall. Avoids MANPATH search problems, etc. etc. (man_MANS): Removed pgawk.1 from the list. * pgawk.1: Removed. Wed Mar 19 14:10:31 2003 Arnold D. Robbins This time for sure. -- Bullwinkle * Release 3.1.2: Release tar file made. Tue Mar 11 11:22:36 2003 Arnold D. Robbins * Makefile.am (man_MANS): Add pgawk.1. * pgawk.1: New file, does `.so gawk.1' so that `man pgawk' will work. Thanks to Nelson Beebe for pointing the need for this. Sun Feb 9 09:45:06 2003 Arnold D. Robbins * gawk.texi, gawkinet.texi: Per Karl Berry, change dircategory to follow current standards. In gawkinet.texi, remove bracketing ifinfo. Thu Feb 6 12:06:22 2003 Arnold D. Robbins * texinfo.tex: Updated to version 2003-02-03.16 from Texinfo 4.5. Tue Feb 4 15:21:46 2003 Arnold D. Robbins * awkcard.in: Redid the page-breaking. Tue Feb 4 14:28:06 2003 Arnold D. Robbins All relevant files: Copyright year updated to 2003. Sun Jan 26 11:13:01 2003 Arnold D. Robbins * texinfo.tex: Updated to version 2003-01-24.17 from prep. * gawk.texi: Documented asorti(), new elements in match() 3rd arg, misc cleanups. Updated to FDL 1.2. * awkcard.in, gawk.1: Ditto for asorti(), match(). * gawkinet.texi: Updated to FDL 1.2. Thu Jan 16 18:34:54 2003 Arnold D. Robbins * texinfo.tex: Updated to version 2003-01-12.11 from prep. Sun Nov 24 17:55:23 2002 Arnold D. Robbins * texinfo.tex: Updated to version 2002-11-05.11 from Texinfo 4.3. Sun Nov 17 21:34:35 2002 Arnold D. Robbins * texinfo.tex: Updated to version 2002-10-13.14 from automake 1.7.1. Fri Nov 1 11:25:00 2002 Arnold D. Robbins From Kaveh Ghazi: * gawk.texi (grcat.c): Include stdlib.h. (main): Fix format specifier warnings. * gawk.texi (pwcat.c): Include config.h/stdlib.h. (main): Fix format specifier warnings. Tue Jun 11 23:08:04 2002 Arnold D. Robbins * gawk.texi: Fix grcat code ifdef for HAVE_GETGRENT. 2002-05-09 Paul Eggert [ ADR: Some minor post-patch editing was required. ] * gawk.texi (igawk): Do not put temporary files in /tmp, as that has some security problems. This fixes a problem originally reported by Jarno Huuskonen via solar@openwall.com. Fix the following problems with igawk while we're at it. * Report missing operands of options; this fixes e.g. an infinite loop with "igawk -W". * Check for --source and -Wsource only, not -.source (which matches errors). Similarly for other multichar options. * Do not use 'echo', as that mishandles backslashes. Mon May 13 01:25:40 2002 Arnold D. Robbins * gawkinet.texi: Change `ifinfo' to `ifnottex' around the Top node. Thanks to Eli Zaretskii. Wed May 1 16:41:32 2002 Arnold D. Robbins * Release 3.1.1: Release tar file made. Tue Apr 16 13:26:13 2002 Arnold D. Robbins * gawk.texi: FINALLY. All O'Reilly production and indexing changes integrated. Index reviewed and cleaned up. * gawkinet.texi: Ditto. * awkcard.in: Redid page breaking. * Makefile.am (clean): Add `awkcard.tr' to list of files that are removed. (distclean): Depend on clean to REALLY GET `awkcard.tr'. Sheesh. Mon Apr 15 14:43:51 2002 Arnold D. Robbins * texinfo.tex: Updated to version from Texinfo 4.2. * gawk.texi: Modified to use new @copying command. * gawkinet.texi: Ditto. Wed Mar 20 17:07:50 2002 Arnold D. Robbins * texinfo.tex: Updated to version from Texinfo 4.1. 2002-02-10 Paul Eggert * gawk.texi (Word Sorting): Don't use sort +1, as POSIX 1003.1-2001 no longer allows it. Use sort -k instead. 2002-01-27 Bruno Haible * gawk.texi: Document the dcngettext function. * awkcard.in: Likewise. * gawk.1: Likewise. Mon Jan 28 18:41:02 2002 Arnold D. Robbins * gawkinet.texi, Makefile.am: Removed User Friendly cartoon. Sigh. Wed Dec 19 16:00:39 2001 Eli Zaretskii * gawk.texi (Profiling): Describe the signals used for profile dumping in the DJGPP version. Mon Sep 3 18:30:13 2001 Arnold D. Robbins * gawk.texi (Top): Put in @ifnottex so that makeinfo --html is now happy. Sun Jun 3 13:04:44 2001 Arnold D. Robbins * Release 3.1.0: Release tar file made. And there was rejoicing. Mon May 14 19:57:31 2001 Arnold D. Robbins * gawk.texi, gawkinet.texi: Versions for distribution put in place. * gawk.1, awkcard.in: Minor edits for consistency of usage, formatting. Wed Nov 22 14:57:59 2000 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: Removed all documentation of abort. Sun Aug 13 11:23:50 2000 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: documented sort function and optional third argument to match. Sun Aug 13 00:40:41 2000 Arnold D. Robbins * gawk.texi: hardwired publisher info. * publisher.texi: Removed. Not needed any more. * gawkinet.texi: Added title page stuff. Thu Jul 5 21:05:57 2000 Arnold D. Robbins * gawk.texi: moved to use of @command, @option everywhere appropriate. Removed all @page and @group in anticipation of re-page breaking. Updated stuff for install-info. Added FDL. Tue Nov 10 11:42:26 1998 Arnold D. Robbins * publisher.texi: new file with publisher related info. * Makefile.in: updated dvi and postscript targets to make them lots smarter about not reformatting if need be. Mon Aug 7 15:23:00 2000 Arnold D. Robbins * Release 3.0.6: Release tar file made. Sun Jun 25 15:08:19 2000 Arnold D. Robbins * Release 3.0.5: Release tar file made. Wed May 17 19:04:54 2000 Arnold D. Robbins * gawk.texi, gawk.1, awkcard.in: Documented %u. Ooops. Tue May 2 11:44:13 2000 Arnold D. Robbins * texinfo.tex: Updated to version 1999-10-01.07. * gawk.texi: Redid page breaking for new texinfo.tex. Thu Apr 6 12:32:49 2000 Arnold D. Robbins * gawk.texi: Change info dir file entry to `(gawk)' from `(gawk.info)'. * Makefile.in [$(infodir)/gawk.info]: Fix grep test is accordance with above. Sun Feb 13 15:36:32 2000 Paul Eggert * gawk.texi: Mention that arithmetic is done in double precision floating point, and point to Goldberg's paper for people who want to know more. Fix some other minor floating point discussion issues. Wed Nov 3 17:04:35 1999 Arnold D. Robbins * gawk.1: Lots of troff ``lint'' from Paul Eggert. Not all of his changes, just the ones I thought worth doing. Mon Oct 11 16:53:54 1999 Arnold D. Robbins * Makefile.in (gawk.dvi): Put $(srcdir) first in TEXINPUTS, and also just use texi2dvi, don't run texindex and tex manually. Doing so is no longer necessary. Mon Aug 9 13:06:01 1999 Arnold D. Robbins * gawk.texi: New node `Array Efficiency' on the best use of subscripting to avoid memory bloat. Thu Jul 29 23:15:34 1999 Arnold D. Robbins * Makefile.in ($(infodir)/gawk.info): Removed loop around $(INSTALL_DATA), since there's only one Info file to install, install it directly. Wed Jun 30 16:14:36 1999 Arnold D. Robbins * Release 3.0.4: Release tar file made. This time for sure. Wed Oct 7 21:59:33 1998 Arnold D. Robbins * texinfo.tex: Updated to version 2.227, from Texinfo 3.12. Sun Oct 19 12:26:08 1997 Arnold D. Robbins * ALL: change references to arnold@gnu.ai.mit.edu to arnold@gnu.org. Tue Sep 23 10:31:17 1997 Arnold D. Robbins * texinfo.tex: Updated to version 2.218, from Texinfo 3.11. Fri Jul 4 08:19:00 1997 Arnold D. Robbins * Makefile.in ($(infodir)/gawk.info): Don't make dependent upon gawk.info, in case installed one is newer. Instead, check that an installed gawk.info exists and is identical to current one. If so, just exit; otherwise do the install. Wed Jul 2 14:55:12 1997 Arnold D. Robbins * Makefile.in ($(infodir)/gawk.info): typo fix. Thu May 15 12:49:08 1997 Arnold D. Robbins * Release 3.0.3: Release tar file made. Fri Apr 18 07:55:47 1997 Arnold D. Robbins * BETA Release 3.0.34: Release tar file made. Sun Apr 13 15:39:20 1997 Arnold D. Robbins * Makefile.in ($(infodir)/gawk.info): exit 0 in case install-info fails. Thu Jan 2 23:17:53 1997 Fred Fish * Makefile.in (awkcard.tr): Use ':' chars to separate parts of sed command, since $(srcdir) may expand to something with '/' characters in it, which confuses sed terribly. * gawk.texi (Amiga Installation): Note change of configuration from "m68k-cbm-amigados" to "m68k-amigaos". Point ftp users towards current ADE distribution and not obsolete Aminet "gcc" distribution. Change "FreshFish" to "Geek Gadgets". Wed Dec 25 11:25:22 1996 Arnold D. Robbins * Release 3.0.2: Release tar file made. Wed Dec 25 11:17:32 1996 Arnold D. Robbins * Makefile.in ($(mandir)/igawk$(manext),$(mandir)/gawk$(manext)): remove chmod command; let $(INSTALL_DATA) use -m. Tue Dec 17 22:38:28 1996 Arnold D. Robbins * Makefile.in (gawk.info,gawk.dvi,postscript): run makeinfo, TeX, and/or troff against files in $(srcdir). Thanks to Ulrich Drepper. ($(infodir)/gawk.info): use --info-dir to install-info, not --infodir. Tue Dec 10 23:09:26 1996 Arnold D. Robbins * Release 3.0.1: Release tar file made. Mon Dec 9 12:48:54 1996 Arnold D. Robbins * no.colors: new file from Michal for old troffs. * Makefile.in [AWKCARD]: changes to parameterize old/new troff. Sun Dec 1 15:04:56 1996 Arnold D. Robbins * texinfo.tex: Updated to version 2.193, from Karl Berry. Tue Nov 26 22:57:15 1996 Arnold D. Robbins * Makefile.in ($(infodir)/gawk.info): Change option in call to `install-info' to `--info-dir' from `--infodir'. Mon Nov 4 13:30:39 1996 Arnold D. Robbins * Makefile.in: updates for reference card. (ad.block, awkcard.in, cardfonts, colors, macros, setter.outline): new files for reference card. Wed Oct 16 12:43:02 1996 Arnold D. Robbins * texinfo.tex: Updated to version 2.185, from texinfo-3.9 dist. Sun Aug 11 23:12:08 1996 Arnold D. Robbins * Makefile.in ($(infodir)/gawk.info): correct use of $(INSTALL_DATA) and remove chmod command. Thu Jul 11 22:06:50 1996 Arnold D. Robbins * Makefile.in ($(mandir)/gawk.$(ext), $(mandir)/igawk.$(ext)): made dependant on files in $(srcdir). Fri Mar 15 06:45:35 1996 Arnold D. Robbins * Makefile.in (clean): add `*~' to list of files to be removed. Thu Jan 25 23:40:15 1996 Arnold D. Robbins * Makefile.in (dvi): run texindex and tex an extra time. This gets the cross references right. Sigh. Wed Jan 24 11:51:54 1996 Arnold D. Robbins * Makefile.in (maintainer-clean): Depend on distclean, not the other way around. Output warning message as per GNU standards. gawk-doc-4.0.1+ds.orig/doc/rflashlight-small.xpic0000644000175000017500000000054707166366262020666 0ustar schotschot#! /usr/X11R6/bin/xpic 80 48 160 80 8 5 36 96 48 112 80 0 0 104 64 8 16 1 37 104 48 128 56 0 0 2 104 48 128 56 1 38 104 72 128 80 0 0 2 104 80 128 72 2 39 128 56 128 72 0 0 2 128 56 128 72 3 40 128 56 160 72 0 0 1 41 80 72 80 72 0 0 2 80 72 80 72 1 42 80 72 96 80 0 0 2 80 80 96 72 1 43 80 64 96 64 0 0 2 80 64 96 64 1 45 80 48 96 56 0 0 2 96 56 80 48 gawk-doc-4.0.1+ds.orig/doc/general-program.pdf0000644000175000017500000001272411511377120020121 0ustar schotschot%PDF-1.4 %쏢 5 0 obj <> stream xTn1 +rVIĉnG8uM2ӮZU!7{ZWn'f`D 9~1 doYh'>gJZQrI]ʑ1R:Bgh09օc[azt"DèzX9{H#Y4alqU-'U6HrުjG&{,N:%QfV0vDkcP!α sCt+.uD˔:Ģ -\blA/sCc9{\U!qFj퍳T[|r4u;xzvoI ׻7ܚu .0Lb{|8 J`rnY]/>iuhuf]#7endstream endobj 6 0 obj 571 endobj 4 0 obj <> /Contents 5 0 R >> endobj 3 0 obj << /Type /Pages /Kids [ 4 0 R ] /Count 1 >> endobj 1 0 obj <> endobj 7 0 obj <>endobj 10 0 obj <> endobj 11 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 12 0 obj <>stream xeTiP[~@ib-ivo5nbw&2k02 I,Z-$aq !d6 ̾ı N $vj;kN3qnڹyGf:љ;w;= c0Qi2Q>@K3L]'#w`nbBT3G`LCmOɫ+%U]{ɡD~a#dQXI/"L^&VD%E~Z^R/(*meHD\.Sw%>x>z:vN\VW9,/ E IAG0 "KRR2 K~Ұt,{;~bhZ,|͸'ڙd:#D|) r+C<d >EOFsCqov߈b<~8{Tg^/7kC#Ծo_,Ĉe7HN DpD˷.} e+iO1F@P,v5Naΰ1nw%}PP %M⢾=ċFOC*Nntڛ;ol8do 2z3,Hfmfۥu@y/.V%3nf(u)h2УQX^[mcY,ƦF3ZJ<0+|ZN[ eYbGUZꠛewXzقvhS0;*o(SYq Cýh4l'B1ndήƲאDd3qzASH&y\i,-Cś}aΥ1( & M6|իyNӷx9WCϩ8;\/_0@6Aq:B/iۋvjW:5GPY_Mtܙ-hG]tRwȭ}1B~xqhpm/Ukp x& '} -E*#v{/)6[KStďbQDk|jLʙx WƦ+[Nyk9O%DJyTS )Ur.+=Z{C0˹ӧlmk 8ڛM6YMm0@894jCe|6t?uũ'#v}Y \)vtAq^ZvtO:>ZxtZ>^#kT!j{# }э6dSu &Z!Z (mER$:bg!p.$zNleAW^bc!hUoic;@\rҵ:nQu\ТwGњY#2^ n<*l 1ms4hQmM4Gϰj\0A;bMU:a# f Ԋ̈́-OQ8R4H˭eV]7LġBm.Ԭtn8@Mp5K-KEdYC׾7䈊Zڂa: endstream endobj 13 0 obj <>stream 2011-01-06T17:36:03+02:00 2011-01-06T17:36:03+02:00 fig2dev Version 3.2 Patchlevel 5c general-program.fig endstream endobj 2 0 obj <>endobj xref 0 14 0000000000 65535 f 0000000884 00000 n 0000004960 00000 n 0000000825 00000 n 0000000675 00000 n 0000000015 00000 n 0000000656 00000 n 0000000949 00000 n 0000001050 00000 n 0000001331 00000 n 0000000990 00000 n 0000001020 00000 n 0000001585 00000 n 0000003538 00000 n trailer << /Size 14 /Root 1 0 R /Info 2 0 R /ID [] >> startxref 5155 %%EOF gawk-doc-4.0.1+ds.orig/doc/gawkinet.texi0000644000175000017500000065002511526015626017060 0ustar schotschot\input texinfo @c -*-texinfo-*- @c %**start of header (This is for running Texinfo on a region.) @setfilename gawkinet.info @settitle TCP/IP Internetworking With @command{gawk} @c %**end of header (This is for running Texinfo on a region.) @c FIXME: web vs. Web @dircategory Network applications @direntry * Gawkinet: (gawkinet). TCP/IP Internetworking With `gawk'. @end direntry @iftex @set DOCUMENT book @set CHAPTER chapter @set SECTION section @set DARKCORNER @inmargin{@image{lflashlight,1cm}, @image{rflashlight,1cm}} @end iftex @ifinfo @set DOCUMENT Info file @set CHAPTER major node @set SECTION node @set DARKCORNER (d.c.) @end ifinfo @ifhtml @set DOCUMENT web page @set CHAPTER chapter @set SECTION section @set DARKCORNER (d.c.) @end ifhtml @set FSF @set FN file name @set FFN File Name @c merge the function and variable indexes into the concept index @ifinfo @synindex fn cp @synindex vr cp @end ifinfo @iftex @syncodeindex fn cp @syncodeindex vr cp @end iftex @c If "finalout" is commented out, the printed output will show @c black boxes that mark lines that are too long. Thus, it is @c unwise to comment it out when running a master in case there are @c overfulls which are deemed okay. @iftex @finalout @end iftex @smallbook @c Special files are described in chapter 6 Printing Output under @c 6.7 Special File Names in gawk. I think the networking does not @c fit into that chapter, thus this separate document. At over 50 @c pages, I think this is the right decision. ADR. @set TITLE TCP/IP Internetworking With @command{gawk} @set EDITION 1.3 @set UPDATE-MONTH December, 2010 @c gawk versions: @set VERSION 4.0 @set PATCHLEVEL 0 @copying This is Edition @value{EDITION} of @cite{@value{TITLE}}, for the @value{VERSION}.@value{PATCHLEVEL} (or later) version of the GNU implementation of AWK. @sp 2 Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010 Free Software Foundation, Inc. @sp 2 Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.3 or any later version published by the Free Software Foundation; with the Invariant Sections being ``GNU General Public License'', the Front-Cover texts being (a) (see below), and with the Back-Cover Texts being (b) (see below). A copy of the license is included in the section entitled ``GNU Free Documentation License''. @enumerate a @item ``A GNU Manual'' @item ``You have the freedom to copy and modify this GNU manual. Buying copies from the FSF supports it in developing GNU and promoting software freedom.'' @end enumerate @end copying @ifinfo This file documents the networking features in GNU @command{awk}. @insertcopying @end ifinfo @setchapternewpage odd @titlepage @title @value{TITLE} @subtitle Edition @value{EDITION} @subtitle @value{UPDATE-MONTH} @author J@"urgen Kahrs @author with Arnold D. Robbins @c Include the Distribution inside the titlepage environment so @c that headings are turned off. Headings on and off do not work. @page @vskip 0pt plus 1filll @sp 2 Published by: @sp 1 Free Software Foundation @* 51 Franklin Street, Fifth Floor @* Boston, MA 02110-1301 USA @* Phone: +1-617-542-5942 @* Fax: +1-617-542-2652 @* Email: @email{gnu@@gnu.org} @* URL: @uref{http://www.gnu.org/} @* ISBN 1-882114-93-0 @* @insertcopying @c @sp 2 @c Cover art by ?????. @end titlepage @iftex @headings off @evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @| @oddheading @| @| @strong{@thischapter}@ @ @ @thispage @end iftex @ifnottex @node Top, Preface, (dir), (dir) @top General Introduction @comment node-name, next, previous, up This file documents the networking features in GNU Awk (@command{gawk}) version 4.0 and later. @insertcopying @end ifnottex @menu * Preface:: About this document. * Introduction:: About networking. * Using Networking:: Some examples. * Some Applications and Techniques:: More extended examples. * Links:: Where to find the stuff mentioned in this document. * GNU Free Documentation License:: The license for this document. * Index:: The index. @detailmenu * Stream Communications:: Sending data streams. * Datagram Communications:: Sending self-contained messages. * The TCP/IP Protocols:: How these models work in the Internet. * Basic Protocols:: The basic protocols. * Ports:: The idea behind ports. * Making Connections:: Making TCP/IP connections. * Gawk Special Files:: How to do @command{gawk} networking. * Special File Fields:: The fields in the special file name. * Comparing Protocols:: Differences between the protocols. * File /inet/tcp:: The TCP special file. * File /inet/udp:: The UDP special file. * TCP Connecting:: Making a TCP connection. * Troubleshooting:: Troubleshooting TCP/IP connections. * Interacting:: Interacting with a service. * Setting Up:: Setting up a service. * Email:: Reading email. * Web page:: Reading a Web page. * Primitive Service:: A primitive Web service. * Interacting Service:: A Web service with interaction. * CGI Lib:: A simple CGI library. * Simple Server:: A simple Web server. * Caveats:: Network programming caveats. * Challenges:: Where to go from here. * PANIC:: An Emergency Web Server. * GETURL:: Retrieving Web Pages. * REMCONF:: Remote Configuration Of Embedded Systems. * URLCHK:: Look For Changed Web Pages. * WEBGRAB:: Extract Links From A Page. * STATIST:: Graphing A Statistical Distribution. * MAZE:: Walking Through A Maze In Virtual Reality. * MOBAGWHO:: A Simple Mobile Agent. * STOXPRED:: Stock Market Prediction As A Service. * PROTBASE:: Searching Through A Protein Database. @end detailmenu @end menu @contents @node Preface, Introduction, Top, Top @unnumbered Preface In May of 1997, J@"urgen Kahrs felt the need for network access from @command{awk}, and, with a little help from me, set about adding features to do this for @command{gawk}. At that time, he wrote the bulk of this @value{DOCUMENT}. The code and documentation were added to the @command{gawk} 3.1 development tree, and languished somewhat until I could finally get down to some serious work on that version of @command{gawk}. This finally happened in the middle of 2000. Meantime, J@"urgen wrote an article about the Internet special files and @samp{|&} operator for @cite{Linux Journal}, and made a networking patch for the production versions of @command{gawk} available from his home page. In August of 2000 (for @command{gawk} 3.0.6), this patch also made it to the main GNU @command{ftp} distribution site. For release with @command{gawk}, I edited J@"urgen's prose for English grammar and style, as he is not a native English speaker. I also rearranged the material somewhat for what I felt was a better order of presentation, and (re)wrote some of the introductory material. The majority of this document and the code are his work, and the high quality and interesting ideas speak for themselves. It is my hope that these features will be of significant value to the @command{awk} community. @sp 1 @noindent Arnold Robbins @* Nof Ayalon, ISRAEL @* March, 2001 @node Introduction, Using Networking, Preface, Top @chapter Networking Concepts This @value{CHAPTER} provides a (necessarily) brief introduction to computer networking concepts. For many applications of @command{gawk} to TCP/IP networking, we hope that this is enough. For more advanced tasks, you will need deeper background, and it may be necessary to switch to lower-level programming in C or C++. There are two real-life models for the way computers send messages to each other over a network. While the analogies are not perfect, they are close enough to convey the major concepts. These two models are the phone system (reliable byte-stream communications), and the postal system (best-effort datagrams). @menu * Stream Communications:: Sending data streams. * Datagram Communications:: Sending self-contained messages. * The TCP/IP Protocols:: How these models work in the Internet. * Making Connections:: Making TCP/IP connections. @end menu @node Stream Communications, Datagram Communications, Introduction, Introduction @section Reliable Byte-streams (Phone Calls) When you make a phone call, the following steps occur: @enumerate @item You dial a number. @item The phone system connects to the called party, telling them there is an incoming call. (Their phone rings.) @item The other party answers the call, or, in the case of a computer network, refuses to answer the call. @item Assuming the other party answers, the connection between you is now a @dfn{duplex} (two-way), @dfn{reliable} (no data lost), sequenced (data comes out in the order sent) data stream. @item You and your friend may now talk freely, with the phone system moving the data (your voices) from one end to the other. From your point of view, you have a direct end-to-end connection with the person on the other end. @end enumerate The same steps occur in a duplex reliable computer networking connection. There is considerably more overhead in setting up the communications, but once it's done, data moves in both directions, reliably, in sequence. @node Datagram Communications, The TCP/IP Protocols, Stream Communications, Introduction @section Best-effort Datagrams (Mailed Letters) Suppose you mail three different documents to your office on the other side of the country on two different days. Doing so entails the following. @enumerate @item Each document travels in its own envelope. @item Each envelope contains both the sender and the recipient address. @item Each envelope may travel a different route to its destination. @item The envelopes may arrive in a different order from the one in which they were sent. @item One or more may get lost in the mail. (Although, fortunately, this does not occur very often.) @item In a computer network, one or more @dfn{packets} may also arrive multiple times. (This doesn't happen with the postal system!) @end enumerate The important characteristics of datagram communications, like those of the postal system are thus: @itemize @bullet @item Delivery is ``best effort;'' the data may never get there. @item Each message is self-contained, including the source and destination addresses. @item Delivery is @emph{not} sequenced; packets may arrive out of order, and/or multiple times. @item Unlike the phone system, overhead is considerably lower. It is not necessary to set up the call first. @end itemize The price the user pays for the lower overhead of datagram communications is exactly the lower reliability; it is often necessary for user-level protocols that use datagram communications to add their own reliability features on top of the basic communications. @node The TCP/IP Protocols, Making Connections, Datagram Communications, Introduction @section The Internet Protocols The Internet Protocol Suite (usually referred to as just TCP/IP)@footnote{ It should be noted that although the Internet seems to have conquered the world, there are other networking protocol suites in existence and in use.} consists of a number of different protocols at different levels or ``layers.'' For our purposes, three protocols provide the fundamental communications mechanisms. All other defined protocols are referred to as user-level protocols (e.g., HTTP, used later in this @value{DOCUMENT}). @menu * Basic Protocols:: The basic protocols. * Ports:: The idea behind ports. @end menu @node Basic Protocols, Ports, The TCP/IP Protocols, The TCP/IP Protocols @subsection The Basic Internet Protocols @table @asis @item IP The Internet Protocol. This protocol is almost never used directly by applications. It provides the basic packet delivery and routing infrastructure of the Internet. Much like the phone company's switching centers or the Post Office's trucks, it is not of much day-to-day interest to the regular user (or programmer). It happens to be a best effort datagram protocol. In the early twenty-first century, there are two versions of this protocol in use: @table @asis @item IPv4 The original version of the Internet Protocol, with 32-bit addresses, on which most of the current Internet is based. @item IPv6 The ``next generation'' of the Internet Protocol, with 128-bit addresses. This protocol is in wide use in certain parts of the world, but has not yet replaced IPv4.@footnote{There isn't an IPv5.} @end table Versions of the other protocols that sit ``atop'' IP exist for both IPv4 and IPv6. However, as the IPv6 versions are fundamentally the same as the original IPv4 versions, we will not distinguish further between them. @item UDP The User Datagram Protocol. This is a best effort datagram protocol. It provides a small amount of extra reliability over IP, and adds the notion of @dfn{ports}, described in @ref{Ports, ,TCP and UDP Ports}. @item TCP The Transmission Control Protocol. This is a duplex, reliable, sequenced byte-stream protocol, again layered on top of IP, and also providing the notion of ports. This is the protocol that you will most likely use when using @command{gawk} for network programming. @end table All other user-level protocols use either TCP or UDP to do their basic communications. Examples are SMTP (Simple Mail Transfer Protocol), FTP (File Transfer Protocol), and HTTP (HyperText Transfer Protocol). @cindex SMTP (Simple Mail Transfer Protocol) @cindex FTP (File Transfer Protocol) @cindex HTTP (Hypertext Transfer Protocol) @node Ports, , Basic Protocols, The TCP/IP Protocols @subsection TCP and UDP Ports In the postal system, the address on an envelope indicates a physical location, such as a residence or office building. But there may be more than one person at the location; thus you have to further quantify the recipient by putting a person or company name on the envelope. In the phone system, one phone number may represent an entire company, in which case you need a person's extension number in order to reach that individual directly. Or, when you call a home, you have to say, ``May I please speak to ...'' before talking to the person directly. IP networking provides the concept of addressing. An IP address represents a particular computer, but no more. In order to reach the mail service on a system, or the FTP or WWW service on a system, you must have some way to further specify which service you want. In the Internet Protocol suite, this is done with @dfn{port numbers}, which represent the services, much like an extension number used with a phone number. Port numbers are 16-bit integers. Unix and Unix-like systems reserve ports below 1024 for ``well known'' services, such as SMTP, FTP, and HTTP. Numbers 1024 and above may be used by any application, although there is no promise made that a particular port number is always available. @node Making Connections, , The TCP/IP Protocols, Introduction @section Making TCP/IP Connections (And Some Terminology) Two terms come up repeatedly when discussing networking: @dfn{client} and @dfn{server}. For now, we'll discuss these terms at the @dfn{connection level}, when first establishing connections between two processes on different systems over a network. (Once the connection is established, the higher level, or @dfn{application level} protocols, such as HTTP or FTP, determine who is the client and who is the server. Often, it turns out that the client and server are the same in both roles.) @cindex servers The @dfn{server} is the system providing the service, such as the web server or email server. It is the @dfn{host} (system) which is @emph{connected to} in a transaction. For this to work though, the server must be expecting connections. Much as there has to be someone at the office building to answer the phone@footnote{In the days before voice mail systems!}, the server process (usually) has to be started first and be waiting for a connection. @cindex clients The @dfn{client} is the system requesting the service. It is the system @emph{initiating the connection} in a transaction. (Just as when you pick up the phone to call an office or store.) In the TCP/IP framework, each end of a connection is represented by a pair of (@var{address}, @var{port}) pairs. For the duration of the connection, the ports in use at each end are unique, and cannot be used simultaneously by other processes on the same system. (Only after closing a connection can a new one be built up on the same port. This is contrary to the usual behavior of fully developed web servers which have to avoid situations in which they are not reachable. We have to pay this price in order to enjoy the benefits of a simple communication paradigm in @command{gawk}.) @cindex blocking @cindex synchronous communications Furthermore, once the connection is established, communications are @dfn{synchronous}.@footnote{For the technically savvy, data reads block---if there's no incoming data, the program is made to wait until there is, instead of receiving a ``there's no data'' error return.} I.e., each end waits on the other to finish transmitting, before replying. This is much like two people in a phone conversation. While both could talk simultaneously, doing so usually doesn't work too well. In the case of TCP, the synchronicity is enforced by the protocol when sending data. Data writes @dfn{block} until the data have been received on the other end. For both TCP and UDP, data reads block until there is incoming data waiting to be read. This is summarized in the following table, where an ``X'' indicates that the given action blocks. @ifnottex @multitable {Protocol} {Reads} {Writes} @item TCP @tab X @tab X @item UDP @tab X @tab @end multitable @end ifnottex @tex \centerline{ \vbox{\bigskip % space above the table (about 1 linespace) % Because we have vertical rules, we can't let TeX insert interline space % in its usual way. \offinterlineskip \halign{\hfil\strut# &\vrule #& \hfil#\hfil& \hfil#\hfil\cr Protocol&&\quad Reads\quad &Writes\cr \noalign{\hrule} \omit&height 2pt\cr \noalign{\hrule height0pt}% without this the rule does not extend; why? TCP&&X&X\cr UDP&&X&\cr }}} @end tex @node Using Networking, Some Applications and Techniques, Introduction, Top @comment node-name, next, previous, up @chapter Networking With @command{gawk} @c STARTOFRANGE netgawk @cindex networks, @command{gawk} and @c STARTOFRANGE gawknet @cindex @command{gawk}, networking The @command{awk} programming language was originally developed as a pattern-matching language for writing short programs to perform data manipulation tasks. @command{awk}'s strength is the manipulation of textual data that is stored in files. It was never meant to be used for networking purposes. To exploit its features in a networking context, it's necessary to use an access mode for network connections that resembles the access of files as closely as possible. @cindex Perl @cindex Python @cindex Tcl/Tk @command{awk} is also meant to be a prototyping language. It is used to demonstrate feasibility and to play with features and user interfaces. This can be done with file-like handling of network connections. @command{gawk} trades the lack of many of the advanced features of the TCP/IP family of protocols for the convenience of simple connection handling. The advanced features are available when programming in C or Perl. In fact, the network programming in this @value{CHAPTER} is very similar to what is described in books such as @cite{Internet Programming with Python}, @cite{Advanced Perl Programming}, or @cite{Web Client Programming with Perl}. @cindex Perl, @command{gawk} networking and @cindex Python, @command{gawk} networking and @cindex Tcl/Tk, @command{gawk} and However, you can do the programming here without first having to learn object-oriented ideology; underlying languages such as Tcl/Tk, Perl, Python; or all of the libraries necessary to extend these languages before they are ready for the Internet. @cindex Transmission Control Protocol, See TCP @cindex TCP (Transmission Control Protocol) This @value{CHAPTER} demonstrates how to use the TCP protocol. The UDP protocol is much less important for most users. @menu * Gawk Special Files:: How to do @command{gawk} networking. * TCP Connecting:: Making a TCP connection. * Troubleshooting:: Troubleshooting TCP/IP connections. * Interacting:: Interacting with a service. * Setting Up:: Setting up a service. * Email:: Reading email. * Web page:: Reading a Web page. * Primitive Service:: A primitive Web service. * Interacting Service:: A Web service with interaction. * Simple Server:: A simple Web server. * Caveats:: Network programming caveats. * Challenges:: Where to go from here. @end menu @node Gawk Special Files, TCP Connecting, Using Networking, Using Networking @comment node-name, next, previous, up @section @command{gawk}'s Networking Mechanisms The @samp{|&} operator for use in communicating with a @dfn{coprocess} is described in @ref{Two-way I/O, ,Two-way Communications With Another Process, gawk, GAWK: Effective AWK Programming}. It shows how to do two-way I/O to a separate process, sending it data with @code{print} or @code{printf} and reading data with @code{getline}. If you haven't read it already, you should detour there to do so. @command{gawk} transparently extends the two-way I/O mechanism to simple networking through the use of special @value{FN}s. When a ``coprocess'' that matches the special files we are about to describe is started, @command{gawk} creates the appropriate network connection, and then two-way I/O proceeds as usual. @c last comma is part of see-also @cindex input/output, two-way, See Also @command{gawk}, networking @cindex TCP/IP, sockets and At the C, C++, and Perl level, networking is accomplished via @dfn{sockets}, an Application Programming Interface (API) originally developed at the University of California at Berkeley that is now used almost universally for TCP/IP networking. Socket level programming, while fairly straightforward, requires paying attention to a number of details, as well as using binary data. It is not well-suited for use from a high-level language like @command{awk}. The special files provided in @command{gawk} hide the details from the programmer, making things much simpler and easier to use. @c Who sez we can't toot our own horn occasionally? @c STARTOFRANGE filenet @cindex filenames, for network access @c STARTOFRANGE gawnetf @cindex @command{gawk}, networking, filenames @c STARTOFRANGE netgawf @cindex networks, @command{gawk} and, filenames The special @value{FN} for network access is made up of several fields, all of which are mandatory: @example /@var{net-type}/@var{protocol}/@var{localport}/@var{hostname}/@var{remoteport} @end example @cindex @code{/inet/} files (@command{gawk}) @cindex files, @code{/inet/} (@command{gawk}) @cindex localport field @cindex remoteport field The @var{net-type} field lets you specify IPv4 versus IPv6, or lets you allow the system to choose. @menu * Special File Fields:: The fields in the special file name. * Comparing Protocols:: Differences between the protocols. @end menu @node Special File Fields, Comparing Protocols, Gawk Special Files, Gawk Special Files @subsection The Fields of the Special @value{FFN} This @value{SECTION} explains the meaning of all the other fields, as well as the range of values and the defaults. All of the fields are mandatory. To let the system pick a value, or if the field doesn't apply to the protocol, specify it as @samp{0}: @table @var @cindex network type field @c last comma is part of secondary @cindex TCP/IP, network type, selecting @item net-type This is one of @samp{inet4} for IPv4, @samp{inet6} for IPv6, or @samp{inet} to use the system default (which is likely to be IPv4). For the rest of this document, we will use the generic @samp{/inet} in our descriptions of how @command{gawk}'s networking works. @cindex protocol field @c last comma is part of secondary @cindex TCP/IP, protocols, selecting @item protocol Determines which member of the TCP/IP family of protocols is selected to transport the data across the network. There are two possible values (always written in lowercase): @samp{tcp} and @samp{udp}. The exact meaning of each is explained later in this @value{SECTION}. @item localport @cindex networks, ports, specifying Determines which port on the local machine is used to communicate across the network. Application-level clients usually use @samp{0} to indicate they do not care which local port is used---instead they specify a remote port to connect to. It is vital for application-level servers to use a number different from @samp{0} here because their service has to be available at a specific publicly known port number. It is possible to use a name from @file{/etc/services} here. @item hostname @cindex hostname field @cindex servers, as hosts Determines which remote host is to be at the other end of the connection. Application-level servers must fill this field with a @samp{0} to indicate their being open for all other hosts to connect to them and enforce connection level server behavior this way. It is not possible for an application-level server to restrict its availability to one remote host by entering a host name here. Application-level clients must enter a name different from @samp{0}. The name can be either symbolic (e.g., @samp{jpl-devvax.jpl.nasa.gov}) or numeric (e.g., @samp{128.149.1.143}). @item remoteport Determines which port on the remote machine is used to communicate across the network. For @file{/inet/tcp} and @file{/inet/udp}, application-level clients @emph{must} use a number other than @samp{0} to indicate to which port on the remote machine they want to connect. Application-level servers must not fill this field with a @samp{0}. Instead they specify a local port to which clients connect. It is possible to use a name from @file{/etc/services} here. @end table @cindex networks, @command{gawk} and, connections @cindex @command{gawk}, networking, connections Experts in network programming will notice that the usual client/server asymmetry found at the level of the socket API is not visible here. This is for the sake of simplicity of the high-level concept. If this asymmetry is necessary for your application, use another language. For @command{gawk}, it is more important to enable users to write a client program with a minimum of code. What happens when first accessing a network connection is seen in the following pseudocode: @smallexample if ((name of remote host given) && (other side accepts connection)) @{ rendez-vous successful; transmit with getline or print @} else @{ if ((other side did not accept) && (localport == 0)) exit unsuccessful if (TCP) @{ set up a server accepting connections this means waiting for the client on the other side to connect @} else ready @} @end smallexample The exact behavior of this algorithm depends on the values of the fields of the special @value{FN}. When in doubt, @ref{table-inet-components} gives you the combinations of values and their meaning. If this table is too complicated, focus on the three lines printed in @strong{bold}. All the examples in @ref{Using Networking, ,Networking With @command{gawk}}, use only the patterns printed in bold letters. @float Table,table-inet-components @caption{/inet Special File Components} @multitable @columnfractions .15 .15 .15 .15 .40 @headitem @sc{protocol} @tab @sc{local port} @tab @sc{host name} @tab @sc{remote port} @tab @sc{Resulting connection-level behavior} @item @strong{tcp} @tab @strong{0} @tab @strong{x} @tab @strong{x} @tab @strong{Dedicated client, fails if immediately connecting to a server on the other side fails} @item udp @tab 0 @tab x @tab x @tab Dedicated client @item @strong{tcp, udp} @tab @strong{x} @tab @strong{x} @tab @strong{x} @tab @strong{Client, switches to dedicated server if necessary} @item @strong{tcp, udp} @tab @strong{x} @tab @strong{0} @tab @strong{0} @tab @strong{Dedicated server} @item tcp, udp @tab x @tab x @tab 0 @tab Invalid @item tcp, udp @tab 0 @tab 0 @tab x @tab Invalid @item tcp, udp @tab x @tab 0 @tab x @tab Invalid @item tcp, udp @tab 0 @tab 0 @tab 0 @tab Invalid @item tcp, udp @tab 0 @tab x @tab 0 @tab Invalid @end multitable @end float In general, TCP is the preferred mechanism to use. It is the simplest protocol to understand and to use. Use UDP only if circumstances demand low-overhead. @node Comparing Protocols, , Special File Fields, Gawk Special Files @subsection Comparing Protocols This @value{SECTION} develops a pair of programs (sender and receiver) that do nothing but send a timestamp from one machine to another. The sender and the receiver are implemented with each of the two protocols available and demonstrate the differences between them. @menu * File /inet/tcp:: The TCP special file. * File /inet/udp:: The UDP special file. @end menu @node File /inet/tcp, File /inet/udp, Comparing Protocols, Comparing Protocols @subsubsection @file{/inet/tcp} @cindex @code{/inet/tcp} special files (@command{gawk}) @cindex files, @code{/inet/tcp} (@command{gawk}) @cindex TCP (Transmission Control Protocol) Once again, always use TCP. (Use UDP when low overhead is a necessity, and use RAW for network experimentation.) The first example is the sender program: @example # Server BEGIN @{ print strftime() |& "/inet/tcp/8888/0/0" close("/inet/tcp/8888/0/0") @} @end example The receiver is very simple: @example # Client BEGIN @{ "/inet/tcp/0/localhost/8888" |& getline print $0 close("/inet/tcp/0/localhost/8888") @} @end example TCP guarantees that the bytes arrive at the receiving end in exactly the same order that they were sent. No byte is lost (except for broken connections), doubled, or out of order. Some overhead is necessary to accomplish this, but this is the price to pay for a reliable service. It does matter which side starts first. The sender/server has to be started first, and it waits for the receiver to read a line. @node File /inet/udp, , File /inet/tcp, Comparing Protocols @subsubsection @file{/inet/udp} @cindex @code{/inet/udp} special files (@command{gawk}) @cindex files, @code{/inet/udp} (@command{gawk}) @cindex UDP (User Datagram Protocol) @cindex User Datagram Protocol, See UDP The server and client programs that use UDP are almost identical to their TCP counterparts; only the @var{protocol} has changed. As before, it does matter which side starts first. The receiving side blocks and waits for the sender. In this case, the receiver/client has to be started first: @example # Server BEGIN @{ print strftime() |& "/inet/udp/8888/0/0" close("/inet/udp/8888/0/0") @} @end example The receiver is almost identical to the TCP receiver: @example # Client BEGIN @{ "/inet/udp/0/localhost/8888" |& getline print $0 close("/inet/udp/0/localhost/8888") @} @end example UDP cannot guarantee that the datagrams at the receiving end will arrive in exactly the same order they were sent. Some datagrams could be lost, some doubled, and some out of order. But no overhead is necessary to accomplish this. This unreliable behavior is good enough for tasks such as data acquisition, logging, and even stateless services like NFS. @node TCP Connecting, Troubleshooting, Gawk Special Files, Using Networking @section Establishing a TCP Connection @c STARTOFRANGE tcpcon @cindex TCP (Transmission Control Protocol), connection, establishing @c STARTOFRANGE netcon @cindex networks, @command{gawk} and, connections @c STARTOFRANGE gawcon @cindex @command{gawk}, networking, connections Let's observe a network connection at work. Type in the following program and watch the output. Within a second, it connects via TCP (@file{/inet/tcp}) to the machine it is running on (@samp{localhost}) and asks the service @samp{daytime} on the machine what time it is: @cindex @code{getline} command @example BEGIN @{ "/inet/tcp/0/localhost/daytime" |& getline print $0 close("/inet/tcp/0/localhost/daytime") @} @end example Even experienced @command{awk} users will find the second line strange in two respects: @itemize @bullet @item A special file is used as a shell command that pipes its output into @code{getline}. One would rather expect to see the special file being read like any other file (@samp{getline < "/inet/tcp/0/localhost/daytime")}. @item @cindex @code{|} (vertical bar), @code{|&} operator (I/O) @cindex vertical bar (@code{|}), @code{|&} operator (I/O) The operator @samp{|&} has not been part of any @command{awk} implementation (until now). It is actually the only extension of the @command{awk} language needed (apart from the special files) to introduce network access. @end itemize @cindex pipes, networking and The @samp{|&} operator was introduced in @command{gawk} 3.1 in order to overcome the crucial restriction that access to files and pipes in @command{awk} is always unidirectional. It was formerly impossible to use both access modes on the same file or pipe. Instead of changing the whole concept of file access, the @samp{|&} operator behaves exactly like the usual pipe operator except for two additions: @itemize @bullet @item Normal shell commands connected to their @command{gawk} program with a @samp{|&} pipe can be accessed bidirectionally. The @samp{|&} turns out to be a quite general, useful, and natural extension of @command{awk}. @item Pipes that consist of a special @value{FN} for network connections are not executed as shell commands. Instead, they can be read and written to, just like a full-duplex network connection. @end itemize In the earlier example, the @samp{|&} operator tells @code{getline} to read a line from the special file @file{/inet/tcp/0/localhost/daytime}. We could also have printed a line into the special file. But instead we just read a line with the time, printed it, and closed the connection. (While we could just let @command{gawk} close the connection by finishing the program, in this @value{DOCUMENT} we are pedantic and always explicitly close the connections.) @node Troubleshooting, Interacting, TCP Connecting, Using Networking @section Troubleshooting Connection Problems @cindex advanced features, network connections @c last comma is part of secondary @cindex troubleshooting, networks, connections It may well be that for some reason the program shown in the previous example does not run on your machine. When looking at possible reasons for this, you will learn much about typical problems that arise in network programming. First of all, your implementation of @command{gawk} may not support network access because it is a pre-3.1 version or you do not have a network interface in your machine. Perhaps your machine uses some other protocol, such as DECnet or Novell's IPX. For the rest of this @value{CHAPTER}, we will assume you work on a Unix machine that supports TCP/IP. If the previous example program does not run on your machine, it may help to replace the name @samp{localhost} with the name of your machine or its IP address. If it does, you could replace @samp{localhost} with the name of another machine in your vicinity---this way, the program connects to another machine. Now you should see the date and time being printed by the program, otherwise your machine may not support the @samp{daytime} service. Try changing the service to @samp{chargen} or @samp{ftp}. This way, the program connects to other services that should give you some response. If you are curious, you should have a look at your @file{/etc/services} file. It could look like this: @ignore @multitable {1234567890123} {1234567890123} {123456789012345678901234567890123456789012} @item Service @strong{name} @tab Service @strong{number} @item echo @tab 7/tcp @tab echo sends back each line it receives @item echo @tab 7/udp @tab echo is good for testing purposes @item discard @tab 9/tcp @tab discard behaves like @file{/dev/null} @item discard @tab 9/udp @tab discard just throws away each line @item daytime @tab 13/tcp @tab daytime sends date & time once per connection @item daytime @tab 13/udp @item chargen @tab 19/tcp @tab chargen infinitely produces character sets @item chargen @tab 19/udp @tab chargen is good for testing purposes @item ftp @tab 21/tcp @tab ftp is the usual file transfer protocol @item telnet @tab 23/tcp @tab telnet is the usual login facility @item smtp @tab 25/tcp @tab smtp is the Simple Mail Transfer Protocol @item finger @tab 79/tcp @tab finger tells you who is logged in @item www @tab 80/tcp @tab www is the HyperText Transfer Protocol @item pop2 @tab 109/tcp @tab pop2 is an older version of pop3 @item pop2 @tab 109/udp @item pop3 @tab 110/tcp @tab pop3 is the Post Office Protocol @item pop3 @tab 110/udp @tab pop3 is used for receiving email @item nntp @tab 119/tcp @tab nntp is the USENET News Transfer Protocol @item irc @tab 194/tcp @tab irc is the Internet Relay Chat @item irc @tab 194/udp @end multitable @end ignore @smallexample # /etc/services: # # Network services, Internet style # # Name Number/Protocol Alternate name # Comments echo 7/tcp echo 7/udp discard 9/tcp sink null discard 9/udp sink null daytime 13/tcp daytime 13/udp chargen 19/tcp ttytst source chargen 19/udp ttytst source ftp 21/tcp telnet 23/tcp smtp 25/tcp mail finger 79/tcp www 80/tcp http # WorldWideWeb HTTP www 80/udp # HyperText Transfer Protocol pop-2 109/tcp postoffice # POP version 2 pop-2 109/udp pop-3 110/tcp # POP version 3 pop-3 110/udp nntp 119/tcp readnews untp # USENET News irc 194/tcp # Internet Relay Chat irc 194/udp @dots{} @end smallexample @cindex Linux @cindex GNU/Linux @cindex Microsoft Windows, networking Here, you find a list of services that traditional Unix machines usually support. If your GNU/Linux machine does not do so, it may be that these services are switched off in some startup script. Systems running some flavor of Microsoft Windows usually do @emph{not} support these services. Nevertheless, it @emph{is} possible to do networking with @command{gawk} on Microsoft Windows.@footnote{Microsoft preferred to ignore the TCP/IP family of protocols until 1995. Then came the rise of the Netscape browser as a landmark ``killer application.'' Microsoft added TCP/IP support and their own browser to Microsoft Windows 95 at the last minute. They even back-ported their TCP/IP implementation to Microsoft Windows for Workgroups 3.11, but it was a rather rudimentary and half-hearted implementation. Nevertheless, the equivalent of @file{/etc/services} resides under @file{C:\WINNT\system32\drivers\etc\services} on Microsoft Windows 2000 and Microsoft Windows XP.} The first column of the file gives the name of the service, and the second column gives a unique number and the protocol that one can use to connect to this service. The rest of the line is treated as a comment. You see that some services (@samp{echo}) support TCP as well as UDP. @node Interacting, Setting Up, Troubleshooting, Using Networking @section Interacting with a Network Service The next program makes use of the possibility to really interact with a network service by printing something into the special file. It asks the so-called @command{finger} service if a user of the machine is logged in. When testing this program, try to change @samp{localhost} to some other machine name in your local network: @c system if test ! -d eg ; then mkdir eg ; fi @c system if test ! -d eg/network ; then mkdir eg/network ; fi @example @c file eg/network/fingerclient.awk BEGIN @{ NetService = "/inet/tcp/0/localhost/finger" print "@var{name}" |& NetService while ((NetService |& getline) > 0) print $0 close(NetService) @} @c endfile @end example After telling the service on the machine which user to look for, the program repeatedly reads lines that come as a reply. When no more lines are coming (because the service has closed the connection), the program also closes the connection. Try replacing @code{"@var{name}"} with your login name (or the name of someone else logged in). For a list of all users currently logged in, replace @var{name} with an empty string (@code{""}). @cindex Linux @cindex GNU/Linux The final @code{close} command could be safely deleted from the above script, because the operating system closes any open connection by default when a script reaches the end of execution. In order to avoid portability problems, it is best to always close connections explicitly. With the Linux kernel, for example, proper closing results in flushing of buffers. Letting the close happen by default may result in discarding buffers. @ignore @c Chuck comments that this seems out of place. He's right. I dunno @c where to put it though. @cindex @command{finger} utility @cindex RFC 1288 In the early days of the Internet (up until about 1992), you could use such a program to check if some user in another country was logged in on a specific machine. RFC 1288@footnote{@uref{http://www.cis.ohio-state.edu/htbin/rfc/rfc1288.html}} provides the exact definition of the @command{finger} protocol. Every contemporary Unix system also has a command named @command{finger}, which functions as a client for the protocol of the same name. Still today, some people maintain simple information systems with this ancient protocol. For example, by typing @samp{finger quake@@seismo.unr.edu} you get the latest @dfn{Earthquake Bulletin} for the state of Nevada. @cindex Earthquake Bulletin @smallexample $ finger quake@@seismo.unr.edu [@dots{}] DATE-(UTC)-TIME LAT LON DEP MAG COMMENTS yy/mm/dd hh:mm:ss deg. deg. km 98/12/14 21:09:22 37.47N 116.30W 0.0 2.3Md 76.4 km S of WARM SPRINGS, NEVA 98/12/14 22:05:09 39.69N 120.41W 11.9 2.1Md 53.8 km WNW of RENO, NEVADA 98/12/15 14:14:19 38.04N 118.60W 2.0 2.3Md 51.0 km S of HAWTHORNE, NEVADA 98/12/17 01:49:02 36.06N 117.58W 13.9 3.0Md 74.9 km SE of LONE PINE, CALIFOR 98/12/17 05:39:26 39.95N 120.87W 6.2 2.6Md 101.6 km WNW of RENO, NEVADA 98/12/22 06:07:42 38.68N 119.82W 5.2 2.3Md 50.7 km S of CARSON CITY, NEVAD @end smallexample @noindent This output from @command{finger} contains the time, location, depth, magnitude, and a short comment about the earthquakes registered in that region during the last 10 days. In many places today the use of such services is restricted because most networks have firewalls and proxy servers between them and the Internet. Most firewalls are programmed to not let @command{finger} requests go beyond the local network. @cindex Coke machine Another (ab)use of the @command{finger} protocol are several Coke machines that are connected to the Internet. There is a short list of such Coke machines.@footnote{@uref{http://ca.yahoo.com/Computers_and_Internet/Internet/Devices_Connected_to_the_Internet/Soda_Machines/}} You can access them either from the command-line or with a simple @command{gawk} script. They usually tell you about the different flavors of Coke and beer available there. If you have an account there, you can even order some drink this way. @end ignore When looking at @file{/etc/services} you may have noticed that the @samp{daytime} service is also available with @samp{udp}. In the earlier example, change @samp{tcp} to @samp{udp}, and change @samp{finger} to @samp{daytime}. After starting the modified program, you see the expected day and time message. The program then hangs, because it waits for more lines coming from the service. However, they never come. This behavior is a consequence of the differences between TCP and UDP. When using UDP, neither party is automatically informed about the other closing the connection. Continuing to experiment this way reveals many other subtle differences between TCP and UDP. To avoid such trouble, one should always remember the advice Douglas E.@: Comer and David Stevens give in Volume III of their series @cite{Internetworking With TCP} (page 14): @cindex TCP (Transmission Control Protocol), UDP and @cindex UDP (User Datagram Protocol), TCP and @cindex Internet, See networks @quotation When designing client-server applications, beginners are strongly advised to use TCP because it provides reliable, connection-oriented communication. Programs only use UDP if the application protocol handles reliability, the application requires hardware broadcast or multicast, or the application cannot tolerate virtual circuit overhead. @end quotation @node Setting Up, Email, Interacting, Using Networking @section Setting Up a Service @c last comma is part of tertiary @cindex networks, @command{gawk} and, service, establishing @c last comma is part of tertiary @cindex @command{gawk}, networking, service, establishing The preceding programs behaved as clients that connect to a server somewhere on the Internet and request a particular service. Now we set up such a service to mimic the behavior of the @samp{daytime} service. Such a server does not know in advance who is going to connect to it over the network. Therefore, we cannot insert a name for the host to connect to in our special @value{FN}. Start the following program in one window. Notice that the service does not have the name @samp{daytime}, but the number @samp{8888}. From looking at @file{/etc/services}, you know that names like @samp{daytime} are just mnemonics for predetermined 16-bit integers. Only the system administrator (@code{root}) could enter our new service into @file{/etc/services} with an appropriate name. Also notice that the service name has to be entered into a different field of the special @value{FN} because we are setting up a server, not a client: @cindex @command{finger} utility @cindex servers @example BEGIN @{ print strftime() |& "/inet/tcp/8888/0/0" close("/inet/tcp/8888/0/0") @} @end example Now open another window on the same machine. Copy the client program given as the first example (@pxref{TCP Connecting, ,Establishing a TCP Connection}) to a new file and edit it, changing the name @samp{daytime} to @samp{8888}. Then start the modified client. You should get a reply like this: @example Sat Sep 27 19:08:16 CEST 1997 @end example @noindent Both programs explicitly close the connection. @c first comma is part of primary @cindex Microsoft Windows, networking, ports @cindex networks, ports, reserved @cindex Unix, network ports and Now we will intentionally make a mistake to see what happens when the name @samp{8888} (the so-called port) is already used by another service. Start the server program in both windows. The first one works, but the second one complains that it could not open the connection. Each port on a single machine can only be used by one server program at a time. Now terminate the server program and change the name @samp{8888} to @samp{echo}. After restarting it, the server program does not run any more, and you know why: there is already an @samp{echo} service running on your machine. But even if this isn't true, you would not get your own @samp{echo} server running on a Unix machine, because the ports with numbers smaller than 1024 (@samp{echo} is at port 7) are reserved for @code{root}. On machines running some flavor of Microsoft Windows, there is no restriction that reserves ports 1 to 1024 for a privileged user; hence, you can start an @samp{echo} server there. Turning this short server program into something really useful is simple. Imagine a server that first reads a @value{FN} from the client through the network connection, then does something with the file and sends a result back to the client. The server-side processing could be: @example BEGIN @{ NetService = "/inet/tcp/8888/0/0" NetService |& getline CatPipe = ("cat " $1) # sets $0 and the fields while ((CatPipe | getline) > 0) print $0 |& NetService close(NetService) @} @end example @noindent and we would have a remote copying facility. Such a server reads the name of a file from any client that connects to it and transmits the contents of the named file across the net. The server-side processing could also be the execution of a command that is transmitted across the network. From this example, you can see how simple it is to open up a security hole on your machine. If you allow clients to connect to your machine and execute arbitrary commands, anyone would be free to do @samp{rm -rf *}. @node Email, Web page, Setting Up, Using Networking @section Reading Email @c @cindex RFC 1939 @c @cindex RFC 821 @cindex @command{gawk}, networking, See Also email @cindex networks, @command{gawk} and, See Also email @cindex POP (Post Office Protocol) @cindex SMTP (Simple Mail Transfer Protocol) @cindex Post Office Protocol (POP) @cindex Simple Mail Transfer Protocol (SMTP) The distribution of email is usually done by dedicated email servers that communicate with your machine using special protocols. To receive email, we will use the Post Office Protocol (POP). Sending can be done with the much older Simple Mail Transfer Protocol (SMTP). @ignore @footnote{RFC 1939 defines POP. RFC 821 defines SMTP. See @uref{http://rfc.fh-koeln.de/doc/rfc/html/rfc.html, RFCs in HTML}.} @end ignore @cindex email When you type in the following program, replace the @var{emailhost} by the name of your local email server. Ask your administrator if the server has a POP service, and then use its name or number in the program below. Now the program is ready to connect to your email server, but it will not succeed in retrieving your mail because it does not yet know your login name or password. Replace them in the program and it shows you the first email the server has in store: @example BEGIN @{ POPService = "/inet/tcp/0/@var{emailhost}/pop3" RS = ORS = "\r\n" print "user @var{name}" |& POPService POPService |& getline print "pass @var{password}" |& POPService POPService |& getline print "retr 1" |& POPService POPService |& getline if ($1 != "+OK") exit print "quit" |& POPService RS = "\r\n\\.\r\n" POPService |& getline print $0 close(POPService) @} @end example @c @cindex RFC 1939 @cindex record separators, POP and @cindex @code{RS} variable, POP and @cindex @code{ORS} variable, POP and @cindex POP (Post Office Protocol) The record separators @code{RS} and @code{ORS} are redefined because the protocol (POP) requires CR-LF to separate lines. After identifying yourself to the email service, the command @samp{retr 1} instructs the service to send the first of all your email messages in line. If the service replies with something other than @samp{+OK}, the program exits; maybe there is no email. Otherwise, the program first announces that it intends to finish reading email, and then redefines @code{RS} in order to read the entire email as multiline input in one record. From the POP RFC, we know that the body of the email always ends with a single line containing a single dot. The program looks for this using @samp{RS = "\r\n\\.\r\n"}. When it finds this sequence in the mail message, it quits. You can invoke this program as often as you like; it does not delete the message it reads, but instead leaves it on the server. @node Web page, Primitive Service, Email, Using Networking @section Reading a Web Page @cindex web pages @cindex HTTP (Hypertext Transfer Protocol) @cindex Hypertext Transfer Protocol, See HTTP @c @cindex RFC 2068 @c @cindex RFC 2616 Retrieving a web page from a web server is as simple as retrieving email from an email server. We only have to use a similar, but not identical, protocol and a different port. The name of the protocol is HyperText Transfer Protocol (HTTP) and the port number is usually 80. As in the preceding @value{SECTION}, ask your administrator about the name of your local web server or proxy web server and its port number for HTTP requests. @ignore @c Chuck says this stuff isn't necessary More detailed information about HTTP can be found at the home of the web protocols,@footnote{@uref{http://www.w3.org/pub/WWW/Protocols}} including the specification of HTTP in RFC 2068. The protocol specification in RFC 2068 is concise and you can get it for free. If you need more explanation and you are willing to pay for a book, you might be interested in one of these books: @enumerate @item When we started writing web clients and servers with @command{gawk}, the only book available with details about HTTP was the one by Paul Hethmon called @cite{Illustrated Guide to HTTP}.@footnote{@uref{http://www.browsebooks.com/Hethmon/?882}} Hethmon not only describes HTTP, he also implements a simple web server in C++. @item Since July 2000, O'Reilly offers the book by Clinton Wong called @cite{HTTP Pocket Reference}.@footnote{@uref{http://www.oreilly.com/catalog/httppr}} It only has 75 pages but its focus definitely is HTTP. This pocket reference is not a replacement for the RFC, but I wish I had had it back in 1997 when I started writing scripts to handle HTTP. @item Another small booklet about HTTP is the one by Toexcell Incorporated Staff, ISBN 1-58348-270-9, called @cite{Hypertext Transfer Protocol Http 1.0 Specifications} @end enumerate @end ignore The following program employs a rather crude approach toward retrieving a web page. It uses the prehistoric syntax of HTTP 0.9, which almost all web servers still support. The most noticeable thing about it is that the program directs the request to the local proxy server whose name you insert in the special @value{FN} (which in turn calls @samp{www.yahoo.com}): @example BEGIN @{ RS = ORS = "\r\n" HttpService = "/inet/tcp/0/@var{proxy}/80" print "GET http://www.yahoo.com" |& HttpService while ((HttpService |& getline) > 0) print $0 close(HttpService) @} @end example @c @cindex RFC 1945 @cindex record separators, HTTP and @cindex @code{RS} variable, HTTP and @cindex @code{ORS} variable, HTTP and @cindex HTTP (Hypertext Transfer Protocol), record separators and @cindex HTML (Hypertext Markup Language) @cindex Hypertext Markup Language (HTML) Again, lines are separated by a redefined @code{RS} and @code{ORS}. The @code{GET} request that we send to the server is the only kind of HTTP request that existed when the web was created in the early 1990s. HTTP calls this @code{GET} request a ``method,'' which tells the service to transmit a web page (here the home page of the Yahoo! search engine). Version 1.0 added the request methods @code{HEAD} and @code{POST}. The current version of HTTP is 1.1,@footnote{Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was initially specified in RFC 2068. In June 1999, RFC 2068 was made obsolete by RFC 2616, an update without any substantial changes.} and knows the additional request methods @code{OPTIONS}, @code{PUT}, @code{DELETE}, and @code{TRACE}. You can fill in any valid web address, and the program prints the HTML code of that page to your screen. Notice the similarity between the responses of the POP and HTTP services. First, you get a header that is terminated by an empty line, and then you get the body of the page in HTML. The lines of the headers also have the same form as in POP. There is the name of a parameter, then a colon, and finally the value of that parameter. @cindex CGI (Common Gateway Interface), dynamic web pages and @cindex Common Gateway Interface, See CGI @cindex GIF image format @cindex PNG image format @cindex images, retrieving over networks Images (@file{.png} or @file{.gif} files) can also be retrieved this way, but then you get binary data that should be redirected into a file. Another application is calling a CGI (Common Gateway Interface) script on some server. CGI scripts are used when the contents of a web page are not constant, but generated instantly at the moment you send a request for the page. For example, to get a detailed report about the current quotes of Motorola stock shares, call a CGI script at Yahoo! with the following: @example get = "GET http://quote.yahoo.com/q?s=MOT&d=t" print get |& HttpService @end example You can also request weather reports this way. @ignore @cindex Boutell, Thomas A good book to go on with is the @cite{HTML Source Book}.@footnote{@uref{http://www.utoronto.ca/webdocs/HTMLdocs/NewHTML/book.html}} There are also some books on CGI programming like @cite{CGI Programming in C & Perl}, by Thomas Boutell@footnote{@uref{http://cseng.aw.com/bookdetail.qry?ISBN=0-201-42219-0&ptype=0}}, and @cite{The CGI Book}.@footnote{@uref{http://www.cgibook.com}} Another good source is @cite{The CGI Resource Index}}.@footnote{@uref{http://www.cgi-resources.com}} @end ignore @node Primitive Service, Interacting Service, Web page, Using Networking @section A Primitive Web Service @c STARTOFRANGE webser @cindex web service Now we know enough about HTTP to set up a primitive web service that just says @code{"Hello, world"} when someone connects to it with a browser. Compared to the situation in the preceding @value{SECTION}, our program changes the role. It tries to behave just like the server we have observed. Since we are setting up a server here, we have to insert the port number in the @samp{localport} field of the special @value{FN}. The other two fields (@var{hostname} and @var{remoteport}) have to contain a @samp{0} because we do not know in advance which host will connect to our service. In the early 1990s, all a server had to do was send an HTML document and close the connection. Here, we adhere to the modern syntax of HTTP. The steps are as follows: @enumerate 1 @item Send a status line telling the web browser that everything is okay. @item Send a line to tell the browser how many bytes follow in the body of the message. This was not necessary earlier because both parties knew that the document ended when the connection closed. Nowadays it is possible to stay connected after the transmission of one web page. This is to avoid the network traffic necessary for repeatedly establishing TCP connections for requesting several images. Thus, there is the need to tell the receiving party how many bytes will be sent. The header is terminated as usual with an empty line. @item Send the @code{"Hello, world"} body in HTML. The useless @code{while} loop swallows the request of the browser. We could actually omit the loop, and on most machines the program would still work. First, start the following program: @end enumerate @example @c file eg/network/hello-serv.awk BEGIN @{ RS = ORS = "\r\n" HttpService = "/inet/tcp/8080/0/0" Hello = "" \ "A Famous Greeting" \ "

Hello, world

" Len = length(Hello) + length(ORS) print "HTTP/1.0 200 OK" |& HttpService print "Content-Length: " Len ORS |& HttpService print Hello |& HttpService while ((HttpService |& getline) > 0) continue; close(HttpService) @} @c endfile @end example Now, on the same machine, start your favorite browser and let it point to @uref{http://localhost:8080} (the browser needs to know on which port our server is listening for requests). If this does not work, the browser probably tries to connect to a proxy server that does not know your machine. If so, change the browser's configuration so that the browser does not try to use a proxy to connect to your machine. @node Interacting Service, Simple Server, Primitive Service, Using Networking @section A Web Service with Interaction @cindex @command{gawk}, web and, See web service @cindex web browsers, See web service @c comma is part of primary @cindex HTTP server, core logic @cindex servers, HTTP @ifinfo This node shows how to set up a simple web server. The subnode is a library file that we will use with all the examples in @ref{Some Applications and Techniques}. @end ifinfo @menu * CGI Lib:: A simple CGI library. @end menu Setting up a web service that allows user interaction is more difficult and shows us the limits of network access in @command{gawk}. In this @value{SECTION}, we develop a main program (a @code{BEGIN} pattern and its action) that will become the core of event-driven execution controlled by a graphical user interface (GUI). Each HTTP event that the user triggers by some action within the browser is received in this central procedure. Parameters and menu choices are extracted from this request, and an appropriate measure is taken according to the user's choice. For example: @cindex HTTP server, core logic @example BEGIN @{ if (MyHost == "") @{ "uname -n" | getline MyHost close("uname -n") @} if (MyPort == 0) MyPort = 8080 HttpService = "/inet/tcp/" MyPort "/0/0" MyPrefix = "http://" MyHost ":" MyPort SetUpServer() while ("awk" != "complex") @{ # header lines are terminated this way RS = ORS = "\r\n" Status = 200 # this means OK Reason = "OK" Header = TopHeader Document = TopDoc Footer = TopFooter if (GETARG["Method"] == "GET") @{ HandleGET() @} else if (GETARG["Method"] == "HEAD") @{ # not yet implemented @} else if (GETARG["Method"] != "") @{ print "bad method", GETARG["Method"] @} Prompt = Header Document Footer print "HTTP/1.0", Status, Reason |& HttpService print "Connection: Close" |& HttpService print "Pragma: no-cache" |& HttpService len = length(Prompt) + length(ORS) print "Content-length:", len |& HttpService print ORS Prompt |& HttpService # ignore all the header lines while ((HttpService |& getline) > 0) ; # stop talking to this client close(HttpService) # wait for new client request HttpService |& getline # do some logging print systime(), strftime(), $0 # read request parameters CGI_setup($1, $2, $3) @} @} @end example This web server presents menu choices in the form of HTML links. Therefore, it has to tell the browser the name of the host it is residing on. When starting the server, the user may supply the name of the host from the command line with @samp{gawk -v MyHost="Rumpelstilzchen"}. If the user does not do this, the server looks up the name of the host it is running on for later use as a web address in HTML documents. The same applies to the port number. These values are inserted later into the HTML content of the web pages to refer to the home system. Each server that is built around this core has to initialize some application-dependent variables (such as the default home page) in a procedure @code{SetUpServer}, which is called immediately before entering the infinite loop of the server. For now, we will write an instance that initiates a trivial interaction. With this home page, the client user can click on two possible choices, and receive the current date either in human-readable format or in seconds since 1970: @example function SetUpServer() @{ TopHeader = "" TopHeader = TopHeader \ "My name is GAWK, GNU AWK" TopDoc = "

\ Do you prefer your date human or \ POSIXed?

" ORS ORS TopFooter = "" @} @end example On the first run through the main loop, the default line terminators are set and the default home page is copied to the actual home page. Since this is the first run, @code{GETARG["Method"]} is not initialized yet, hence the case selection over the method does nothing. Now that the home page is initialized, the server can start communicating to a client browser. @c @cindex RFC 2068 It does so by printing the HTTP header into the network connection (@samp{print @dots{} |& HttpService}). This command blocks execution of the server script until a client connects. If this server script is compared with the primitive one we wrote before, you will notice two additional lines in the header. The first instructs the browser to close the connection after each request. The second tells the browser that it should never try to @emph{remember} earlier requests that had identical web addresses (no caching). Otherwise, it could happen that the browser retrieves the time of day in the previous example just once, and later it takes the web page from the cache, always displaying the same time of day although time advances each second. Having supplied the initial home page to the browser with a valid document stored in the parameter @code{Prompt}, it closes the connection and waits for the next request. When the request comes, a log line is printed that allows us to see which request the server receives. The final step in the loop is to call the function @code{CGI_setup}, which reads all the lines of the request (coming from the browser), processes them, and stores the transmitted parameters in the array @code{PARAM}. The complete text of these application-independent functions can be found in @ref{CGI Lib, ,A Simple CGI Library}. For now, we use a simplified version of @code{CGI_setup}: @example function CGI_setup( method, uri, version, i) @{ delete GETARG; delete MENU; delete PARAM GETARG["Method"] = $1 GETARG["URI"] = $2 GETARG["Version"] = $3 i = index($2, "?") # is there a "?" indicating a CGI request? @group if (i > 0) @{ split(substr($2, 1, i-1), MENU, "[/:]") split(substr($2, i+1), PARAM, "&") for (i in PARAM) @{ j = index(PARAM[i], "=") GETARG[substr(PARAM[i], 1, j-1)] = \ substr(PARAM[i], j+1) @} @} else @{ # there is no "?", no need for splitting PARAMs split($2, MENU, "[/:]") @} @end group @} @end example At first, the function clears all variables used for global storage of request parameters. The rest of the function serves the purpose of filling the global parameters with the extracted new values. To accomplish this, the name of the requested resource is split into parts and stored for later evaluation. If the request contains a @samp{?}, then the request has CGI variables seamlessly appended to the web address. Everything in front of the @samp{?} is split up into menu items, and everything behind the @samp{?} is a list of @samp{@var{variable}=@var{value}} pairs (separated by @samp{&}) that also need splitting. This way, CGI variables are isolated and stored. This procedure lacks recognition of special characters that are transmitted in coded form@footnote{As defined in RFC 2068.}. Here, any optional request header and body parts are ignored. We do not need header parameters and the request body. However, when refining our approach or working with the @code{POST} and @code{PUT} methods, reading the header and body becomes inevitable. Header parameters should then be stored in a global array as well as the body. On each subsequent run through the main loop, one request from a browser is received, evaluated, and answered according to the user's choice. This can be done by letting the value of the HTTP method guide the main loop into execution of the procedure @code{HandleGET}, which evaluates the user's choice. In this case, we have only one hierarchical level of menus, but in the general case, menus are nested. The menu choices at each level are separated by @samp{/}, just as in @value{FN}s. Notice how simple it is to construct menus of arbitrary depth: @example function HandleGET() @{ if ( MENU[2] == "human") @{ Footer = strftime() TopFooter @} else if (MENU[2] == "POSIX") @{ Footer = systime() TopFooter @} @} @end example The disadvantage of this approach is that our server is slow and can handle only one request at a time. Its main advantage, however, is that the server consists of just one @command{gawk} program. No need for installing an @command{httpd}, and no need for static separate HTML files, CGI scripts, or @code{root} privileges. This is rapid prototyping. This program can be started on the same host that runs your browser. Then let your browser point to @uref{http://localhost:8080}. @cindex XBM image format @cindex images, in web pages @cindex web pages, images in @cindex GNUPlot utility It is also possible to include images into the HTML pages. Most browsers support the not very well-known @file{.xbm} format, which may contain only monochrome pictures but is an ASCII format. Binary images are possible but not so easy to handle. Another way of including images is to generate them with a tool such as GNUPlot, by calling the tool with the @code{system} function or through a pipe. @node CGI Lib, , Interacting Service, Interacting Service @subsection A Simple CGI Library @quotation @i{HTTP is like being married: you have to be able to handle whatever you're given, while being very careful what you send back.}@* Phil Smith III,@* @uref{http://www.netfunny.com/rhf/jokes/99/Mar/http.html} @end quotation @c STARTOFRANGE cgilib @cindex CGI (Common Gateway Interface), library In @ref{Interacting Service, ,A Web Service with Interaction}, we saw the function @code{CGI_setup} as part of the web server ``core logic'' framework. The code presented there handles almost everything necessary for CGI requests. One thing it doesn't do is handle encoded characters in the requests. For example, an @samp{&} is encoded as a percent sign followed by the hexadecimal value: @samp{%26}. These encoded values should be decoded. Following is a simple library to perform these tasks. This code is used for all web server examples used throughout the rest of this @value{DOCUMENT}. If you want to use it for your own web server, store the source code into a file named @file{inetlib.awk}. Then you can include these functions into your code by placing the following statement into your program (on the first line of your script): @example @@include inetlib.awk @end example @noindent But beware, this mechanism is only possible if you invoke your web server script with @command{igawk} instead of the usual @command{awk} or @command{gawk}. Here is the code: @example @c file eg/network/coreserv.awk # CGI Library and core of a web server @c endfile @ignore @c file eg/network/coreserv.awk # # Juergen Kahrs, Juergen.Kahrs@@vr-web.de # with Arnold Robbins, arnold@@gnu.org # September 2000 @c endfile @end ignore @c file eg/network/coreserv.awk # Global arrays # GETARG --- arguments to CGI GET command # MENU --- menu items (path names) # PARAM --- parameters of form x=y # Optional variable MyHost contains host address # Optional variable MyPort contains port number # Needs TopHeader, TopDoc, TopFooter # Sets MyPrefix, HttpService, Status, Reason BEGIN @{ if (MyHost == "") @{ "uname -n" | getline MyHost close("uname -n") @} if (MyPort == 0) MyPort = 8080 HttpService = "/inet/tcp/" MyPort "/0/0" MyPrefix = "http://" MyHost ":" MyPort SetUpServer() while ("awk" != "complex") @{ # header lines are terminated this way RS = ORS = "\r\n" Status = 200 # this means OK Reason = "OK" Header = TopHeader Document = TopDoc Footer = TopFooter if (GETARG["Method"] == "GET") @{ HandleGET() @} else if (GETARG["Method"] == "HEAD") @{ # not yet implemented @} else if (GETARG["Method"] != "") @{ print "bad method", GETARG["Method"] @} Prompt = Header Document Footer print "HTTP/1.0", Status, Reason |& HttpService print "Connection: Close" |& HttpService print "Pragma: no-cache" |& HttpService len = length(Prompt) + length(ORS) print "Content-length:", len |& HttpService print ORS Prompt |& HttpService # ignore all the header lines while ((HttpService |& getline) > 0) continue # stop talking to this client close(HttpService) # wait for new client request HttpService |& getline # do some logging print systime(), strftime(), $0 CGI_setup($1, $2, $3) @} @} function CGI_setup( method, uri, version, i) @{ delete GETARG delete MENU delete PARAM GETARG["Method"] = method GETARG["URI"] = uri GETARG["Version"] = version i = index(uri, "?") if (i > 0) @{ # is there a "?" indicating a CGI request? split(substr(uri, 1, i-1), MENU, "[/:]") split(substr(uri, i+1), PARAM, "&") for (i in PARAM) @{ PARAM[i] = _CGI_decode(PARAM[i]) j = index(PARAM[i], "=") GETARG[substr(PARAM[i], 1, j-1)] = \ substr(PARAM[i], j+1) @} @} else @{ # there is no "?", no need for splitting PARAMs split(uri, MENU, "[/:]") @} for (i in MENU) # decode characters in path if (i > 4) # but not those in host name MENU[i] = _CGI_decode(MENU[i]) @} @c endfile @end example This isolates details in a single function, @code{CGI_setup}. Decoding of encoded characters is pushed off to a helper function, @code{_CGI_decode}. The use of the leading underscore (@samp{_}) in the function name is intended to indicate that it is an ``internal'' function, although there is nothing to enforce this: @example @c file eg/network/coreserv.awk function _CGI_decode(str, hexdigs, i, pre, code1, code2, val, result) @{ hexdigs = "123456789abcdef" i = index(str, "%") if (i == 0) # no work to do return str do @{ pre = substr(str, 1, i-1) # part before %xx code1 = substr(str, i+1, 1) # first hex digit code2 = substr(str, i+2, 1) # second hex digit str = substr(str, i+3) # rest of string code1 = tolower(code1) code2 = tolower(code2) val = index(hexdigs, code1) * 16 \ + index(hexdigs, code2) result = result pre sprintf("%c", val) i = index(str, "%") @} while (i != 0) if (length(str) > 0) result = result str return result @} @c endfile @end example This works by splitting the string apart around an encoded character. The two digits are converted to lowercase characters and looked up in a string of hex digits. Note that @code{0} is not in the string on purpose; @code{index} returns zero when it's not found, automatically giving the correct value! Once the hexadecimal value is converted from characters in a string into a numerical value, @code{sprintf} converts the value back into a real character. The following is a simple test harness for the above functions: @example @c file eg/network/testserv.awk BEGIN @{ CGI_setup("GET", "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \ "&percent=a %25 sign", "1.0") for (i in MENU) printf "MENU[\"%s\"] = %s\n", i, MENU[i] for (i in PARAM) printf "PARAM[\"%s\"] = %s\n", i, PARAM[i] for (i in GETARG) printf "GETARG[\"%s\"] = %s\n", i, GETARG[i] @} @c endfile @end example And this is the result when we run it: @c artificial line wrap in last output line @example $ gawk -f testserv.awk @print{} MENU["4"] = www.gnu.org @print{} MENU["5"] = cgi-bin @print{} MENU["6"] = foo @print{} MENU["1"] = http @print{} MENU["2"] = @print{} MENU["3"] = @print{} PARAM["1"] = p1=stuff @print{} PARAM["2"] = p2=stuff&junk @print{} PARAM["3"] = percent=a % sign @print{} GETARG["p1"] = stuff @print{} GETARG["percent"] = a % sign @print{} GETARG["p2"] = stuff&junk @print{} GETARG["Method"] = GET @print{} GETARG["Version"] = 1.0 @print{} GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff& p2=stuff%26junk&percent=a %25 sign @end example @node Simple Server, Caveats, Interacting Service, Using Networking @section A Simple Web Server @c STARTOFRANGE webserx @cindex web servers @c STARTOFRANGE serweb @cindex servers, web In the preceding @value{SECTION}, we built the core logic for event-driven GUIs. In this @value{SECTION}, we finally extend the core to a real application. No one would actually write a commercial web server in @command{gawk}, but it is instructive to see that it is feasible in principle. @cindex ELIZA program @cindex Weizenbaum, Joseph The application is ELIZA, the famous program by Joseph Weizenbaum that mimics the behavior of a professional psychotherapist when talking to you. Weizenbaum would certainly object to this description, but this is part of the legend around ELIZA. Take the site-independent core logic and append the following code: @example @c file eg/network/eliza.awk function SetUpServer() @{ SetUpEliza() TopHeader = \ "An HTTP-based System with GAWK\ \ " TopDoc = "\

Please choose one of the following actions:

\
" TopFooter = "" @} @c endfile @end example @code{SetUpServer} is similar to the previous example, except for calling another function, @code{SetUpEliza}. This approach can be used to implement other kinds of servers. The only changes needed to do so are hidden in the functions @code{SetUpServer} and @code{HandleGET}. Perhaps it might be necessary to implement other HTTP methods. The @command{igawk} program that comes with @command{gawk} may be useful for this process. When extending this example to a complete application, the first thing to do is to implement the function @code{SetUpServer} to initialize the HTML pages and some variables. These initializations determine the way your HTML pages look (colors, titles, menu items, etc.). The function @code{HandleGET} is a nested case selection that decides which page the user wants to see next. Each nesting level refers to a menu level of the GUI. Each case implements a certain action of the menu. On the deepest level of case selection, the handler essentially knows what the user wants and stores the answer into the variable that holds the HTML page contents: @smallexample @c file eg/network/eliza.awk function HandleGET() @{ # A real HTTP server would treat some parts of the URI as a file name. # We take parts of the URI as menu choices and go on accordingly. if(MENU[2] == "AboutServer") @{ Document = "This is not a CGI script.\ This is an httpd, an HTML file, and a CGI script all \ in one GAWK script. It needs no separate www-server, \ no installation, and no root privileges.\

To run it, do this:

    \
  • start this script with \"gawk -f httpserver.awk\",
  • \
  • and on the same host let your www browser open location\ \"http://localhost:8080\"
  • \
\

\ Details of HTTP come from:

    \
  • Hethmon: Illustrated Guide to HTTP

    \
  • RFC 2068

JK 14.9.1997

" @} else if (MENU[2] == "AboutELIZA") @{ Document = "This is an implementation of the famous ELIZA\ program by Joseph Weizenbaum. It is written in GAWK and\ uses an HTML GUI." @} else if (MENU[2] == "StartELIZA") @{ gsub(/\+/, " ", GETARG["YouSay"]) # Here we also have to substitute coded special characters Document = "
" \ "

" ElizaSays(GETARG["YouSay"]) "

\

\

" @} @} @c endfile @end smallexample Now we are down to the heart of ELIZA, so you can see how it works. Initially the user does not say anything; then ELIZA resets its money counter and asks the user to tell what comes to mind open heartedly. The subsequent answers are converted to uppercase characters and stored for later comparison. ELIZA presents the bill when being confronted with a sentence that contains the phrase ``shut up.'' Otherwise, it looks for keywords in the sentence, conjugates the rest of the sentence, remembers the keyword for later use, and finally selects an answer from the set of possible answers: @smallexample @c file eg/network/eliza.awk function ElizaSays(YouSay) @{ if (YouSay == "") @{ cost = 0 answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM" @} else @{ q = toupper(YouSay) gsub("'", "", q) if(q == qold) @{ answer = "PLEASE DONT REPEAT YOURSELF !" @} else @{ if (index(q, "SHUT UP") > 0) @{ answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\ int(100*rand()+30+cost/100) @} else @{ qold = q w = "-" # no keyword recognized yet for (i in k) @{ # search for keywords if (index(q, i) > 0) @{ w = i break @} @} if (w == "-") @{ # no keyword, take old subject w = wold subj = subjold @} else @{ # find subject subj = substr(q, index(q, w) + length(w)+1) wold = w subjold = subj # remember keyword and subject @} for (i in conj) gsub(i, conj[i], q) # conjugation # from all answers to this keyword, select one randomly answer = r[indices[int(split(k[w], indices) * rand()) + 1]] # insert subject into answer gsub("_", subj, answer) @} @} @} cost += length(answer) # for later payment : 1 cent per character return answer @} @c endfile @end smallexample In the long but simple function @code{SetUpEliza}, you can see tables for conjugation, keywords, and answers.@footnote{The version shown here is abbreviated. The full version comes with the @command{gawk} distribution.} The associative array @code{k} contains indices into the array of answers @code{r}. To choose an answer, ELIZA just picks an index randomly: @example @c file eg/network/eliza.awk function SetUpEliza() @{ srand() wold = "-" subjold = " " # table for conjugation conj[" ARE " ] = " AM " conj["WERE " ] = "WAS " conj[" YOU " ] = " I " conj["YOUR " ] = "MY " conj[" IVE " ] =\ conj[" I HAVE " ] = " YOU HAVE " conj[" YOUVE " ] =\ conj[" YOU HAVE "] = " I HAVE " conj[" IM " ] =\ conj[" I AM " ] = " YOU ARE " conj[" YOURE " ] =\ conj[" YOU ARE " ] = " I AM " # table of all answers r[1] = "DONT YOU BELIEVE THAT I CAN _" r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?" @c endfile @dots{} @end example @ignore @c file eg/network/eliza.awk r[3] = "YOU WANT ME TO BE ABLE TO _ ?" r[4] = "PERHAPS YOU DONT WANT TO _ " r[5] = "DO YOU WANT TO BE ABLE TO _ ?" r[6] = "WHAT MAKES YOU THINK I AM _ ?" r[7] = "DOES IT PLEASE YOU TO BELIEVE I AM _ ?" r[8] = "PERHAPS YOU WOULD LIKE TO BE _ ?" r[9] = "DO YOU SOMETIMES WISH YOU WERE _ ?" r[10] = "DONT YOU REALLY _ ?" r[11] = "WHY DONT YOU _ ?" r[12] = "DO YOU WISH TO BE ABLE TO _ ?" r[13] = "DOES THAT TROUBLE YOU ?" r[14] = "TELL ME MORE ABOUT SUCH FEELINGS" r[15] = "DO YOU OFTEN FEEL _ ?" r[16] = "DO YOU ENJOY FEELING _ ?" r[17] = "DO YOU REALLY BELIEVE I DONT _ ?" r[18] = "PERHAPS IN GOOD TIME I WILL _ " r[19] = "DO YOU WANT ME TO _ ?" r[20] = "DO YOU THINK YOU SHOULD BE ABLE TO _ ?" r[21] = "WHY CANT YOU _ ?" r[22] = "WHY ARE YOU INTERESTED IN WHETHER OR NOT I AM _ ?" r[23] = "WOULD YOU PREFER IF I WERE NOT _ ?" r[24] = "PERHAPS IN YOUR FANTASIES I AM _ " r[25] = "HOW DO YOU KNOW YOU CANT _ ?" r[26] = "HAVE YOU TRIED ?" r[27] = "PERHAPS YOU CAN NOW _ " r[28] = "DID YOU COME TO ME BECAUSE YOU ARE _ ?" r[29] = "HOW LONG HAVE YOU BEEN _ ?" r[30] = "DO YOU BELIEVE ITS NORMAL TO BE _ ?" r[31] = "DO YOU ENJOY BEING _ ?" r[32] = "WE WERE DISCUSSING YOU -- NOT ME" r[33] = "Oh, I _" r[34] = "YOU'RE NOT REALLY TALKING ABOUT ME, ARE YOU ?" r[35] = "WHAT WOULD IT MEAN TO YOU, IF YOU GOT _ ?" r[36] = "WHY DO YOU WANT _ ?" r[37] = "SUPPOSE YOU SOON GOT _" r[38] = "WHAT IF YOU NEVER GOT _ ?" r[39] = "I SOMETIMES ALSO WANT _" r[40] = "WHY DO YOU ASK ?" r[41] = "DOES THAT QUESTION INTEREST YOU ?" r[42] = "WHAT ANSWER WOULD PLEASE YOU THE MOST ?" r[43] = "WHAT DO YOU THINK ?" r[44] = "ARE SUCH QUESTIONS IN YOUR MIND OFTEN ?" r[45] = "WHAT IS IT THAT YOU REALLY WANT TO KNOW ?" r[46] = "HAVE YOU ASKED ANYONE ELSE ?" r[47] = "HAVE YOU ASKED SUCH QUESTIONS BEFORE ?" r[48] = "WHAT ELSE COMES TO MIND WHEN YOU ASK THAT ?" r[49] = "NAMES DON'T INTEREST ME" r[50] = "I DONT CARE ABOUT NAMES -- PLEASE GO ON" r[51] = "IS THAT THE REAL REASON ?" r[52] = "DONT ANY OTHER REASONS COME TO MIND ?" r[53] = "DOES THAT REASON EXPLAIN ANYTHING ELSE ?" r[54] = "WHAT OTHER REASONS MIGHT THERE BE ?" r[55] = "PLEASE DON'T APOLOGIZE !" r[56] = "APOLOGIES ARE NOT NECESSARY" r[57] = "WHAT FEELINGS DO YOU HAVE WHEN YOU APOLOGIZE ?" r[58] = "DON'T BE SO DEFENSIVE" r[59] = "WHAT DOES THAT DREAM SUGGEST TO YOU ?" r[60] = "DO YOU DREAM OFTEN ?" r[61] = "WHAT PERSONS APPEAR IN YOUR DREAMS ?" r[62] = "ARE YOU DISTURBED BY YOUR DREAMS ?" r[63] = "HOW DO YOU DO ... PLEASE STATE YOUR PROBLEM" r[64] = "YOU DON'T SEEM QUITE CERTAIN" r[65] = "WHY THE UNCERTAIN TONE ?" r[66] = "CAN'T YOU BE MORE POSITIVE ?" r[67] = "YOU AREN'T SURE ?" r[68] = "DON'T YOU KNOW ?" r[69] = "WHY NO _ ?" r[70] = "DON'T SAY NO, IT'S ALWAYS SO NEGATIVE" r[71] = "WHY NOT ?" r[72] = "ARE YOU SURE ?" r[73] = "WHY NO ?" r[74] = "WHY ARE YOU CONCERNED ABOUT MY _ ?" r[75] = "WHAT ABOUT YOUR OWN _ ?" r[76] = "CAN'T YOU THINK ABOUT A SPECIFIC EXAMPLE ?" r[77] = "WHEN ?" r[78] = "WHAT ARE YOU THINKING OF ?" r[79] = "REALLY, ALWAYS ?" r[80] = "DO YOU REALLY THINK SO ?" r[81] = "BUT YOU ARE NOT SURE YOU _ " r[82] = "DO YOU DOUBT YOU _ ?" r[83] = "IN WHAT WAY ?" r[84] = "WHAT RESEMBLANCE DO YOU SEE ?" r[85] = "WHAT DOES THE SIMILARITY SUGGEST TO YOU ?" r[86] = "WHAT OTHER CONNECTION DO YOU SEE ?" r[87] = "COULD THERE REALLY BE SOME CONNECTIONS ?" r[88] = "HOW ?" r[89] = "YOU SEEM QUITE POSITIVE" r[90] = "ARE YOU SURE ?" r[91] = "I SEE" r[92] = "I UNDERSTAND" r[93] = "WHY DO YOU BRING UP THE TOPIC OF FRIENDS ?" r[94] = "DO YOUR FRIENDS WORRY YOU ?" r[95] = "DO YOUR FRIENDS PICK ON YOU ?" r[96] = "ARE YOU SURE YOU HAVE ANY FRIENDS ?" r[97] = "DO YOU IMPOSE ON YOUR FRIENDS ?" r[98] = "PERHAPS YOUR LOVE FOR FRIENDS WORRIES YOU" r[99] = "DO COMPUTERS WORRY YOU ?" r[100] = "ARE YOU TALKING ABOUT ME IN PARTICULAR ?" r[101] = "ARE YOU FRIGHTENED BY MACHINES ?" r[102] = "WHY DO YOU MENTION COMPUTERS ?" r[103] = "WHAT DO YOU THINK MACHINES HAVE TO DO WITH YOUR PROBLEMS ?" r[104] = "DON'T YOU THINK COMPUTERS CAN HELP PEOPLE ?" r[105] = "WHAT IS IT ABOUT MACHINES THAT WORRIES YOU ?" r[106] = "SAY, DO YOU HAVE ANY PSYCHOLOGICAL PROBLEMS ?" r[107] = "WHAT DOES THAT SUGGEST TO YOU ?" r[108] = "I SEE" r[109] = "IM NOT SURE I UNDERSTAND YOU FULLY" r[110] = "COME COME ELUCIDATE YOUR THOUGHTS" r[111] = "CAN YOU ELABORATE ON THAT ?" r[112] = "THAT IS QUITE INTERESTING" r[113] = "WHY DO YOU HAVE PROBLEMS WITH MONEY ?" r[114] = "DO YOU THINK MONEY IS EVERYTHING ?" r[115] = "ARE YOU SURE THAT MONEY IS THE PROBLEM ?" r[116] = "I THINK WE WANT TO TALK ABOUT YOU, NOT ABOUT ME" r[117] = "WHAT'S ABOUT ME ?" r[118] = "WHY DO YOU ALWAYS BRING UP MY NAME ?" @c endfile @end ignore @example @c file eg/network/eliza.awk # table for looking up answers that # fit to a certain keyword k["CAN YOU"] = "1 2 3" k["CAN I"] = "4 5" k["YOU ARE"] =\ k["YOURE"] = "6 7 8 9" @c endfile @dots{} @end example @ignore @c file eg/network/eliza.awk k["I DONT"] = "10 11 12 13" k["I FEEL"] = "14 15 16" k["WHY DONT YOU"] = "17 18 19" k["WHY CANT I"] = "20 21" k["ARE YOU"] = "22 23 24" k["I CANT"] = "25 26 27" k["I AM"] =\ k["IM "] = "28 29 30 31" k["YOU "] = "32 33 34" k["I WANT"] = "35 36 37 38 39" k["WHAT"] =\ k["HOW"] =\ k["WHO"] =\ k["WHERE"] =\ k["WHEN"] =\ k["WHY"] = "40 41 42 43 44 45 46 47 48" k["NAME"] = "49 50" k["CAUSE"] = "51 52 53 54" k["SORRY"] = "55 56 57 58" k["DREAM"] = "59 60 61 62" k["HELLO"] =\ k["HI "] = "63" k["MAYBE"] = "64 65 66 67 68" k[" NO "] = "69 70 71 72 73" k["YOUR"] = "74 75" k["ALWAYS"] = "76 77 78 79" k["THINK"] = "80 81 82" k["LIKE"] = "83 84 85 86 87 88 89" k["YES"] = "90 91 92" k["FRIEND"] = "93 94 95 96 97 98" k["COMPUTER"] = "99 100 101 102 103 104 105" k["-"] = "106 107 108 109 110 111 112" k["MONEY"] = "113 114 115" k["ELIZA"] = "116 117 118" @c endfile @end ignore @example @c file eg/network/eliza.awk @} @c endfile @end example @cindex Humphrys, Mark @cindex ELIZA program Some interesting remarks and details (including the original source code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has a page with a collection of ELIZA-like programs. Many of them are written in Java, some of them disclosing the Java source code, and a few even explain how to modify the Java source code. @node Caveats, Challenges, Simple Server, Using Networking @section Network Programming Caveats @cindex networks, @command{gawk} and, troubleshooting @cindex @command{gawk}, networking, troubleshooting @cindex troubleshooting, @command{gawk}, networks By now it should be clear that debugging a networked application is more complicated than debugging a single-process single-hosted application. The behavior of a networked application sometimes looks noncausal because it is not reproducible in a strong sense. Whether a network application works or not sometimes depends on the following: @itemize @bullet @item How crowded the underlying network is @item If the party at the other end is running or not @item The state of the party at the other end @end itemize @cindex troubleshooting, networks, timeouts The most difficult problems for a beginner arise from the hidden states of the underlying network. After closing a TCP connection, it's often necessary to wait a short while before reopening the connection. Even more difficult is the establishment of a connection that previously ended with a ``broken pipe.'' Those connections have to ``time out'' for a minute or so before they can reopen. Check this with the command @samp{netstat -a}, which provides a list of still ``active'' connections. @node Challenges, , Caveats, Using Networking @section Where To Go From Here @cindex Loebner, Hugh @cindex contest Now, you have learned enough to build your own application. You could, for example, take part in the Loebner Contest to win $100,000. The Loebner Prize is the first formal instantiation of a Turing Test. Hugh Loebner agreed with The Cambridge Center for Behavioral Studies to underwrite a contest designed to implement the Turing Test. Dr.@: Loebner pledged a Grand Prize of $100,000 for the first computer whose responses were indistinguishable from a human's. Each year an annual prize of $2000 and a bronze medal is awarded to the @emph{most} human computer. The winner of the annual contest is the best entry relative to other entries that year, irrespective of how good it is in an absolute sense. Here is an example of a conversation with the winning program of 1997: @smallexample (c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE] [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40] PROGRAM[10:39:20]Hi, my name is Catherine, what's yours? JUDGE02[10:39:36]My name is Nathan. PROGRAM[10:39:37]Well, it's nice to meet you, Nathan. PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian PROGRAM[10:40:03]couple who came out at a White House party on Sunday? JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it? PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very PROGRAM[10:41:21]embarrassed? JUDGE02[10:41:37]You tell me. I didn't see it. PROGRAM[10:41:38]Are you still a Friend of Bill Clinton? JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture. PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity, PROGRAM[10:42:51]wouldnt you say--can it all be bad luck? JUDGE02[10:43:20]I asked you if you knew anything about sculpture. PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with PROGRAM[10:43:36]everyone waiting to see how much his friends have said about PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something PROGRAM[10:44:01]dramatic actually happen? JUDGE02[10:44:19]Do you know what sculpture is? PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I PROGRAM[10:44:51]must say. JUDGE02[10:45:26]Have you ever been to the Salmagundi Club? PROGRAM[10:45:29]Never. to go back to the original discussion Time to get PROGRAM[10:45:43]off this one I think and onto something more down to earth! JUDGE02[10:46:20]What is more down to earth than art? PROGRAM[10:46:21]I don't know what -- to be honest. - PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a PROGRAM[10:47:03]man? " JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are" JUDGE02[10:48:10]from another play the name of which I cannot remember. PROGRAM[10:48:12]What, if anything, do you enjoy about being a man? JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender. PROGRAM[10:49:02]Do you think of yourself as being attractive? @end smallexample @cindex Clinton, Bill This program insists on always speaking about the same story around Bill Clinton. You see, even a program with a rather narrow mind can behave so much like a human being that it can win this prize. It is quite common to let these programs talk to each other via network connections. But during the competition itself, the program and its computer have to be present at the place the competition is held. We all would love to see a @command{gawk} program win in such an event. Maybe it is up to you to accomplish this? Some other ideas for useful networked applications: @itemize @bullet @item Read the file @file{doc/awkforai.txt} in the @command{gawk} distribution. It was written by Ronald P.@: Loui (at the time, Associate Professor of Computer Science, at Washington University in St. Louis, @email{loui@@ai.wustl.edu}) and summarizes why he taught @command{gawk} to students of Artificial Intelligence. Here are some passages from the text: @cindex AI @cindex PROLOG @cindex Loui, Ronald @cindex agent @quotation The GAWK manual can be consumed in a single lab session and the language can be mastered by the next morning by the average student. GAWK's automatic initialization, implicit coercion, I/O support and lack of pointers forgive many of the mistakes that young programmers are likely to make. Those who have seen C but not mastered it are happy to see that GAWK retains some of the same sensibilities while adding what must be regarded as spoonsful of syntactic sugar.@* @dots{}@* @cindex robot There are further simple answers. Probably the best is the fact that increasingly, undergraduate AI programming is involving the Web. Oren Etzioni (University of Washington, Seattle) has for a while been arguing that the ``softbot'' is replacing the mechanical engineers' robot as the most glamorous AI testbed. If the artifact whose behavior needs to be controlled in an intelligent way is the software agent, then a language that is well-suited to controlling the software environment is the appropriate language. That would imply a scripting language. If the robot is KAREL, then the right language is ``turn left; turn right.'' If the robot is Netscape, then the right language is something that can generate @samp{netscape -remote 'openURL(http://cs.wustl.edu/~loui)'} with elan.@* @dots{}@* AI programming requires high-level thinking. There have always been a few gifted programmers who can write high-level programs in assembly language. Most however need the ambient abstraction to have a higher floor.@* @dots{}@* Second, inference is merely the expansion of notation. No matter whether the logic that underlies an AI program is fuzzy, probabilistic, deontic, defeasible, or deductive, the logic merely defines how strings can be transformed into other strings. A language that provides the best support for string processing in the end provides the best support for logic, for the exploration of various logics, and for most forms of symbolic processing that AI might choose to call ``reasoning'' instead of ``logic.'' The implication is that PROLOG, which saves the AI programmer from having to write a unifier, saves perhaps two dozen lines of GAWK code at the expense of strongly biasing the logic and representational expressiveness of any approach. @end quotation Now that @command{gawk} itself can connect to the Internet, it should be obvious that it is suitable for writing intelligent web agents. @item @command{awk} is strong at pattern recognition and string processing. So, it is well suited to the classic problem of language translation. A first try could be a program that knows the 100 most frequent English words and their counterparts in German or French. The service could be implemented by regularly reading email with the program above, replacing each word by its translation and sending the translation back via SMTP. Users would send English email to their translation service and get back a translated email message in return. As soon as this works, more effort can be spent on a real translation program. @item Another dialogue-oriented application (on the verge of ridicule) is the email ``support service.'' Troubled customers write an email to an automatic @command{gawk} service that reads the email. It looks for keywords in the mail and assembles a reply email accordingly. By carefully investigating the email header, and repeating these keywords through the reply email, it is rather simple to give the customer a feeling that someone cares. Ideally, such a service would search a database of previous cases for solutions. If none exists, the database could, for example, consist of all the newsgroups, mailing lists and FAQs on the Internet. @end itemize @node Some Applications and Techniques, Links, Using Networking, Top @comment node-name, next, previous, up @chapter Some Applications and Techniques In this @value{CHAPTER}, we look at a number of self-contained scripts, with an emphasis on concise networking. Along the way, we work towards creating building blocks that encapsulate often needed functions of the networking world, show new techniques that broaden the scope of problems that can be solved with @command{gawk}, and explore leading edge technology that may shape the future of networking. We often refer to the site-independent core of the server that we built in @ref{Simple Server, ,A Simple Web Server}. When building new and nontrivial servers, we always copy this building block and append new instances of the two functions @code{SetUpServer} and @code{HandleGET}. This makes a lot of sense, since this scheme of event-driven execution provides @command{gawk} with an interface to the most widely accepted standard for GUIs: the web browser. Now, @command{gawk} can rival even Tcl/Tk. @cindex Tcl/Tk, @command{gawk} and Tcl and @command{gawk} have much in common. Both are simple scripting languages that allow us to quickly solve problems with short programs. But Tcl has Tk on top of it, and @command{gawk} had nothing comparable up to now. While Tcl needs a large and ever-changing library (Tk, which was bound to the X Window System until recently), @command{gawk} needs just the networking interface and some kind of browser on the client's side. Besides better portability, the most important advantage of this approach (embracing well-established standards such HTTP and HTML) is that @emph{we do not need to change the language}. We let others do the work of fighting over protocols and standards. We can use HTML, JavaScript, VRML, or whatever else comes along to do our work. @menu * PANIC:: An Emergency Web Server. * GETURL:: Retrieving Web Pages. * REMCONF:: Remote Configuration Of Embedded Systems. * URLCHK:: Look For Changed Web Pages. * WEBGRAB:: Extract Links From A Page. * STATIST:: Graphing A Statistical Distribution. * MAZE:: Walking Through A Maze In Virtual Reality. * MOBAGWHO:: A Simple Mobile Agent. * STOXPRED:: Stock Market Prediction As A Service. * PROTBASE:: Searching Through A Protein Database. @end menu @node PANIC, GETURL, Some Applications and Techniques, Some Applications and Techniques @section PANIC: An Emergency Web Server @cindex PANIC program @cindex networks, See Also web pages @cindex web service At first glance, the @code{"Hello, world"} example in @ref{Primitive Service, ,A Primitive Web Service}, seems useless. By adding just a few lines, we can turn it into something useful. The PANIC program tells everyone who connects that the local site is not working. When a web server breaks down, it makes a difference if customers get a strange ``network unreachable'' message, or a short message telling them that the server has a problem. In such an emergency, the hard disk and everything on it (including the regular web service) may be unavailable. Rebooting the web server off a diskette makes sense in this setting. To use the PANIC program as an emergency web server, all you need are the @command{gawk} executable and the program below on a diskette. By default, it connects to port 8080. A different value may be supplied on the command line: @example @c file eg/network/panic.awk BEGIN @{ RS = ORS = "\r\n" if (MyPort == 0) MyPort = 8080 HttpService = "/inet/tcp/" MyPort "/0/0" Hello = "Out Of Service" \ "

" \ "This site is temporarily out of service." \ "

" Len = length(Hello) + length(ORS) while ("awk" != "complex") @{ print "HTTP/1.0 200 OK" |& HttpService print "Content-Length: " Len ORS |& HttpService print Hello |& HttpService while ((HttpService |& getline) > 0) continue; close(HttpService) @} @} @c endfile @end example @node GETURL, REMCONF, PANIC, Some Applications and Techniques @section GETURL: Retrieving Web Pages @cindex GETURL program @cindex web pages, retrieving GETURL is a versatile building block for shell scripts that need to retrieve files from the Internet. It takes a web address as a command-line parameter and tries to retrieve the contents of this address. The contents are printed to standard output, while the header is printed to @file{/dev/stderr}. A surrounding shell script could analyze the contents and extract the text or the links. An ASCII browser could be written around GETURL. But more interestingly, web robots are straightforward to write on top of GETURL. On the Internet, you can find several programs of the same name that do the same job. They are usually much more complex internally and at least 10 times longer. At first, GETURL checks if it was called with exactly one web address. Then, it checks if the user chose to use a special proxy server whose name is handed over in a variable. By default, it is assumed that the local machine serves as proxy. GETURL uses the @code{GET} method by default to access the web page. By handing over the name of a different method (such as @code{HEAD}), it is possible to choose a different behavior. With the @code{HEAD} method, the user does not receive the body of the page content, but does receive the header: @example @c file eg/network/geturl.awk BEGIN @{ if (ARGC != 2) @{ print "GETURL - retrieve Web page via HTTP 1.0" print "IN:\n the URL as a command-line parameter" print "PARAM(S):\n -v Proxy=MyProxy" print "OUT:\n the page content on stdout" print " the page header on stderr" print "JK 16.05.1997" print "ADR 13.08.2000" exit @} URL = ARGV[1]; ARGV[1] = "" if (Proxy == "") Proxy = "127.0.0.1" if (ProxyPort == 0) ProxyPort = 80 if (Method == "") Method = "GET" HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort ORS = RS = "\r\n\r\n" print Method " " URL " HTTP/1.0" |& HttpService HttpService |& getline Header print Header > "/dev/stderr" while ((HttpService |& getline) > 0) printf "%s", $0 close(HttpService) @} @c endfile @end example This program can be changed as needed, but be careful with the last lines. Make sure transmission of binary data is not corrupted by additional line breaks. Even as it is now, the byte sequence @code{"\r\n\r\n"} would disappear if it were contained in binary data. Don't get caught in a trap when trying a quick fix on this one. @node REMCONF, URLCHK, GETURL, Some Applications and Techniques @section REMCONF: Remote Configuration of Embedded Systems @cindex REMCONF program @cindex Linux @cindex GNU/Linux @cindex Yahoo! Today, you often find powerful processors in embedded systems. Dedicated network routers and controllers for all kinds of machinery are examples of embedded systems. Processors like the Intel 80x86 or the AMD Elan are able to run multitasking operating systems, such as XINU or GNU/Linux in embedded PCs. These systems are small and usually do not have a keyboard or a display. Therefore it is difficult to set up their configuration. There are several widespread ways to set them up: @itemize @bullet @item DIP switches @item Read Only Memories such as EPROMs @item Serial lines or some kind of keyboard @item Network connections via @command{telnet} or SNMP @item HTTP connections with HTML GUIs @end itemize In this @value{SECTION}, we look at a solution that uses HTTP connections to control variables of an embedded system that are stored in a file. Since embedded systems have tight limits on resources like memory, it is difficult to employ advanced techniques such as SNMP and HTTP servers. @command{gawk} fits in quite nicely with its single executable which needs just a short script to start working. The following program stores the variables in a file, and a concurrent process in the embedded system may read the file. The program uses the site-independent part of the simple web server that we developed in @ref{Interacting Service, ,A Web Service with Interaction}. As mentioned there, all we have to do is to write two new procedures @code{SetUpServer} and @code{HandleGET}: @smallexample @c file eg/network/remconf.awk function SetUpServer() @{ TopHeader = "Remote Configuration" TopDoc = "\

Please choose one of the following actions:

\ " TopFooter = "" if (ConfigFile == "") ConfigFile = "config.asc" @} @c endfile @end smallexample The function @code{SetUpServer} initializes the top level HTML texts as usual. It also initializes the name of the file that contains the configuration parameters and their values. In case the user supplies a name from the command line, that name is used. The file is expected to contain one parameter per line, with the name of the parameter in column one and the value in column two. The function @code{HandleGET} reflects the structure of the menu tree as usual. The first menu choice tells the user what this is all about. The second choice reads the configuration file line by line and stores the parameters and their values. Notice that the record separator for this file is @code{"\n"}, in contrast to the record separator for HTTP. The third menu choice builds an HTML table to show the contents of the configuration file just read. The fourth choice does the real work of changing parameters, and the last one just saves the configuration into a file: @smallexample @c file eg/network/remconf.awk function HandleGET() @{ if(MENU[2] == "AboutServer") @{ Document = "This is a GUI for remote configuration of an\ embedded system. It is is implemented as one GAWK script." @} else if (MENU[2] == "ReadConfig") @{ RS = "\n" while ((getline < ConfigFile) > 0) config[$1] = $2; close(ConfigFile) RS = "\r\n" Document = "Configuration has been read." @} else if (MENU[2] == "CheckConfig") @{ Document = "" for (i in config) Document = Document "" \ "" Document = Document "
" i "" config[i] "
" @} else if (MENU[2] == "ChangeConfig") @{ if ("Param" in GETARG) @{ # any parameter to set? if (GETARG["Param"] in config) @{ # is parameter valid? config[GETARG["Param"]] = GETARG["Value"] Document = (GETARG["Param"] " = " GETARG["Value"] ".") @} else @{ Document = "Parameter " GETARG["Param"] " is invalid." @} @} else @{ Document = "

Change one parameter

\ \ \ \ \
ParameterValue
" @} @} else if (MENU[2] == "SaveConfig") @{ for (i in config) printf("%s %s\n", i, config[i]) > ConfigFile close(ConfigFile) Document = "Configuration has been saved." @} @} @c endfile @end smallexample @cindex MiniSQL We could also view the configuration file as a database. From this point of view, the previous program acts like a primitive database server. Real SQL database systems also make a service available by providing a TCP port that clients can connect to. But the application level protocols they use are usually proprietary and also change from time to time. This is also true for the protocol that MiniSQL uses. @node URLCHK, WEBGRAB, REMCONF, Some Applications and Techniques @section URLCHK: Look for Changed Web Pages @cindex URLCHK program Most people who make heavy use of Internet resources have a large bookmark file with pointers to interesting web sites. It is impossible to regularly check by hand if any of these sites have changed. A program is needed to automatically look at the headers of web pages and tell which ones have changed. URLCHK does the comparison after using GETURL with the @code{HEAD} method to retrieve the header. Like GETURL, this program first checks that it is called with exactly one command-line parameter. URLCHK also takes the same command-line variables @code{Proxy} and @code{ProxyPort} as GETURL, because these variables are handed over to GETURL for each URL that gets checked. The one and only parameter is the name of a file that contains one line for each URL. In the first column, we find the URL, and the second and third columns hold the length of the URL's body when checked for the two last times. Now, we follow this plan: @enumerate @item Read the URLs from the file and remember their most recent lengths @item Delete the contents of the file @item For each URL, check its new length and write it into the file @item If the most recent and the new length differ, tell the user @end enumerate It may seem a bit peculiar to read the URLs from a file together with their two most recent lengths, but this approach has several advantages. You can call the program again and again with the same file. After running the program, you can regenerate the changed URLs by extracting those lines that differ in their second and third columns: @c inspired by URLCHK in iX 5/97 166. @smallexample @c file eg/network/urlchk.awk BEGIN @{ if (ARGC != 2) @{ print "URLCHK - check if URLs have changed" print "IN:\n the file with URLs as a command-line parameter" print " file contains URL, old length, new length" print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080" print "OUT:\n same as file with URLs" print "JK 02.03.1998" exit @} URLfile = ARGV[1]; ARGV[1] = "" if (Proxy != "") Proxy = " -v Proxy=" Proxy if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort while ((getline < URLfile) > 0) Length[$1] = $3 + 0 close(URLfile) # now, URLfile is read in and can be updated GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk " for (i in Length) @{ GetThisHeader = GetHeader i " 2>&1" while ((GetThisHeader | getline) > 0) if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0 close(GetThisHeader) print i, Length[i], NewLength > URLfile if (Length[i] != NewLength) # report only changed URLs print i, Length[i], NewLength @} close(URLfile) @} @c endfile @end smallexample Another thing that may look strange is the way GETURL is called. Before calling GETURL, we have to check if the proxy variables need to be passed on. If so, we prepare strings that will become part of the command line later. In @code{GetHeader}, we store these strings together with the longest part of the command line. Later, in the loop over the URLs, @code{GetHeader} is appended with the URL and a redirection operator to form the command that reads the URL's header over the Internet. GETURL always produces the headers over @file{/dev/stderr}. That is the reason why we need the redirection operator to have the header piped in. This program is not perfect because it assumes that changing URLs results in changed lengths, which is not necessarily true. A more advanced approach is to look at some other header line that holds time information. But, as always when things get a bit more complicated, this is left as an exercise to the reader. @node WEBGRAB, STATIST, URLCHK, Some Applications and Techniques @section WEBGRAB: Extract Links from a Page @cindex WEBGRAB program @c Inspired by iX 1/98 157. @cindex robot Sometimes it is necessary to extract links from web pages. Browsers do it, web robots do it, and sometimes even humans do it. Since we have a tool like GETURL at hand, we can solve this problem with some help from the Bourne shell: @example @c file eg/network/webgrab.awk BEGIN @{ RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" @} RT != "" @{ command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \ " > doc" NR ".html") print command @} @c endfile @end example Notice that the regular expression for URLs is rather crude. A precise regular expression is much more complex. But this one works rather well. One problem is that it is unable to find internal links of an HTML document. Another problem is that @samp{ftp}, @samp{telnet}, @samp{news}, @samp{mailto}, and other kinds of links are missing in the regular expression. However, it is straightforward to add them, if doing so is necessary for other tasks. This program reads an HTML file and prints all the HTTP links that it finds. It relies on @command{gawk}'s ability to use regular expressions as record separators. With @code{RS} set to a regular expression that matches links, the second action is executed each time a non-empty link is found. We can find the matching link itself in @code{RT}. The action could use the @code{system} function to let another GETURL retrieve the page, but here we use a different approach. This simple program prints shell commands that can be piped into @command{sh} for execution. This way it is possible to first extract the links, wrap shell commands around them, and pipe all the shell commands into a file. After editing the file, execution of the file retrieves exactly those files that we really need. In case we do not want to edit, we can retrieve all the pages like this: @smallexample gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh @end smallexample @cindex Microsoft Windows After this, you will find the contents of all referenced documents in files named @file{doc*.html} even if they do not contain HTML code. The most annoying thing is that we always have to pass the proxy to GETURL. If you do not like to see the headers of the web pages appear on the screen, you can redirect them to @file{/dev/null}. Watching the headers appear can be quite interesting, because it reveals interesting details such as which web server the companies use. Now, it is clear how the clever marketing people use web robots to determine the market shares of Microsoft and Netscape in the web server market. Port 80 of any web server is like a small hole in a repellent firewall. After attaching a browser to port 80, we usually catch a glimpse of the bright side of the server (its home page). With a tool like GETURL at hand, we are able to discover some of the more concealed or even ``indecent'' services (i.e., lacking conformity to standards of quality). It can be exciting to see the fancy CGI scripts that lie there, revealing the inner workings of the server, ready to be called: @itemize @bullet @item With a command such as: @example gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/ @end example some servers give you a directory listing of the CGI files. Knowing the names, you can try to call some of them and watch for useful results. Sometimes there are executables in such directories (such as Perl interpreters) that you may call remotely. If there are subdirectories with configuration data of the web server, this can also be quite interesting to read. @item @cindex apache The well-known Apache web server usually has its CGI files in the directory @file{/cgi-bin}. There you can often find the scripts @file{test-cgi} and @file{printenv}. Both tell you some things about the current connection and the installation of the web server. Just call: @smallexample gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv @end smallexample @item Sometimes it is even possible to retrieve system files like the web server's log file---possibly containing customer data---or even the file @file{/etc/passwd}. (We don't recommend this!) @end itemize @strong{Caution:} Although this may sound funny or simply irrelevant, we are talking about severe security holes. Try to explore your own system this way and make sure that none of the above reveals too much information about your system. @node STATIST, MAZE, WEBGRAB, Some Applications and Techniques @section STATIST: Graphing a Statistical Distribution @cindex STATIST program @cindex GNUPlot utility @cindex image format @cindex GIF image format @cindex PNG image format @cindex PS image format @cindex Boutell, Thomas @iftex @image{statist,3in} @end iftex In the HTTP server examples we've shown thus far, we never present an image to the browser and its user. Presenting images is one task. Generating images that reflect some user input and presenting these dynamically generated images is another. In this @value{SECTION}, we use GNUPlot for generating @file{.png}, @file{.ps}, or @file{.gif} files.@footnote{Due to licensing problems, the default installation of GNUPlot disables the generation of @file{.gif} files. If your installed version does not accept @samp{set term gif}, just download and install the most recent version of GNUPlot and the @uref{http://www.boutell.com/gd/, GD library} by Thomas Boutell. Otherwise you still have the chance to generate some ASCII-art style images with GNUPlot by using @samp{set term dumb}. (We tried it and it worked.)} The program we develop takes the statistical parameters of two samples and computes the t-test statistics. As a result, we get the probabilities that the means and the variances of both samples are the same. In order to let the user check plausibility, the program presents an image of the distributions. The statistical computation follows @cite{Numerical Recipes in C: The Art of Scientific Computing} by William H.@: Press, Saul A.@: Teukolsky, William T.@: Vetterling, and Brian P. Flannery. Since @command{gawk} does not have a built-in function for the computation of the beta function, we use the @code{ibeta} function of GNUPlot. As a side effect, we learn how to use GNUPlot as a sophisticated calculator. The comparison of means is done as in @code{tutest}, paragraph 14.2, page 613, and the comparison of variances is done as in @code{ftest}, page 611 in @cite{Numerical Recipes}. @cindex Numerical Recipes As usual, we take the site-independent code for servers and append our own functions @code{SetUpServer} and @code{HandleGET}: @smallexample @c file eg/network/statist.awk function SetUpServer() @{ TopHeader = "Statistics with GAWK" TopDoc = "\

Please choose one of the following actions:

\ " TopFooter = "" GnuPlot = "gnuplot 2>&1" m1=m2=0; v1=v2=1; n1=n2=10 @} @c endfile @end smallexample Here, you see the menu structure that the user sees. Later, we will see how the program structure of the @code{HandleGET} function reflects the menu structure. What is missing here is the link for the image we generate. In an event-driven environment, request, generation, and delivery of images are separated. Notice the way we initialize the @code{GnuPlot} command string for the pipe. By default, GNUPlot outputs the generated image via standard output, as well as the results of @code{print}(ed) calculations via standard error. The redirection causes standard error to be mixed into standard output, enabling us to read results of calculations with @code{getline}. By initializing the statistical parameters with some meaningful defaults, we make sure the user gets an image the first time he uses the program. @cindex JavaScript Following is the rather long function @code{HandleGET}, which implements the contents of this service by reacting to the different kinds of requests from the browser. Before you start playing with this script, make sure that your browser supports JavaScript and that it also has this option switched on. The script uses a short snippet of JavaScript code for delayed opening of a window with an image. A more detailed explanation follows: @smallexample @c file eg/network/statist.awk function HandleGET() @{ if(MENU[2] == "AboutServer") @{ Document = "This is a GUI for a statistical computation.\ It compares means and variances of two distributions.\ It is implemented as one GAWK script and uses GNUPLOT." @} else if (MENU[2] == "EnterParameters") @{ Document = "" if ("m1" in GETARG) @{ # are there parameters to compare? Document = Document "" m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"] m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"] t = (m1-m2)/sqrt(v1/n1+v2/n2) df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \ + (v2/n2)*(v2/n2) /(n2-1)) if (v1>v2) @{ f = v1/v2 df1 = n1 - 1 df2 = n2 - 1 @} else @{ f = v2/v1 df1 = n2 - 1 df2 = n1 - 1 @} print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \ df2/(df2+df1*f) ")" |& GnuPlot print "print pt, pF" |& GnuPlot RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot print "set term png small color" |& GnuPlot #print "set term postscript color" |& GnuPlot #print "set term gif medium size 320,240" |& GnuPlot print "set yrange[-0.3:]" |& GnuPlot print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\ mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot print "quit" |& GnuPlot GnuPlot |& getline Image while ((GnuPlot |& getline) > 0) Image = Image RS $0 close(GnuPlot) @} Document = Document "\

Do these samples have the same Gaussian distribution?

\
\ \ \ \ \ \ \ \ \ \
1. Mean 1. Variance 1. Count
2. Mean 2. Variance 2. Count

" @} else if (MENU[2] ~ "Image") @{ Reason = "OK" ORS "Content-type: image/png" #Reason = "OK" ORS "Content-type: application/x-postscript" #Reason = "OK" ORS "Content-type: image/gif" Header = Footer = "" Document = Image @} @} @c endfile @end smallexample @cindex PostScript As usual, we give a short description of the service in the first menu choice. The third menu choice shows us that generation and presentation of an image are two separate actions. While the latter takes place quite instantly in the third menu choice, the former takes place in the much longer second choice. Image data passes from the generating action to the presenting action via the variable @code{Image} that contains a complete @file{.png} image, which is otherwise stored in a file. If you prefer @file{.ps} or @file{.gif} images over the default @file{.png} images, you may select these options by uncommenting the appropriate lines. But remember to do so in two places: when telling GNUPlot which kind of images to generate, and when transmitting the image at the end of the program. Looking at the end of the program, the way we pass the @samp{Content-type} to the browser is a bit unusual. It is appended to the @samp{OK} of the first header line to make sure the type information becomes part of the header. The other variables that get transmitted across the network are made empty, because in this case we do not have an HTML document to transmit, but rather raw image data to contain in the body. Most of the work is done in the second menu choice. It starts with a strange JavaScript code snippet. When first implementing this server, we used a short @code{@w{""} here. But then browsers got smarter and tried to improve on speed by requesting the image and the HTML code at the same time. When doing this, the browser tries to build up a connection for the image request while the request for the HTML text is not yet completed. The browser tries to connect to the @command{gawk} server on port 8080 while port 8080 is still in use for transmission of the HTML text. The connection for the image cannot be built up, so the image appears as ``broken'' in the browser window. We solved this problem by telling the browser to open a separate window for the image, but only after a delay of 1000 milliseconds. By this time, the server should be ready for serving the next request. But there is one more subtlety in the JavaScript code. Each time the JavaScript code opens a window for the image, the name of the image is appended with a timestamp (@code{systime}). Why this constant change of name for the image? Initially, we always named the image @code{Image}, but then the Netscape browser noticed the name had @emph{not} changed since the previous request and displayed the previous image (caching behavior). The server core is implemented so that browsers are told @emph{not} to cache anything. Obviously HTTP requests do not always work as expected. One way to circumvent the cache of such overly smart browsers is to change the name of the image with each request. These three lines of JavaScript caused us a lot of trouble. The rest can be broken down into two phases. At first, we check if there are statistical parameters. When the program is first started, there usually are no parameters because it enters the page coming from the top menu. Then, we only have to present the user a form that he can use to change statistical parameters and submit them. Subsequently, the submission of the form causes the execution of the first phase because @emph{now} there @emph{are} parameters to handle. Now that we have parameters, we know there will be an image available. Therefore we insert the JavaScript code here to initiate the opening of the image in a separate window. Then, we prepare some variables that will be passed to GNUPlot for calculation of the probabilities. Prior to reading the results, we must temporarily change @code{RS} because GNUPlot separates lines with newlines. After instructing GNUPlot to generate a @file{.png} (or @file{.ps} or @file{.gif}) image, we initiate the insertion of some text, explaining the resulting probabilities. The final @samp{plot} command actually generates the image data. This raw binary has to be read in carefully without adding, changing, or deleting a single byte. Hence the unusual initialization of @code{Image} and completion with a @code{while} loop. When using this server, it soon becomes clear that it is far from being perfect. It mixes source code of six scripting languages or protocols: @itemize @bullet @item GNU @command{awk} implements a server for the protocol: @item HTTP which transmits: @item HTML text which contains a short piece of: @item JavaScript code opening a separate window. @item A Bourne shell script is used for piping commands into: @item GNUPlot to generate the image to be opened. @end itemize After all this work, the GNUPlot image opens in the JavaScript window where it can be viewed by the user. It is probably better not to mix up so many different languages. The result is not very readable. Furthermore, the statistical part of the server does not take care of invalid input. Among others, using negative variances will cause invalid results. @node MAZE, MOBAGWHO, STATIST, Some Applications and Techniques @section MAZE: Walking Through a Maze In Virtual Reality @cindex MAZE @cindex VRML @c VRML in iX 11/96 134. @quotation @cindex Perlis, Alan @i{In the long run, every program becomes rococo, and then rubble.}@* Alan Perlis @end quotation By now, we know how to present arbitrary @samp{Content-type}s to a browser. In this @value{SECTION}, our server will present a 3D world to our browser. The 3D world is described in a scene description language (VRML, Virtual Reality Modeling Language) that allows us to travel through a perspective view of a 2D maze with our browser. Browsers with a VRML plugin enable exploration of this technology. We could do one of those boring @samp{Hello world} examples here, that are usually presented when introducing novices to VRML. If you have never written any VRML code, have a look at the VRML FAQ. Presenting a static VRML scene is a bit trivial; in order to expose @command{gawk}'s new capabilities, we will present a dynamically generated VRML scene. The function @code{SetUpServer} is very simple because it only sets the default HTML page and initializes the random number generator. As usual, the surrounding server lets you browse the maze. @smallexample @c file eg/network/maze.awk function SetUpServer() @{ TopHeader = "Walk through a maze" TopDoc = "\

Please choose one of the following actions:

\ " TopFooter = "" srand() @} @c endfile @end smallexample The function @code{HandleGET} is a bit longer because it first computes the maze and afterwards generates the VRML code that is sent across the network. As shown in the STATIST example (@pxref{STATIST}), we set the type of the content to VRML and then store the VRML representation of the maze as the page content. We assume that the maze is stored in a 2D array. Initially, the maze consists of walls only. Then, we add an entry and an exit to the maze and let the rest of the work be done by the function @code{MakeMaze}. Now, only the wall fields are left in the maze. By iterating over the these fields, we generate one line of VRML code for each wall field. @smallexample @c file eg/network/maze.awk function HandleGET() @{ if (MENU[2] == "AboutServer") @{ Document = "If your browser has a VRML 2 plugin,\ this server shows you a simple VRML scene." @} else if (MENU[2] == "VRMLtest") @{ XSIZE = YSIZE = 11 # initially, everything is wall for (y = 0; y < YSIZE; y++) for (x = 0; x < XSIZE; x++) Maze[x, y] = "#" delete Maze[0, 1] # entry is not wall delete Maze[XSIZE-1, YSIZE-2] # exit is not wall MakeMaze(1, 1) Document = "\ #VRML V2.0 utf8\n\ Group @{\n\ children [\n\ PointLight @{\n\ ambientIntensity 0.2\n\ color 0.7 0.7 0.7\n\ location 0.0 8.0 10.0\n\ @}\n\ DEF B1 Background @{\n\ skyColor [0 0 0, 1.0 1.0 1.0 ]\n\ skyAngle 1.6\n\ groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\ groundAngle [ 1.2 1.57 ]\n\ @}\n\ DEF Wall Shape @{\n\ geometry Box @{size 1 1 1@}\n\ appearance Appearance @{ material Material @{ diffuseColor 0 0 1 @} @}\n\ @}\n\ DEF Entry Viewpoint @{\n\ position 0.5 1.0 5.0\n\ orientation 0.0 0.0 -1.0 0.52\n\ @}\n" for (i in Maze) @{ split(i, t, SUBSEP) Document = Document " Transform @{ translation " Document = Document t[1] " 0 -" t[2] " children USE Wall @}\n" @} Document = Document " ] # end of group for world\n@}" Reason = "OK" ORS "Content-type: model/vrml" Header = Footer = "" @} @} @c endfile @end smallexample Finally, we have a look at @code{MakeMaze}, the function that generates the @code{Maze} array. When entered, this function assumes that the array has been initialized so that each element represents a wall element and the maze is initially full of wall elements. Only the entrance and the exit of the maze should have been left free. The parameters of the function tell us which element must be marked as not being a wall. After this, we take a look at the four neighboring elements and remember which we have already treated. Of all the neighboring elements, we take one at random and walk in that direction. Therefore, the wall element in that direction has to be removed and then, we call the function recursively for that element. The maze is only completed if we iterate the above procedure for @emph{all} neighboring elements (in random order) and for our present element by recursively calling the function for the present element. This last iteration could have been done in a loop, but it is done much simpler recursively. Notice that elements with coordinates that are both odd are assumed to be on our way through the maze and the generating process cannot terminate as long as there is such an element not being @code{delete}d. All other elements are potentially part of the wall. @smallexample @c file eg/network/maze.awk function MakeMaze(x, y) @{ delete Maze[x, y] # here we are, we have no wall here p = 0 # count unvisited fields in all directions if (x-2 SUBSEP y in Maze) d[p++] = "-x" if (x SUBSEP y-2 in Maze) d[p++] = "-y" if (x+2 SUBSEP y in Maze) d[p++] = "+x" if (x SUBSEP y+2 in Maze) d[p++] = "+y" if (p>0) @{ # if there are unvisited fields, go there p = int(p*rand()) # choose one unvisited field at random if (d[p] == "-x") @{ delete Maze[x - 1, y]; MakeMaze(x - 2, y) @} else if (d[p] == "-y") @{ delete Maze[x, y - 1]; MakeMaze(x, y - 2) @} else if (d[p] == "+x") @{ delete Maze[x + 1, y]; MakeMaze(x + 2, y) @} else if (d[p] == "+y") @{ delete Maze[x, y + 1]; MakeMaze(x, y + 2) @} # we are back from recursion MakeMaze(x, y); # try again while there are unvisited fields @} @} @c endfile @end smallexample @node MOBAGWHO, STOXPRED, MAZE, Some Applications and Techniques @section MOBAGWHO: a Simple Mobile Agent @cindex MOBAGWHO program @cindex agent @quotation @cindex Hoare, C.A.R. @i{There are two ways of constructing a software design: One way is to make it so simple that there are obviously no deficiencies, and the other way is to make it so complicated that there are no obvious deficiencies.} @* C. A. R. Hoare @end quotation A @dfn{mobile agent} is a program that can be dispatched from a computer and transported to a remote server for execution. This is called @dfn{migration}, which means that a process on another system is started that is independent from its originator. Ideally, it wanders through a network while working for its creator or owner. In places like the UMBC Agent Web, people are quite confident that (mobile) agents are a software engineering paradigm that enables us to significantly increase the efficiency of our work. Mobile agents could become the mediators between users and the networking world. For an unbiased view at this technology, see the remarkable paper @cite{Mobile Agents: Are they a good idea?}.@footnote{@uref{http://www.research.ibm.com/massive/mobag.ps}} @ignore @c Chuck says to take all of this out. @cindex Tcl/Tk A good instance of this paradigm is @cite{Agent Tcl},@footnote{@uref{http://agent.cs.dartmouth.edu/software/agent2.0/}} an extension of the Tcl language. After introducing a typical development environment, the aforementioned paper shows a nice little example application that we will try to rebuild in @command{gawk}. The @command{who} agent takes a list of servers and wanders from one server to the next one, always looking to see who is logged in. Having reached the last one, it sends back a message with a list of all users it found on each machine. But before implementing something that might or might not be a mobile agent, let us clarify the concept and some important terms. The agent paradigm in general is such a young scientific discipline that it has not yet developed a widely-accepted terminology. Some authors try to give precise definitions, but their scope is often not wide enough to be generally accepted. Franklin and Graesser ask @cite{Is it an Agent or just a Program: A Taxonomy for Autonomous Agents}@footnote{@uref{http://www.msci.memphis.edu/~franklin/AgentProg.html}} and give even better answers than Caglayan and Harrison in their @cite{Agent Sourcebook}.@footnote{@uref{http://www.aminda.com/mazzu/sourcebook/}} @itemize @minus @item @i{An autonomous agent is a system situated within and a part of an environment that senses that environment and acts on it, over time, in pursuit of its own agenda and so as to effect what it senses in the future.} (Quoted from Franklin and Graesser.) @item A mobile agent is able to transport itself from one machine to another. @item The term @dfn{migration} often denotes this process of moving. But neither of the two sources above even mentions this term, while others use it regularly. @end itemize Before delving into the (rather demanding) details of implementation, let us give just one more quotation as a final motivation. Steven Farley published an excellent paper called @cite{Mobile Agent System Architecture},@footnote{This often cited text originally appeared as a conference paper here: @uref{http://www.sigs.com/publications/docs/java/9705/farley.html} Many bibliographies on the Internet point to this dead link. Meanwhile, the paper appeared as a contribution to a book called More Java Gems here: @uref{http://uk.cambridge.org/computerscience/object/catalogue/0521774772/default.htm}} in which he asks ``Why use an agent architecture?'' @quotation If client-server systems are the currently established norm and distributed object systems such as CORBA are defining the future standards, why bother with agents? Agent architectures have certain advantages over these other types. Three of the most important advantages are: @cindex CORBA @enumerate @item An agent performs much processing at the server where local bandwidth is high, thus reducing the amount of network bandwidth consumed and increasing overall performance. In contrast, a CORBA client object with the equivalent functionality of a given agent must make repeated remote method calls to the server object because CORBA objects cannot move across the network at runtime. @item An agent operates independently of the application from which the agent was invoked. The agent operates asynchronously, meaning that the client application does not need to wait for the results. This is especially important for mobile users who are not always connected to the network. @item The use of agents allows for the injection of new functionality into a system at run time. An agent system essentially contains its own automatic software distribution mechanism. Since CORBA has no built-in support for mobile code, new functionality generally has to be installed manually. @end enumerate Of course a non-agent system can exhibit these same features with some work. But the mobile code paradigm supports the transfer of executable code to a remote location for asynchronous execution from the start. An agent architecture should be considered for systems where the above features are primary requirements. @end quotation @end ignore When trying to migrate a process from one system to another, a server process is needed on the receiving side. Depending on the kind of server process, several ways of implementation come to mind. How the process is implemented depends upon the kind of server process: @itemize @bullet @item HTTP can be used as the protocol for delivery of the migrating process. In this case, we use a common web server as the receiving server process. A universal CGI script mediates between migrating process and web server. Each server willing to accept migrating agents makes this universal service available. HTTP supplies the @code{POST} method to transfer some data to a file on the web server. When a CGI script is called remotely with the @code{POST} method instead of the usual @code{GET} method, data is transmitted from the client process to the standard input of the server's CGI script. So, to implement a mobile agent, we must not only write the agent program to start on the client side, but also the CGI script to receive the agent on the server side. @cindex CGI (Common Gateway Interface) @cindex apache @item The @code{PUT} method can also be used for migration. HTTP does not require a CGI script for migration via @code{PUT}. However, with common web servers there is no advantage to this solution, because web servers such as Apache require explicit activation of a special @code{PUT} script. @item @cite{Agent Tcl} pursues a different course; it relies on a dedicated server process with a dedicated protocol specialized for receiving mobile agents. @end itemize Our agent example abuses a common web server as a migration tool. So, it needs a universal CGI script on the receiving side (the web server). The receiving script is activated with a @code{POST} request when placed into a location like @file{/httpd/cgi-bin/PostAgent.sh}. Make sure that the server system uses a version of @command{gawk} that supports network access (Version 3.1 or later; verify with @samp{gawk --version}). @example @c file eg/network/PostAgent.sh #!/bin/sh MobAg=/tmp/MobileAgent.$$ # direct script to mobile agent file cat > $MobAg # execute agent concurrently gawk -f $MobAg $MobAg > /dev/null & # HTTP header, terminator and body gawk 'BEGIN @{ print "\r\nAgent started" @}' rm $MobAg # delete script file of agent @c endfile @end example By making its process id (@code{$$}) part of the unique @value{FN}, the script avoids conflicts between concurrent instances of the script. First, all lines from standard input (the mobile agent's source code) are copied into this unique file. Then, the agent is started as a concurrent process and a short message reporting this fact is sent to the submitting client. Finally, the script file of the mobile agent is removed because it is no longer needed. Although it is a short script, there are several noteworthy points: @table @asis @item Security @emph{There is none}. In fact, the CGI script should never be made available on a server that is part of the Internet because everyone would be allowed to execute arbitrary commands with it. This behavior is acceptable only when performing rapid prototyping. @item Self-Reference Each migrating instance of an agent is started in a way that enables it to read its own source code from standard input and use the code for subsequent migrations. This is necessary because it needs to treat the agent's code as data to transmit. @command{gawk} is not the ideal language for such a job. Lisp and Tcl are more suitable because they do not make a distinction between program code and data. @item Independence After migration, the agent is not linked to its former home in any way. By reporting @samp{Agent started}, it waves ``Goodbye'' to its origin. The originator may choose to terminate or not. @end table @cindex Lisp The originating agent itself is started just like any other command-line script, and reports the results on standard output. By letting the name of the original host migrate with the agent, the agent that migrates to a host far away from its origin can report the result back home. Having arrived at the end of the journey, the agent establishes a connection and reports the results. This is the reason for determining the name of the host with @samp{uname -n} and storing it in @code{MyOrigin} for later use. We may also set variables with the @option{-v} option from the command line. This interactivity is only of importance in the context of starting a mobile agent; therefore this @code{BEGIN} pattern and its action do not take part in migration: @smallexample @c file eg/network/mobag.awk BEGIN @{ if (ARGC != 2) @{ print "MOBAG - a simple mobile agent" print "CALL:\n gawk -f mobag.awk mobag.awk" print "IN:\n the name of this script as a command-line parameter" print "PARAM:\n -v MyOrigin=myhost.com" print "OUT:\n the result on stdout" print "JK 29.03.1998 01.04.1998" exit @} if (MyOrigin == "") @{ "uname -n" | getline MyOrigin close("uname -n") @} @} @c endfile @end smallexample Since @command{gawk} cannot manipulate and transmit parts of the program directly, the source code is read and stored in strings. Therefore, the program scans itself for the beginning and the ending of functions. Each line in between is appended to the code string until the end of the function has been reached. A special case is this part of the program itself. It is not a function. Placing a similar framework around it causes it to be treated like a function. Notice that this mechanism works for all the functions of the source code, but it cannot guarantee that the order of the functions is preserved during migration: @smallexample @c file eg/network/mobag.awk #ReadMySelf /^function / @{ FUNC = $2 @} /^END/ || /^#ReadMySelf/ @{ FUNC = $1 @} FUNC != "" @{ MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 @} (FUNC != "") && (/^@}/ || /^#EndOfMySelf/) \ @{ FUNC = "" @} #EndOfMySelf @c endfile @end smallexample The web server code in @ref{Interacting Service, ,A Web Service with Interaction}, was first developed as a site-independent core. Likewise, the @command{gawk}-based mobile agent starts with an agent-independent core, to which can be appended application-dependent functions. What follows is the only application-independent function needed for the mobile agent: @smallexample @c file eg/network/mobag.awk function migrate(Destination, MobCode, Label) @{ MOBVAR["Label"] = Label MOBVAR["Destination"] = Destination RS = ORS = "\r\n" HttpService = "/inet/tcp/0/" Destination for (i in MOBFUN) MobCode = (MobCode "\n" MOBFUN[i]) MobCode = MobCode "\n\nBEGIN @{" for (i in MOBVAR) MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"") MobCode = MobCode "\n@}\n" print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService print "Content-length:", length(MobCode) ORS |& HttpService printf "%s", MobCode |& HttpService while ((HttpService |& getline) > 0) print $0 close(HttpService) @} @c endfile @end smallexample The @code{migrate} function prepares the aforementioned strings containing the program code and transmits them to a server. A consequence of this modular approach is that the @code{migrate} function takes some parameters that aren't needed in this application, but that will be in future ones. Its mandatory parameter @code{Destination} holds the name (or IP address) of the server that the agent wants as a host for its code. The optional parameter @code{MobCode} may contain some @command{gawk} code that is inserted during migration in front of all other code. The optional parameter @code{Label} may contain a string that tells the agent what to do in program execution after arrival at its new home site. One of the serious obstacles in implementing a framework for mobile agents is that it does not suffice to migrate the code. It is also necessary to migrate the state of execution of the agent. In contrast to @cite{Agent Tcl}, this program does not try to migrate the complete set of variables. The following conventions are used: @itemize @bullet @item Each variable in an agent program is local to the current host and does @emph{not} migrate. @item The array @code{MOBFUN} shown above is an exception. It is handled by the function @code{migrate} and does migrate with the application. @item The other exception is the array @code{MOBVAR}. Each variable that takes part in migration has to be an element of this array. @code{migrate} also takes care of this. @end itemize Now it's clear what happens to the @code{Label} parameter of the function @code{migrate}. It is copied into @code{MOBVAR["Label"]} and travels alongside the other data. Since travelling takes place via HTTP, records must be separated with @code{"\r\n"} in @code{RS} and @code{ORS} as usual. The code assembly for migration takes place in three steps: @itemize @bullet @item Iterate over @code{MOBFUN} to collect all functions verbatim. @item Prepare a @code{BEGIN} pattern and put assignments to mobile variables into the action part. @item Transmission itself resembles GETURL: the header with the request and the @code{Content-length} is followed by the body. In case there is any reply over the network, it is read completely and echoed to standard output to avoid irritating the server. @end itemize The application-independent framework is now almost complete. What follows is the @code{END} pattern that is executed when the mobile agent has finished reading its own code. First, it checks whether it is already running on a remote host or not. In case initialization has not yet taken place, it starts @code{MyInit}. Otherwise (later, on a remote host), it starts @code{MyJob}: @smallexample @c file eg/network/mobag.awk END @{ if (ARGC != 2) exit # stop when called with wrong parameters if (MyOrigin != "") # is this the originating host? MyInit() # if so, initialize the application else # we are on a host with migrated data MyJob() # so we do our job @} @c endfile @end smallexample All that's left to extend the framework into a complete application is to write two application-specific functions: @code{MyInit} and @code{MyJob}. Keep in mind that the former is executed once on the originating host, while the latter is executed after each migration: @smallexample @c file eg/network/mobag.awk function MyInit() @{ MOBVAR["MyOrigin"] = MyOrigin MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80" split(MOBVAR["Machines"], Machines) # which host is the first? migrate(Machines[1], "", "") # go to the first host while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result print $0 # print result close("/inet/tcp/8080/0/0") @} @c endfile @end smallexample As mentioned earlier, this agent takes the name of its origin (@code{MyOrigin}) with it. Then, it takes the name of its first destination and goes there for further work. Notice that this name has the port number of the web server appended to the name of the server, because the function @code{migrate} needs it this way to create the @code{HttpService} variable. Finally, it waits for the result to arrive. The @code{MyJob} function runs on the remote host: @smallexample @c file eg/network/mobag.awk function MyJob() @{ # forget this host sub(MOBVAR["Destination"], "", MOBVAR["Machines"]) MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":" while (("who" | getline) > 0) # who is logged in? MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0 close("who") if (index(MOBVAR["Machines"], "/") > 0) @{ # any more machines to visit? split(MOBVAR["Machines"], Machines) # which host is next? migrate(Machines[1], "", "") # go there @} else @{ # no more machines gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080" close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080") @} @} @c endfile @end smallexample After migrating, the first thing to do in @code{MyJob} is to delete the name of the current host from the list of hosts to visit. Now, it is time to start the real work by appending the host's name to the result string, and reading line by line who is logged in on this host. A very annoying circumstance is the fact that the elements of @code{MOBVAR} cannot hold the newline character (@code{"\n"}). If they did, migration of this string did not work because the string didn't obey the syntax rule for a string in @command{gawk}. @code{SUBSEP} is used as a temporary replacement. If the list of hosts to visit holds at least one more entry, the agent migrates to that place to go on working there. Otherwise, we replace the @code{SUBSEP}s with a newline character in the resulting string, and report it to the originating host, whose name is stored in @code{MOBVAR["MyOrigin"]}. @node STOXPRED, PROTBASE, MOBAGWHO, Some Applications and Techniques @section STOXPRED: Stock Market Prediction As A Service @cindex STOXPRED program @cindex Yahoo! @quotation @i{Far out in the uncharted backwaters of the unfashionable end of the Western Spiral arm of the Galaxy lies a small unregarded yellow sun.} @i{Orbiting this at a distance of roughly ninety-two million miles is an utterly insignificant little blue-green planet whose ape-descendent life forms are so amazingly primitive that they still think digital watches are a pretty neat idea.} @i{This planet has --- or rather had --- a problem, which was this: most of the people living on it were unhappy for pretty much of the time. Many solutions were suggested for this problem, but most of these were largely concerned with the movements of small green pieces of paper, which is odd because it wasn't the small green pieces of paper that were unhappy.} @* Douglas Adams, @cite{The Hitch Hiker's Guide to the Galaxy} @end quotation @cindex @command{cron} utility Valuable services on the Internet are usually @emph{not} implemented as mobile agents. There are much simpler ways of implementing services. All Unix systems provide, for example, the @command{cron} service. Unix system users can write a list of tasks to be done each day, each week, twice a day, or just once. The list is entered into a file named @file{crontab}. For example, to distribute a newsletter on a daily basis this way, use @command{cron} for calling a script each day early in the morning. @example # run at 8 am on weekdays, distribute the newsletter 0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1 @end example The script first looks for interesting information on the Internet, assembles it in a nice form and sends the results via email to the customers. The following is an example of a primitive newsletter on stock market prediction. It is a report which first tries to predict the change of each share in the Dow Jones Industrial Index for the particular day. Then it mentions some especially promising shares as well as some shares which look remarkably bad on that day. The report ends with the usual disclaimer which tells every child @emph{not} to try this at home and hurt anybody. @cindex Dow Jones Industrial Index @smallexample Good morning Uncle Scrooge, This is your daily stock market report for Monday, October 16, 2000. Here are the predictions for today: AA neutral GE up JNJ down MSFT neutral @dots{} UTX up DD down IBM up MO down WMT up DIS up INTC up MRK down XOM down EK down IP down The most promising shares for today are these: INTC http://biz.yahoo.com/n/i/intc.html The stock shares to avoid today are these: EK http://biz.yahoo.com/n/e/ek.html IP http://biz.yahoo.com/n/i/ip.html DD http://biz.yahoo.com/n/d/dd.html @dots{} @end smallexample @ignore @c Chuck suggests removing this paragraph If you are not into stock market prediction but want to earn money with a more humane service, you might prefer to send out horoscopes to your customers. Or, once every refrigerator in every household on this side of the Chinese Wall is connected to the Internet, such a service could inspect the contents of your customer's refrigerators each day and advise them on nutrition. Big Brother is watching them. @end ignore The script as a whole is rather long. In order to ease the pain of studying other people's source code, we have broken the script up into meaningful parts which are invoked one after the other. The basic structure of the script is as follows: @example @c file eg/network/stoxpred.awk BEGIN @{ Init() ReadQuotes() CleanUp() Prediction() Report() SendMail() @} @c endfile @end example The earlier parts store data into variables and arrays which are subsequently used by later parts of the script. The @code{Init} function first checks if the script is invoked correctly (without any parameters). If not, it informs the user of the correct usage. What follows are preparations for the retrieval of the historical quote data. The names of the 30 stock shares are stored in an array @code{name} along with the current date in @code{day}, @code{month}, and @code{year}. All users who are separated from the Internet by a firewall and have to direct their Internet accesses to a proxy must supply the name of the proxy to this script with the @samp{-v Proxy=@var{name}} option. For most users, the default proxy and port number should suffice. @example @c file eg/network/stoxpred.awk function Init() @{ if (ARGC != 1) @{ print "STOXPRED - daily stock share prediction" print "IN:\n no parameters, nothing on stdin" print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80" print "OUT:\n commented predictions as email" print "JK 09.10.2000" exit @} # Remember ticker symbols from Dow Jones Industrial Index StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \ SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \ MRK XOM EK IP", name); # Remember the current date as the end of the time series day = strftime("%d") month = strftime("%m") year = strftime("%Y") if (Proxy == "") Proxy = "chart.yahoo.com" if (ProxyPort == 0) ProxyPort = 80 YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort @} @c endfile @end example @cindex CSV format There are two really interesting parts in the script. One is the function which reads the historical stock quotes from an Internet server. The other is the one that does the actual prediction. In the following function we see how the quotes are read from the Yahoo server. The data which comes from the server is in CSV format (comma-separated values): @example @c file eg/network/stoxdata.txt Date,Open,High,Low,Close,Volume 9-Oct-00,22.75,22.75,21.375,22.375,7888500 6-Oct-00,23.8125,24.9375,21.5625,22,10701100 5-Oct-00,24.4375,24.625,23.125,23.50,5810300 @c endfile @end example Lines contain values of the same time instant, whereas columns are separated by commas and contain the kind of data that is described in the header (first) line. At first, @command{gawk} is instructed to separate columns by commas (@samp{FS = ","}). In the loop that follows, a connection to the Yahoo server is first opened, then a download takes place, and finally the connection is closed. All this happens once for each ticker symbol. In the body of this loop, an Internet address is built up as a string according to the rules of the Yahoo server. The starting and ending date are chosen to be exactly the same, but one year apart in the past. All the action is initiated within the @code{printf} command which transmits the request for data to the Yahoo server. In the inner loop, the server's data is first read and then scanned line by line. Only lines which have six columns and the name of a month in the first column contain relevant data. This data is stored in the two-dimensional array @code{quote}; one dimension being time, the other being the ticker symbol. During retrieval of the first stock's data, the calendar names of the time instances are stored in the array @code{day} because we need them later. @smallexample @c file eg/network/stoxpred.awk function ReadQuotes() @{ # Retrieve historical data for each ticker symbol FS = "," for (stock = 1; stock <= StockCount; stock++) @{ URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \ "&a=" month "&b=" day "&c=" year-1 \ "&d=" month "&e=" day "&f=" year \ "g=d&q=q&y=0&z=" name[stock] "&x=.csv" printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData while ((YahooData |& getline) > 0) @{ if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) @{ if (stock == 1) days[++daycount] = $1; quote[$1, stock] = $5 @} @} close(YahooData) @} FS = " " @} @c endfile @end smallexample Now that we @emph{have} the data, it can be checked once again to make sure that no individual stock is missing or invalid, and that all the stock quotes are aligned correctly. Furthermore, we renumber the time instances. The most recent day gets day number 1 and all other days get consecutive numbers. All quotes are rounded toward the nearest whole number in US Dollars. @smallexample @c file eg/network/stoxpred.awk function CleanUp() @{ # clean up time series; eliminate incomplete data sets for (d = 1; d <= daycount; d++) @{ for (stock = 1; stock <= StockCount; stock++) if (! ((days[d], stock) in quote)) stock = StockCount + 10 if (stock > StockCount + 1) continue datacount++ for (stock = 1; stock <= StockCount; stock++) data[datacount, stock] = int(0.5 + quote[days[d], stock]) @} delete quote delete days @} @c endfile @end smallexample Now we have arrived at the second really interesting part of the whole affair. What we present here is a very primitive prediction algorithm: @emph{If a stock fell yesterday, assume it will also fall today; if it rose yesterday, assume it will rise today}. (Feel free to replace this algorithm with a smarter one.) If a stock changed in the same direction on two consecutive days, this is an indication which should be highlighted. Two-day advances are stored in @code{hot} and two-day declines in @code{avoid}. The rest of the function is a sanity check. It counts the number of correct predictions in relation to the total number of predictions one could have made in the year before. @smallexample @c file eg/network/stoxpred.awk function Prediction() @{ # Predict each ticker symbol by prolonging yesterday's trend for (stock = 1; stock <= StockCount; stock++) @{ if (data[1, stock] > data[2, stock]) @{ predict[stock] = "up" @} else if (data[1, stock] < data[2, stock]) @{ predict[stock] = "down" @} else @{ predict[stock] = "neutral" @} if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock])) hot[stock] = 1 if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock])) avoid[stock] = 1 @} # Do a plausibility check: how many predictions proved correct? for (s = 1; s <= StockCount; s++) @{ for (d = 1; d <= datacount-2; d++) @{ if (data[d+1, s] > data[d+2, s]) @{ UpCount++ @} else if (data[d+1, s] < data[d+2, s]) @{ DownCount++ @} else @{ NeutralCount++ @} if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) || ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) || ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s]))) CorrectCount++ @} @} @} @c endfile @end smallexample At this point the hard work has been done: the array @code{predict} contains the predictions for all the ticker symbols. It is up to the function @code{Report} to find some nice words to introduce the desired information. @smallexample @c file eg/network/stoxpred.awk function Report() @{ # Generate report report = "\nThis is your daily " report = report "stock market report for "strftime("%A, %B %d, %Y")".\n" report = report "Here are the predictions for today:\n\n" for (stock = 1; stock <= StockCount; stock++) report = report "\t" name[stock] "\t" predict[stock] "\n" for (stock in hot) @{ if (HotCount++ == 0) report = report "\nThe most promising shares for today are these:\n\n" report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" @} for (stock in avoid) @{ if (AvoidCount++ == 0) report = report "\nThe stock shares to avoid today are these:\n\n" report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" @} report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0 report = report " losers. When using this kind\nof prediction scheme for" report = report " the 12 months which lie behind us,\nwe get " UpCount report = report " 'ups' and " DownCount " 'downs' and " NeutralCount report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount report = report " predictions " CorrectCount " proved correct next day.\n" report = report "A success rate of "\ int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n" report = report "Random choice would have produced a 33% success rate.\n" report = report "Disclaimer: Like every other prediction of the stock\n" report = report "market, this report is, of course, complete nonsense.\n" report = report "If you are stupid enough to believe these predictions\n" report = report "you should visit a doctor who can treat your ailment." @} @c endfile @end smallexample The function @code{SendMail} goes through the list of customers and opens a pipe to the @code{mail} command for each of them. Each one receives an email message with a proper subject heading and is addressed with his full name. @smallexample @c file eg/network/stoxpred.awk function SendMail() @{ # send report to customers customer["uncle.scrooge@@ducktown.gov"] = "Uncle Scrooge" customer["more@@utopia.org" ] = "Sir Thomas More" customer["spinoza@@denhaag.nl" ] = "Baruch de Spinoza" customer["marx@@highgate.uk" ] = "Karl Marx" customer["keynes@@the.long.run" ] = "John Maynard Keynes" customer["bierce@@devil.hell.org" ] = "Ambrose Bierce" customer["laplace@@paris.fr" ] = "Pierre Simon de Laplace" for (c in customer) @{ MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c print "Good morning " customer[c] "," | MailPipe print report "\n.\n" | MailPipe close(MailPipe) @} @} @c endfile @end smallexample Be patient when running the script by hand. Retrieving the data for all the ticker symbols and sending the emails may take several minutes to complete, depending upon network traffic and the speed of the available Internet link. The quality of the prediction algorithm is likely to be disappointing. Try to find a better one. Should you find one with a success rate of more than 50%, please tell us about it! It is only for the sake of curiosity, of course. @code{:-)} @ignore @c chuck says to remove this Let us give you one final indication as to what one can expect from a prediction of stock data, which is sometimes said to contain much randomness. One theory says that all relevant information to be taken into account when estimating the price of a stock is contained in the stock quotes. Every bit of useful information has influenced the fair price. Therefore (the theory says) temporary changes (i.e., fluctuations within a minute) have to be purely random. But what is the cause of short-term changes in stock prices? Stock prices are fixed when supply and demand meet each other. What people are willing to pay reflects human expectations. Human expectations are not necessarily random. On the Internet, you can find an elucidating paper about predictability and human expectations: @uref{http://it.ucsd.edu/IT/Newsletter/archives/meir/05meir.html, @cite{Reflections on ``Universal Prediction of Individual Sequences''}} The authors (Feder, Merhav, Gutman) introduce the reader to the subject by telling a thrilling anecdote. @cindex Shannon, Claude @quotation In the early 50's, at Bell Laboratories, David Hagelbarger built a simple ``mind reading'' machine, whose purpose was to play the ``penny matching'' game. In this game, a player chooses head or tail, while a ``mind reading'' machine tries to predict and match his choice. Surprisingly, as Robert Lucky tells in his book ``Silicon Dreams'', Hagelbarger's simple, 8-state machine, was able to match the ``pennies'' of its human opponent 5,218 times over the course of 9,795 plays. Random guessing would lead to such a high success rate with a probability less than one out of 10 billion! Shannon, who was interested in prediction, information, and thinking machines, closely followed Hagelbarger's machine, and eventually built his own stripped-down version of the machine, having the same states, but one that used a simpler strategy at each state. As the legend goes, in a duel between the two machines, Shannon's machine won by a slight margin! No one knows if this was due to a superior algorithm or just a chance happening associated with the specific sequence at that game. In any event, the success of both these machines against ``untrained'' human opponents was explained by the fact that the human opponents cannot draw completely random bits. @end quotation @end ignore @node PROTBASE, , STOXPRED, Some Applications and Techniques @section PROTBASE: Searching Through A Protein Database @cindex PROTBASE @cindex NCBI, National Center for Biotechnology Information @cindex BLAST, Basic Local Alignment Search Tool @cindex Hoare, C.A.R. @quotation @i{Hoare's Law of Large Problems: Inside every large problem is a small problem struggling to get out.} @end quotation Yahoo's database of stock market data is just one among the many large databases on the Internet. Another one is located at NCBI (National Center for Biotechnology Information). Established in 1988 as a national resource for molecular biology information, NCBI creates public databases, conducts research in computational biology, develops software tools for analyzing genome data, and disseminates biomedical information. In this section, we look at one of NCBI's public services, which is called BLAST (Basic Local Alignment Search Tool). You probably know that the information necessary for reproducing living cells is encoded in the genetic material of the cells. The genetic material is a very long chain of four base nucleotides. It is the order of appearance (the sequence) of nucleotides which contains the information about the substance to be produced. Scientists in biotechnology often find a specific fragment, determine the nucleotide sequence, and need to know where the sequence at hand comes from. This is where the large databases enter the game. At NCBI, databases store the knowledge about which sequences have ever been found and where they have been found. When the scientist sends his sequence to the BLAST service, the server looks for regions of genetic material in its database which look the most similar to the delivered nucleotide sequence. After a search time of some seconds or minutes the server sends an answer to the scientist. In order to make access simple, NCBI chose to offer their database service through popular Internet protocols. There are four basic ways to use the so-called BLAST services: @itemize @bullet @item The easiest way to use BLAST is through the web. Users may simply point their browsers at the NCBI home page and link to the BLAST pages. NCBI provides a stable URL that may be used to perform BLAST searches without interactive use of a web browser. This is what we will do later in this section. A demonstration client and a @file{README} file demonstrate how to access this URL. @item Currently, @command{blastcl3} is the standard network BLAST client. You can download @command{blastcl3} from the anonymous FTP location. @item BLAST 2.0 can be run locally as a full executable and can be used to run BLAST searches against private local databases, or downloaded copies of the NCBI databases. BLAST 2.0 executables may be found on the NCBI anonymous FTP server. @item The NCBI BLAST Email server is the best option for people without convenient access to the web. A similarity search can be performed by sending a properly formatted mail message containing the nucleotide or protein query sequence to @email{blast@@ncbi.nlm.nih.gov}. The query sequence is compared against the specified database using the BLAST algorithm and the results are returned in an email message. For more information on formulating email BLAST searches, you can send a message consisting of the word ``HELP'' to the same address, @email{blast@@ncbi.nlm.nih.gov}. @end itemize Our starting point is the demonstration client mentioned in the first option. The @file{README} file that comes along with the client explains the whole process in a nutshell. In the rest of this section, we first show what such requests look like. Then we show how to use @command{gawk} to implement a client in about 10 lines of code. Finally, we show how to interpret the result returned from the service. Sequences are expected to be represented in the standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions: lower-case letters are accepted and are mapped into upper-case; a single hyphen or dash can be used to represent a gap of indeterminate length; and in amino acid sequences, @samp{U} and @samp{*} are acceptable letters (see below). Before submitting a request, any numerical digits in the query sequence should either be removed or replaced by appropriate letter codes (e.g., @samp{N} for unknown nucleic acid residue or @samp{X} for unknown amino acid residue). The nucleic acid codes supported are: @example A --> adenosine M --> A C (amino) C --> cytidine S --> G C (strong) G --> guanine W --> A T (weak) T --> thymidine B --> G T C U --> uridine D --> G A T R --> G A (purine) H --> A C T Y --> T C (pyrimidine) V --> G C A K --> G T (keto) N --> A G C T (any) - gap of indeterminate length @end example Now you know the alphabet of nucleotide sequences. The last two lines of the following example query show you such a sequence, which is obviously made up only of elements of the alphabet just described. Store this example query into a file named @file{protbase.request}. You are now ready to send it to the server with the demonstration client. @example @c file eg/network/protbase.request PROGRAM blastn DATALIB month EXPECT 0.75 BEGIN >GAWK310 the gawking gene GNU AWK tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat caccaccatggacagcaaa @c endfile @end example @cindex FASTA/Pearson format The actual search request begins with the mandatory parameter @samp{PROGRAM} in the first column followed by the value @samp{blastn} (the name of the program) for searching nucleic acids. The next line contains the mandatory search parameter @samp{DATALIB} with the value @samp{month} for the newest nucleic acid sequences. The third line contains an optional @samp{EXPECT} parameter and the value desired for it. The fourth line contains the mandatory @samp{BEGIN} directive, followed by the query sequence in FASTA/Pearson format. Each line of information must be less than 80 characters in length. The ``month'' database contains all new or revised sequences released in the last 30 days and is useful for searching against new sequences. There are five different blast programs, @command{blastn} being the one that compares a nucleotide query sequence against a nucleotide sequence database. The last server directive that must appear in every request is the @samp{BEGIN} directive. The query sequence should immediately follow the @samp{BEGIN} directive and must appear in FASTA/Pearson format. A sequence in FASTA/Pearson format begins with a single-line description. The description line, which is required, is distinguished from the lines of sequence data that follow it by having a greater-than (@samp{>}) symbol in the first column. For the purposes of the BLAST server, the text of the description is arbitrary. If you prefer to use a client written in @command{gawk}, just store the following 10 lines of code into a file named @file{protbase.awk} and use this client instead. Invoke it with @samp{gawk -f protbase.awk protbase.request}. Then wait a minute and watch the result coming in. In order to replicate the demonstration client's behavior as closely as possible, this client does not use a proxy server. We could also have extended the client program in @ref{GETURL, ,Retrieving Web Pages}, to implement the client request from @file{protbase.awk} as a special case. @smallexample @c file eg/network/protbase.awk @{ request = request "\n" $0 @} END @{ BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80" printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService printf "Content-Length: " length(request) "\n\n" |& BLASTService printf request |& BLASTService while ((BLASTService |& getline) > 0) print $0 close(BLASTService) @} @c endfile @end smallexample The demonstration client from NCBI is 214 lines long (written in C) and it is not immediately obvious what it does. Our client is so short that it @emph{is} obvious what it does. First it loops over all lines of the query and stores the whole query into a variable. Then the script establishes an Internet connection to the NCBI server and transmits the query by framing it with a proper HTTP request. Finally it receives and prints the complete result coming from the server. Now, let us look at the result. It begins with an HTTP header, which you can ignore. Then there are some comments about the query having been filtered to avoid spuriously high scores. After this, there is a reference to the paper that describes the software being used for searching the data base. After a repetition of the original query's description we find the list of significant alignments: @smallexample @c file eg/network/protbase.result Sequences producing significant alignments: (bits) Value gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20 gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20 emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20 emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20 emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20 emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20 gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20 @c endfile @end smallexample This means that the query sequence was found in seven human chromosomes. But the value 0.20 (20%) means that the probability of an accidental match is rather high (20%) in all cases and should be taken into account. You may wonder what the first column means. It is a key to the specific database in which this occurrence was found. The unique sequence identifiers reported in the search results can be used as sequence retrieval keys via the NCBI server. The syntax of sequence header lines used by the NCBI BLAST server depends on the database from which each sequence was obtained. The table below lists the identifiers for the databases from which the sequences were derived. @ifinfo @example Database Name Identifier Syntax ============================ ======================== GenBank gb|accession|locus EMBL Data Library emb|accession|locus DDBJ, DNA Database of Japan dbj|accession|locus NBRF PIR pir||entry Protein Research Foundation prf||name SWISS-PROT sp|accession|entry name Brookhaven Protein Data Bank pdb|entry|chain Kabat's Sequences of Immuno@dots{} gnl|kabat|identifier Patents pat|country|number GenInfo Backbone Id bbs|number @end example @end ifinfo @ifnotinfo @multitable {Kabat's Sequences of Immuno@dots{}} {@code{@w{sp|accession|entry name}}} @item GenBank @tab @code{gb|accession|locus} @item EMBL Data Library @tab @code{emb|accession|locus} @item DDBJ, DNA Database of Japan @tab @code{dbj|accession|locus} @item NBRF PIR @tab @code{pir||entry} @item Protein Research Foundation @tab @code{prf||name} @item SWISS-PROT @tab @code{@w{sp|accession|entry name}} @item Brookhaven Protein Data Bank @tab @code{pdb|entry|chain} @item Kabat's Sequences of Immuno@dots{} @tab @code{gnl|kabat|identifier} @item Patents @tab @code{pat|country|number} @item GenInfo Backbone Id @tab @code{bbs|number} @end multitable @end ifnotinfo For example, an identifier might be @samp{gb|AC021182.14|AC021182}, where the @samp{gb} tag indicates that the identifier refers to a GenBank sequence, @samp{AC021182.14} is its GenBank ACCESSION, and @samp{AC021182} is the GenBank LOCUS. The identifier contains no spaces, so that a space indicates the end of the identifier. Let us continue in the result listing. Each of the seven alignments mentioned above is subsequently described in detail. We will have a closer look at the first of them. @smallexample >gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4 unordered pieces Length = 176383 Score = 38.2 bits (19), Expect = 0.20 Identities = 19/19 (100%) Strand = Plus / Plus Query: 35 tggtgaagtgtgtttcttg 53 ||||||||||||||||||| Sbjct: 69786 tggtgaagtgtgtttcttg 69804 @end smallexample This alignment was located on the human chromosome 7. The fragment on which part of the query was found had a total length of 176383. Only 19 of the nucleotides matched and the matching sequence ran from character 35 to 53 in the query sequence and from 69786 to 69804 in the fragment on chromosome 7. If you are still reading at this point, you are probably interested in finding out more about Computational Biology and you might appreciate the following hints. @cindex Computational Biology @cindex Bioinformatics @enumerate @item There is a book called @cite{Introduction to Computational Biology} by Michael S. Waterman, which is worth reading if you are seriously interested. You can find a good book review on the Internet. @item While Waterman's book can explain to you the algorithms employed internally in the database search engines, most practitioners prefer to approach the subject differently. The applied side of Computational Biology is called Bioinformatics, and emphasizes the tools available for day-to-day work as well as how to actually @emph{use} them. One of the very few affordable books on Bioinformatics is @cite{Developing Bioinformatics Computer Skills}. @item The sequences @emph{gawk} and @emph{gnuawk} are in widespread use in the genetic material of virtually every earthly living being. Let us take this as a clear indication that the divine creator has intended @code{gawk} to prevail over other scripting languages such as @code{perl}, @code{tcl}, or @code{python} which are not even proper sequences. (:-) @end enumerate @node Links, GNU Free Documentation License, Some Applications and Techniques, Top @chapter Related Links This section lists the URLs for various items discussed in this @value{CHAPTER}. They are presented in the order in which they appear. @table @asis @item @cite{Internet Programming with Python} @uref{http://www.fsbassociates.com/books/python.htm} @item @cite{Advanced Perl Programming} @uref{http://www.oreilly.com/catalog/advperl} @item @cite{Web Client Programming with Perl} @uref{http://www.oreilly.com/catalog/webclient} @item Richard Stevens's home page and book @uref{http://www.kohala.com/~rstevens} @item The SPAK home page @uref{http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html} @item Volume III of @cite{Internetworking with TCP/IP}, by Comer and Stevens @uref{http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html} @item XBM Graphics File Format @uref{http://www.wotsit.org/download.asp?f=xbm} @item GNUPlot @uref{http://www.cs.dartmouth.edu/gnuplot_info.html} @item Mark Humphrys' Eliza page @uref{http://www.compapp.dcu.ie/~humphrys/eliza.html} @item Yahoo! Eliza Information @uref{http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence} @item Java versions of Eliza @uref{http://www.tjhsst.edu/Psych/ch1/eliza.html} @item Java versions of Eliza with source code @uref{http://home.adelphia.net/~lifeisgood/eliza/eliza.htm} @item Eliza Programs with Explanations @uref{http://chayden.net/chayden/eliza/Eliza.shtml} @item Loebner Contest @uref{http://acm.org/~loebner/loebner-prize.htmlx} @item Tck/Tk Information @uref{http://www.scriptics.com/} @item Intel 80x86 Processors @uref{http://developer.intel.com/design/platform/embedpc/what_is.htm} @item AMD Elan Processors @uref{http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html} @item XINU @uref{http://willow.canberra.edu.au/~chrisc/xinu.html } @item GNU/Linux @uref{http://uclinux.lineo.com/} @item Embedded PCs @uref{http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/} @item MiniSQL @uref{http://www.hughes.com.au/library/} @item Market Share Surveys @uref{http://www.netcraft.com/survey} @item @cite{Numerical Recipes in C: The Art of Scientific Computing} @uref{http://www.nr.com} @item VRML @uref{http://www.vrml.org} @item The VRML FAQ @uref{http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ} @item The UMBC Agent Web @uref{http://www.cs.umbc.edu/agents } @item Apache Web Server @uref{http://www.apache.org} @item National Center for Biotechnology Information (NCBI) @uref{http://www.ncbi.nlm.nih.gov} @item Basic Local Alignment Search Tool (BLAST) @uref{http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html} @item NCBI Home Page @uref{http://www.ncbi.nlm.nih.gov} @item BLAST Pages @uref{http://www.ncbi.nlm.nih.gov/BLAST} @item BLAST Demonstration Client @uref{ftp://ncbi.nlm.nih.gov/blast/blasturl/} @item BLAST anonymous FTP location @uref{ftp://ncbi.nlm.nih.gov/blast/network/netblast/} @item BLAST 2.0 Executables @uref{ftp://ncbi.nlm.nih.gov/blast/executables/} @item IUB/IUPAC Amino Acid and Nucleic Acid Codes @uref{http://www.uthscsa.edu/geninfo/blastmail.html#item6} @item FASTA/Pearson Format @uref{http://www.ncbi.nlm.nih.gov/BLAST/fasta.html} @item Fasta/Pearson Sequence in Java @uref{http://www.kazusa.or.jp/java/codon_table_java/} @item Book Review of @cite{Introduction to Computational Biology} @uref{http://www.acm.org/crossroads/xrds5-1/introcb.html} @item @cite{Developing Bioinformatics Computer Skills} @uref{http://www.oreilly.com/catalog/bioskills/} @end table @c The GNU Free Documentation License. @node GNU Free Documentation License, Index, Links, Top @unnumbered GNU Free Documentation License @cindex FDL (Free Documentation License) @cindex Free Documentation License (FDL) @cindex GNU Free Documentation License @center Version 1.3, 3 November 2008 @c This file is intended to be included within another document, @c hence no sectioning command or @node. @display Copyright @copyright{} 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc. @uref{http://fsf.org/} Everyone is permitted to copy and distribute verbatim copies of this license document, but changing it is not allowed. @end display @enumerate 0 @item PREAMBLE The purpose of this License is to make a manual, textbook, or other functional and useful document @dfn{free} in the sense of freedom: to assure everyone the effective freedom to copy and redistribute it, with or without modifying it, either commercially or noncommercially. Secondarily, this License preserves for the author and publisher a way to get credit for their work, while not being considered responsible for modifications made by others. This License is a kind of ``copyleft'', which means that derivative works of the document must themselves be free in the same sense. It complements the GNU General Public License, which is a copyleft license designed for free software. We have designed this License in order to use it for manuals for free software, because free software needs free documentation: a free program should come with manuals providing the same freedoms that the software does. But this License is not limited to software manuals; it can be used for any textual work, regardless of subject matter or whether it is published as a printed book. We recommend this License principally for works whose purpose is instruction or reference. @item APPLICABILITY AND DEFINITIONS This License applies to any manual or other work, in any medium, that contains a notice placed by the copyright holder saying it can be distributed under the terms of this License. Such a notice grants a world-wide, royalty-free license, unlimited in duration, to use that work under the conditions stated herein. The ``Document'', below, refers to any such manual or work. Any member of the public is a licensee, and is addressed as ``you''. You accept the license if you copy, modify or distribute the work in a way requiring permission under copyright law. A ``Modified Version'' of the Document means any work containing the Document or a portion of it, either copied verbatim, or with modifications and/or translated into another language. A ``Secondary Section'' is a named appendix or a front-matter section of the Document that deals exclusively with the relationship of the publishers or authors of the Document to the Document's overall subject (or to related matters) and contains nothing that could fall directly within that overall subject. (Thus, if the Document is in part a textbook of mathematics, a Secondary Section may not explain any mathematics.) The relationship could be a matter of historical connection with the subject or with related matters, or of legal, commercial, philosophical, ethical or political position regarding them. The ``Invariant Sections'' are certain Secondary Sections whose titles are designated, as being those of Invariant Sections, in the notice that says that the Document is released under this License. If a section does not fit the above definition of Secondary then it is not allowed to be designated as Invariant. The Document may contain zero Invariant Sections. If the Document does not identify any Invariant Sections then there are none. The ``Cover Texts'' are certain short passages of text that are listed, as Front-Cover Texts or Back-Cover Texts, in the notice that says that the Document is released under this License. A Front-Cover Text may be at most 5 words, and a Back-Cover Text may be at most 25 words. A ``Transparent'' copy of the Document means a machine-readable copy, represented in a format whose specification is available to the general public, that is suitable for revising the document straightforwardly with generic text editors or (for images composed of pixels) generic paint programs or (for drawings) some widely available drawing editor, and that is suitable for input to text formatters or for automatic translation to a variety of formats suitable for input to text formatters. A copy made in an otherwise Transparent file format whose markup, or absence of markup, has been arranged to thwart or discourage subsequent modification by readers is not Transparent. An image format is not Transparent if used for any substantial amount of text. A copy that is not ``Transparent'' is called ``Opaque''. Examples of suitable formats for Transparent copies include plain @sc{ascii} without markup, Texinfo input format, La@TeX{} input format, @acronym{SGML} or @acronym{XML} using a publicly available @acronym{DTD}, and standard-conforming simple @acronym{HTML}, PostScript or @acronym{PDF} designed for human modification. Examples of transparent image formats include @acronym{PNG}, @acronym{XCF} and @acronym{JPG}. Opaque formats include proprietary formats that can be read and edited only by proprietary word processors, @acronym{SGML} or @acronym{XML} for which the @acronym{DTD} and/or processing tools are not generally available, and the machine-generated @acronym{HTML}, PostScript or @acronym{PDF} produced by some word processors for output purposes only. The ``Title Page'' means, for a printed book, the title page itself, plus such following pages as are needed to hold, legibly, the material this License requires to appear in the title page. For works in formats which do not have any title page as such, ``Title Page'' means the text near the most prominent appearance of the work's title, preceding the beginning of the body of the text. The ``publisher'' means any person or entity that distributes copies of the Document to the public. A section ``Entitled XYZ'' means a named subunit of the Document whose title either is precisely XYZ or contains XYZ in parentheses following text that translates XYZ in another language. (Here XYZ stands for a specific section name mentioned below, such as ``Acknowledgements'', ``Dedications'', ``Endorsements'', or ``History''.) To ``Preserve the Title'' of such a section when you modify the Document means that it remains a section ``Entitled XYZ'' according to this definition. The Document may include Warranty Disclaimers next to the notice which states that this License applies to the Document. These Warranty Disclaimers are considered to be included by reference in this License, but only as regards disclaiming warranties: any other implication that these Warranty Disclaimers may have is void and has no effect on the meaning of this License. @item VERBATIM COPYING You may copy and distribute the Document in any medium, either commercially or noncommercially, provided that this License, the copyright notices, and the license notice saying this License applies to the Document are reproduced in all copies, and that you add no other conditions whatsoever to those of this License. You may not use technical measures to obstruct or control the reading or further copying of the copies you make or distribute. However, you may accept compensation in exchange for copies. If you distribute a large enough number of copies you must also follow the conditions in section 3. You may also lend copies, under the same conditions stated above, and you may publicly display copies. @item COPYING IN QUANTITY If you publish printed copies (or copies in media that commonly have printed covers) of the Document, numbering more than 100, and the Document's license notice requires Cover Texts, you must enclose the copies in covers that carry, clearly and legibly, all these Cover Texts: Front-Cover Texts on the front cover, and Back-Cover Texts on the back cover. Both covers must also clearly and legibly identify you as the publisher of these copies. The front cover must present the full title with all words of the title equally prominent and visible. You may add other material on the covers in addition. Copying with changes limited to the covers, as long as they preserve the title of the Document and satisfy these conditions, can be treated as verbatim copying in other respects. If the required texts for either cover are too voluminous to fit legibly, you should put the first ones listed (as many as fit reasonably) on the actual cover, and continue the rest onto adjacent pages. If you publish or distribute Opaque copies of the Document numbering more than 100, you must either include a machine-readable Transparent copy along with each Opaque copy, or state in or with each Opaque copy a computer-network location from which the general network-using public has access to download using public-standard network protocols a complete Transparent copy of the Document, free of added material. If you use the latter option, you must take reasonably prudent steps, when you begin distribution of Opaque copies in quantity, to ensure that this Transparent copy will remain thus accessible at the stated location until at least one year after the last time you distribute an Opaque copy (directly or through your agents or retailers) of that edition to the public. It is requested, but not required, that you contact the authors of the Document well before redistributing any large number of copies, to give them a chance to provide you with an updated version of the Document. @item MODIFICATIONS You may copy and distribute a Modified Version of the Document under the conditions of sections 2 and 3 above, provided that you release the Modified Version under precisely this License, with the Modified Version filling the role of the Document, thus licensing distribution and modification of the Modified Version to whoever possesses a copy of it. In addition, you must do these things in the Modified Version: @enumerate A @item Use in the Title Page (and on the covers, if any) a title distinct from that of the Document, and from those of previous versions (which should, if there were any, be listed in the History section of the Document). You may use the same title as a previous version if the original publisher of that version gives permission. @item List on the Title Page, as authors, one or more persons or entities responsible for authorship of the modifications in the Modified Version, together with at least five of the principal authors of the Document (all of its principal authors, if it has fewer than five), unless they release you from this requirement. @item State on the Title page the name of the publisher of the Modified Version, as the publisher. @item Preserve all the copyright notices of the Document. @item Add an appropriate copyright notice for your modifications adjacent to the other copyright notices. @item Include, immediately after the copyright notices, a license notice giving the public permission to use the Modified Version under the terms of this License, in the form shown in the Addendum below. @item Preserve in that license notice the full lists of Invariant Sections and required Cover Texts given in the Document's license notice. @item Include an unaltered copy of this License. @item Preserve the section Entitled ``History'', Preserve its Title, and add to it an item stating at least the title, year, new authors, and publisher of the Modified Version as given on the Title Page. If there is no section Entitled ``History'' in the Document, create one stating the title, year, authors, and publisher of the Document as given on its Title Page, then add an item describing the Modified Version as stated in the previous sentence. @item Preserve the network location, if any, given in the Document for public access to a Transparent copy of the Document, and likewise the network locations given in the Document for previous versions it was based on. These may be placed in the ``History'' section. You may omit a network location for a work that was published at least four years before the Document itself, or if the original publisher of the version it refers to gives permission. @item For any section Entitled ``Acknowledgements'' or ``Dedications'', Preserve the Title of the section, and preserve in the section all the substance and tone of each of the contributor acknowledgements and/or dedications given therein. @item Preserve all the Invariant Sections of the Document, unaltered in their text and in their titles. Section numbers or the equivalent are not considered part of the section titles. @item Delete any section Entitled ``Endorsements''. Such a section may not be included in the Modified Version. @item Do not retitle any existing section to be Entitled ``Endorsements'' or to conflict in title with any Invariant Section. @item Preserve any Warranty Disclaimers. @end enumerate If the Modified Version includes new front-matter sections or appendices that qualify as Secondary Sections and contain no material copied from the Document, you may at your option designate some or all of these sections as invariant. To do this, add their titles to the list of Invariant Sections in the Modified Version's license notice. These titles must be distinct from any other section titles. You may add a section Entitled ``Endorsements'', provided it contains nothing but endorsements of your Modified Version by various parties---for example, statements of peer review or that the text has been approved by an organization as the authoritative definition of a standard. You may add a passage of up to five words as a Front-Cover Text, and a passage of up to 25 words as a Back-Cover Text, to the end of the list of Cover Texts in the Modified Version. Only one passage of Front-Cover Text and one of Back-Cover Text may be added by (or through arrangements made by) any one entity. If the Document already includes a cover text for the same cover, previously added by you or by arrangement made by the same entity you are acting on behalf of, you may not add another; but you may replace the old one, on explicit permission from the previous publisher that added the old one. The author(s) and publisher(s) of the Document do not by this License give permission to use their names for publicity for or to assert or imply endorsement of any Modified Version. @item COMBINING DOCUMENTS You may combine the Document with other documents released under this License, under the terms defined in section 4 above for modified versions, provided that you include in the combination all of the Invariant Sections of all of the original documents, unmodified, and list them all as Invariant Sections of your combined work in its license notice, and that you preserve all their Warranty Disclaimers. The combined work need only contain one copy of this License, and multiple identical Invariant Sections may be replaced with a single copy. If there are multiple Invariant Sections with the same name but different contents, make the title of each such section unique by adding at the end of it, in parentheses, the name of the original author or publisher of that section if known, or else a unique number. Make the same adjustment to the section titles in the list of Invariant Sections in the license notice of the combined work. In the combination, you must combine any sections Entitled ``History'' in the various original documents, forming one section Entitled ``History''; likewise combine any sections Entitled ``Acknowledgements'', and any sections Entitled ``Dedications''. You must delete all sections Entitled ``Endorsements.'' @item COLLECTIONS OF DOCUMENTS You may make a collection consisting of the Document and other documents released under this License, and replace the individual copies of this License in the various documents with a single copy that is included in the collection, provided that you follow the rules of this License for verbatim copying of each of the documents in all other respects. You may extract a single document from such a collection, and distribute it individually under this License, provided you insert a copy of this License into the extracted document, and follow this License in all other respects regarding verbatim copying of that document. @item AGGREGATION WITH INDEPENDENT WORKS A compilation of the Document or its derivatives with other separate and independent documents or works, in or on a volume of a storage or distribution medium, is called an ``aggregate'' if the copyright resulting from the compilation is not used to limit the legal rights of the compilation's users beyond what the individual works permit. When the Document is included in an aggregate, this License does not apply to the other works in the aggregate which are not themselves derivative works of the Document. If the Cover Text requirement of section 3 is applicable to these copies of the Document, then if the Document is less than one half of the entire aggregate, the Document's Cover Texts may be placed on covers that bracket the Document within the aggregate, or the electronic equivalent of covers if the Document is in electronic form. Otherwise they must appear on printed covers that bracket the whole aggregate. @item TRANSLATION Translation is considered a kind of modification, so you may distribute translations of the Document under the terms of section 4. Replacing Invariant Sections with translations requires special permission from their copyright holders, but you may include translations of some or all Invariant Sections in addition to the original versions of these Invariant Sections. You may include a translation of this License, and all the license notices in the Document, and any Warranty Disclaimers, provided that you also include the original English version of this License and the original versions of those notices and disclaimers. In case of a disagreement between the translation and the original version of this License or a notice or disclaimer, the original version will prevail. If a section in the Document is Entitled ``Acknowledgements'', ``Dedications'', or ``History'', the requirement (section 4) to Preserve its Title (section 1) will typically require changing the actual title. @item TERMINATION You may not copy, modify, sublicense, or distribute the Document except as expressly provided under this License. Any attempt otherwise to copy, modify, sublicense, or distribute it is void, and will automatically terminate your rights under this License. However, if you cease all violation of this License, then your license from a particular copyright holder is reinstated (a) provisionally, unless and until the copyright holder explicitly and finally terminates your license, and (b) permanently, if the copyright holder fails to notify you of the violation by some reasonable means prior to 60 days after the cessation. Moreover, your license from a particular copyright holder is reinstated permanently if the copyright holder notifies you of the violation by some reasonable means, this is the first time you have received notice of violation of this License (for any work) from that copyright holder, and you cure the violation prior to 30 days after your receipt of the notice. Termination of your rights under this section does not terminate the licenses of parties who have received copies or rights from you under this License. If your rights have been terminated and not permanently reinstated, receipt of a copy of some or all of the same material does not give you any rights to use it. @item FUTURE REVISIONS OF THIS LICENSE The Free Software Foundation may publish new, revised versions of the GNU Free Documentation License from time to time. Such new versions will be similar in spirit to the present version, but may differ in detail to address new problems or concerns. See @uref{http://www.gnu.org/copyleft/}. Each version of the License is given a distinguishing version number. If the Document specifies that a particular numbered version of this License ``or any later version'' applies to it, you have the option of following the terms and conditions either of that specified version or of any later version that has been published (not as a draft) by the Free Software Foundation. If the Document does not specify a version number of this License, you may choose any version ever published (not as a draft) by the Free Software Foundation. If the Document specifies that a proxy can decide which future versions of this License can be used, that proxy's public statement of acceptance of a version permanently authorizes you to choose that version for the Document. @item RELICENSING ``Massive Multiauthor Collaboration Site'' (or ``MMC Site'') means any World Wide Web server that publishes copyrightable works and also provides prominent facilities for anybody to edit those works. A public wiki that anybody can edit is an example of such a server. A ``Massive Multiauthor Collaboration'' (or ``MMC'') contained in the site means any set of copyrightable works thus published on the MMC site. ``CC-BY-SA'' means the Creative Commons Attribution-Share Alike 3.0 license published by Creative Commons Corporation, a not-for-profit corporation with a principal place of business in San Francisco, California, as well as future copyleft versions of that license published by that same organization. ``Incorporate'' means to publish or republish a Document, in whole or in part, as part of another Document. An MMC is ``eligible for relicensing'' if it is licensed under this License, and if all works that were first published under this License somewhere other than this MMC, and subsequently incorporated in whole or in part into the MMC, (1) had no cover texts or invariant sections, and (2) were thus incorporated prior to November 1, 2008. The operator of an MMC Site may republish an MMC contained in the site under CC-BY-SA on the same site at any time before August 1, 2009, provided the MMC is eligible for relicensing. @end enumerate @c fakenode --- for prepinfo @unnumberedsec ADDENDUM: How to use this License for your documents To use this License in a document you have written, include a copy of the License in the document and put the following copyright and license notices just after the title page: @smallexample @group Copyright (C) @var{year} @var{your name}. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.3 or any later version published by the Free Software Foundation; with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. A copy of the license is included in the section entitled ``GNU Free Documentation License''. @end group @end smallexample If you have Invariant Sections, Front-Cover Texts and Back-Cover Texts, replace the ``with@dots{}Texts.'' line with this: @smallexample @group with the Invariant Sections being @var{list their titles}, with the Front-Cover Texts being @var{list}, and with the Back-Cover Texts being @var{list}. @end group @end smallexample If you have Invariant Sections without Cover Texts, or some other combination of the three, merge those two alternatives to suit the situation. If your document contains nontrivial examples of program code, we recommend releasing these examples in parallel under your choice of free software license, such as the GNU General Public License, to permit their use in free software. @c Local Variables: @c ispell-local-pdict: "ispell-dict" @c End: @node Index, , GNU Free Documentation License, Top @comment node-name, next, previous, up @unnumbered Index @printindex cp @bye Conventions: 1. Functions, built-in or otherwise, do NOT have () after them. 2. Gawk built-in vars and functions are in @code. Also program vars and functions. 3. HTTP method names are in @code. 4. Protocols such as echo, ftp, etc are in @samp. 5. URLs are in @url. 6. All RFCs in the index. Put a space between `RFC' and the number. gawk-doc-4.0.1+ds.orig/doc/process-flow.fig0000644000175000017500000000236011511377120017451 0ustar schotschot#FIG 3.2 Produced by xfig version 3.2.5b Landscape Center Metric A4 100.00 Single -2 1200 2 2 3 0 1 0 7 50 -1 -1 0.000 0 0 -1 0 0 6 4819 3540 5460 4181 6101 3540 5460 2899 4819 3540 4819 3540 2 1 0 1 0 7 50 -1 -1 0.000 0 0 -1 1 0 2 1 1 1.00 60.00 120.00 3960 3555 4770 3555 2 1 0 1 0 7 50 -1 -1 0.000 0 0 -1 1 0 2 1 1 1.00 60.00 120.00 6165 3555 6975 3555 2 4 0 1 0 7 50 -1 -1 0.000 0 0 5 0 0 5 2569 3240 2569 3877 3910 3877 3910 3240 2569 3240 2 4 0 1 0 7 50 -1 -1 0.000 0 0 5 0 0 5 7020 3240 7020 3881 8369 3881 8369 3240 7020 3240 2 1 0 1 0 7 50 -1 -1 0.000 0 0 -1 1 0 2 1 1 1.00 60.00 120.00 5490 4230 5490 5040 2 4 0 1 0 7 50 -1 -1 0.000 0 0 5 0 0 5 4953 5067 4953 5625 5980 5625 5980 5067 4953 5067 2 1 0 1 0 7 50 -1 -1 0.000 0 0 -1 1 0 3 1 1 1.00 60.00 120.00 4905 5355 4275 5355 4275 3600 4 0 0 50 -1 0 12 0.0000 4 150 480 5265 3375 More\001 4 0 0 50 -1 0 12 0.0000 4 150 420 5265 3630 Data\001 4 0 0 50 -1 0 12 0.0000 4 150 270 5265 3885 ?\001 4 0 0 50 -1 0 12 0.0000 4 150 270 6210 3465 No\001 4 0 0 50 -1 0 12 0.0000 4 150 330 5535 4455 Yes\001 4 0 0 50 -1 0 12 0.0000 4 150 1035 2745 3645 Initialization\001 4 0 0 50 -1 0 12 0.0000 4 195 810 7290 3600 Clean Up\001 4 0 0 50 -1 0 12 0.0000 4 150 690 5130 5400 Process\001 gawk-doc-4.0.1+ds.orig/doc/gawk.texi0000644000175000017500000440142211734665352016207 0ustar schotschot\input texinfo @c -*-texinfo-*- @c %**start of header (This is for running Texinfo on a region.) @setfilename gawk.info @settitle The GNU Awk User's Guide @c %**end of header (This is for running Texinfo on a region.) @dircategory Text creation and manipulation @direntry * Gawk: (gawk). A text scanning and processing language. @end direntry @dircategory Individual utilities @direntry * awk: (gawk)Invoking gawk. Text scanning and processing. @end direntry @set xref-automatic-section-title @c The following information should be updated here only! @c This sets the edition of the document, the version of gawk it @c applies to and all the info about who's publishing this edition @c These apply across the board. @set UPDATE-MONTH February, 2012 @set VERSION 4.0 @set PATCHLEVEL 1 @set FSF @set TITLE GAWK: Effective AWK Programming @set SUBTITLE A User's Guide for GNU Awk @set EDITION 4 @iftex @set DOCUMENT book @set CHAPTER chapter @set APPENDIX appendix @set SECTION section @set SUBSECTION subsection @set DARKCORNER @inmargin{@image{lflashlight,1cm}, @image{rflashlight,1cm}} @set COMMONEXT (c.e.) @end iftex @ifinfo @set DOCUMENT Info file @set CHAPTER major node @set APPENDIX major node @set SECTION minor node @set SUBSECTION node @set DARKCORNER (d.c.) @set COMMONEXT (c.e.) @end ifinfo @ifhtml @set DOCUMENT Web page @set CHAPTER chapter @set APPENDIX appendix @set SECTION section @set SUBSECTION subsection @set DARKCORNER (d.c.) @set COMMONEXT (c.e.) @end ifhtml @ifdocbook @set DOCUMENT book @set CHAPTER chapter @set APPENDIX appendix @set SECTION section @set SUBSECTION subsection @set DARKCORNER (d.c.) @set COMMONEXT (c.e.) @end ifdocbook @ifplaintext @set DOCUMENT book @set CHAPTER chapter @set APPENDIX appendix @set SECTION section @set SUBSECTION subsection @set DARKCORNER (d.c.) @set COMMONEXT (c.e.) @end ifplaintext @c some special symbols @iftex @set LEQ @math{@leq} @end iftex @ifnottex @set LEQ <= @end ifnottex @ifnottex @macro ii{text} @i{\text\} @end macro @end ifnottex @c For HTML, spell out email addresses, to avoid problems with @c address harvesters for spammers. @ifhtml @macro EMAIL{real,spelled} ``\spelled\'' @end macro @end ifhtml @ifnothtml @macro EMAIL{real,spelled} @email{\real\} @end macro @end ifnothtml @set FN file name @set FFN File Name @set DF data file @set DDF Data File @set PVERSION version @set CTL Ctrl @ignore Some comments on the layout for TeX. 1. Use at least texinfo.tex 2000-09-06.09 2. I have done A LOT of work to make this look good. There are `@page' commands and use of `@group ... @end group' in a number of places. If you muck with anything, it's your responsibility not to break the layout. @end ignore @c merge the function and variable indexes into the concept index @ifinfo @synindex fn cp @synindex vr cp @end ifinfo @iftex @syncodeindex fn cp @syncodeindex vr cp @end iftex @ifxml @syncodeindex fn cp @syncodeindex vr cp @end ifxml @c If "finalout" is commented out, the printed output will show @c black boxes that mark lines that are too long. Thus, it is @c unwise to comment it out when running a master in case there are @c overfulls which are deemed okay. @iftex @finalout @end iftex @copying Copyright @copyright{} 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2007, 2009, 2010, 2011, 2012 Free Software Foundation, Inc. @sp 2 This is Edition @value{EDITION} of @cite{@value{TITLE}: @value{SUBTITLE}}, for the @value{VERSION}.@value{PATCHLEVEL} (or later) version of the GNU implementation of AWK. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.3 or any later version published by the Free Software Foundation; with the Invariant Sections being ``GNU General Public License'', the Front-Cover texts being (a) (see below), and with the Back-Cover Texts being (b) (see below). A copy of the license is included in the section entitled ``GNU Free Documentation License''. @enumerate a @item ``A GNU Manual'' @item ``You have the freedom to copy and modify this GNU manual. Buying copies from the FSF supports it in developing GNU and promoting software freedom.'' @end enumerate @end copying @c Comment out the "smallbook" for technical review. Saves @c considerable paper. Remember to turn it back on *before* @c starting the page-breaking work. @c 4/2002: Karl Berry recommends commenting out this and the @c `@setchapternewpage odd', and letting users use `texi2dvi -t' @c if they want to waste paper. @c @smallbook @c Uncomment this for the release. Leaving it off saves paper @c during editing and review. @setchapternewpage odd @titlepage @title @value{TITLE} @subtitle @value{SUBTITLE} @subtitle Edition @value{EDITION} @subtitle @value{UPDATE-MONTH} @author Arnold D. Robbins @c Include the Distribution inside the titlepage environment so @c that headings are turned off. Headings on and off do not work. @page @vskip 0pt plus 1filll ``To boldly go where no man has gone before'' is a Registered Trademark of Paramount Pictures Corporation. @* @c sorry, i couldn't resist @sp 3 Published by: @sp 1 Free Software Foundation @* 51 Franklin Street, Fifth Floor @* Boston, MA 02110-1301 USA @* Phone: +1-617-542-5942 @* Fax: +1-617-542-2652 @* Email: @email{gnu@@gnu.org} @* URL: @uref{http://www.gnu.org/} @* @c This one is correct for gawk 3.1.0 from the FSF ISBN 1-882114-28-0 @* @sp 2 @insertcopying @end titlepage @c Thanks to Bob Chassell for directions on doing dedications. @iftex @headings off @page @w{ } @sp 9 @center @i{To Miriam, for making me complete.} @sp 1 @center @i{To Chana, for the joy you bring us.} @sp 1 @center @i{To Rivka, for the exponential increase.} @sp 1 @center @i{To Nachum, for the added dimension.} @sp 1 @center @i{To Malka, for the new beginning.} @w{ } @page @w{ } @page @headings on @end iftex @iftex @headings off @evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @| @oddheading @| @| @strong{@thischapter}@ @ @ @thispage @end iftex @ifnottex @ifnotxml @node Top @top General Introduction @c Preface node should come right after the Top @c node, in `unnumbered' sections, then the chapter, `What is gawk'. @c Licensing nodes are appendices, they're not central to AWK. This file documents @command{awk}, a program that you can use to select particular records in a file and perform operations upon them. @insertcopying @end ifnotxml @end ifnottex @menu * Foreword:: Some nice words about this @value{DOCUMENT}. * Preface:: What this @value{DOCUMENT} is about; brief history and acknowledgments. * Getting Started:: A basic introduction to using @command{awk}. How to run an @command{awk} program. Command-line syntax. * Invoking Gawk:: How to run @command{gawk}. * Regexp:: All about matching things using regular expressions. * Reading Files:: How to read files and manipulate fields. * Printing:: How to print using @command{awk}. Describes the @code{print} and @code{printf} statements. Also describes redirection of output. * Expressions:: Expressions are the basic building blocks of statements. * Patterns and Actions:: Overviews of patterns and actions. * Arrays:: The description and use of arrays. Also includes array-oriented control statements. * Functions:: Built-in and user-defined functions. * Internationalization:: Getting @command{gawk} to speak your language. * Advanced Features:: Stuff for advanced users, specific to @command{gawk}. * Library Functions:: A Library of @command{awk} Functions. * Sample Programs:: Many @command{awk} programs with complete explanations. * Debugger:: The @code{dgawk} debugger. * Language History:: The evolution of the @command{awk} language. * Installation:: Installing @command{gawk} under various operating systems. * Notes:: Notes about @command{gawk} extensions and possible future work. * Basic Concepts:: A very quick introduction to programming concepts. * Glossary:: An explanation of some unfamiliar terms. * Copying:: Your right to copy and distribute @command{gawk}. * GNU Free Documentation License:: The license for this @value{DOCUMENT}. * Index:: Concept and Variable Index. @detailmenu * History:: The history of @command{gawk} and @command{awk}. * Names:: What name to use to find @command{awk}. * This Manual:: Using this @value{DOCUMENT}. Includes sample input files that you can use. * Conventions:: Typographical Conventions. * Manual History:: Brief history of the GNU project and this @value{DOCUMENT}. * How To Contribute:: Helping to save the world. * Acknowledgments:: Acknowledgments. * Running gawk:: How to run @command{gawk} programs; includes command-line syntax. * One-shot:: Running a short throwaway @command{awk} program. * Read Terminal:: Using no input files (input from terminal instead). * Long:: Putting permanent @command{awk} programs in files. * Executable Scripts:: Making self-contained @command{awk} programs. * Comments:: Adding documentation to @command{gawk} programs. * Quoting:: More discussion of shell quoting issues. * DOS Quoting:: Quoting in Windows Batch Files. * Sample Data Files:: Sample data files for use in the @command{awk} programs illustrated in this @value{DOCUMENT}. * Very Simple:: A very simple example. * Two Rules:: A less simple one-line example using two rules. * More Complex:: A more complex example. * Statements/Lines:: Subdividing or combining statements into lines. * Other Features:: Other Features of @command{awk}. * When:: When to use @command{gawk} and when to use other things. * Command Line:: How to run @command{awk}. * Options:: Command-line options and their meanings. * Other Arguments:: Input file names and variable assignments. * Naming Standard Input:: How to specify standard input with other files. * Environment Variables:: The environment variables @command{gawk} uses. * AWKPATH Variable:: Searching directories for @command{awk} programs. * Other Environment Variables:: The environment variables. * Exit Status:: @command{gawk}'s exit status. * Include Files:: Including other files into your program. * Obsolete:: Obsolete Options and/or features. * Undocumented:: Undocumented Options and Features. * Regexp Usage:: How to Use Regular Expressions. * Escape Sequences:: How to write nonprinting characters. * Regexp Operators:: Regular Expression Operators. * Bracket Expressions:: What can go between @samp{[...]}. * GNU Regexp Operators:: Operators specific to GNU software. * Case-sensitivity:: How to do case-insensitive matching. * Leftmost Longest:: How much text matches. * Computed Regexps:: Using Dynamic Regexps. * Records:: Controlling how data is split into records. * Fields:: An introduction to fields. * Nonconstant Fields:: Nonconstant Field Numbers. * Changing Fields:: Changing the Contents of a Field. * Field Separators:: The field separator and how to change it. * Default Field Splitting:: How fields are normally separated. * Regexp Field Splitting:: Using regexps as the field separator. * Single Character Fields:: Making each character a separate field. * Command Line Field Separator:: Setting @code{FS} from the command-line. * Field Splitting Summary:: Some final points and a summary table. * Constant Size:: Reading constant width data. * Splitting By Content:: Defining Fields By Content * Multiple Line:: Reading multi-line records. * Getline:: Reading files under explicit program control using the @code{getline} function. * Plain Getline:: Using @code{getline} with no arguments. * Getline/Variable:: Using @code{getline} into a variable. * Getline/File:: Using @code{getline} from a file. * Getline/Variable/File:: Using @code{getline} into a variable from a file. * Getline/Pipe:: Using @code{getline} from a pipe. * Getline/Variable/Pipe:: Using @code{getline} into a variable from a pipe. * Getline/Coprocess:: Using @code{getline} from a coprocess. * Getline/Variable/Coprocess:: Using @code{getline} into a variable from a coprocess. * Getline Notes:: Important things to know about @code{getline}. * Getline Summary:: Summary of @code{getline} Variants. * Command line directories:: What happens if you put a directory on the command line. * Print:: The @code{print} statement. * Print Examples:: Simple examples of @code{print} statements. * Output Separators:: The output separators and how to change them. * OFMT:: Controlling Numeric Output With @code{print}. * Printf:: The @code{printf} statement. * Basic Printf:: Syntax of the @code{printf} statement. * Control Letters:: Format-control letters. * Format Modifiers:: Format-specification modifiers. * Printf Examples:: Several examples. * Redirection:: How to redirect output to multiple files and pipes. * Special Files:: File name interpretation in @command{gawk}. @command{gawk} allows access to inherited file descriptors. * Special FD:: Special files for I/O. * Special Network:: Special files for network communications. * Special Caveats:: Things to watch out for. * Close Files And Pipes:: Closing Input and Output Files and Pipes. * Values:: Constants, Variables, and Regular Expressions. * Constants:: String, numeric and regexp constants. * Scalar Constants:: Numeric and string constants. * Nondecimal-numbers:: What are octal and hex numbers. * Regexp Constants:: Regular Expression constants. * Using Constant Regexps:: When and how to use a regexp constant. * Variables:: Variables give names to values for later use. * Using Variables:: Using variables in your programs. * Assignment Options:: Setting variables on the command-line and a summary of command-line syntax. This is an advanced method of input. * Conversion:: The conversion of strings to numbers and vice versa. * All Operators:: @command{gawk}'s operators. * Arithmetic Ops:: Arithmetic operations (@samp{+}, @samp{-}, etc.) * Concatenation:: Concatenating strings. * Assignment Ops:: Changing the value of a variable or a field. * Increment Ops:: Incrementing the numeric value of a variable. * Truth Values and Conditions:: Testing for true and false. * Truth Values:: What is ``true'' and what is ``false''. * Typing and Comparison:: How variables acquire types and how this affects comparison of numbers and strings with @samp{<}, etc. * Variable Typing:: String type versus numeric type. * Comparison Operators:: The comparison operators. * POSIX String Comparison:: String comparison with POSIX rules. * Boolean Ops:: Combining comparison expressions using boolean operators @samp{||} (``or''), @samp{&&} (``and'') and @samp{!} (``not''). * Conditional Exp:: Conditional expressions select between two subexpressions under control of a third subexpression. * Function Calls:: A function call is an expression. * Precedence:: How various operators nest. * Locales:: How the locale affects things. * Pattern Overview:: What goes into a pattern. * Regexp Patterns:: Using regexps as patterns. * Expression Patterns:: Any expression can be used as a pattern. * Ranges:: Pairs of patterns specify record ranges. * BEGIN/END:: Specifying initialization and cleanup rules. * Using BEGIN/END:: How and why to use BEGIN/END rules. * I/O And BEGIN/END:: I/O issues in BEGIN/END rules. * BEGINFILE/ENDFILE:: Two special patterns for advanced control. * Empty:: The empty pattern, which matches every record. * Using Shell Variables:: How to use shell variables with @command{awk}. * Action Overview:: What goes into an action. * Statements:: Describes the various control statements in detail. * If Statement:: Conditionally execute some @command{awk} statements. * While Statement:: Loop until some condition is satisfied. * Do Statement:: Do specified action while looping until some condition is satisfied. * For Statement:: Another looping statement, that provides initialization and increment clauses. * Switch Statement:: Switch/case evaluation for conditional execution of statements based on a value. * Break Statement:: Immediately exit the innermost enclosing loop. * Continue Statement:: Skip to the end of the innermost enclosing loop. * Next Statement:: Stop processing the current input record. * Nextfile Statement:: Stop processing the current file. * Exit Statement:: Stop execution of @command{awk}. * Built-in Variables:: Summarizes the built-in variables. * User-modified:: Built-in variables that you change to control @command{awk}. * Auto-set:: Built-in variables where @command{awk} gives you information. * ARGC and ARGV:: Ways to use @code{ARGC} and @code{ARGV}. * Array Basics:: The basics of arrays. * Array Intro:: Introduction to Arrays * Reference to Elements:: How to examine one element of an array. * Assigning Elements:: How to change an element of an array. * Array Example:: Basic Example of an Array * Scanning an Array:: A variation of the @code{for} statement. It loops through the indices of an array's existing elements. * Controlling Scanning:: Controlling the order in which arrays are scanned. * Delete:: The @code{delete} statement removes an element from an array. * Numeric Array Subscripts:: How to use numbers as subscripts in @command{awk}. * Uninitialized Subscripts:: Using Uninitialized variables as subscripts. * Multi-dimensional:: Emulating multidimensional arrays in @command{awk}. * Multi-scanning:: Scanning multidimensional arrays. * Arrays of Arrays:: True multidimensional arrays. * Built-in:: Summarizes the built-in functions. * Calling Built-in:: How to call built-in functions. * Numeric Functions:: Functions that work with numbers, including @code{int()}, @code{sin()} and @code{rand()}. * String Functions:: Functions for string manipulation, such as @code{split()}, @code{match()} and @code{sprintf()}. * Gory Details:: More than you want to know about @samp{\} and @samp{&} with @code{sub()}, @code{gsub()}, and @code{gensub()}. * I/O Functions:: Functions for files and shell commands. * Time Functions:: Functions for dealing with timestamps. * Bitwise Functions:: Functions for bitwise operations. * Type Functions:: Functions for type information. * I18N Functions:: Functions for string translation. * User-defined:: Describes User-defined functions in detail. * Definition Syntax:: How to write definitions and what they mean. * Function Example:: An example function definition and what it does. * Function Caveats:: Things to watch out for. * Calling A Function:: Don't use spaces. * Variable Scope:: Controlling variable scope. * Pass By Value/Reference:: Passing parameters. * Return Statement:: Specifying the value a function returns. * Dynamic Typing:: How variable types can change at runtime. * Indirect Calls:: Choosing the function to call at runtime. * I18N and L10N:: Internationalization and Localization. * Explaining gettext:: How GNU @code{gettext} works. * Programmer i18n:: Features for the programmer. * Translator i18n:: Features for the translator. * String Extraction:: Extracting marked strings. * Printf Ordering:: Rearranging @code{printf} arguments. * I18N Portability:: @command{awk}-level portability issues. * I18N Example:: A simple i18n example. * Gawk I18N:: @command{gawk} is also internationalized. * Nondecimal Data:: Allowing nondecimal input data. * Array Sorting:: Facilities for controlling array traversal and sorting arrays. * Controlling Array Traversal:: How to use PROCINFO["sorted_in"]. * Array Sorting Functions:: How to use @code{asort()} and @code{asorti()}. * Two-way I/O:: Two-way communications with another process. * TCP/IP Networking:: Using @command{gawk} for network programming. * Profiling:: Profiling your @command{awk} programs. * Library Names:: How to best name private global variables in library functions. * General Functions:: Functions that are of general use. * Strtonum Function:: A replacement for the built-in @code{strtonum()} function. * Assert Function:: A function for assertions in @command{awk} programs. * Round Function:: A function for rounding if @code{sprintf()} does not do it correctly. * Cliff Random Function:: The Cliff Random Number Generator. * Ordinal Functions:: Functions for using characters as numbers and vice versa. * Join Function:: A function to join an array into a string. * Gettimeofday Function:: A function to get formatted times. * Data File Management:: Functions for managing command-line data files. * Filetrans Function:: A function for handling data file transitions. * Rewind Function:: A function for rereading the current file. * File Checking:: Checking that data files are readable. * Empty Files:: Checking for zero-length files. * Ignoring Assigns:: Treating assignments as file names. * Getopt Function:: A function for processing command-line arguments. * Passwd Functions:: Functions for getting user information. * Group Functions:: Functions for getting group information. * Walking Arrays:: A function to walk arrays of arrays. * Running Examples:: How to run these examples. * Clones:: Clones of common utilities. * Cut Program:: The @command{cut} utility. * Egrep Program:: The @command{egrep} utility. * Id Program:: The @command{id} utility. * Split Program:: The @command{split} utility. * Tee Program:: The @command{tee} utility. * Uniq Program:: The @command{uniq} utility. * Wc Program:: The @command{wc} utility. * Miscellaneous Programs:: Some interesting @command{awk} programs. * Dupword Program:: Finding duplicated words in a document. * Alarm Program:: An alarm clock. * Translate Program:: A program similar to the @command{tr} utility. * Labels Program:: Printing mailing labels. * Word Sorting:: A program to produce a word usage count. * History Sorting:: Eliminating duplicate entries from a history file. * Extract Program:: Pulling out programs from Texinfo source files. * Simple Sed:: A Simple Stream Editor. * Igawk Program:: A wrapper for @command{awk} that includes files. * Anagram Program:: Finding anagrams from a dictionary. * Signature Program:: People do amazing things with too much time on their hands. * Debugging:: Introduction to @command{dgawk}. * Debugging Concepts:: Debugging In General. * Debugging Terms:: Additional Debugging Concepts. * Awk Debugging:: Awk Debugging. * Sample dgawk session:: Sample @command{dgawk} session. * dgawk invocation:: @command{dgawk} Invocation. * Finding The Bug:: Finding The Bug. * List of Debugger Commands:: Main @command{dgawk} Commands. * Breakpoint Control:: Control of breakpoints. * Dgawk Execution Control:: Control of execution. * Viewing And Changing Data:: Viewing and changing data. * Dgawk Stack:: Dealing with the stack. * Dgawk Info:: Obtaining information about the program and the debugger state. * Miscellaneous Dgawk Commands:: Miscellaneous Commands. * Readline Support:: Readline Support. * Dgawk Limitations:: Limitations and future plans. * V7/SVR3.1:: The major changes between V7 and System V Release 3.1. * SVR4:: Minor changes between System V Releases 3.1 and 4. * POSIX:: New features from the POSIX standard. * BTL:: New features from Brian Kernighan's version of @command{awk}. * POSIX/GNU:: The extensions in @command{gawk} not in POSIX @command{awk}. * Common Extensions:: Common Extensions Summary. * Ranges and Locales:: How locales used to affect regexp ranges. * Contributors:: The major contributors to @command{gawk}. * Gawk Distribution:: What is in the @command{gawk} distribution. * Getting:: How to get the distribution. * Extracting:: How to extract the distribution. * Distribution contents:: What is in the distribution. * Unix Installation:: Installing @command{gawk} under various versions of Unix. * Quick Installation:: Compiling @command{gawk} under Unix. * Additional Configuration Options:: Other compile-time options. * Configuration Philosophy:: How it's all supposed to work. * Non-Unix Installation:: Installation on Other Operating Systems. * PC Installation:: Installing and Compiling @command{gawk} on MS-DOS and OS/2. * PC Binary Installation:: Installing a prepared distribution. * PC Compiling:: Compiling @command{gawk} for MS-DOS, Windows32, and OS/2. * PC Testing:: Testing @command{gawk} on PC systems. * PC Using:: Running @command{gawk} on MS-DOS, Windows32 and OS/2. * Cygwin:: Building and running @command{gawk} for Cygwin. * MSYS:: Using @command{gawk} In The MSYS Environment. * VMS Installation:: Installing @command{gawk} on VMS. * VMS Compilation:: How to compile @command{gawk} under VMS. * VMS Installation Details:: How to install @command{gawk} under VMS. * VMS Running:: How to run @command{gawk} under VMS. * VMS Old Gawk:: An old version comes with some VMS systems. * Bugs:: Reporting Problems and Bugs. * Other Versions:: Other freely available @command{awk} implementations. * Compatibility Mode:: How to disable certain @command{gawk} extensions. * Additions:: Making Additions To @command{gawk}. * Accessing The Source:: Accessing the Git repository. * Adding Code:: Adding code to the main body of @command{gawk}. * New Ports:: Porting @command{gawk} to a new operating system. * Dynamic Extensions:: Adding new built-in functions to @command{gawk}. * Internals:: A brief look at some @command{gawk} internals. * Plugin License:: A note about licensing. * Sample Library:: A example of new functions. * Internal File Description:: What the new functions will do. * Internal File Ops:: The code for internal file operations. * Using Internal File Ops:: How to use an external extension. * Future Extensions:: New features that may be implemented one day. * Basic High Level:: The high level view. * Basic Data Typing:: A very quick intro to data types. * Floating Point Issues:: Stuff to know about floating-point numbers. * String Conversion Precision:: The String Value Can Lie. * Unexpected Results:: Floating Point Numbers Are Not Abstract Numbers. * POSIX Floating Point Problems:: Standards Versus Existing Practice. @end detailmenu @end menu @c dedication for Info file @ifinfo @center To Miriam, for making me complete. @sp 1 @center To Chana, for the joy you bring us. @sp 1 @center To Rivka, for the exponential increase. @sp 1 @center To Nachum, for the added dimension. @sp 1 @center To Malka, for the new beginning. @end ifinfo @summarycontents @contents @node Foreword @unnumbered Foreword Arnold Robbins and I are good friends. We were introduced @c 11 years ago in 1990 by circumstances---and our favorite programming language, AWK. The circumstances started a couple of years earlier. I was working at a new job and noticed an unplugged Unix computer sitting in the corner. No one knew how to use it, and neither did I. However, a couple of days later it was running, and I was @code{root} and the one-and-only user. That day, I began the transition from statistician to Unix programmer. On one of many trips to the library or bookstore in search of books on Unix, I found the gray AWK book, a.k.a.@: Aho, Kernighan and Weinberger, @cite{The AWK Programming Language}, Addison-Wesley, 1988. AWK's simple programming paradigm---find a pattern in the input and then perform an action---often reduced complex or tedious data manipulations to few lines of code. I was excited to try my hand at programming in AWK. Alas, the @command{awk} on my computer was a limited version of the language described in the AWK book. I discovered that my computer had ``old @command{awk}'' and the AWK book described ``new @command{awk}.'' I learned that this was typical; the old version refused to step aside or relinquish its name. If a system had a new @command{awk}, it was invariably called @command{nawk}, and few systems had it. The best way to get a new @command{awk} was to @command{ftp} the source code for @command{gawk} from @code{prep.ai.mit.edu}. @command{gawk} was a version of new @command{awk} written by David Trueman and Arnold, and available under the GNU General Public License. (Incidentally, it's no longer difficult to find a new @command{awk}. @command{gawk} ships with GNU/Linux, and you can download binaries or source code for almost any system; my wife uses @command{gawk} on her VMS box.) My Unix system started out unplugged from the wall; it certainly was not plugged into a network. So, oblivious to the existence of @command{gawk} and the Unix community in general, and desiring a new @command{awk}, I wrote my own, called @command{mawk}. Before I was finished I knew about @command{gawk}, but it was too late to stop, so I eventually posted to a @code{comp.sources} newsgroup. A few days after my posting, I got a friendly email from Arnold introducing himself. He suggested we share design and algorithms and attached a draft of the POSIX standard so that I could update @command{mawk} to support language extensions added after publication of the AWK book. Frankly, if our roles had been reversed, I would not have been so open and we probably would have never met. I'm glad we did meet. He is an AWK expert's AWK expert and a genuinely nice person. Arnold contributes significant amounts of his expertise and time to the Free Software Foundation. This book is the @command{gawk} reference manual, but at its core it is a book about AWK programming that will appeal to a wide audience. It is a definitive reference to the AWK language as defined by the 1987 Bell Laboratories release and codified in the 1992 POSIX Utilities standard. On the other hand, the novice AWK programmer can study a wealth of practical programs that emphasize the power of AWK's basic idioms: data driven control-flow, pattern matching with regular expressions, and associative arrays. Those looking for something new can try out @command{gawk}'s interface to network protocols via special @file{/inet} files. The programs in this book make clear that an AWK program is typically much smaller and faster to develop than a counterpart written in C. Consequently, there is often a payoff to prototype an algorithm or design in AWK to get it running quickly and expose problems early. Often, the interpreted performance is adequate and the AWK prototype becomes the product. The new @command{pgawk} (profiling @command{gawk}), produces program execution counts. I recently experimented with an algorithm that for @math{n} lines of input, exhibited @tex $\sim\! Cn^2$ @end tex @ifnottex ~ C n^2 @end ifnottex performance, while theory predicted @tex $\sim\! Cn\log n$ @end tex @ifnottex ~ C n log n @end ifnottex behavior. A few minutes poring over the @file{awkprof.out} profile pinpointed the problem to a single line of code. @command{pgawk} is a welcome addition to my programmer's toolbox. Arnold has distilled over a decade of experience writing and using AWK programs, and developing @command{gawk}, into this book. If you use AWK or want to learn how, then read this book. @display Michael Brennan Author of @command{mawk} March, 2001 @end display @node Preface @unnumbered Preface @c I saw a comment somewhere that the preface should describe the book itself, @c and the introduction should describe what the book covers. @c @c 12/2000: Chuck wants the preface & intro combined. Several kinds of tasks occur repeatedly when working with text files. You might want to extract certain lines and discard the rest. Or you may need to make changes wherever certain patterns appear, but leave the rest of the file alone. Writing single-use programs for these tasks in languages such as C, C++, or Java is time-consuming and inconvenient. Such jobs are often easier with @command{awk}. The @command{awk} utility interprets a special-purpose programming language that makes it easy to handle simple data-reformatting jobs. The GNU implementation of @command{awk} is called @command{gawk}; if you invoke it with the proper options or environment variables (@pxref{Options}), it is fully compatible with the POSIX@footnote{The 2008 POSIX standard can be found online at @url{http://www.opengroup.org/onlinepubs/9699919799/}.} specification of the @command{awk} language and with the Unix version of @command{awk} maintained by Brian Kernighan. This means that all properly written @command{awk} programs should work with @command{gawk}. Thus, we usually don't distinguish between @command{gawk} and other @command{awk} implementations. @cindex @command{awk}, POSIX and, See Also POSIX @command{awk} @cindex @command{awk}, POSIX and @cindex POSIX, @command{awk} and @cindex @command{gawk}, @command{awk} and @cindex @command{awk}, @command{gawk} and @cindex @command{awk}, uses for Using @command{awk} allows you to: @itemize @bullet @item Manage small, personal databases @item Generate reports @item Validate data @item Produce indexes and perform other document preparation tasks @item Experiment with algorithms that you can adapt later to other computer languages @end itemize @cindex @command{awk}, See Also @command{gawk} @cindex @command{gawk}, See Also @command{awk} @cindex @command{gawk}, uses for In addition, @command{gawk} provides facilities that make it easy to: @itemize @bullet @item Extract bits and pieces of data for processing @item Sort data @item Perform simple network communications @end itemize This @value{DOCUMENT} teaches you about the @command{awk} language and how you can use it effectively. You should already be familiar with basic system commands, such as @command{cat} and @command{ls},@footnote{These commands are available on POSIX-compliant systems, as well as on traditional Unix-based systems. If you are using some other operating system, you still need to be familiar with the ideas of I/O redirection and pipes.} as well as basic shell facilities, such as input/output (I/O) redirection and pipes. @cindex GNU @command{awk}, See @command{gawk} Implementations of the @command{awk} language are available for many different computing environments. This @value{DOCUMENT}, while describing the @command{awk} language in general, also describes the particular implementation of @command{awk} called @command{gawk} (which stands for ``GNU awk''). @command{gawk} runs on a broad range of Unix systems, ranging from Intel@registeredsymbol{}-architecture PC-based computers up through large-scale systems, such as Crays. @command{gawk} has also been ported to Mac OS X, Microsoft Windows (all versions) and OS/2 PCs, and VMS. (Some other, obsolete systems to which @command{gawk} was once ported are no longer supported and the code for those systems has been removed.) @menu * History:: The history of @command{gawk} and @command{awk}. * Names:: What name to use to find @command{awk}. * This Manual:: Using this @value{DOCUMENT}. Includes sample input files that you can use. * Conventions:: Typographical Conventions. * Manual History:: Brief history of the GNU project and this @value{DOCUMENT}. * How To Contribute:: Helping to save the world. * Acknowledgments:: Acknowledgments. @end menu @node History @unnumberedsec History of @command{awk} and @command{gawk} @cindex recipe for a programming language @cindex programming language, recipe for @center Recipe For A Programming Language @multitable {2 parts} {1 part @code{egrep}} {1 part @code{snobol}} @item @tab 1 part @code{egrep} @tab 1 part @code{snobol} @item @tab 2 parts @code{ed} @tab 3 parts C @end multitable @quotation Blend all parts well using @code{lex} and @code{yacc}. Document minimally and release. After eight years, add another part @code{egrep} and two more parts C. Document very well and release. @end quotation @cindex Aho, Alfred @cindex Weinberger, Peter @cindex Kernighan, Brian @cindex @command{awk}, history of The name @command{awk} comes from the initials of its designers: Alfred V.@: Aho, Peter J.@: Weinberger and Brian W.@: Kernighan. The original version of @command{awk} was written in 1977 at AT&T Bell Laboratories. In 1985, a new version made the programming language more powerful, introducing user-defined functions, multiple input streams, and computed regular expressions. This new version became widely available with Unix System V Release 3.1 (1987). The version in System V Release 4 (1989) added some new features and cleaned up the behavior in some of the ``dark corners'' of the language. The specification for @command{awk} in the POSIX Command Language and Utilities standard further clarified the language. Both the @command{gawk} designers and the original Bell Laboratories @command{awk} designers provided feedback for the POSIX specification. @cindex Rubin, Paul @cindex Fenlason, Jay @cindex Trueman, David Paul Rubin wrote the GNU implementation, @command{gawk}, in 1986. Jay Fenlason completed it, with advice from Richard Stallman. John Woods contributed parts of the code as well. In 1988 and 1989, David Trueman, with help from me, thoroughly reworked @command{gawk} for compatibility with the newer @command{awk}. Circa 1994, I became the primary maintainer. Current development focuses on bug fixes, performance improvements, standards compliance, and occasionally, new features. In May of 1997, J@"urgen Kahrs felt the need for network access from @command{awk}, and with a little help from me, set about adding features to do this for @command{gawk}. At that time, he also wrote the bulk of @cite{TCP/IP Internetworking with @command{gawk}} (a separate document, available as part of the @command{gawk} distribution). His code finally became part of the main @command{gawk} distribution with @command{gawk} @value{PVERSION} 3.1. John Haque rewrote the @command{gawk} internals, in the process providing an @command{awk}-level debugger. This version became available as @command{gawk} @value{PVERSION} 4.0, in 2011. @xref{Contributors}, for a complete list of those who made important contributions to @command{gawk}. @node Names @section A Rose by Any Other Name @cindex @command{awk}, new vs.@: old The @command{awk} language has evolved over the years. Full details are provided in @ref{Language History}. The language described in this @value{DOCUMENT} is often referred to as ``new @command{awk}'' (@command{nawk}). @cindex @command{awk}, versions of Because of this, there are systems with multiple versions of @command{awk}. Some systems have an @command{awk} utility that implements the original version of the @command{awk} language and a @command{nawk} utility for the new version. Others have an @command{oawk} version for the ``old @command{awk}'' language and plain @command{awk} for the new one. Still others only have one version, which is usually the new one.@footnote{Often, these systems use @command{gawk} for their @command{awk} implementation!} @cindex @command{nawk} utility @cindex @command{oawk} utility All in all, this makes it difficult for you to know which version of @command{awk} you should run when writing your programs. The best advice we can give here is to check your local documentation. Look for @command{awk}, @command{oawk}, and @command{nawk}, as well as for @command{gawk}. It is likely that you already have some version of new @command{awk} on your system, which is what you should use when running your programs. (Of course, if you're reading this @value{DOCUMENT}, chances are good that you have @command{gawk}!) Throughout this @value{DOCUMENT}, whenever we refer to a language feature that should be available in any complete implementation of POSIX @command{awk}, we simply use the term @command{awk}. When referring to a feature that is specific to the GNU implementation, we use the term @command{gawk}. @node This Manual @section Using This Book @cindex @command{awk}, terms describing The term @command{awk} refers to a particular program as well as to the language you use to tell this program what to do. When we need to be careful, we call the language ``the @command{awk} language,'' and the program ``the @command{awk} utility.'' This @value{DOCUMENT} explains both how to write programs in the @command{awk} language and how to run the @command{awk} utility. The term @dfn{@command{awk} program} refers to a program written by you in the @command{awk} programming language. @cindex @command{gawk}, @command{awk} and @cindex @command{awk}, @command{gawk} and @cindex POSIX @command{awk} Primarily, this @value{DOCUMENT} explains the features of @command{awk} as defined in the POSIX standard. It does so in the context of the @command{gawk} implementation. While doing so, it also attempts to describe important differences between @command{gawk} and other @command{awk} implementations.@footnote{All such differences appear in the index under the entry ``differences in @command{awk} and @command{gawk}.''} Finally, any @command{gawk} features that are not in the POSIX standard for @command{awk} are noted. @ifnotinfo This @value{DOCUMENT} has the difficult task of being both a tutorial and a reference. If you are a novice, feel free to skip over details that seem too complex. You should also ignore the many cross-references; they are for the expert user and for the online Info and HTML versions of the document. @end ifnotinfo There are subsections labeled as @strong{Advanced Notes} scattered throughout the @value{DOCUMENT}. They add a more complete explanation of points that are relevant, but not likely to be of interest on first reading. All appear in the index, under the heading ``advanced features.'' Most of the time, the examples use complete @command{awk} programs. Some of the more advanced sections show only the part of the @command{awk} program that illustrates the concept currently being described. While this @value{DOCUMENT} is aimed principally at people who have not been exposed to @command{awk}, there is a lot of information here that even the @command{awk} expert should find useful. In particular, the description of POSIX @command{awk} and the example programs in @ref{Library Functions}, and in @ref{Sample Programs}, should be of interest. @ref{Getting Started}, provides the essentials you need to know to begin using @command{awk}. @ref{Invoking Gawk}, describes how to run @command{gawk}, the meaning of its command-line options, and how it finds @command{awk} program source files. @ref{Regexp}, introduces regular expressions in general, and in particular the flavors supported by POSIX @command{awk} and @command{gawk}. @ref{Reading Files}, describes how @command{awk} reads your data. It introduces the concepts of records and fields, as well as the @code{getline} command. I/O redirection is first described here. Network I/O is also briefly introduced here. @ref{Printing}, describes how @command{awk} programs can produce output with @code{print} and @code{printf}. @ref{Expressions}, describes expressions, which are the basic building blocks for getting most things done in a program. @ref{Patterns and Actions}, describes how to write patterns for matching records, actions for doing something when a record is matched, and the built-in variables @command{awk} and @command{gawk} use. @ref{Arrays}, covers @command{awk}'s one-and-only data structure: associative arrays. Deleting array elements and whole arrays is also described, as well as sorting arrays in @command{gawk}. It also describes how @command{gawk} provides arrays of arrays. @ref{Functions}, describes the built-in functions @command{awk} and @command{gawk} provide, as well as how to define your own functions. @ref{Internationalization}, describes special features in @command{gawk} for translating program messages into different languages at runtime. @ref{Advanced Features}, describes a number of @command{gawk}-specific advanced features. Of particular note are the abilities to have two-way communications with another process, perform TCP/IP networking, and profile your @command{awk} programs. @ref{Library Functions}, and @ref{Sample Programs}, provide many sample @command{awk} programs. Reading them allows you to see @command{awk} solving real problems. @ref{Debugger}, describes the @command{awk} debugger, @command{dgawk}. @ref{Language History}, describes how the @command{awk} language has evolved since its first release to present. It also describes how @command{gawk} has acquired features over time. @ref{Installation}, describes how to get @command{gawk}, how to compile it on POSIX-compatible systems, and how to compile and use it on different non-POSIX systems. It also describes how to report bugs in @command{gawk} and where to get other freely available @command{awk} implementations. @ref{Notes}, describes how to disable @command{gawk}'s extensions, as well as how to contribute new code to @command{gawk}, how to write extension libraries, and some possible future directions for @command{gawk} development. @ref{Basic Concepts}, provides some very cursory background material for those who are completely unfamiliar with computer programming. Also centralized there is a discussion of some of the issues surrounding floating-point numbers. The @ref{Glossary}, defines most, if not all, the significant terms used throughout the book. If you find terms that you aren't familiar with, try looking them up here. @ref{Copying}, and @ref{GNU Free Documentation License}, present the licenses that cover the @command{gawk} source code and this @value{DOCUMENT}, respectively. @node Conventions @section Typographical Conventions @cindex Texinfo This @value{DOCUMENT} is written in @uref{http://texinfo.org, Texinfo}, the GNU documentation formatting language. A single Texinfo source file is used to produce both the printed and online versions of the documentation. @ifnotinfo Because of this, the typographical conventions are slightly different than in other books you may have read. @end ifnotinfo @ifinfo This @value{SECTION} briefly documents the typographical conventions used in Texinfo. @end ifinfo Examples you would type at the command-line are preceded by the common shell primary and secondary prompts, @samp{$} and @samp{>}. Input that you type is shown @kbd{like this}. Output from the command is preceded by the glyph ``@print{}''. This typically represents the command's standard output. Error messages, and other output on the command's standard error, are preceded by the glyph ``@error{}''. For example: @example $ @kbd{echo hi on stdout} @print{} hi on stdout $ @kbd{echo hello on stderr 1>&2} @error{} hello on stderr @end example @ifnotinfo In the text, command names appear in @code{this font}, while code segments appear in the same font and quoted, @samp{like this}. Options look like this: @option{-f}. Some things are emphasized @emph{like this}, and if a point needs to be made strongly, it is done @strong{like this}. The first occurrence of a new term is usually its @dfn{definition} and appears in the same font as the previous occurrence of ``definition'' in this sentence. Finally, @value{FN}s are indicated like this: @file{/path/to/ourfile}. @end ifnotinfo Characters that you type at the keyboard look @kbd{like this}. In particular, there are special characters called ``control characters.'' These are characters that you type by holding down both the @kbd{CONTROL} key and another key, at the same time. For example, a @kbd{@value{CTL}-d} is typed by first pressing and holding the @kbd{CONTROL} key, next pressing the @kbd{d} key and finally releasing both keys. @c fakenode --- for prepinfo @subsubheading Dark Corners @cindex Kernighan, Brian @quotation @i{Dark corners are basically fractal --- no matter how much you illuminate, there's always a smaller but darker one.}@* Brian Kernighan @end quotation @cindex d.c., See dark corner @cindex dark corner Until the POSIX standard (and @cite{@value{TITLE}}), many features of @command{awk} were either poorly documented or not documented at all. Descriptions of such features (often called ``dark corners'') are noted in this @value{DOCUMENT} with @iftex the picture of a flashlight in the margin, as shown here. @value{DARKCORNER} @end iftex @ifnottex ``(d.c.)''. @end ifnottex They also appear in the index under the heading ``dark corner.'' As noted by the opening quote, though, any coverage of dark corners is, by definition, incomplete. Extensions to the standard @command{awk} language that are supported by more than one @command{awk} implementation are marked ``@value{COMMONEXT},'' and listed in the index under ``common extensions'' and ``extensions, common.'' @node Manual History @unnumberedsec The GNU Project and This Book @cindex FSF (Free Software Foundation) @cindex Free Software Foundation (FSF) @cindex Stallman, Richard The Free Software Foundation (FSF) is a nonprofit organization dedicated to the production and distribution of freely distributable software. It was founded by Richard M.@: Stallman, the author of the original Emacs editor. GNU Emacs is the most widely used version of Emacs today. @cindex GNU Project @cindex GPL (General Public License) @cindex General Public License, See GPL @cindex documentation, online The GNU@footnote{GNU stands for ``GNU's not Unix.''} Project is an ongoing effort on the part of the Free Software Foundation to create a complete, freely distributable, POSIX-compliant computing environment. The FSF uses the ``GNU General Public License'' (GPL) to ensure that their software's source code is always available to the end user. A copy of the GPL is included @ifnotinfo in this @value{DOCUMENT} @end ifnotinfo for your reference (@pxref{Copying}). The GPL applies to the C language source code for @command{gawk}. To find out more about the FSF and the GNU Project online, see @uref{http://www.gnu.org, the GNU Project's home page}. This @value{DOCUMENT} may also be read from @uref{http://www.gnu.org/software/gawk/manual/, their web site}. A shell, an editor (Emacs), highly portable optimizing C, C++, and Objective-C compilers, a symbolic debugger and dozens of large and small utilities (such as @command{gawk}), have all been completed and are freely available. The GNU operating system kernel (the HURD), has been released but remains in an early stage of development. @cindex Linux @cindex GNU/Linux @cindex operating systems, BSD-based @cindex Alpha (DEC) Until the GNU operating system is more fully developed, you should consider using GNU/Linux, a freely distributable, Unix-like operating system for Intel@registeredsymbol{}, Power Architecture, Sun SPARC, IBM S/390, and other systems.@footnote{The terminology ``GNU/Linux'' is explained in the @ref{Glossary}.} Many GNU/Linux distributions are available for download from the Internet. (There are numerous other freely available, Unix-like operating systems based on the Berkeley Software Distribution, and some of them use recent versions of @command{gawk} for their versions of @command{awk}. @uref{http://www.netbsd.org, NetBSD}, @uref{http://www.freebsd.org, FreeBSD}, and @uref{http://www.openbsd.org, OpenBSD} are three of the most popular ones, but there are others.) @ifnotinfo The @value{DOCUMENT} you are reading is actually free---at least, the information in it is free to anyone. The machine-readable source code for the @value{DOCUMENT} comes with @command{gawk}; anyone may take this @value{DOCUMENT} to a copying machine and make as many copies as they like. (Take a moment to check the Free Documentation License in @ref{GNU Free Documentation License}.) @end ifnotinfo @ignore @cindex Close, Diane The @value{DOCUMENT} itself has gone through several previous, preliminary editions. Paul Rubin wrote the very first draft of @cite{The GAWK Manual}; it was around 40 pages in size. Diane Close and Richard Stallman improved it, yielding the version which I started working with in the fall of 1988. It was around 90 pages long and barely described the original, ``old'' version of @command{awk}. After substantial revision, the first version of the @cite{The GAWK Manual} to be released was Edition 0.11 Beta in October of 1989. The manual then underwent more substantial revision for Edition 0.13 of December 1991. David Trueman, Pat Rankin and Michal Jaegermann contributed sections of the manual for Edition 0.13. That edition was published by the FSF as a bound book early in 1992. Since then there were several minor revisions, notably Edition 0.14 of November 1992 that was published by the FSF in January of 1993 and Edition 0.16 of August 1993. Edition 1.0 of @cite{GAWK: The GNU Awk User's Guide} represented a significant re-working of @cite{The GAWK Manual}, with much additional material. The FSF and I agreed that I was now the primary author. @c I also felt that the manual needed a more descriptive title. In January 1996, SSC published Edition 1.0 under the title @cite{Effective AWK Programming}. In February 1997, they published Edition 1.0.3 which had minor changes as a ``second edition.'' In 1999, the FSF published this same version as Edition 2 of @cite{GAWK: The GNU Awk User's Guide}. Edition @value{EDITION} maintains the basic structure of Edition 1.0, but with significant additional material, reflecting the host of new features in @command{gawk} @value{PVERSION} @value{VERSION}. Of particular note is @ref{Array Sorting}, @ref{Bitwise Functions}, @ref{Internationalization}, @ref{Advanced Features}, and @ref{Dynamic Extensions}. @end ignore @cindex Close, Diane The @value{DOCUMENT} itself has gone through a number of previous editions. Paul Rubin wrote the very first draft of @cite{The GAWK Manual}; it was around 40 pages in size. Diane Close and Richard Stallman improved it, yielding a version that was around 90 pages long and barely described the original, ``old'' version of @command{awk}. I started working with that version in the fall of 1988. As work on it progressed, the FSF published several preliminary versions (numbered 0.@var{x}). In 1996, Edition 1.0 was released with @command{gawk} 3.0.0. The FSF published the first two editions under the title @cite{The GNU Awk User's Guide}. This edition maintains the basic structure of the previous editions. For Edition 4.0, the content has been thoroughly reviewed and updated. All references to versions prior to 4.0 have been removed. Of significant note for this edition is @ref{Debugger}. @cite{@value{TITLE}} will undoubtedly continue to evolve. An electronic version comes with the @command{gawk} distribution from the FSF. If you find an error in this @value{DOCUMENT}, please report it! @xref{Bugs}, for information on submitting problem reports electronically. @node How To Contribute @unnumberedsec How to Contribute As the maintainer of GNU @command{awk}, I once thought that I would be able to manage a collection of publicly available @command{awk} programs and I even solicited contributions. Making things available on the Internet helps keep the @command{gawk} distribution down to manageable size. The initial collection of material, such as it is, is still available at @uref{ftp://ftp.freefriends.org/arnold/Awkstuff}. In the hopes of doing something more broad, I acquired the @code{awk.info} domain. However, I found that I could not dedicate enough time to managing contributed code: the archive did not grow and the domain went unused for several years. Fortunately, late in 2008, a volunteer took on the task of setting up an @command{awk}-related web site---@uref{http://awk.info}---and did a very nice job. If you have written an interesting @command{awk} program, or have written a @command{gawk} extension that you would like to share with the rest of the world, please see @uref{http://awk.info/?contribute} for how to contribute it to the web site. @ignore Other links: http://www.reddit.com/r/linux/comments/dtect/composing_music_in_awk/ @end ignore @node Acknowledgments @unnumberedsec Acknowledgments The initial draft of @cite{The GAWK Manual} had the following acknowledgments: @quotation Many people need to be thanked for their assistance in producing this manual. Jay Fenlason contributed many ideas and sample programs. Richard Mlynarik and Robert Chassell gave helpful comments on drafts of this manual. The paper @cite{A Supplemental Document for @command{awk}} by John W.@: Pierce of the Chemistry Department at UC San Diego, pinpointed several issues relevant both to @command{awk} implementation and to this manual, that would otherwise have escaped us. @end quotation @cindex Stallman, Richard I would like to acknowledge Richard M.@: Stallman, for his vision of a better world and for his courage in founding the FSF and starting the GNU Project. Earlier editions of this @value{DOCUMENT} had the following acknowledgements: @quotation The following people (in alphabetical order) provided helpful comments on various versions of this book, Rick Adams, Dr.@: Nelson H.F. Beebe, Karl Berry, Dr.@: Michael Brennan, Rich Burridge, Claire Cloutier, Diane Close, Scott Deifik, Christopher (``Topher'') Eliot, Jeffrey Friedl, Dr.@: Darrel Hankerson, Michal Jaegermann, Dr.@: Richard J.@: LeBlanc, Michael Lijewski, Pat Rankin, Miriam Robbins, Mary Sheehan, and Chuck Toporek. @cindex Berry, Karl @cindex Chassell, Robert J.@: @c @cindex Texinfo Robert J.@: Chassell provided much valuable advice on the use of Texinfo. He also deserves special thanks for convincing me @emph{not} to title this @value{DOCUMENT} @cite{How To Gawk Politely}. Karl Berry helped significantly with the @TeX{} part of Texinfo. @cindex Hartholz, Marshall @cindex Hartholz, Elaine @cindex Schreiber, Bert @cindex Schreiber, Rita I would like to thank Marshall and Elaine Hartholz of Seattle and Dr.@: Bert and Rita Schreiber of Detroit for large amounts of quiet vacation time in their homes, which allowed me to make significant progress on this @value{DOCUMENT} and on @command{gawk} itself. @cindex Hughes, Phil Phil Hughes of SSC contributed in a very important way by loaning me his laptop GNU/Linux system, not once, but twice, which allowed me to do a lot of work while away from home. @cindex Trueman, David David Trueman deserves special credit; he has done a yeoman job of evolving @command{gawk} so that it performs well and without bugs. Although he is no longer involved with @command{gawk}, working with him on this project was a significant pleasure. @cindex Drepper, Ulrich @cindex GNITS mailing list @cindex mailing list, GNITS The intrepid members of the GNITS mailing list, and most notably Ulrich Drepper, provided invaluable help and feedback for the design of the internationalization features. Chuck Toporek, Mary Sheehan, and Claire Coutier of O'Reilly & Associates contributed significant editorial help for this @value{DOCUMENT} for the 3.1 release of @command{gawk}. @end quotation @cindex Beebe, Nelson @cindex Buening, Andreas @cindex Colombo, Antonio @cindex Davies, Stephen @cindex Deifik, Scott @cindex DuBois, John @cindex Hankerson, Darrel @cindex Haque, John @cindex Jaegermann, Michal @cindex Kahrs, J@"urgen @cindex Kasal, Stepan @cindex Pitts, Dave @cindex Rankin, Pat @cindex Schorr, Andrew @cindex Vinschen, Corinna @cindex Wallin, Anders @cindex Zaretskii, Eli Dr.@: Nelson Beebe, Andreas Buening, Antonio Colombo, Stephen Davies, Scott Deifik, John H. DuBois III, Darrel Hankerson, Michal Jaegermann, J@"urgen Kahrs, Dave Pitts, Stepan Kasal, Pat Rankin, Andrew Schorr, Corinna Vinschen, Anders Wallin, and Eli Zaretskii (in alphabetical order) make up the current @command{gawk} ``crack portability team.'' Without their hard work and help, @command{gawk} would not be nearly the fine program it is today. It has been and continues to be a pleasure working with this team of fine people. John Haque contributed the modifications to convert @command{gawk} into a byte-code interpreter, including the debugger. Stephen Davies contributed to the effort to bring the byte-code changes into the mainstream code base. Efraim Yawitz contributed the initial text of @ref{Debugger}. @cindex Kernighan, Brian I would like to thank Brian Kernighan for invaluable assistance during the testing and debugging of @command{gawk}, and for ongoing help and advice in clarifying numerous points about the language. We could not have done nearly as good a job on either @command{gawk} or its documentation without his help. @cindex Robbins, Miriam @cindex Robbins, Jean @cindex Robbins, Harry @cindex G-d I must thank my wonderful wife, Miriam, for her patience through the many versions of this project, for her proofreading, and for sharing me with the computer. I would like to thank my parents for their love, and for the grace with which they raised and educated me. Finally, I also must acknowledge my gratitude to G-d, for the many opportunities He has sent my way, as well as for the gifts He has given me with which to take advantage of those opportunities. @sp 2 @noindent Arnold Robbins @* Nof Ayalon @* ISRAEL @* March, 2011 @ignore @c Try this @iftex @page @headings off @majorheading I@ @ @ @ The @command{awk} Language and @command{gawk} Part I describes the @command{awk} language and @command{gawk} program in detail. It starts with the basics, and continues through all of the features of @command{awk} and @command{gawk}. It contains the following chapters: @itemize @bullet @item @ref{Getting Started}. @item @ref{Regexp}. @item @ref{Reading Files}. @item @ref{Printing}. @item @ref{Expressions}. @item @ref{Patterns and Actions}. @item @ref{Arrays}. @item @ref{Functions}. @item @ref{Internationalization}. @item @ref{Advanced Features}. @item @ref{Invoking Gawk}. @end itemize @page @evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @| @oddheading @| @| @strong{@thischapter}@ @ @ @thispage @end iftex @end ignore @node Getting Started @chapter Getting Started with @command{awk} @c @cindex script, definition of @c @cindex rule, definition of @c @cindex program, definition of @c @cindex basic function of @command{awk} @cindex @command{awk}, function of The basic function of @command{awk} is to search files for lines (or other units of text) that contain certain patterns. When a line matches one of the patterns, @command{awk} performs specified actions on that line. @command{awk} keeps processing input lines in this way until it reaches the end of the input files. @cindex @command{awk}, uses for @cindex programming languages@comma{} data-driven vs.@: procedural @cindex @command{awk} programs Programs in @command{awk} are different from programs in most other languages, because @command{awk} programs are @dfn{data-driven}; that is, you describe the data you want to work with and then what to do when you find it. Most other languages are @dfn{procedural}; you have to describe, in great detail, every step the program is to take. When working with procedural languages, it is usually much harder to clearly describe the data your program will process. For this reason, @command{awk} programs are often refreshingly easy to read and write. @cindex program, definition of @cindex rule, definition of When you run @command{awk}, you specify an @command{awk} @dfn{program} that tells @command{awk} what to do. The program consists of a series of @dfn{rules}. (It may also contain @dfn{function definitions}, an advanced feature that we will ignore for now. @xref{User-defined}.) Each rule specifies one pattern to search for and one action to perform upon finding the pattern. Syntactically, a rule consists of a pattern followed by an action. The action is enclosed in curly braces to separate it from the pattern. Newlines usually separate rules. Therefore, an @command{awk} program looks like this: @example @var{pattern} @{ @var{action} @} @var{pattern} @{ @var{action} @} @dots{} @end example @menu * Running gawk:: How to run @command{gawk} programs; includes command-line syntax. * Sample Data Files:: Sample data files for use in the @command{awk} programs illustrated in this @value{DOCUMENT}. * Very Simple:: A very simple example. * Two Rules:: A less simple one-line example using two rules. * More Complex:: A more complex example. * Statements/Lines:: Subdividing or combining statements into lines. * Other Features:: Other Features of @command{awk}. * When:: When to use @command{gawk} and when to use other things. @end menu @node Running gawk @section How to Run @command{awk} Programs @cindex @command{awk} programs, running There are several ways to run an @command{awk} program. If the program is short, it is easiest to include it in the command that runs @command{awk}, like this: @example awk '@var{program}' @var{input-file1} @var{input-file2} @dots{} @end example @cindex command line, formats When the program is long, it is usually more convenient to put it in a file and run it with a command like this: @example awk -f @var{program-file} @var{input-file1} @var{input-file2} @dots{} @end example This @value{SECTION} discusses both mechanisms, along with several variations of each. @menu * One-shot:: Running a short throwaway @command{awk} program. * Read Terminal:: Using no input files (input from terminal instead). * Long:: Putting permanent @command{awk} programs in files. * Executable Scripts:: Making self-contained @command{awk} programs. * Comments:: Adding documentation to @command{gawk} programs. * Quoting:: More discussion of shell quoting issues. @end menu @node One-shot @subsection One-Shot Throwaway @command{awk} Programs Once you are familiar with @command{awk}, you will often type in simple programs the moment you want to use them. Then you can write the program as the first argument of the @command{awk} command, like this: @example awk '@var{program}' @var{input-file1} @var{input-file2} @dots{} @end example @noindent where @var{program} consists of a series of @var{patterns} and @var{actions}, as described earlier. @cindex single quote (@code{'}) @cindex @code{'} (single quote) This command format instructs the @dfn{shell}, or command interpreter, to start @command{awk} and use the @var{program} to process records in the input file(s). There are single quotes around @var{program} so the shell won't interpret any @command{awk} characters as special shell characters. The quotes also cause the shell to treat all of @var{program} as a single argument for @command{awk}, and allow @var{program} to be more than one line long. @cindex shells, scripts @cindex @command{awk} programs, running, from shell scripts This format is also useful for running short or medium-sized @command{awk} programs from shell scripts, because it avoids the need for a separate file for the @command{awk} program. A self-contained shell script is more reliable because there are no other files to misplace. @ref{Very Simple}, @ifnotinfo later in this @value{CHAPTER}, @end ifnotinfo presents several short, self-contained programs. @node Read Terminal @subsection Running @command{awk} Without Input Files @cindex standard input @cindex input, standard @cindex input files, running @command{awk} without You can also run @command{awk} without any input files. If you type the following command line: @example awk '@var{program}' @end example @noindent @command{awk} applies the @var{program} to the @dfn{standard input}, which usually means whatever you type on the terminal. This continues until you indicate end-of-file by typing @kbd{@value{CTL}-d}. (On other operating systems, the end-of-file character may be different. For example, on OS/2, it is @kbd{@value{CTL}-z}.) @cindex files, input, See input files @cindex input files, running @command{awk} without @cindex @command{awk} programs, running, without input files As an example, the following program prints a friendly piece of advice (from Douglas Adams's @cite{The Hitchhiker's Guide to the Galaxy}), to keep you from worrying about the complexities of computer programming@footnote{If you use Bash as your shell, you should execute the command @samp{set +H} before running this program interactively, to disable the C shell-style command history, which treats @samp{!} as a special character. We recommend putting this command into your personal startup file.} (@code{BEGIN} is a feature we haven't discussed yet): @example $ @kbd{awk "BEGIN @{ print \"Don't Panic!\" @}"} @print{} Don't Panic! @end example @cindex quoting @cindex double quote (@code{"}) @cindex @code{"} (double quote) @cindex @code{\} (backslash) @cindex backslash (@code{\}) This program does not read any input. The @samp{\} before each of the inner double quotes is necessary because of the shell's quoting rules---in particular because it mixes both single quotes and double quotes.@footnote{Although we generally recommend the use of single quotes around the program text, double quotes are needed here in order to put the single quote into the message.} This next simple @command{awk} program emulates the @command{cat} utility; it copies whatever you type on the keyboard to its standard output (why this works is explained shortly). @example $ @kbd{awk '@{ print @}'} @kbd{Now is the time for all good men} @print{} Now is the time for all good men @kbd{to come to the aid of their country.} @print{} to come to the aid of their country. @kbd{Four score and seven years ago, ...} @print{} Four score and seven years ago, ... @kbd{What, me worry?} @print{} What, me worry? @kbd{@value{CTL}-d} @end example @node Long @subsection Running Long Programs @cindex @command{awk} programs, running @cindex @command{awk} programs, lengthy @cindex files, @command{awk} programs in Sometimes your @command{awk} programs can be very long. In this case, it is more convenient to put the program into a separate file. In order to tell @command{awk} to use that file for its program, you type: @example awk -f @var{source-file} @var{input-file1} @var{input-file2} @dots{} @end example @cindex @code{-f} option @cindex command line, options @cindex options, command-line The @option{-f} instructs the @command{awk} utility to get the @command{awk} program from the file @var{source-file}. Any @value{FN} can be used for @var{source-file}. For example, you could put the program: @example BEGIN @{ print "Don't Panic!" @} @end example @noindent into the file @file{advice}. Then this command: @example awk -f advice @end example @noindent does the same thing as this one: @example awk "BEGIN @{ print \"Don't Panic!\" @}" @end example @cindex quoting @noindent This was explained earlier (@pxref{Read Terminal}). Note that you don't usually need single quotes around the @value{FN} that you specify with @option{-f}, because most @value{FN}s don't contain any of the shell's special characters. Notice that in @file{advice}, the @command{awk} program did not have single quotes around it. The quotes are only needed for programs that are provided on the @command{awk} command line. @c STARTOFRANGE sq1x @cindex single quote (@code{'}) @c STARTOFRANGE qs2x @cindex @code{'} (single quote) If you want to clearly identify your @command{awk} program files as such, you can add the extension @file{.awk} to the @value{FN}. This doesn't affect the execution of the @command{awk} program but it does make ``housekeeping'' easier. @node Executable Scripts @subsection Executable @command{awk} Programs @cindex @command{awk} programs @cindex @code{#} (number sign), @code{#!} (executable scripts) @cindex number sign (@code{#}), @code{#!} (executable scripts) @cindex Unix, @command{awk} scripts and @cindex @code{#} (number sign), @code{#!} (executable scripts), portability issues with @cindex number sign (@code{#}), @code{#!} (executable scripts), portability issues with Once you have learned @command{awk}, you may want to write self-contained @command{awk} scripts, using the @samp{#!} script mechanism. You can do this on many systems.@footnote{The @samp{#!} mechanism works on GNU/Linux systems, BSD-based systems and commercial Unix systems.} For example, you could update the file @file{advice} to look like this: @example #! /bin/awk -f BEGIN @{ print "Don't Panic!" @} @end example @noindent After making this file executable (with the @command{chmod} utility), simply type @samp{advice} at the shell and the system arranges to run @command{awk}@footnote{The line beginning with @samp{#!} lists the full @value{FN} of an interpreter to run and an optional initial command-line argument to pass to that interpreter. The operating system then runs the interpreter with the given argument and the full argument list of the executed program. The first argument in the list is the full @value{FN} of the @command{awk} program. The rest of the argument list contains either options to @command{awk}, or @value{DF}s, or both. Note that on many systems @command{awk} may be found in @file{/usr/bin} instead of in @file{/bin}. Caveat Emptor.} as if you had typed @samp{awk -f advice}: @example $ @kbd{chmod +x advice} $ @kbd{advice} @print{} Don't Panic! @end example @noindent (We assume you have the current directory in your shell's search path variable [typically @code{$PATH}]. If not, you may need to type @samp{./advice} at the shell.) Self-contained @command{awk} scripts are useful when you want to write a program that users can invoke without their having to know that the program is written in @command{awk}. @c fakenode --- for prepinfo @subheading Advanced Notes: Portability Issues with @samp{#!} @cindex portability, @code{#!} (executable scripts) Some systems limit the length of the interpreter name to 32 characters. Often, this can be dealt with by using a symbolic link. You should not put more than one argument on the @samp{#!} line after the path to @command{awk}. It does not work. The operating system treats the rest of the line as a single argument and passes it to @command{awk}. Doing this leads to confusing behavior---most likely a usage diagnostic of some sort from @command{awk}. @cindex @code{ARGC}/@code{ARGV} variables, portability and @cindex portability, @code{ARGV} variable Finally, the value of @code{ARGV[0]} (@pxref{Built-in Variables}) varies depending upon your operating system. Some systems put @samp{awk} there, some put the full pathname of @command{awk} (such as @file{/bin/awk}), and some put the name of your script (@samp{advice}). @value{DARKCORNER} Don't rely on the value of @code{ARGV[0]} to provide your script name. @node Comments @subsection Comments in @command{awk} Programs @cindex @code{#} (number sign), commenting @cindex number sign (@code{#}), commenting @cindex commenting @cindex @command{awk} programs, documenting A @dfn{comment} is some text that is included in a program for the sake of human readers; it is not really an executable part of the program. Comments can explain what the program does and how it works. Nearly all programming languages have provisions for comments, as programs are typically hard to understand without them. In the @command{awk} language, a comment starts with the sharp sign character (@samp{#}) and continues to the end of the line. The @samp{#} does not have to be the first character on the line. The @command{awk} language ignores the rest of a line following a sharp sign. For example, we could have put the following into @file{advice}: @example # This program prints a nice friendly message. It helps # keep novice users from being afraid of the computer. BEGIN @{ print "Don't Panic!" @} @end example You can put comment lines into keyboard-composed throwaway @command{awk} programs, but this usually isn't very useful; the purpose of a comment is to help you or another person understand the program when reading it at a later time. @cindex quoting @cindex single quote (@code{'}), vs.@: apostrophe @cindex @code{'} (single quote), vs.@: apostrophe @quotation CAUTION As mentioned in @ref{One-shot}, you can enclose small to medium programs in single quotes, in order to keep your shell scripts self-contained. When doing so, @emph{don't} put an apostrophe (i.e., a single quote) into a comment (or anywhere else in your program). The shell interprets the quote as the closing quote for the entire program. As a result, usually the shell prints a message about mismatched quotes, and if @command{awk} actually runs, it will probably print strange messages about syntax errors. For example, look at the following: @example $ @kbd{awk '@{ print "hello" @} # let's be cute'} > @end example The shell sees that the first two quotes match, and that a new quoted object begins at the end of the command line. It therefore prompts with the secondary prompt, waiting for more input. With Unix @command{awk}, closing the quoted string produces this result: @example $ @kbd{awk '@{ print "hello" @} # let's be cute'} > @kbd{'} @error{} awk: can't open file be @error{} source line number 1 @end example @cindex @code{\} (backslash) @cindex backslash (@code{\}) Putting a backslash before the single quote in @samp{let's} wouldn't help, since backslashes are not special inside single quotes. The next @value{SUBSECTION} describes the shell's quoting rules. @end quotation @node Quoting @subsection Shell-Quoting Issues @cindex quoting, rules for @menu * DOS Quoting:: Quoting in Windows Batch Files. @end menu For short to medium length @command{awk} programs, it is most convenient to enter the program on the @command{awk} command line. This is best done by enclosing the entire program in single quotes. This is true whether you are entering the program interactively at the shell prompt, or writing it as part of a larger shell script: @example awk '@var{program text}' @var{input-file1} @var{input-file2} @dots{} @end example @cindex shells, quoting, rules for @cindex Bourne shell, quoting rules for Once you are working with the shell, it is helpful to have a basic knowledge of shell quoting rules. The following rules apply only to POSIX-compliant, Bourne-style shells (such as Bash, the GNU Bourne-Again Shell). If you use the C shell, you're on your own. @itemize @bullet @item Quoted items can be concatenated with nonquoted items as well as with other quoted items. The shell turns everything into one argument for the command. @item Preceding any single character with a backslash (@samp{\}) quotes that character. The shell removes the backslash and passes the quoted character on to the command. @item @cindex @code{\} (backslash) @cindex backslash (@code{\}) @cindex single quote (@code{'}) @cindex @code{'} (single quote) Single quotes protect everything between the opening and closing quotes. The shell does no interpretation of the quoted text, passing it on verbatim to the command. It is @emph{impossible} to embed a single quote inside single-quoted text. Refer back to @ref{Comments}, for an example of what happens if you try. @item @cindex double quote (@code{"}) @cindex @code{"} (double quote) Double quotes protect most things between the opening and closing quotes. The shell does at least variable and command substitution on the quoted text. Different shells may do additional kinds of processing on double-quoted text. Since certain characters within double-quoted text are processed by the shell, they must be @dfn{escaped} within the text. Of note are the characters @samp{$}, @samp{`}, @samp{\}, and @samp{"}, all of which must be preceded by a backslash within double-quoted text if they are to be passed on literally to the program. (The leading backslash is stripped first.) Thus, the example seen @ifnotinfo previously @end ifnotinfo in @ref{Read Terminal}, is applicable: @example $ @kbd{awk "BEGIN @{ print \"Don't Panic!\" @}"} @print{} Don't Panic! @end example @cindex single quote (@code{'}), with double quotes @cindex @code{'} (single quote), with double quotes Note that the single quote is not special within double quotes. @item Null strings are removed when they occur as part of a non-null command-line argument, while explicit non-null objects are kept. For example, to specify that the field separator @code{FS} should be set to the null string, use: @example awk -F "" '@var{program}' @var{files} # correct @end example @noindent @cindex null strings, quoting and Don't use this: @example awk -F"" '@var{program}' @var{files} # wrong! @end example @noindent In the second case, @command{awk} will attempt to use the text of the program as the value of @code{FS}, and the first @value{FN} as the text of the program! This results in syntax errors at best, and confusing behavior at worst. @end itemize @cindex quoting, tricks for Mixing single and double quotes is difficult. You have to resort to shell quoting tricks, like this: @example $ @kbd{awk 'BEGIN @{ print "Here is a single quote <'"'"'>" @}'} @print{} Here is a single quote <'> @end example @noindent This program consists of three concatenated quoted strings. The first and the third are single-quoted, the second is double-quoted. This can be ``simplified'' to: @example $ @kbd{awk 'BEGIN @{ print "Here is a single quote <'\''>" @}'} @print{} Here is a single quote <'> @end example @noindent Judge for yourself which of these two is the more readable. Another option is to use double quotes, escaping the embedded, @command{awk}-level double quotes: @example $ @kbd{awk "BEGIN @{ print \"Here is a single quote <'>\" @}"} @print{} Here is a single quote <'> @end example @noindent @c ENDOFRANGE sq1x @c ENDOFRANGE qs2x This option is also painful, because double quotes, backslashes, and dollar signs are very common in more advanced @command{awk} programs. A third option is to use the octal escape sequence equivalents (@pxref{Escape Sequences}) for the single- and double-quote characters, like so: @example $ @kbd{awk 'BEGIN @{ print "Here is a single quote <\47>" @}'} @print{} Here is a single quote <'> $ @kbd{awk 'BEGIN @{ print "Here is a double quote <\42>" @}'} @print{} Here is a double quote <"> @end example @noindent This works nicely, except that you should comment clearly what the escapes mean. A fourth option is to use command-line variable assignment, like this: @example $ awk -v sq="'" 'BEGIN @{ print "Here is a single quote <" sq ">" @}' @print{} Here is a single quote <'> @end example If you really need both single and double quotes in your @command{awk} program, it is probably best to move it into a separate file, where the shell won't be part of the picture, and you can say what you mean. @node DOS Quoting @subsubsection Quoting in MS-Windows Batch Files @ignore Date: Wed, 21 May 2008 09:58:43 +0200 (CEST) From: jeroen.brink@inter.NL.net Subject: (g)awk "contribution" To: arnold@skeeve.com Message-id: <42220.193.172.132.34.1211356723.squirrel@webmail.internl.net> Hello Arnold, maybe you can help me out. Found your email on the GNU/awk online manual pages. I've searched hard to figure out how, on Windows, to print double quotes. Couldn't find it in the Quotes area, nor on google or elsewhere. Finally i figured out how to do this myself. How to print all lines in a file surrounded by double quotes (on Windows): gawk "{ print \"\042\" $0 \"\042\" }" Maybe this is a helpfull tip for other (Windows) gawk users. However, i don't have a clue as to where to "publish" this tip! Do you? Kind regards, Jeroen Brink @end ignore Although this @value{DOCUMENT} generally only worries about POSIX systems and the POSIX shell, the following issue arises often enough for many users that it is worth addressing. The ``shells'' on Microsoft Windows systems use the double-quote character for quoting, and make it difficult or impossible to include an escaped double-quote character in a command-line script. The following example, courtesy of Jeroen Brink, shows how to print all lines in a file surrounded by double quotes: @example gawk "@{ print \"\042\" $0 \"\042\" @}" @var{file} @end example @node Sample Data Files @section @value{DDF}s for the Examples @c For gawk >= 4.0, update these data files. No-one has such slow modems! @cindex input files, examples @cindex @code{BBS-list} file Many of the examples in this @value{DOCUMENT} take their input from two sample @value{DF}s. The first, @file{BBS-list}, represents a list of computer bulletin board systems together with information about those systems. The second @value{DF}, called @file{inventory-shipped}, contains information about monthly shipments. In both files, each line is considered to be one @dfn{record}. In the @value{DF} @file{BBS-list}, each record contains the name of a computer bulletin board, its phone number, the board's baud rate(s), and a code for the number of hours it is operational. An @samp{A} in the last column means the board operates 24 hours a day. A @samp{B} in the last column means the board only operates on evening and weekend hours. A @samp{C} means the board operates only on weekends: @c 2e: Update the baud rates to reflect today's faster modems @example @c system if test ! -d eg ; then mkdir eg ; fi @c system if test ! -d eg/lib ; then mkdir eg/lib ; fi @c system if test ! -d eg/data ; then mkdir eg/data ; fi @c system if test ! -d eg/prog ; then mkdir eg/prog ; fi @c system if test ! -d eg/misc ; then mkdir eg/misc ; fi @c file eg/data/BBS-list aardvark 555-5553 1200/300 B alpo-net 555-3412 2400/1200/300 A barfly 555-7685 1200/300 A bites 555-1675 2400/1200/300 A camelot 555-0542 300 C core 555-2912 1200/300 C fooey 555-1234 2400/1200/300 B foot 555-6699 1200/300 B macfoo 555-6480 1200/300 A sdace 555-3430 2400/1200/300 A sabafoo 555-2127 1200/300 C @c endfile @end example @cindex @code{inventory-shipped} file The @value{DF} @file{inventory-shipped} represents information about shipments during the year. Each record contains the month, the number of green crates shipped, the number of red boxes shipped, the number of orange bags shipped, and the number of blue packages shipped, respectively. There are 16 entries, covering the 12 months of last year and the first four months of the current year. @example @c file eg/data/inventory-shipped Jan 13 25 15 115 Feb 15 32 24 226 Mar 15 24 34 228 Apr 31 52 63 420 May 16 34 29 208 Jun 31 42 75 492 Jul 24 34 67 436 Aug 15 34 47 316 Sep 13 55 37 277 Oct 29 54 68 525 Nov 20 87 82 577 Dec 17 35 61 401 Jan 21 36 64 620 Feb 26 58 80 652 Mar 24 75 70 495 Apr 21 70 74 514 @c endfile @end example @ifinfo If you are reading this in GNU Emacs using Info, you can copy the regions of text showing these sample files into your own test files. This way you can try out the examples shown in the remainder of this document. You do this by using the command @kbd{M-x write-region} to copy text from the Info file into a file for use with @command{awk} (@xref{Misc File Ops, , Miscellaneous File Operations, emacs, GNU Emacs Manual}, for more information). Using this information, create your own @file{BBS-list} and @file{inventory-shipped} files and practice what you learn in this @value{DOCUMENT}. @cindex Texinfo If you are using the stand-alone version of Info, see @ref{Extract Program}, for an @command{awk} program that extracts these @value{DF}s from @file{gawk.texi}, the Texinfo source file for this Info file. @end ifinfo @node Very Simple @section Some Simple Examples The following command runs a simple @command{awk} program that searches the input file @file{BBS-list} for the character string @samp{foo} (a grouping of characters is usually called a @dfn{string}; the term @dfn{string} is based on similar usage in English, such as ``a string of pearls,'' or ``a string of cars in a train''): @example awk '/foo/ @{ print $0 @}' BBS-list @end example @noindent When lines containing @samp{foo} are found, they are printed because @w{@samp{print $0}} means print the current line. (Just @samp{print} by itself means the same thing, so we could have written that instead.) You will notice that slashes (@samp{/}) surround the string @samp{foo} in the @command{awk} program. The slashes indicate that @samp{foo} is the pattern to search for. This type of pattern is called a @dfn{regular expression}, which is covered in more detail later (@pxref{Regexp}). The pattern is allowed to match parts of words. There are single quotes around the @command{awk} program so that the shell won't interpret any of it as special shell characters. Here is what this program prints: @example $ @kbd{awk '/foo/ @{ print $0 @}' BBS-list} @print{} fooey 555-1234 2400/1200/300 B @print{} foot 555-6699 1200/300 B @print{} macfoo 555-6480 1200/300 A @print{} sabafoo 555-2127 1200/300 C @end example @cindex actions, default @cindex patterns, default In an @command{awk} rule, either the pattern or the action can be omitted, but not both. If the pattern is omitted, then the action is performed for @emph{every} input line. If the action is omitted, the default action is to print all lines that match the pattern. @cindex actions, empty Thus, we could leave out the action (the @code{print} statement and the curly braces) in the previous example and the result would be the same: @command{awk} prints all lines matching the pattern @samp{foo}. By comparison, omitting the @code{print} statement but retaining the curly braces makes an empty action that does nothing (i.e., no lines are printed). @cindex @command{awk} programs, one-line examples Many practical @command{awk} programs are just a line or two. Following is a collection of useful, short programs to get you started. Some of these programs contain constructs that haven't been covered yet. (The description of the program will give you a good idea of what is going on, but please read the rest of the @value{DOCUMENT} to become an @command{awk} expert!) Most of the examples use a @value{DF} named @file{data}. This is just a placeholder; if you use these programs yourself, substitute your own @value{FN}s for @file{data}. For future reference, note that there is often more than one way to do things in @command{awk}. At some point, you may want to look back at these examples and see if you can come up with different ways to do the same things shown here: @itemize @bullet @item Print the length of the longest input line: @example awk '@{ if (length($0) > max) max = length($0) @} END @{ print max @}' data @end example @item Print every line that is longer than 80 characters: @example awk 'length($0) > 80' data @end example The sole rule has a relational expression as its pattern and it has no action---so the default action, printing the record, is used. @cindex @command{expand} utility @item Print the length of the longest line in @file{data}: @example expand data | awk '@{ if (x < length()) x = length() @} END @{ print "maximum line length is " x @}' @end example The input is processed by the @command{expand} utility to change TABs into spaces, so the widths compared are actually the right-margin columns. @item Print every line that has at least one field: @example awk 'NF > 0' data @end example This is an easy way to delete blank lines from a file (or rather, to create a new file similar to the old file but from which the blank lines have been removed). @item Print seven random numbers from 0 to 100, inclusive: @example awk 'BEGIN @{ for (i = 1; i <= 7; i++) print int(101 * rand()) @}' @end example @item Print the total number of bytes used by @var{files}: @example ls -l @var{files} | awk '@{ x += $5 @} END @{ print "total bytes: " x @}' @end example @item Print the total number of kilobytes used by @var{files}: @c Don't use \ continuation, not discussed yet @c Remember that awk does floating point division, @c no need for (x+1023) / 1024 @example ls -l @var{files} | awk '@{ x += $5 @} END @{ print "total K-bytes:", x / 1024 @}' @end example @item Print a sorted list of the login names of all users: @example awk -F: '@{ print $1 @}' /etc/passwd | sort @end example @item Count the lines in a file: @example awk 'END @{ print NR @}' data @end example @item Print the even-numbered lines in the @value{DF}: @example awk 'NR % 2 == 0' data @end example If you use the expression @samp{NR % 2 == 1} instead, the program would print the odd-numbered lines. @end itemize @node Two Rules @section An Example with Two Rules @cindex @command{awk} programs The @command{awk} utility reads the input files one line at a time. For each line, @command{awk} tries the patterns of each of the rules. If several patterns match, then several actions are run in the order in which they appear in the @command{awk} program. If no patterns match, then no actions are run. After processing all the rules that match the line (and perhaps there are none), @command{awk} reads the next line. (However, @pxref{Next Statement}, and also @pxref{Nextfile Statement}). This continues until the program reaches the end of the file. For example, the following @command{awk} program contains two rules: @example /12/ @{ print $0 @} /21/ @{ print $0 @} @end example @noindent The first rule has the string @samp{12} as the pattern and @samp{print $0} as the action. The second rule has the string @samp{21} as the pattern and also has @samp{print $0} as the action. Each rule's action is enclosed in its own pair of braces. This program prints every line that contains the string @samp{12} @emph{or} the string @samp{21}. If a line contains both strings, it is printed twice, once by each rule. This is what happens if we run this program on our two sample @value{DF}s, @file{BBS-list} and @file{inventory-shipped}: @example $ @kbd{awk '/12/ @{ print $0 @}} > @kbd{/21/ @{ print $0 @}' BBS-list inventory-shipped} @print{} aardvark 555-5553 1200/300 B @print{} alpo-net 555-3412 2400/1200/300 A @print{} barfly 555-7685 1200/300 A @print{} bites 555-1675 2400/1200/300 A @print{} core 555-2912 1200/300 C @print{} fooey 555-1234 2400/1200/300 B @print{} foot 555-6699 1200/300 B @print{} macfoo 555-6480 1200/300 A @print{} sdace 555-3430 2400/1200/300 A @print{} sabafoo 555-2127 1200/300 C @print{} sabafoo 555-2127 1200/300 C @print{} Jan 21 36 64 620 @print{} Apr 21 70 74 514 @end example @noindent Note how the line beginning with @samp{sabafoo} in @file{BBS-list} was printed twice, once for each rule. @node More Complex @section A More Complex Example Now that we've mastered some simple tasks, let's look at what typical @command{awk} programs do. This example shows how @command{awk} can be used to summarize, select, and rearrange the output of another utility. It uses features that haven't been covered yet, so don't worry if you don't understand all the details: @example LC_ALL=C ls -l | awk '$6 == "Nov" @{ sum += $5 @} END @{ print sum @}' @end example @cindex @command{ls} utility This command prints the total number of bytes in all the files in the current directory that were last modified in November (of any year). The @w{@samp{ls -l}} part of this example is a system command that gives you a listing of the files in a directory, including each file's size and the date the file was last modified. Its output looks like this: @example -rw-r--r-- 1 arnold user 1933 Nov 7 13:05 Makefile -rw-r--r-- 1 arnold user 10809 Nov 7 13:03 awk.h -rw-r--r-- 1 arnold user 983 Apr 13 12:14 awk.tab.h -rw-r--r-- 1 arnold user 31869 Jun 15 12:20 awkgram.y -rw-r--r-- 1 arnold user 22414 Nov 7 13:03 awk1.c -rw-r--r-- 1 arnold user 37455 Nov 7 13:03 awk2.c -rw-r--r-- 1 arnold user 27511 Dec 9 13:07 awk3.c -rw-r--r-- 1 arnold user 7989 Nov 7 13:03 awk4.c @end example @noindent @cindex line continuations, with C shell The first field contains read-write permissions, the second field contains the number of links to the file, and the third field identifies the owner of the file. The fourth field identifies the group of the file. The fifth field contains the size of the file in bytes. The sixth, seventh, and eighth fields contain the month, day, and time, respectively, that the file was last modified. Finally, the ninth field contains the @value{FN}.@footnote{The @samp{LC_ALL=C} is needed to produce this traditional-style output from @command{ls}.} @c @cindex automatic initialization @cindex initialization, automatic The @samp{$6 == "Nov"} in our @command{awk} program is an expression that tests whether the sixth field of the output from @w{@samp{ls -l}} matches the string @samp{Nov}. Each time a line has the string @samp{Nov} for its sixth field, the action @samp{sum += $5} is performed. This adds the fifth field (the file's size) to the variable @code{sum}. As a result, when @command{awk} has finished reading all the input lines, @code{sum} is the total of the sizes of the files whose lines matched the pattern. (This works because @command{awk} variables are automatically initialized to zero.) After the last line of output from @command{ls} has been processed, the @code{END} rule executes and prints the value of @code{sum}. In this example, the value of @code{sum} is 80600. These more advanced @command{awk} techniques are covered in later sections (@pxref{Action Overview}). Before you can move on to more advanced @command{awk} programming, you have to know how @command{awk} interprets your input and displays your output. By manipulating fields and using @code{print} statements, you can produce some very useful and impressive-looking reports. @node Statements/Lines @section @command{awk} Statements Versus Lines @cindex line breaks @cindex newlines Most often, each line in an @command{awk} program is a separate statement or separate rule, like this: @example awk '/12/ @{ print $0 @} /21/ @{ print $0 @}' BBS-list inventory-shipped @end example @cindex @command{gawk}, newlines in However, @command{gawk} ignores newlines after any of the following symbols and keywords: @example , @{ ? : || && do else @end example @noindent A newline at any other point is considered the end of the statement.@footnote{The @samp{?} and @samp{:} referred to here is the three-operand conditional expression described in @ref{Conditional Exp}. Splitting lines after @samp{?} and @samp{:} is a minor @command{gawk} extension; if @option{--posix} is specified (@pxref{Options}), then this extension is disabled.} @cindex @code{\} (backslash), continuing lines and @cindex backslash (@code{\}), continuing lines and If you would like to split a single statement into two lines at a point where a newline would terminate it, you can @dfn{continue} it by ending the first line with a backslash character (@samp{\}). The backslash must be the final character on the line in order to be recognized as a continuation character. A backslash is allowed anywhere in the statement, even in the middle of a string or regular expression. For example: @example awk '/This regular expression is too long, so continue it\ on the next line/ @{ print $1 @}' @end example @noindent @cindex portability, backslash continuation and We have generally not used backslash continuation in our sample programs. @command{gawk} places no limit on the length of a line, so backslash continuation is never strictly necessary; it just makes programs more readable. For this same reason, as well as for clarity, we have kept most statements short in the sample programs presented throughout the @value{DOCUMENT}. Backslash continuation is most useful when your @command{awk} program is in a separate source file instead of entered from the command line. You should also note that many @command{awk} implementations are more particular about where you may use backslash continuation. For example, they may not allow you to split a string constant using backslash continuation. Thus, for maximum portability of your @command{awk} programs, it is best not to split your lines in the middle of a regular expression or a string. @c 10/2000: gawk, mawk, and current bell labs awk allow it, @c solaris 2.7 nawk does not. Solaris /usr/xpg4/bin/awk does though! sigh. @cindex @command{csh} utility @cindex backslash (@code{\}), continuing lines and, in @command{csh} @cindex @code{\} (backslash), continuing lines and, in @command{csh} @quotation CAUTION @emph{Backslash continuation does not work as described with the C shell.} It works for @command{awk} programs in files and for one-shot programs, @emph{provided} you are using a POSIX-compliant shell, such as the Unix Bourne shell or Bash. But the C shell behaves differently! There, you must use two backslashes in a row, followed by a newline. Note also that when using the C shell, @emph{every} newline in your @command{awk} program must be escaped with a backslash. To illustrate: @example % @kbd{awk 'BEGIN @{ \} ? @kbd{ print \\} ? @kbd{ "hello, world" \} ? @kbd{@}'} @print{} hello, world @end example @noindent Here, the @samp{%} and @samp{?} are the C shell's primary and secondary prompts, analogous to the standard shell's @samp{$} and @samp{>}. Compare the previous example to how it is done with a POSIX-compliant shell: @example $ @kbd{awk 'BEGIN @{} > @kbd{print \} > @kbd{"hello, world"} > @kbd{@}'} @print{} hello, world @end example @end quotation @command{awk} is a line-oriented language. Each rule's action has to begin on the same line as the pattern. To have the pattern and action on separate lines, you @emph{must} use backslash continuation; there is no other option. @cindex backslash (@code{\}), continuing lines and, comments and @cindex @code{\} (backslash), continuing lines and, comments and @cindex commenting, backslash continuation and Another thing to keep in mind is that backslash continuation and comments do not mix. As soon as @command{awk} sees the @samp{#} that starts a comment, it ignores @emph{everything} on the rest of the line. For example: @example $ gawk 'BEGIN @{ print "dont panic" # a friendly \ > BEGIN rule > @}' @error{} gawk: cmd. line:2: BEGIN rule @error{} gawk: cmd. line:2: ^ parse error @end example @noindent In this case, it looks like the backslash would continue the comment onto the next line. However, the backslash-newline combination is never even noticed because it is ``hidden'' inside the comment. Thus, the @code{BEGIN} is noted as a syntax error. @cindex statements, multiple @cindex @code{;} (semicolon) @cindex semicolon (@code{;}) When @command{awk} statements within one rule are short, you might want to put more than one of them on a line. This is accomplished by separating the statements with a semicolon (@samp{;}). This also applies to the rules themselves. Thus, the program shown at the start of this @value{SECTION} could also be written this way: @example /12/ @{ print $0 @} ; /21/ @{ print $0 @} @end example @quotation NOTE The requirement that states that rules on the same line must be separated with a semicolon was not in the original @command{awk} language; it was added for consistency with the treatment of statements within an action. @end quotation @node Other Features @section Other Features of @command{awk} @cindex variables The @command{awk} language provides a number of predefined, or @dfn{built-in}, variables that your programs can use to get information from @command{awk}. There are other variables your program can set as well to control how @command{awk} processes your data. In addition, @command{awk} provides a number of built-in functions for doing common computational and string-related operations. @command{gawk} provides built-in functions for working with timestamps, performing bit manipulation, for runtime string translation (internationalization), determining the type of a variable, and array sorting. As we develop our presentation of the @command{awk} language, we introduce most of the variables and many of the functions. They are described systematically in @ref{Built-in Variables}, and @ref{Built-in}. @node When @section When to Use @command{awk} @cindex @command{awk}, uses for Now that you've seen some of what @command{awk} can do, you might wonder how @command{awk} could be useful for you. By using utility programs, advanced patterns, field separators, arithmetic statements, and other selection criteria, you can produce much more complex output. The @command{awk} language is very useful for producing reports from large amounts of raw data, such as summarizing information from the output of other utility programs like @command{ls}. (@xref{More Complex}.) Programs written with @command{awk} are usually much smaller than they would be in other languages. This makes @command{awk} programs easy to compose and use. Often, @command{awk} programs can be quickly composed at your keyboard, used once, and thrown away. Because @command{awk} programs are interpreted, you can avoid the (usually lengthy) compilation part of the typical edit-compile-test-debug cycle of software development. Complex programs have been written in @command{awk}, including a complete retargetable assembler for eight-bit microprocessors (@pxref{Glossary}, for more information), and a microcode assembler for a special-purpose Prolog computer. While the original @command{awk}'s capabilities were strained by tasks of such complexity, modern versions are more capable. Even Brian Kernighan's version of @command{awk} has fewer predefined limits, and those that it has are much larger than they used to be. @cindex @command{awk} programs, complex If you find yourself writing @command{awk} scripts of more than, say, a few hundred lines, you might consider using a different programming language. Emacs Lisp is a good choice if you need sophisticated string or pattern matching capabilities. The shell is also good at string and pattern matching; in addition, it allows powerful use of the system utilities. More conventional languages, such as C, C++, and Java, offer better facilities for system programming and for managing the complexity of large programs. Programs in these languages may require more lines of source code than the equivalent @command{awk} programs, but they are easier to maintain and usually run more efficiently. @node Invoking Gawk @chapter Running @command{awk} and @command{gawk} This @value{CHAPTER} covers how to run awk, both POSIX-standard and @command{gawk}-specific command-line options, and what @command{awk} and @command{gawk} do with non-option arguments. It then proceeds to cover how @command{gawk} searches for source files, reading standard input along with other files, @command{gawk}'s environment variables, @command{gawk}'s exit status, using include files, and obsolete and undocumented options and/or features. Many of the options and features described here are discussed in more detail later in the @value{DOCUMENT}; feel free to skip over things in this @value{CHAPTER} that don't interest you right now. @menu * Command Line:: How to run @command{awk}. * Options:: Command-line options and their meanings. * Other Arguments:: Input file names and variable assignments. * Naming Standard Input:: How to specify standard input with other files. * Environment Variables:: The environment variables @command{gawk} uses. * Exit Status:: @command{gawk}'s exit status. * Include Files:: Including other files into your program. * Obsolete:: Obsolete Options and/or features. * Undocumented:: Undocumented Options and Features. @end menu @node Command Line @section Invoking @command{awk} @cindex command line, invoking @command{awk} from @cindex @command{awk}, invoking @cindex arguments, command-line, invoking @command{awk} @cindex options, command-line, invoking @command{awk} There are two ways to run @command{awk}---with an explicit program or with one or more program files. Here are templates for both of them; items enclosed in [@dots{}] in these templates are optional: @example awk @r{[@var{options}]} -f progfile @r{[@code{--}]} @var{file} @dots{} awk @r{[@var{options}]} @r{[@code{--}]} '@var{program}' @var{file} @dots{} @end example @cindex GNU long options @cindex long options @cindex options, long Besides traditional one-letter POSIX-style options, @command{gawk} also supports GNU long options. @cindex dark corner, invoking @command{awk} @cindex lint checking, empty programs It is possible to invoke @command{awk} with an empty program: @example awk '' datafile1 datafile2 @end example @cindex @code{--lint} option @noindent Doing so makes little sense, though; @command{awk} exits silently when given an empty program. @value{DARKCORNER} If @option{--lint} has been specified on the command line, @command{gawk} issues a warning that the program is empty. @node Options @section Command-Line Options @c STARTOFRANGE ocl @cindex options, command-line @c STARTOFRANGE clo @cindex command line, options @c STARTOFRANGE gnulo @cindex GNU long options @c STARTOFRANGE longo @cindex options, long Options begin with a dash and consist of a single character. GNU-style long options consist of two dashes and a keyword. The keyword can be abbreviated, as long as the abbreviation allows the option to be uniquely identified. If the option takes an argument, then the keyword is either immediately followed by an equals sign (@samp{=}) and the argument's value, or the keyword and the argument's value are separated by whitespace. If a particular option with a value is given more than once, it is the last value that counts. @cindex POSIX @command{awk}, GNU long options and Each long option for @command{gawk} has a corresponding POSIX-style short option. The long and short options are interchangeable in all contexts. The following list describes options mandated by the POSIX standard: @table @code @item -F @var{fs} @itemx --field-separator @var{fs} @cindex @code{-F} option @cindex @code{--field-separator} option @cindex @code{FS} variable, @code{--field-separator} option and Set the @code{FS} variable to @var{fs} (@pxref{Field Separators}). @item -f @var{source-file} @itemx --file @var{source-file} @cindex @code{-f} option @cindex @code{--file} option @cindex @command{awk} programs, location of Read @command{awk} program source from @var{source-file} instead of in the first non-option argument. This option may be given multiple times; the @command{awk} program consists of the concatenation the contents of each specified @var{source-file}. @item -v @var{var}=@var{val} @itemx --assign @var{var}=@var{val} @cindex @code{-v} option @cindex @code{--assign} option @cindex variables, setting Set the variable @var{var} to the value @var{val} @emph{before} execution of the program begins. Such variable values are available inside the @code{BEGIN} rule (@pxref{Other Arguments}). The @option{-v} option can only set one variable, but it can be used more than once, setting another variable each time, like this: @samp{awk @w{-v foo=1} @w{-v bar=2} @dots{}}. @cindex built-in variables, @code{-v} option@comma{} setting with @cindex variables, built-in, @code{-v} option@comma{} setting with @quotation CAUTION Using @option{-v} to set the values of the built-in variables may lead to surprising results. @command{awk} will reset the values of those variables as it needs to, possibly ignoring any predefined value you may have given. @end quotation @item -W @var{gawk-opt} @cindex @code{-W} option Provide an implementation-specific option. This is the POSIX convention for providing implementation-specific options. These options also have corresponding GNU-style long options. Note that the long options may be abbreviated, as long as the abbreviations remain unique. The full list of @command{gawk}-specific options is provided next. @item -- @cindex command line, options, end of @cindex options, command-line, end of Signal the end of the command-line options. The following arguments are not treated as options even if they begin with @samp{-}. This interpretation of @option{--} follows the POSIX argument parsing conventions. @cindex @code{-} (hyphen), filenames beginning with @cindex hyphen (@code{-}), filenames beginning with This is useful if you have @value{FN}s that start with @samp{-}, or in shell scripts, if you have @value{FN}s that will be specified by the user that could start with @samp{-}. It is also useful for passing options on to the @command{awk} program; see @ref{Getopt Function}. @end table @c ENDOFRANGE gnulo @c ENDOFRANGE longo The following list describes @command{gawk}-specific options: @table @code @item -b @itemx --characters-as-bytes @cindex @code{-b} option @cindex @code{--characters-as-bytes} option Cause @command{gawk} to treat all input data as single-byte characters. Normally, @command{gawk} follows the POSIX standard and attempts to process its input data according to the current locale. This can often involve converting multibyte characters into wide characters (internally), and can lead to problems or confusion if the input data does not contain valid multibyte characters. This option is an easy way to tell @command{gawk}: ``hands off my data!''. @item -c @itemx --traditional @cindex @code{--c} option @cindex @code{--traditional} option @cindex compatibility mode (@command{gawk}), specifying Specify @dfn{compatibility mode}, in which the GNU extensions to the @command{awk} language are disabled, so that @command{gawk} behaves just like Brian Kernighan's version @command{awk}. @xref{POSIX/GNU}, which summarizes the extensions. Also see @ref{Compatibility Mode}. @item -C @itemx --copyright @cindex @code{-C} option @cindex @code{--copyright} option @cindex GPL (General Public License), printing Print the short version of the General Public License and then exit. @item -d@r{[}@var{file}@r{]} @itemx --dump-variables@r{[}=@var{file}@r{]} @cindex @code{-d} option @cindex @code{--dump-variables} option @cindex @code{awkvars.out} file @cindex files, @code{awkvars.out} @cindex variables, global, printing list of Print a sorted list of global variables, their types, and final values to @var{file}. If no @var{file} is provided, print this list to the file named @file{awkvars.out} in the current directory. No space is allowed between the @option{-d} and @var{file}, if @var{file} is supplied. @cindex troubleshooting, typographical errors@comma{} global variables Having a list of all global variables is a good way to look for typographical errors in your programs. You would also use this option if you have a large program with a lot of functions, and you want to be sure that your functions don't inadvertently use global variables that you meant to be local. (This is a particularly easy mistake to make with simple variable names like @code{i}, @code{j}, etc.) @item -e @var{program-text} @itemx --source @var{program-text} @cindex @code{-e} option @cindex @code{--source} option @cindex source code, mixing Provide program source code in the @var{program-text}. This option allows you to mix source code in files with source code that you enter on the command line. This is particularly useful when you have library functions that you want to use from your command-line programs (@pxref{AWKPATH Variable}). @item -E @var{file} @itemx --exec @var{file} @cindex @code{-E} option @cindex @code{--exec} option @cindex @command{awk} programs, location of @cindex CGI, @command{awk} scripts for Similar to @option{-f}, read @command{awk} program text from @var{file}. There are two differences from @option{-f}: @itemize @bullet @item This option terminates option processing; anything else on the command line is passed on directly to the @command{awk} program. @item Command-line variable assignments of the form @samp{@var{var}=@var{value}} are disallowed. @end itemize This option is particularly necessary for World Wide Web CGI applications that pass arguments through the URL; using this option prevents a malicious (or other) user from passing in options, assignments, or @command{awk} source code (via @option{--source}) to the CGI application. This option should be used with @samp{#!} scripts (@pxref{Executable Scripts}), like so: @example #! /usr/local/bin/gawk -E @var{awk program here @dots{}} @end example @item -g @itemx --gen-pot @cindex @code{-g} option @cindex @code{--gen-pot} option @cindex portable object files, generating @cindex files, portable object, generating Analyze the source program and generate a GNU @code{gettext} Portable Object Template file on standard output for all string constants that have been marked for translation. @xref{Internationalization}, for information about this option. @item -h @itemx --help @cindex @code{-h} option @cindex @code{--help} option @cindex GNU long options, printing list of @cindex options, printing list of @cindex printing, list of options Print a ``usage'' message summarizing the short and long style options that @command{gawk} accepts and then exit. @item -L @r{[}value@r{]} @itemx --lint@r{[}=value@r{]} @cindex @code{-l} option @cindex @code{--lint} option @cindex lint checking, issuing warnings @cindex warnings, issuing Warn about constructs that are dubious or nonportable to other @command{awk} implementations. Some warnings are issued when @command{gawk} first reads your program. Others are issued at runtime, as your program executes. With an optional argument of @samp{fatal}, lint warnings become fatal errors. This may be drastic, but its use will certainly encourage the development of cleaner @command{awk} programs. With an optional argument of @samp{invalid}, only warnings about things that are actually invalid are issued. (This is not fully implemented yet.) Some warnings are only printed once, even if the dubious constructs they warn about occur multiple times in your @command{awk} program. Thus, when eliminating problems pointed out by @option{--lint}, you should take care to search for all occurrences of each inappropriate construct. As @command{awk} programs are usually short, doing so is not burdensome. @item -n @itemx --non-decimal-data @cindex @code{-n} option @cindex @code{--non-decimal-data} option @cindex hexadecimal values@comma{} enabling interpretation of @cindex octal values@comma{} enabling interpretation of @cindex troubleshooting, @code{--non-decimal-data} option Enable automatic interpretation of octal and hexadecimal values in input data (@pxref{Nondecimal Data}). @quotation CAUTION This option can severely break old programs. Use with care. @end quotation @item -N @itemx --use-lc-numeric @cindex @code{-N} option @cindex @code{--use-lc-numeric} option Force the use of the locale's decimal point character when parsing numeric input data (@pxref{Locales}). @item -O @itemx --optimize @cindex @code{--optimize} option @cindex @code{-O} option Enable some optimizations on the internal representation of the program. At the moment this includes just simple constant folding. The @command{gawk} maintainer hopes to add more optimizations over time. @item -p@r{[}@var{file}@r{]} @itemx --profile@r{[}=@var{file}@r{]} @cindex @code{-p} option @cindex @code{--profile} option @cindex @command{awk} programs, profiling, enabling Enable profiling of @command{awk} programs (@pxref{Profiling}). By default, profiles are created in a file named @file{awkprof.out}. The optional @var{file} argument allows you to specify a different @value{FN} for the profile file. No space is allowed between the @option{-p} and @var{file}, if @var{file} is supplied. When run with @command{gawk}, the profile is just a ``pretty printed'' version of the program. When run with @command{pgawk}, the profile contains execution counts for each statement in the program in the left margin, and function call counts for each function. @item -P @itemx --posix @cindex @code{-P} option @cindex @code{--posix} option @cindex POSIX mode @cindex @command{gawk}, extensions@comma{} disabling Operate in strict POSIX mode. This disables all @command{gawk} extensions (just like @option{--traditional}) and disables all extensions not allowed by POSIX. @xref{Common Extensions}, for a summary of the extensions in @command{gawk} that are disabled by this option. Also, the following additional restrictions apply: @itemize @bullet @cindex newlines @cindex whitespace, newlines as @item Newlines do not act as whitespace to separate fields when @code{FS} is equal to a single space (@pxref{Fields}). @item Newlines are not allowed after @samp{?} or @samp{:} (@pxref{Conditional Exp}). @cindex @code{FS} variable, as TAB character @item Specifying @samp{-Ft} on the command-line does not set the value of @code{FS} to be a single TAB character (@pxref{Field Separators}). @cindex locale decimal point character @cindex decimal point character, locale specific @item The locale's decimal point character is used for parsing input data (@pxref{Locales}). @end itemize @c @cindex automatic warnings @c @cindex warnings, automatic @cindex @code{--traditional} option, @code{--posix} option and @cindex @code{--posix} option, @code{--traditional} option and If you supply both @option{--traditional} and @option{--posix} on the command line, @option{--posix} takes precedence. @command{gawk} also issues a warning if both options are supplied. @item -r @itemx --re-interval @cindex @code{-r} option @cindex @code{--re-interval} option @cindex regular expressions, interval expressions and Allow interval expressions (@pxref{Regexp Operators}) in regexps. This is now @command{gawk}'s default behavior. Nevertheless, this option remains both for backward compatibility, and for use in combination with the @option{--traditional} option. @item -R @var{file} @itemx --command=@var{file} @cindex @code{-R} option @cindex @code{--command} option @command{dgawk} only. Read @command{dgawk} debugger options and commands from @var{file}. @xref{Dgawk Info}, for more information. @item -S @itemx --sandbox @cindex @code{-S} option @cindex @code{--sandbox} option @cindex sandbox mode Disable the @code{system()} function, input redirections with @code{getline}, output redirections with @code{print} and @code{printf}, and dynamic extensions. This is particularly useful when you want to run @command{awk} scripts from questionable sources and need to make sure the scripts can't access your system (other than the specified input data file). @item -t @itemx --lint-old @cindex @code{--L} option @cindex @code{--lint-old} option Warn about constructs that are not available in the original version of @command{awk} from Version 7 Unix (@pxref{V7/SVR3.1}). @item -V @itemx --version @cindex @code{-V} option @cindex @code{--version} option @cindex @command{gawk}, versions of, information about@comma{} printing Print version information for this particular copy of @command{gawk}. This allows you to determine if your copy of @command{gawk} is up to date with respect to whatever the Free Software Foundation is currently distributing. It is also useful for bug reports (@pxref{Bugs}). @end table As long as program text has been supplied, any other options are flagged as invalid with a warning message but are otherwise ignored. @cindex @code{-F} option, @code{-Ft} sets @code{FS} to TAB In compatibility mode, as a special case, if the value of @var{fs} supplied to the @option{-F} option is @samp{t}, then @code{FS} is set to the TAB character (@code{"\t"}). This is true only for @option{--traditional} and not for @option{--posix} (@pxref{Field Separators}). @cindex @code{-f} option, on command line The @option{-f} option may be used more than once on the command line. If it is, @command{awk} reads its program source from all of the named files, as if they had been concatenated together into one big file. This is useful for creating libraries of @command{awk} functions. These functions can be written once and then retrieved from a standard place, instead of having to be included into each individual program. (As mentioned in @ref{Definition Syntax}, function names must be unique.) With standard @command{awk}, library functions can still be used, even if the program is entered at the terminal, by specifying @samp{-f /dev/tty}. After typing your program, type @kbd{@value{CTL}-d} (the end-of-file character) to terminate it. (You may also use @samp{-f -} to read program source from the standard input but then you will not be able to also use the standard input as a source of data.) Because it is clumsy using the standard @command{awk} mechanisms to mix source file and command-line @command{awk} programs, @command{gawk} provides the @option{--source} option. This does not require you to pre-empt the standard input for your source code; it allows you to easily mix command-line and library source code (@pxref{AWKPATH Variable}). The @option{--source} option may also be used multiple times on the command line. @cindex @code{--source} option If no @option{-f} or @option{--source} option is specified, then @command{gawk} uses the first non-option command-line argument as the text of the program source code. @cindex @env{POSIXLY_CORRECT} environment variable @cindex lint checking, @env{POSIXLY_CORRECT} environment variable @cindex POSIX mode If the environment variable @env{POSIXLY_CORRECT} exists, then @command{gawk} behaves in strict POSIX mode, exactly as if you had supplied the @option{--posix} command-line option. Many GNU programs look for this environment variable to suppress extensions that conflict with POSIX, but @command{gawk} behaves differently: it suppresses all extensions, even those that do not conflict with POSIX, and behaves in strict POSIX mode. If @option{--lint} is supplied on the command line and @command{gawk} turns on POSIX mode because of @env{POSIXLY_CORRECT}, then it issues a warning message indicating that POSIX mode is in effect. You would typically set this variable in your shell's startup file. For a Bourne-compatible shell (such as Bash), you would add these lines to the @file{.profile} file in your home directory: @example POSIXLY_CORRECT=true export POSIXLY_CORRECT @end example @cindex @command{csh} utility, @env{POSIXLY_CORRECT} environment variable For a C shell-compatible shell,@footnote{Not recommended.} you would add this line to the @file{.login} file in your home directory: @example setenv POSIXLY_CORRECT true @end example @cindex portability, @env{POSIXLY_CORRECT} environment variable Having @env{POSIXLY_CORRECT} set is not recommended for daily use, but it is good for testing the portability of your programs to other environments. @c ENDOFRANGE ocl @c ENDOFRANGE clo @node Other Arguments @section Other Command-Line Arguments @cindex command line, arguments @cindex arguments, command-line Any additional arguments on the command line are normally treated as input files to be processed in the order specified. However, an argument that has the form @code{@var{var}=@var{value}}, assigns the value @var{value} to the variable @var{var}---it does not specify a file at all. (See @ref{Assignment Options}.) @cindex @command{gawk}, @code{ARGIND} variable in @cindex @code{ARGIND} variable, command-line arguments @cindex @code{ARGC}/@code{ARGV} variables, command-line arguments All these arguments are made available to your @command{awk} program in the @code{ARGV} array (@pxref{Built-in Variables}). Command-line options and the program text (if present) are omitted from @code{ARGV}. All other arguments, including variable assignments, are included. As each element of @code{ARGV} is processed, @command{gawk} sets the variable @code{ARGIND} to the index in @code{ARGV} of the current element. @cindex input files, variable assignments and The distinction between @value{FN} arguments and variable-assignment arguments is made when @command{awk} is about to open the next input file. At that point in execution, it checks the @value{FN} to see whether it is really a variable assignment; if so, @command{awk} sets the variable instead of reading a file. Therefore, the variables actually receive the given values after all previously specified files have been read. In particular, the values of variables assigned in this fashion are @emph{not} available inside a @code{BEGIN} rule (@pxref{BEGIN/END}), because such rules are run before @command{awk} begins scanning the argument list. @cindex dark corner, escape sequences The variable values given on the command line are processed for escape sequences (@pxref{Escape Sequences}). @value{DARKCORNER} In some earlier implementations of @command{awk}, when a variable assignment occurred before any @value{FN}s, the assignment would happen @emph{before} the @code{BEGIN} rule was executed. @command{awk}'s behavior was thus inconsistent; some command-line assignments were available inside the @code{BEGIN} rule, while others were not. Unfortunately, some applications came to depend upon this ``feature.'' When @command{awk} was changed to be more consistent, the @option{-v} option was added to accommodate applications that depended upon the old behavior. The variable assignment feature is most useful for assigning to variables such as @code{RS}, @code{OFS}, and @code{ORS}, which control input and output formats before scanning the @value{DF}s. It is also useful for controlling state if multiple passes are needed over a @value{DF}. For example: @cindex files, multiple passes over @example awk 'pass == 1 @{ @var{pass 1 stuff} @} pass == 2 @{ @var{pass 2 stuff} @}' pass=1 mydata pass=2 mydata @end example Given the variable assignment feature, the @option{-F} option for setting the value of @code{FS} is not strictly necessary. It remains for historical compatibility. @node Naming Standard Input @section Naming Standard Input Often, you may wish to read standard input together with other files. For example, you may wish to read one file, read standard input coming from a pipe, and then read another file. The way to name the standard input, with all versions of @command{awk}, is to use a single, standalone minus sign or dash, @samp{-}. For example: @example @var{some_command} | awk -f myprog.awk file1 - file2 @end example @noindent Here, @command{awk} first reads @file{file1}, then it reads the output of @var{some_command}, and finally it reads @file{file2}. You may also use @code{"-"} to name standard input when reading files with @code{getline} (@pxref{Getline/File}). In addition, @command{gawk} allows you to specify the special @value{FN} @file{/dev/stdin}, both on the command line and with @code{getline}. Some other versions of @command{awk} also support this, but it is not standard. (Some operating systems provide a @file{/dev/stdin} file in the file system, however, @command{gawk} always processes this @value{FN} itself.) @node Environment Variables @section The Environment Variables @command{gawk} Uses A number of environment variables influence how @command{gawk} behaves. @menu * AWKPATH Variable:: Searching directories for @command{awk} programs. * Other Environment Variables:: The environment variables. @end menu @node AWKPATH Variable @subsection The @env{AWKPATH} Environment Variable @cindex @env{AWKPATH} environment variable @cindex directories, searching @cindex search paths @cindex search paths, for source files @cindex differences in @command{awk} and @command{gawk}, @code{AWKPATH} environment variable @ifinfo The previous @value{SECTION} described how @command{awk} program files can be named on the command-line with the @option{-f} option. @end ifinfo In most @command{awk} implementations, you must supply a precise path name for each program file, unless the file is in the current directory. But in @command{gawk}, if the @value{FN} supplied to the @option{-f} option does not contain a @samp{/}, then @command{gawk} searches a list of directories (called the @dfn{search path}), one by one, looking for a file with the specified name. The search path is a string consisting of directory names separated by colons. @command{gawk} gets its search path from the @env{AWKPATH} environment variable. If that variable does not exist, @command{gawk} uses a default path, @samp{.:/usr/local/share/awk}.@footnote{Your version of @command{gawk} may use a different directory; it will depend upon how @command{gawk} was built and installed. The actual directory is the value of @samp{$(datadir)} generated when @command{gawk} was configured. You probably don't need to worry about this, though.} The search path feature is particularly useful for building libraries of useful @command{awk} functions. The library files can be placed in a standard directory in the default path and then specified on the command line with a short @value{FN}. Otherwise, the full @value{FN} would have to be typed for each file. By using both the @option{--source} and @option{-f} options, your command-line @command{awk} programs can use facilities in @command{awk} library files (@pxref{Library Functions}). Path searching is not done if @command{gawk} is in compatibility mode. This is true for both @option{--traditional} and @option{--posix}. @xref{Options}. @quotation NOTE To include the current directory in the path, either place @file{.} explicitly in the path or write a null entry in the path. (A null entry is indicated by starting or ending the path with a colon or by placing two colons next to each other (@samp{::}).) This path search mechanism is similar to the shell's. @c someday, @cite{The Bourne Again Shell}.... However, @command{gawk} always looks in the current directory @emph{before} searching @env{AWKPATH}, so there is no real reason to include the current directory in the search path. @c Prior to 4.0, gawk searched the current directory after the @c path search, but it's not worth documenting it. @end quotation If @env{AWKPATH} is not defined in the environment, @command{gawk} places its default search path into @code{ENVIRON["AWKPATH"]}. This makes it easy to determine the actual search path that @command{gawk} will use from within an @command{awk} program. While you can change @code{ENVIRON["AWKPATH"]} within your @command{awk} program, this has no effect on the running program's behavior. This makes sense: the @env{AWKPATH} environment variable is used to find the program source files. Once your program is running, all the files have been found, and @command{gawk} no longer needs to use @env{AWKPATH}. @node Other Environment Variables @subsection Other Environment Variables A number of other environment variables affect @command{gawk}'s behavior, but they are more specialized. Those in the following list are meant to be used by regular users. @table @env @item POSIXLY_CORRECT Causes @command{gawk} to switch POSIX compatibility mode, disabling all traditional and GNU extensions. @xref{Options}. @item GAWK_SOCK_RETRIES Controls the number of time @command{gawk} will attempt to retry a two-way TCP/IP (socket) connection before giving up. @xref{TCP/IP Networking}. @item GAWK_MSEC_SLEEP Specifies the interval between connection retries, in milliseconds. On systems that do not support the @code{usleep()} system call, the value is rounded up to an integral number of seconds. @end table The environment variables in the following list are meant for use by the @command{gawk} developers for testing and tuning. They are subject to change. The variables are: @table @env @item AVG_CHAIN_MAX The average number of items @command{gawk} will maintain on a hash chain for managing arrays. @item AWK_HASH If this variable exists with a value of @samp{gst}, @command{gawk} will switch to using the hash function from GNU Smalltalk for managing arrays. This function may be marginally faster than the standard function. @item AWKREADFUNC If this variable exists, @command{gawk} switches to reading source files one line at a time, instead of reading in blocks. This exists for debugging problems on filesystems on non-POSIX operating systems where I/O is performed in records, not in blocks. @item GAWK_NO_DFA If this variable exists, @command{gawk} does not use the DFA regexp matcher for ``does it match'' kinds of tests. This can cause @command{gawk} to be slower. Its purpose is to help isolate differences between the two regexp matchers that @command{gawk} uses internally. (There aren't supposed to be differences, but occasionally theory and practice don't coordinate with each other.) @item GAWK_STACKSIZE This specifies the amount by which @command{gawk} should grow its internal evaluation stack, when needed. @item TIDYMEM If this variable exists, @command{gawk} uses the @code{mtrace()} library calls from GNU LIBC to help track down possible memory leaks. @end table @node Exit Status @section @command{gawk}'s Exit Status @cindex exit status, of @command{gawk} If the @code{exit} statement is used with a value (@pxref{Exit Statement}), then @command{gawk} exits with the numeric value given to it. Otherwise, if there were no problems during execution, @command{gawk} exits with the value of the C constant @code{EXIT_SUCCESS}. This is usually zero. If an error occurs, @command{gawk} exits with the value of the C constant @code{EXIT_FAILURE}. This is usually one. If @command{gawk} exits because of a fatal error, the exit status is 2. On non-POSIX systems, this value may be mapped to @code{EXIT_FAILURE}. @node Include Files @section Including Other Files Into Your Program @c Panos Papadopoulos contributed the original @c text for this section. This @value{SECTION} describes a feature that is specific to @command{gawk}. The @samp{@@include} keyword can be used to read external @command{awk} source files. This gives you the ability to split large @command{awk} source files into smaller, more manageable pieces, and also lets you reuse common @command{awk} code from various @command{awk} scripts. In other words, you can group together @command{awk} functions, used to carry out specific tasks, into external files. These files can be used just like function libraries, using the @samp{@@include} keyword in conjunction with the @code{AWKPATH} environment variable. Let's see an example. We'll start with two (trivial) @command{awk} scripts, namely @file{test1} and @file{test2}. Here is the @file{test1} script: @example BEGIN @{ print "This is script test1." @} @end example @noindent and here is @file{test2}: @example @@include "test1" BEGIN @{ print "This is script test2." @} @end example Running @command{gawk} with @file{test2} produces the following result: @example $ @kbd{gawk -f test2} @print{} This is file test1. @print{} This is file test2. @end example @code{gawk} runs the @file{test2} script which includes @file{test1} using the @samp{@@include} keyword. So, to include external @command{awk} source files you just use @samp{@@include} followed by the name of the file to be included, enclosed in double quotes. @quotation NOTE Keep in mind that this is a language construct and the @value{FN} cannot be a string variable, but rather just a literal string in double quotes. @end quotation The files to be included may be nested; e.g., given a third script, namely @file{test3}: @example @@include "test2" BEGIN @{ print "This is script test3." @} @end example @noindent Running @command{gawk} with the @file{test3} script produces the following results: @example $ @kbd{gawk -f test3} @print{} This is file test1. @print{} This is file test2. @print{} This is file test3. @end example The @value{FN} can, of course, be a pathname. For example: @example @@include "../io_funcs" @end example @noindent or: @example @@include "/usr/awklib/network" @end example @noindent are valid. The @code{AWKPATH} environment variable can be of great value when using @samp{@@include}. The same rules for the use of the @code{AWKPATH} variable in command-line file searches (@pxref{AWKPATH Variable}) apply to @samp{@@include} also. This is very helpful in constructing @command{gawk} function libraries. If you have a large script with useful, general purpose @command{awk} functions, you can break it down into library files and put those files in a special directory. You can then include those ``libraries,'' using either the full pathnames of the files, or by setting the @code{AWKPATH} environment variable accordingly and then using @samp{@@include} with just the file part of the full pathname. Of course you can have more than one directory to keep library files; the more complex the working environment is, the more directories you may need to organize the files to be included. Given the ability to specify multiple @option{-f} options, the @samp{@@include} mechanism is not strictly necessary. However, the @samp{@@include} keyword can help you in constructing self-contained @command{gawk} programs, thus reducing the need for writing complex and tedious command lines. In particular, @samp{@@include} is very useful for writing CGI scripts to be run from web pages. As mentioned in @ref{AWKPATH Variable}, the current directory is always searched first for source files, before searching in @env{AWKPATH}, and this also applies to files named with @samp{@@include}. @node Obsolete @section Obsolete Options and/or Features @cindex features, advanced, See advanced features @cindex options, deprecated @cindex features, deprecated @cindex obsolete features This @value{SECTION} describes features and/or command-line options from previous releases of @command{gawk} that are either not available in the current version or that are still supported but deprecated (meaning that they will @emph{not} be in the next release). @c update this section for each release! @cindex @code{PROCINFO} array The process-related special files @file{/dev/pid}, @file{/dev/ppid}, @file{/dev/pgrpid}, and @file{/dev/user} were deprecated in @command{gawk} 3.1, but still worked. As of @value{PVERSION} 4.0, they are no longer interpreted specially by @command{gawk}. (Use @code{PROCINFO} instead; see @ref{Auto-set}.) @ignore This @value{SECTION} is thus essentially a place holder, in case some option becomes obsolete in a future version of @command{gawk}. @end ignore @node Undocumented @section Undocumented Options and Features @cindex undocumented features @cindex features, undocumented @cindex Skywalker, Luke @cindex Kenobi, Obi-Wan @cindex Jedi knights @cindex Knights, jedi @quotation @i{Use the Source, Luke!}@* Obi-Wan @end quotation This @value{SECTION} intentionally left blank. @ignore @c If these came out in the Info file or TeX document, then they wouldn't @c be undocumented, would they? @command{gawk} has one undocumented option: @table @code @item -W nostalgia @itemx --nostalgia Print the message @code{"awk: bailing out near line 1"} and dump core. This option was inspired by the common behavior of very early versions of Unix @command{awk} and by a t--shirt. The message is @emph{not} subject to translation in non-English locales. @c so there! nyah, nyah. @end table Early versions of @command{awk} used to not require any separator (either a newline or @samp{;}) between the rules in @command{awk} programs. Thus, it was common to see one-line programs like: @example awk '@{ sum += $1 @} END @{ print sum @}' @end example @command{gawk} actually supports this but it is purposely undocumented because it is considered bad style. The correct way to write such a program is either @example awk '@{ sum += $1 @} ; END @{ print sum @}' @end example @noindent or @example awk '@{ sum += $1 @} END @{ print sum @}' data @end example @noindent @xref{Statements/Lines}, for a fuller explanation. You can insert newlines after the @samp{;} in @code{for} loops. This seems to have been a long-undocumented feature in Unix @command{awk}. Similarly, you may use @code{print} or @code{printf} statements in the @var{init} and @var{increment} parts of a @code{for} loop. This is another long-undocumented ``feature'' of Unix @code{awk}. @end ignore @ignore @c Try this @iftex @page @headings off @majorheading II@ @ @ Using @command{awk} and @command{gawk} Part II shows how to use @command{awk} and @command{gawk} for problem solving. There is lots of code here for you to read and learn from. It contains the following chapters: @itemize @bullet @item @ref{Library Functions}. @item @ref{Sample Programs}. @end itemize @page @evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @| @oddheading @| @| @strong{@thischapter}@ @ @ @thispage @end iftex @end ignore @node Regexp @chapter Regular Expressions @cindex regexp, See regular expressions @c STARTOFRANGE regexp @cindex regular expressions A @dfn{regular expression}, or @dfn{regexp}, is a way of describing a set of strings. Because regular expressions are such a fundamental part of @command{awk} programming, their format and use deserve a separate @value{CHAPTER}. @cindex forward slash (@code{/}) @cindex @code{/} (forward slash) A regular expression enclosed in slashes (@samp{/}) is an @command{awk} pattern that matches every input record whose text belongs to that set. The simplest regular expression is a sequence of letters, numbers, or both. Such a regexp matches any string that contains that sequence. Thus, the regexp @samp{foo} matches any string containing @samp{foo}. Therefore, the pattern @code{/foo/} matches any input record containing the three characters @samp{foo} @emph{anywhere} in the record. Other kinds of regexps let you specify more complicated classes of strings. @ifnotinfo Initially, the examples in this @value{CHAPTER} are simple. As we explain more about how regular expressions work, we present more complicated instances. @end ifnotinfo @menu * Regexp Usage:: How to Use Regular Expressions. * Escape Sequences:: How to write nonprinting characters. * Regexp Operators:: Regular Expression Operators. * Bracket Expressions:: What can go between @samp{[...]}. * GNU Regexp Operators:: Operators specific to GNU software. * Case-sensitivity:: How to do case-insensitive matching. * Leftmost Longest:: How much text matches. * Computed Regexps:: Using Dynamic Regexps. @end menu @node Regexp Usage @section How to Use Regular Expressions @cindex regular expressions, as patterns A regular expression can be used as a pattern by enclosing it in slashes. Then the regular expression is tested against the entire text of each record. (Normally, it only needs to match some part of the text in order to succeed.) For example, the following prints the second field of each record that contains the string @samp{foo} anywhere in it: @example $ @kbd{awk '/foo/ @{ print $2 @}' BBS-list} @print{} 555-1234 @print{} 555-6699 @print{} 555-6480 @print{} 555-2127 @end example @cindex regular expressions, operators @cindex operators, string-matching @c @cindex operators, @code{~} @cindex string-matching operators @cindex @code{~} (tilde), @code{~} operator @cindex tilde (@code{~}), @code{~} operator @cindex @code{!} (exclamation point), @code{!~} operator @cindex exclamation point (@code{!}), @code{!~} operator @c @cindex operators, @code{!~} @cindex @code{if} statement @cindex @code{while} statement @cindex @code{do}-@code{while} statement @c @cindex statements, @code{if} @c @cindex statements, @code{while} @c @cindex statements, @code{do} Regular expressions can also be used in matching expressions. These expressions allow you to specify the string to match against; it need not be the entire current input record. The two operators @samp{~} and @samp{!~} perform regular expression comparisons. Expressions using these operators can be used as patterns, or in @code{if}, @code{while}, @code{for}, and @code{do} statements. (@xref{Statements}.) For example: @example @var{exp} ~ /@var{regexp}/ @end example @noindent is true if the expression @var{exp} (taken as a string) matches @var{regexp}. The following example matches, or selects, all input records with the uppercase letter @samp{J} somewhere in the first field: @example $ @kbd{awk '$1 ~ /J/' inventory-shipped} @print{} Jan 13 25 15 115 @print{} Jun 31 42 75 492 @print{} Jul 24 34 67 436 @print{} Jan 21 36 64 620 @end example So does this: @example awk '@{ if ($1 ~ /J/) print @}' inventory-shipped @end example This next example is true if the expression @var{exp} (taken as a character string) does @emph{not} match @var{regexp}: @example @var{exp} !~ /@var{regexp}/ @end example The following example matches, or selects, all input records whose first field @emph{does not} contain the uppercase letter @samp{J}: @example $ @kbd{awk '$1 !~ /J/' inventory-shipped} @print{} Feb 15 32 24 226 @print{} Mar 15 24 34 228 @print{} Apr 31 52 63 420 @print{} May 16 34 29 208 @dots{} @end example @cindex regexp constants @cindex regular expressions, constants, See regexp constants When a regexp is enclosed in slashes, such as @code{/foo/}, we call it a @dfn{regexp constant}, much like @code{5.27} is a numeric constant and @code{"foo"} is a string constant. @node Escape Sequences @section Escape Sequences @cindex escape sequences @cindex backslash (@code{\}), in escape sequences @cindex @code{\} (backslash), in escape sequences Some characters cannot be included literally in string constants (@code{"foo"}) or regexp constants (@code{/foo/}). Instead, they should be represented with @dfn{escape sequences}, which are character sequences beginning with a backslash (@samp{\}). One use of an escape sequence is to include a double-quote character in a string constant. Because a plain double quote ends the string, you must use @samp{\"} to represent an actual double-quote character as a part of the string. For example: @example $ @kbd{awk 'BEGIN @{ print "He said \"hi!\" to her." @}'} @print{} He said "hi!" to her. @end example The backslash character itself is another character that cannot be included normally; you must write @samp{\\} to put one backslash in the string or regexp. Thus, the string whose contents are the two characters @samp{"} and @samp{\} must be written @code{"\"\\"}. Other escape sequences represent unprintable characters such as TAB or newline. While there is nothing to stop you from entering most unprintable characters directly in a string constant or regexp constant, they may look ugly. The following table lists all the escape sequences used in @command{awk} and what they represent. Unless noted otherwise, all these escape sequences apply to both string constants and regexp constants: @table @code @item \\ A literal backslash, @samp{\}. @c @cindex @command{awk} language, V.4 version @cindex @code{\} (backslash), @code{\a} escape sequence @cindex backslash (@code{\}), @code{\a} escape sequence @item \a The ``alert'' character, @kbd{@value{CTL}-g}, ASCII code 7 (BEL). (This usually makes some sort of audible noise.) @cindex @code{\} (backslash), @code{\b} escape sequence @cindex backslash (@code{\}), @code{\b} escape sequence @item \b Backspace, @kbd{@value{CTL}-h}, ASCII code 8 (BS). @cindex @code{\} (backslash), @code{\f} escape sequence @cindex backslash (@code{\}), @code{\f} escape sequence @item \f Formfeed, @kbd{@value{CTL}-l}, ASCII code 12 (FF). @cindex @code{\} (backslash), @code{\n} escape sequence @cindex backslash (@code{\}), @code{\n} escape sequence @item \n Newline, @kbd{@value{CTL}-j}, ASCII code 10 (LF). @cindex @code{\} (backslash), @code{\r} escape sequence @cindex backslash (@code{\}), @code{\r} escape sequence @item \r Carriage return, @kbd{@value{CTL}-m}, ASCII code 13 (CR). @cindex @code{\} (backslash), @code{\t} escape sequence @cindex backslash (@code{\}), @code{\t} escape sequence @item \t Horizontal TAB, @kbd{@value{CTL}-i}, ASCII code 9 (HT). @c @cindex @command{awk} language, V.4 version @cindex @code{\} (backslash), @code{\v} escape sequence @cindex backslash (@code{\}), @code{\v} escape sequence @item \v Vertical tab, @kbd{@value{CTL}-k}, ASCII code 11 (VT). @cindex @code{\} (backslash), @code{\}@var{nnn} escape sequence @cindex backslash (@code{\}), @code{\}@var{nnn} escape sequence @item \@var{nnn} The octal value @var{nnn}, where @var{nnn} stands for 1 to 3 digits between @samp{0} and @samp{7}. For example, the code for the ASCII ESC (escape) character is @samp{\033}. @c @cindex @command{awk} language, V.4 version @c @cindex @command{awk} language, POSIX version @cindex @code{\} (backslash), @code{\x} escape sequence @cindex backslash (@code{\}), @code{\x} escape sequence @cindex common extensions, @code{\x} escape sequence @cindex extensions, common@comma{} @code{\x} escape sequence @item \x@var{hh}@dots{} The hexadecimal value @var{hh}, where @var{hh} stands for a sequence of hexadecimal digits (@samp{0}--@samp{9}, and either @samp{A}--@samp{F} or @samp{a}--@samp{f}). Like the same construct in ISO C, the escape sequence continues until the first nonhexadecimal digit is seen. @value{COMMONEXT} However, using more than two hexadecimal digits produces undefined results. (The @samp{\x} escape sequence is not allowed in POSIX @command{awk}.) @cindex @code{\} (backslash), @code{\/} escape sequence @cindex backslash (@code{\}), @code{\/} escape sequence @item \/ A literal slash (necessary for regexp constants only). This sequence is used when you want to write a regexp constant that contains a slash. Because the regexp is delimited by slashes, you need to escape the slash that is part of the pattern, in order to tell @command{awk} to keep processing the rest of the regexp. @cindex @code{\} (backslash), @code{\"} escape sequence @cindex backslash (@code{\}), @code{\"} escape sequence @item \" A literal double quote (necessary for string constants only). This sequence is used when you want to write a string constant that contains a double quote. Because the string is delimited by double quotes, you need to escape the quote that is part of the string, in order to tell @command{awk} to keep processing the rest of the string. @end table In @command{gawk}, a number of additional two-character sequences that begin with a backslash have special meaning in regexps. @xref{GNU Regexp Operators}. In a regexp, a backslash before any character that is not in the previous list and not listed in @ref{GNU Regexp Operators}, means that the next character should be taken literally, even if it would normally be a regexp operator. For example, @code{/a\+b/} matches the three characters @samp{a+b}. @cindex backslash (@code{\}), in escape sequences @cindex @code{\} (backslash), in escape sequences @cindex portability For complete portability, do not use a backslash before any character not shown in the previous list. To summarize: @itemize @bullet @item The escape sequences in the table above are always processed first, for both string constants and regexp constants. This happens very early, as soon as @command{awk} reads your program. @item @command{gawk} processes both regexp constants and dynamic regexps (@pxref{Computed Regexps}), for the special operators listed in @ref{GNU Regexp Operators}. @item A backslash before any other character means to treat that character literally. @end itemize @c fakenode --- for prepinfo @subheading Advanced Notes: Backslash Before Regular Characters @cindex portability, backslash in escape sequences @cindex POSIX @command{awk}, backslashes in string constants @cindex backslash (@code{\}), in escape sequences, POSIX and @cindex @code{\} (backslash), in escape sequences, POSIX and @cindex troubleshooting, backslash before nonspecial character If you place a backslash in a string constant before something that is not one of the characters previously listed, POSIX @command{awk} purposely leaves what happens as undefined. There are two choices: @c @cindex automatic warnings @c @cindex warnings, automatic @table @asis @item Strip the backslash out This is what Brian Kernighan's @command{awk} and @command{gawk} both do. For example, @code{"a\qc"} is the same as @code{"aqc"}. (Because this is such an easy bug both to introduce and to miss, @command{gawk} warns you about it.) Consider @samp{FS = @w{"[ \t]+\|[ \t]+"}} to use vertical bars surrounded by whitespace as the field separator. There should be two backslashes in the string: @samp{FS = @w{"[ \t]+\\|[ \t]+"}}.) @c I did this! This is why I added the warning. @cindex @command{gawk}, escape sequences @cindex Unix @command{awk}, backslashes in escape sequences @item Leave the backslash alone Some other @command{awk} implementations do this. In such implementations, typing @code{"a\qc"} is the same as typing @code{"a\\qc"}. @end table @c fakenode --- for prepinfo @subheading Advanced Notes: Escape Sequences for Metacharacters @cindex metacharacters, escape sequences for Suppose you use an octal or hexadecimal escape to represent a regexp metacharacter. (See @ref{Regexp Operators}.) Does @command{awk} treat the character as a literal character or as a regexp operator? @cindex dark corner, escape sequences, for metacharacters Historically, such characters were taken literally. @value{DARKCORNER} However, the POSIX standard indicates that they should be treated as real metacharacters, which is what @command{gawk} does. In compatibility mode (@pxref{Options}), @command{gawk} treats the characters represented by octal and hexadecimal escape sequences literally when used in regexp constants. Thus, @code{/a\52b/} is equivalent to @code{/a\*b/}. @node Regexp Operators @section Regular Expression Operators @c STARTOFRANGE regexpo @cindex regular expressions, operators You can combine regular expressions with special characters, called @dfn{regular expression operators} or @dfn{metacharacters}, to increase the power and versatility of regular expressions. The escape sequences described @ifnotinfo earlier @end ifnotinfo in @ref{Escape Sequences}, are valid inside a regexp. They are introduced by a @samp{\} and are recognized and converted into corresponding real characters as the very first step in processing regexps. Here is a list of metacharacters. All characters that are not escape sequences and that are not listed in the table stand for themselves: @table @code @cindex backslash (@code{\}) @cindex @code{\} (backslash) @item \ This is used to suppress the special meaning of a character when matching. For example, @samp{\$} matches the character @samp{$}. @cindex regular expressions, anchors in @cindex Texinfo, chapter beginnings in files @cindex @code{^} (caret) @cindex caret (@code{^}) @item ^ This matches the beginning of a string. For example, @samp{^@@chapter} matches @samp{@@chapter} at the beginning of a string and can be used to identify chapter beginnings in Texinfo source files. The @samp{^} is known as an @dfn{anchor}, because it anchors the pattern to match only at the beginning of the string. It is important to realize that @samp{^} does not match the beginning of a line embedded in a string. The condition is not true in the following example: @example if ("line1\nLINE 2" ~ /^L/) @dots{} @end example @cindex @code{$} (dollar sign) @cindex dollar sign (@code{$}) @item $ This is similar to @samp{^}, but it matches only at the end of a string. For example, @samp{p$} matches a record that ends with a @samp{p}. The @samp{$} is an anchor and does not match the end of a line embedded in a string. The condition in the following example is not true: @example if ("line1\nLINE 2" ~ /1$/) @dots{} @end example @cindex @code{.} (period) @cindex period (@code{.}) @item . @r{(period)} This matches any single character, @emph{including} the newline character. For example, @samp{.P} matches any single character followed by a @samp{P} in a string. Using concatenation, we can make a regular expression such as @samp{U.A}, which matches any three-character sequence that begins with @samp{U} and ends with @samp{A}. @cindex POSIX @command{awk}, period (@code{.})@comma{} using In strict POSIX mode (@pxref{Options}), @samp{.} does not match the @sc{nul} character, which is a character with all bits equal to zero. Otherwise, @sc{nul} is just another character. Other versions of @command{awk} may not be able to match the @sc{nul} character. @cindex @code{[]} (square brackets) @cindex square brackets (@code{[]}) @cindex bracket expressions @cindex character sets, See Also bracket expressions @cindex character lists, See bracket expressions @item [@dots{}] This is called a @dfn{bracket expression}.@footnote{In other literature, you may see a bracket expression referred to as either a @dfn{character set}, a @dfn{character class}, or a @dfn{character list}.} It matches any @emph{one} of the characters that are enclosed in the square brackets. For example, @samp{[MVX]} matches any one of the characters @samp{M}, @samp{V}, or @samp{X} in a string. A full discussion of what can be inside the square brackets of a bracket expression is given in @ref{Bracket Expressions}. @cindex bracket expressions, complemented @item [^ @dots{}] This is a @dfn{complemented bracket expression}. The first character after the @samp{[} @emph{must} be a @samp{^}. It matches any characters @emph{except} those in the square brackets. For example, @samp{[^awk]} matches any character that is not an @samp{a}, @samp{w}, or @samp{k}. @cindex @code{|} (vertical bar) @cindex vertical bar (@code{|}) @item | This is the @dfn{alternation operator} and it is used to specify alternatives. The @samp{|} has the lowest precedence of all the regular expression operators. For example, @samp{^P|[[:digit:]]} matches any string that matches either @samp{^P} or @samp{[[:digit:]]}. This means it matches any string that starts with @samp{P} or contains a digit. The alternation applies to the largest possible regexps on either side. @cindex @code{()} (parentheses) @cindex parentheses @code{()} @item (@dots{}) Parentheses are used for grouping in regular expressions, as in arithmetic. They can be used to concatenate regular expressions containing the alternation operator, @samp{|}. For example, @samp{@@(samp|code)\@{[^@}]+\@}} matches both @samp{@@code@{foo@}} and @samp{@@samp@{bar@}}. (These are Texinfo formatting control sequences. The @samp{+} is explained further on in this list.) @cindex @code{*} (asterisk), @code{*} operator, as regexp operator @cindex asterisk (@code{*}), @code{*} operator, as regexp operator @item * This symbol means that the preceding regular expression should be repeated as many times as necessary to find a match. For example, @samp{ph*} applies the @samp{*} symbol to the preceding @samp{h} and looks for matches of one @samp{p} followed by any number of @samp{h}s. This also matches just @samp{p} if no @samp{h}s are present. The @samp{*} repeats the @emph{smallest} possible preceding expression. (Use parentheses if you want to repeat a larger expression.) It finds as many repetitions as possible. For example, @samp{awk '/\(c[ad][ad]*r x\)/ @{ print @}' sample} prints every record in @file{sample} containing a string of the form @samp{(car x)}, @samp{(cdr x)}, @samp{(cadr x)}, and so on. Notice the escaping of the parentheses by preceding them with backslashes. @cindex @code{+} (plus sign) @cindex plus sign (@code{+}) @item + This symbol is similar to @samp{*}, except that the preceding expression must be matched at least once. This means that @samp{wh+y} would match @samp{why} and @samp{whhy}, but not @samp{wy}, whereas @samp{wh*y} would match all three of these strings. The following is a simpler way of writing the last @samp{*} example: @example awk '/\(c[ad]+r x\)/ @{ print @}' sample @end example @cindex @code{?} (question mark) regexp operator @cindex question mark (@code{?}) regexp operator @item ? This symbol is similar to @samp{*}, except that the preceding expression can be matched either once or not at all. For example, @samp{fe?d} matches @samp{fed} and @samp{fd}, but nothing else. @cindex interval expressions @item @{@var{n}@} @itemx @{@var{n},@} @itemx @{@var{n},@var{m}@} One or two numbers inside braces denote an @dfn{interval expression}. If there is one number in the braces, the preceding regexp is repeated @var{n} times. If there are two numbers separated by a comma, the preceding regexp is repeated @var{n} to @var{m} times. If there is one number followed by a comma, then the preceding regexp is repeated at least @var{n} times: @table @code @item wh@{3@}y Matches @samp{whhhy}, but not @samp{why} or @samp{whhhhy}. @item wh@{3,5@}y Matches @samp{whhhy}, @samp{whhhhy}, or @samp{whhhhhy}, only. @item wh@{2,@}y Matches @samp{whhy} or @samp{whhhy}, and so on. @end table @cindex POSIX @command{awk}, interval expressions in Interval expressions were not traditionally available in @command{awk}. They were added as part of the POSIX standard to make @command{awk} and @command{egrep} consistent with each other. @cindex @command{gawk}, interval expressions and Initially, because old programs may use @samp{@{} and @samp{@}} in regexp constants, @command{gawk} did @emph{not} match interval expressions in regexps. However, beginning with @value{PVERSION} 4.0, @command{gawk} does match interval expressions by default. This is because compatibility with POSIX has become more important to most @command{gawk} users than compatibility with old programs. For programs that use @samp{@{} and @samp{@}} in regexp constants, it is good practice to always escape them with a backslash. Then the regexp constants are valid and work the way you want them to, using any version of @command{awk}.@footnote{Use two backslashes if you're using a string constant with a regexp operator or function.} Finally, when @samp{@{} and @samp{@}} appear in regexp constants in a way that cannot be interpreted as an interval expression (such as @code{/q@{a@}/}), then they stand for themselves. @end table @cindex precedence, regexp operators @cindex regular expressions, operators, precedence of In regular expressions, the @samp{*}, @samp{+}, and @samp{?} operators, as well as the braces @samp{@{} and @samp{@}}, have the highest precedence, followed by concatenation, and finally by @samp{|}. As in arithmetic, parentheses can change how operators are grouped. @cindex POSIX @command{awk}, regular expressions and @cindex @command{gawk}, regular expressions, precedence In POSIX @command{awk} and @command{gawk}, the @samp{*}, @samp{+}, and @samp{?} operators stand for themselves when there is nothing in the regexp that precedes them. For example, @code{/+/} matches a literal plus sign. However, many other versions of @command{awk} treat such a usage as a syntax error. If @command{gawk} is in compatibility mode (@pxref{Options}), interval expressions are not available in regular expressions. @c ENDOFRANGE regexpo @node Bracket Expressions @section Using Bracket Expressions @c STARTOFRANGE charlist @cindex bracket expressions @cindex bracket expressions, range expressions @cindex range expressions (regexps) As mentioned earlier, a bracket expression matches any character amongst those listed between the opening and closing square brackets. Within a bracket expression, a @dfn{range expression} consists of two characters separated by a hyphen. It matches any single character that sorts between the two characters, based upon the system's native character set. For example, @samp{[0-9]} is equivalent to @samp{[0123456789]}. (See @ref{Ranges and Locales}, for an explanation of how the POSIX standard and @command{gawk} have changed over time. This is mainly of historical interest.) @cindex @code{\} (backslash), in bracket expressions @cindex backslash (@code{\}), in bracket expressions @cindex @code{^} (caret), in bracket expressions @cindex caret (@code{^}), in bracket expressions @cindex @code{-} (hyphen), in bracket expressions @cindex hyphen (@code{-}), in bracket expressions To include one of the characters @samp{\}, @samp{]}, @samp{-}, or @samp{^} in a bracket expression, put a @samp{\} in front of it. For example: @example [d\]] @end example @noindent matches either @samp{d} or @samp{]}. @cindex POSIX @command{awk}, bracket expressions and @cindex Extended Regular Expressions (EREs) @cindex EREs (Extended Regular Expressions) @cindex @command{egrep} utility This treatment of @samp{\} in bracket expressions is compatible with other @command{awk} implementations and is also mandated by POSIX. The regular expressions in @command{awk} are a superset of the POSIX specification for Extended Regular Expressions (EREs). POSIX EREs are based on the regular expressions accepted by the traditional @command{egrep} utility. @cindex bracket expressions, character classes @cindex POSIX @command{awk}, bracket expressions and, character classes @dfn{Character classes} are a feature introduced in the POSIX standard. A character class is a special notation for describing lists of characters that have a specific attribute, but the actual characters can vary from country to country and/or from character set to character set. For example, the notion of what is an alphabetic character differs between the United States and France. A character class is only valid in a regexp @emph{inside} the brackets of a bracket expression. Character classes consist of @samp{[:}, a keyword denoting the class, and @samp{:]}. @ref{table-char-classes} lists the character classes defined by the POSIX standard. @float Table,table-char-classes @caption{POSIX Character Classes} @multitable @columnfractions .15 .85 @headitem Class @tab Meaning @item @code{[:alnum:]} @tab Alphanumeric characters. @item @code{[:alpha:]} @tab Alphabetic characters. @item @code{[:blank:]} @tab Space and TAB characters. @item @code{[:cntrl:]} @tab Control characters. @item @code{[:digit:]} @tab Numeric characters. @item @code{[:graph:]} @tab Characters that are both printable and visible. (A space is printable but not visible, whereas an @samp{a} is both.) @item @code{[:lower:]} @tab Lowercase alphabetic characters. @item @code{[:print:]} @tab Printable characters (characters that are not control characters). @item @code{[:punct:]} @tab Punctuation characters (characters that are not letters, digits, control characters, or space characters). @item @code{[:space:]} @tab Space characters (such as space, TAB, and formfeed, to name a few). @item @code{[:upper:]} @tab Uppercase alphabetic characters. @item @code{[:xdigit:]} @tab Characters that are hexadecimal digits. @end multitable @end float For example, before the POSIX standard, you had to write @code{/[A-Za-z0-9]/} to match alphanumeric characters. If your character set had other alphabetic characters in it, this would not match them. With the POSIX character classes, you can write @code{/[[:alnum:]]/} to match the alphabetic and numeric characters in your character set. @cindex bracket expressions, collating elements @cindex bracket expressions, non-ASCII @cindex collating elements Two additional special sequences can appear in bracket expressions. These apply to non-ASCII character sets, which can have single symbols (called @dfn{collating elements}) that are represented with more than one character. They can also have several characters that are equivalent for @dfn{collating}, or sorting, purposes. (For example, in French, a plain ``e'' and a grave-accented ``@`e'' are equivalent.) These sequences are: @table @asis @cindex bracket expressions, collating symbols @cindex collating symbols @item Collating symbols Multicharacter collating elements enclosed between @samp{[.} and @samp{.]}. For example, if @samp{ch} is a collating element, then @code{[[.ch.]]} is a regexp that matches this collating element, whereas @code{[ch]} is a regexp that matches either @samp{c} or @samp{h}. @cindex bracket expressions, equivalence classes @item Equivalence classes Locale-specific names for a list of characters that are equal. The name is enclosed between @samp{[=} and @samp{=]}. For example, the name @samp{e} might be used to represent all of ``e,'' ``@`e,'' and ``@'e.'' In this case, @code{[[=e=]]} is a regexp that matches any of @samp{e}, @samp{@'e}, or @samp{@`e}. @end table These features are very valuable in non-English-speaking locales. @cindex internationalization, localization, character classes @cindex @command{gawk}, character classes and @cindex POSIX @command{awk}, bracket expressions and, character classes @quotation CAUTION The library functions that @command{gawk} uses for regular expression matching currently recognize only POSIX character classes; they do not recognize collating symbols or equivalence classes. @end quotation @c maybe one day ... @c ENDOFRANGE charlist @node GNU Regexp Operators @section @command{gawk}-Specific Regexp Operators @c This section adapted (long ago) from the regex-0.12 manual @c STARTOFRANGE regexpg @cindex regular expressions, operators, @command{gawk} @c STARTOFRANGE gregexp @cindex @command{gawk}, regular expressions, operators @cindex operators, GNU-specific @cindex regular expressions, operators, for words @cindex word, regexp definition of GNU software that deals with regular expressions provides a number of additional regexp operators. These operators are described in this @value{SECTION} and are specific to @command{gawk}; they are not available in other @command{awk} implementations. Most of the additional operators deal with word matching. For our purposes, a @dfn{word} is a sequence of one or more letters, digits, or underscores (@samp{_}): @table @code @c @cindex operators, @code{\s} (@command{gawk}) @cindex backslash (@code{\}), @code{\s} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\s} operator (@command{gawk}) @item \s Matches any whitespace character. Think of it as shorthand for @w{@code{[[:space:]]}}. @c @cindex operators, @code{\S} (@command{gawk}) @cindex backslash (@code{\}), @code{\S} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\S} operator (@command{gawk}) @item \S Matches any character that is not whitespace. Think of it as shorthand for @w{@code{[^[:space:]]}}. @c @cindex operators, @code{\w} (@command{gawk}) @cindex backslash (@code{\}), @code{\w} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\w} operator (@command{gawk}) @item \w Matches any word-constituent character---that is, it matches any letter, digit, or underscore. Think of it as shorthand for @w{@code{[[:alnum:]_]}}. @c @cindex operators, @code{\W} (@command{gawk}) @cindex backslash (@code{\}), @code{\W} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\W} operator (@command{gawk}) @item \W Matches any character that is not word-constituent. Think of it as shorthand for @w{@code{[^[:alnum:]_]}}. @c @cindex operators, @code{\<} (@command{gawk}) @cindex backslash (@code{\}), @code{\<} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\<} operator (@command{gawk}) @item \< Matches the empty string at the beginning of a word. For example, @code{/\} (@command{gawk}) @cindex backslash (@code{\}), @code{\>} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\>} operator (@command{gawk}) @item \> Matches the empty string at the end of a word. For example, @code{/stow\>/} matches @samp{stow} but not @samp{stowaway}. @c @cindex operators, @code{\y} (@command{gawk}) @cindex backslash (@code{\}), @code{\y} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\y} operator (@command{gawk}) @cindex word boundaries@comma{} matching @item \y Matches the empty string at either the beginning or the end of a word (i.e., the word boundar@strong{y}). For example, @samp{\yballs?\y} matches either @samp{ball} or @samp{balls}, as a separate word. @c @cindex operators, @code{\B} (@command{gawk}) @cindex backslash (@code{\}), @code{\B} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\B} operator (@command{gawk}) @item \B Matches the empty string that occurs between two word-constituent characters. For example, @code{/\Brat\B/} matches @samp{crate} but it does not match @samp{dirty rat}. @samp{\B} is essentially the opposite of @samp{\y}. @end table @cindex buffers, operators for @cindex regular expressions, operators, for buffers @cindex operators, string-matching, for buffers There are two other operators that work on buffers. In Emacs, a @dfn{buffer} is, naturally, an Emacs buffer. For other programs, @command{gawk}'s regexp library routines consider the entire string to match as the buffer. The operators are: @table @code @item \` @c @cindex operators, @code{\`} (@command{gawk}) @cindex backslash (@code{\}), @code{\`} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\`} operator (@command{gawk}) Matches the empty string at the beginning of a buffer (string). @c @cindex operators, @code{\'} (@command{gawk}) @cindex backslash (@code{\}), @code{\'} operator (@command{gawk}) @cindex @code{\} (backslash), @code{\'} operator (@command{gawk}) @item \' Matches the empty string at the end of a buffer (string). @end table @cindex @code{^} (caret) @cindex caret (@code{^}) @cindex @code{?} (question mark) regexp operator @cindex question mark (@code{?}) regexp operator Because @samp{^} and @samp{$} always work in terms of the beginning and end of strings, these operators don't add any new capabilities for @command{awk}. They are provided for compatibility with other GNU software. @cindex @command{gawk}, word-boundary operator @cindex word-boundary operator (@command{gawk}) @cindex operators, word-boundary (@command{gawk}) In other GNU software, the word-boundary operator is @samp{\b}. However, that conflicts with the @command{awk} language's definition of @samp{\b} as backspace, so @command{gawk} uses a different letter. An alternative method would have been to require two backslashes in the GNU operators, but this was deemed too confusing. The current method of using @samp{\y} for the GNU @samp{\b} appears to be the lesser of two evils. @c NOTE!!! Keep this in sync with the same table in the summary appendix! @c @c Should really do this with file inclusion. @cindex regular expressions, @command{gawk}, command-line options @cindex @command{gawk}, command-line options The various command-line options (@pxref{Options}) control how @command{gawk} interprets characters in regexps: @table @asis @item No options In the default case, @command{gawk} provides all the facilities of POSIX regexps and the @ifnotinfo previously described GNU regexp operators. @end ifnotinfo @ifnottex GNU regexp operators described in @ref{Regexp Operators}. @end ifnottex @item @code{--posix} Only POSIX regexps are supported; the GNU operators are not special (e.g., @samp{\w} matches a literal @samp{w}). Interval expressions are allowed. @item @code{--traditional} Traditional Unix @command{awk} regexps are matched. The GNU operators are not special, and interval expressions are not available. The POSIX character classes (@code{[[:alnum:]]}, etc.) are supported, as Brian Kernighan's @command{awk} does support them. Characters described by octal and hexadecimal escape sequences are treated literally, even if they represent regexp metacharacters. @item @code{--re-interval} Allow interval expressions in regexps, if @option{--traditional} has been provided. Otherwise, interval expressions are available by default. @end table @c ENDOFRANGE gregexp @c ENDOFRANGE regexpg @node Case-sensitivity @section Case Sensitivity in Matching @c STARTOFRANGE regexpcs @cindex regular expressions, case sensitivity @c STARTOFRANGE csregexp @cindex case sensitivity, regexps and Case is normally significant in regular expressions, both when matching ordinary characters (i.e., not metacharacters) and inside bracket expressions. Thus, a @samp{w} in a regular expression matches only a lowercase @samp{w} and not an uppercase @samp{W}. The simplest way to do a case-independent match is to use a bracket expression---for example, @samp{[Ww]}. However, this can be cumbersome if you need to use it often, and it can make the regular expressions harder to read. There are two alternatives that you might prefer. One way to perform a case-insensitive match at a particular point in the program is to convert the data to a single case, using the @code{tolower()} or @code{toupper()} built-in string functions (which we haven't discussed yet; @pxref{String Functions}). For example: @example tolower($1) ~ /foo/ @{ @dots{} @} @end example @noindent converts the first field to lowercase before matching against it. This works in any POSIX-compliant @command{awk}. @cindex @command{gawk}, regular expressions, case sensitivity @cindex case sensitivity, @command{gawk} @cindex differences in @command{awk} and @command{gawk}, regular expressions @cindex @code{~} (tilde), @code{~} operator @cindex tilde (@code{~}), @code{~} operator @cindex @code{!} (exclamation point), @code{!~} operator @cindex exclamation point (@code{!}), @code{!~} operator @cindex @code{IGNORECASE} variable @cindex @command{gawk}, @code{IGNORECASE} variable in @c @cindex variables, @code{IGNORECASE} Another method, specific to @command{gawk}, is to set the variable @code{IGNORECASE} to a nonzero value (@pxref{Built-in Variables}). When @code{IGNORECASE} is not zero, @emph{all} regexp and string operations ignore case. Changing the value of @code{IGNORECASE} dynamically controls the case-sensitivity of the program as it runs. Case is significant by default because @code{IGNORECASE} (like most variables) is initialized to zero: @example x = "aB" if (x ~ /ab/) @dots{} # this test will fail IGNORECASE = 1 if (x ~ /ab/) @dots{} # now it will succeed @end example In general, you cannot use @code{IGNORECASE} to make certain rules case-insensitive and other rules case-sensitive, because there is no straightforward way to set @code{IGNORECASE} just for the pattern of a particular rule.@footnote{Experienced C and C++ programmers will note that it is possible, using something like @samp{IGNORECASE = 1 && /foObAr/ @{ @dots{} @}} and @samp{IGNORECASE = 0 || /foobar/ @{ @dots{} @}}. However, this is somewhat obscure and we don't recommend it.} To do this, use either bracket expressions or @code{tolower()}. However, one thing you can do with @code{IGNORECASE} only is dynamically turn case-sensitivity on or off for all the rules at once. @code{IGNORECASE} can be set on the command line or in a @code{BEGIN} rule (@pxref{Other Arguments}; also @pxref{Using BEGIN/END}). Setting @code{IGNORECASE} from the command line is a way to make a program case-insensitive without having to edit it. Both regexp and string comparison operations are affected by @code{IGNORECASE}. @c @cindex ISO 8859-1 @c @cindex ISO Latin-1 In multibyte locales, the equivalences between upper- and lowercase characters are tested based on the wide-character values of the locale's character set. Otherwise, the characters are tested based on the ISO-8859-1 (ISO Latin-1) character set. This character set is a superset of the traditional 128 ASCII characters, which also provides a number of characters suitable for use with European languages.@footnote{If you don't understand this, don't worry about it; it just means that @command{gawk} does the right thing.} The value of @code{IGNORECASE} has no effect if @command{gawk} is in compatibility mode (@pxref{Options}). Case is always significant in compatibility mode. @c ENDOFRANGE csregexp @c ENDOFRANGE regexpcs @node Leftmost Longest @section How Much Text Matches? @cindex regular expressions, leftmost longest match @c @cindex matching, leftmost longest Consider the following: @example echo aaaabcd | awk '@{ sub(/a+/, ""); print @}' @end example This example uses the @code{sub()} function (which we haven't discussed yet; @pxref{String Functions}) to make a change to the input record. Here, the regexp @code{/a+/} indicates ``one or more @samp{a} characters,'' and the replacement text is @samp{}. The input contains four @samp{a} characters. @command{awk} (and POSIX) regular expressions always match the leftmost, @emph{longest} sequence of input characters that can match. Thus, all four @samp{a} characters are replaced with @samp{} in this example: @example $ @kbd{echo aaaabcd | awk '@{ sub(/a+/, ""); print @}'} @print{} bcd @end example For simple match/no-match tests, this is not so important. But when doing text matching and substitutions with the @code{match()}, @code{sub()}, @code{gsub()}, and @code{gensub()} functions, it is very important. @ifinfo @xref{String Functions}, for more information on these functions. @end ifinfo Understanding this principle is also important for regexp-based record and field splitting (@pxref{Records}, and also @pxref{Field Separators}). @node Computed Regexps @section Using Dynamic Regexps @c STARTOFRANGE dregexp @cindex regular expressions, computed @c STARTOFRANGE regexpd @cindex regular expressions, dynamic @cindex @code{~} (tilde), @code{~} operator @cindex tilde (@code{~}), @code{~} operator @cindex @code{!} (exclamation point), @code{!~} operator @cindex exclamation point (@code{!}), @code{!~} operator @c @cindex operators, @code{~} @c @cindex operators, @code{!~} The righthand side of a @samp{~} or @samp{!~} operator need not be a regexp constant (i.e., a string of characters between slashes). It may be any expression. The expression is evaluated and converted to a string if necessary; the contents of the string are then used as the regexp. A regexp computed in this way is called a @dfn{dynamic regexp}: @example BEGIN @{ digits_regexp = "[[:digit:]]+" @} $0 ~ digits_regexp @{ print @} @end example @noindent This sets @code{digits_regexp} to a regexp that describes one or more digits, and tests whether the input record matches this regexp. @quotation NOTE When using the @samp{~} and @samp{!~} operators, there is a difference between a regexp constant enclosed in slashes and a string constant enclosed in double quotes. If you are going to use a string constant, you have to understand that the string is, in essence, scanned @emph{twice}: the first time when @command{awk} reads your program, and the second time when it goes to match the string on the lefthand side of the operator with the pattern on the right. This is true of any string-valued expression (such as @code{digits_regexp}, shown previously), not just string constants. @end quotation @cindex regexp constants, slashes vs.@: quotes @cindex @code{\} (backslash), regexp constants @cindex backslash (@code{\}), regexp constants @cindex @code{"} (double quote), regexp constants @cindex double quote (@code{"}), regexp constants What difference does it make if the string is scanned twice? The answer has to do with escape sequences, and particularly with backslashes. To get a backslash into a regular expression inside a string, you have to type two backslashes. For example, @code{/\*/} is a regexp constant for a literal @samp{*}. Only one backslash is needed. To do the same thing with a string, you have to type @code{"\\*"}. The first backslash escapes the second one so that the string actually contains the two characters @samp{\} and @samp{*}. @cindex troubleshooting, regexp constants vs.@: string constants @cindex regexp constants, vs.@: string constants @cindex string constants, vs.@: regexp constants Given that you can use both regexp and string constants to describe regular expressions, which should you use? The answer is ``regexp constants,'' for several reasons: @itemize @bullet @item String constants are more complicated to write and more difficult to read. Using regexp constants makes your programs less error-prone. Not understanding the difference between the two kinds of constants is a common source of errors. @item It is more efficient to use regexp constants. @command{awk} can note that you have supplied a regexp and store it internally in a form that makes pattern matching more efficient. When using a string constant, @command{awk} must first convert the string into this internal form and then perform the pattern matching. @item Using regexp constants is better form; it shows clearly that you intend a regexp match. @end itemize @c fakenode --- for prepinfo @subheading Advanced Notes: Using @code{\n} in Bracket Expressions of Dynamic Regexps @cindex regular expressions, dynamic, with embedded newlines @cindex newlines, in dynamic regexps Some commercial versions of @command{awk} do not allow the newline character to be used inside a bracket expression for a dynamic regexp: @example $ @kbd{awk '$0 ~ "[ \t\n]"'} @error{} awk: newline in character class [ @error{} ]... @error{} source line number 1 @error{} context is @error{} >>> <<< @end example @cindex newlines, in regexp constants But a newline in a regexp constant works with no problem: @example $ @kbd{awk '$0 ~ /[ \t\n]/'} @kbd{here is a sample line} @print{} here is a sample line @kbd{@value{CTL}-d} @end example @command{gawk} does not have this problem, and it isn't likely to occur often in practice, but it's worth noting for future reference. @c ENDOFRANGE dregexp @c ENDOFRANGE regexpd @c ENDOFRANGE regexp @node Reading Files @chapter Reading Input Files @c STARTOFRANGE infir @cindex input files, reading @cindex input files @cindex @code{FILENAME} variable In the typical @command{awk} program, @command{awk} reads all input either from the standard input (by default, this is the keyboard, but often it is a pipe from another command) or from files whose names you specify on the @command{awk} command line. If you specify input files, @command{awk} reads them in order, processing all the data from one before going on to the next. The name of the current input file can be found in the built-in variable @code{FILENAME} (@pxref{Built-in Variables}). @cindex records @cindex fields The input is read in units called @dfn{records}, and is processed by the rules of your program one record at a time. By default, each record is one line. Each record is automatically split into chunks called @dfn{fields}. This makes it more convenient for programs to work on the parts of a record. @cindex @code{getline} command On rare occasions, you may need to use the @code{getline} command. The @code{getline} command is valuable, both because it can do explicit input from any number of files, and because the files used with it do not have to be named on the @command{awk} command line (@pxref{Getline}). @menu * Records:: Controlling how data is split into records. * Fields:: An introduction to fields. * Nonconstant Fields:: Nonconstant Field Numbers. * Changing Fields:: Changing the Contents of a Field. * Field Separators:: The field separator and how to change it. * Constant Size:: Reading constant width data. * Splitting By Content:: Defining Fields By Content * Multiple Line:: Reading multi-line records. * Getline:: Reading files under explicit program control using the @code{getline} function. * Command line directories:: What happens if you put a directory on the command line. @end menu @node Records @section How Input Is Split into Records @c STARTOFRANGE inspl @cindex input, splitting into records @c STARTOFRANGE recspl @cindex records, splitting input into @cindex @code{NR} variable @cindex @code{FNR} variable The @command{awk} utility divides the input for your @command{awk} program into records and fields. @command{awk} keeps track of the number of records that have been read so far from the current input file. This value is stored in a built-in variable called @code{FNR}. It is reset to zero when a new file is started. Another built-in variable, @code{NR}, records the total number of input records read so far from all @value{DF}s. It starts at zero, but is never automatically reset to zero. @cindex separators, for records @cindex record separators Records are separated by a character called the @dfn{record separator}. By default, the record separator is the newline character. This is why records are, by default, single lines. A different character can be used for the record separator by assigning the character to the built-in variable @code{RS}. @cindex newlines, as record separators @cindex @code{RS} variable Like any other variable, the value of @code{RS} can be changed in the @command{awk} program with the assignment operator, @samp{=} (@pxref{Assignment Ops}). The new record-separator character should be enclosed in quotation marks, which indicate a string constant. Often the right time to do this is at the beginning of execution, before any input is processed, so that the very first record is read with the proper separator. To do this, use the special @code{BEGIN} pattern (@pxref{BEGIN/END}). For example: @cindex @code{BEGIN} pattern @example awk 'BEGIN @{ RS = "/" @} @{ print $0 @}' BBS-list @end example @noindent changes the value of @code{RS} to @code{"/"}, before reading any input. This is a string whose first character is a slash; as a result, records are separated by slashes. Then the input file is read, and the second rule in the @command{awk} program (the action with no pattern) prints each record. Because each @code{print} statement adds a newline at the end of its output, this @command{awk} program copies the input with each slash changed to a newline. Here are the results of running the program on @file{BBS-list}: @example $ @kbd{awk 'BEGIN @{ RS = "/" @}} > @kbd{@{ print $0 @}' BBS-list} @print{} aardvark 555-5553 1200 @print{} 300 B @print{} alpo-net 555-3412 2400 @print{} 1200 @print{} 300 A @print{} barfly 555-7685 1200 @print{} 300 A @print{} bites 555-1675 2400 @print{} 1200 @print{} 300 A @print{} camelot 555-0542 300 C @print{} core 555-2912 1200 @print{} 300 C @print{} fooey 555-1234 2400 @print{} 1200 @print{} 300 B @print{} foot 555-6699 1200 @print{} 300 B @print{} macfoo 555-6480 1200 @print{} 300 A @print{} sdace 555-3430 2400 @print{} 1200 @print{} 300 A @print{} sabafoo 555-2127 1200 @print{} 300 C @print{} @end example @noindent Note that the entry for the @samp{camelot} BBS is not split. In the original @value{DF} (@pxref{Sample Data Files}), the line looks like this: @example camelot 555-0542 300 C @end example @noindent It has one baud rate only, so there are no slashes in the record, unlike the others which have two or more baud rates. In fact, this record is treated as part of the record for the @samp{core} BBS; the newline separating them in the output is the original newline in the @value{DF}, not the one added by @command{awk} when it printed the record! @cindex record separators, changing @cindex separators, for records Another way to change the record separator is on the command line, using the variable-assignment feature (@pxref{Other Arguments}): @example awk '@{ print $0 @}' RS="/" BBS-list @end example @noindent This sets @code{RS} to @samp{/} before processing @file{BBS-list}. Using an unusual character such as @samp{/} for the record separator produces correct behavior in the vast majority of cases. However, the following (extreme) pipeline prints a surprising @samp{1}: @example $ echo | awk 'BEGIN @{ RS = "a" @} ; @{ print NF @}' @print{} 1 @end example There is one field, consisting of a newline. The value of the built-in variable @code{NF} is the number of fields in the current record. @cindex dark corner, input files Reaching the end of an input file terminates the current input record, even if the last character in the file is not the character in @code{RS}. @value{DARKCORNER} @cindex null strings @cindex strings, empty, See null strings The empty string @code{""} (a string without any characters) has a special meaning as the value of @code{RS}. It means that records are separated by one or more blank lines and nothing else. @xref{Multiple Line}, for more details. If you change the value of @code{RS} in the middle of an @command{awk} run, the new value is used to delimit subsequent records, but the record currently being processed, as well as records already processed, are not affected. @cindex @command{gawk}, @code{RT} variable in @cindex @code{RT} variable @cindex records, terminating @cindex terminating records @cindex differences in @command{awk} and @command{gawk}, record separators @cindex regular expressions, as record separators @cindex record separators, regular expressions as @cindex separators, for records, regular expressions as After the end of the record has been determined, @command{gawk} sets the variable @code{RT} to the text in the input that matched @code{RS}. @cindex common extensions, @code{RS} as a regexp @cindex extensions, common@comma{} @code{RS} as a regexp When using @command{gawk}, the value of @code{RS} is not limited to a one-character string. It can be any regular expression (@pxref{Regexp}). @value{COMMONEXT} In general, each record ends at the next string that matches the regular expression; the next record starts at the end of the matching string. This general rule is actually at work in the usual case, where @code{RS} contains just a newline: a record ends at the beginning of the next matching string (the next newline in the input), and the following record starts just after the end of this string (at the first character of the following line). The newline, because it matches @code{RS}, is not part of either record. When @code{RS} is a single character, @code{RT} contains the same single character. However, when @code{RS} is a regular expression, @code{RT} contains the actual input text that matched the regular expression. If the input file ended without any text that matches @code{RS}, @command{gawk} sets @code{RT} to the null string. The following example illustrates both of these features. It sets @code{RS} equal to a regular expression that matches either a newline or a series of one or more uppercase letters with optional leading and/or trailing whitespace: @example $ @kbd{echo record 1 AAAA record 2 BBBB record 3 |} > @kbd{gawk 'BEGIN @{ RS = "\n|( *[[:upper:]]+ *)" @}} > @kbd{@{ print "Record =", $0, "and RT =", RT @}'} @print{} Record = record 1 and RT = AAAA @print{} Record = record 2 and RT = BBBB @print{} Record = record 3 and RT = @print{} @end example @noindent The final line of output has an extra blank line. This is because the value of @code{RT} is a newline, and the @code{print} statement supplies its own terminating newline. @xref{Simple Sed}, for a more useful example of @code{RS} as a regexp and @code{RT}. If you set @code{RS} to a regular expression that allows optional trailing text, such as @samp{RS = "abc(XYZ)?"} it is possible, due to implementation constraints, that @command{gawk} may match the leading part of the regular expression, but not the trailing part, particularly if the input text that could match the trailing part is fairly long. @command{gawk} attempts to avoid this problem, but currently, there's no guarantee that this will never happen. @quotation NOTE Remember that in @command{awk}, the @samp{^} and @samp{$} anchor metacharacters match the beginning and end of a @emph{string}, and not the beginning and end of a @emph{line}. As a result, something like @samp{RS = "^[[:upper:]]"} can only match at the beginning of a file. This is because @command{gawk} views the input file as one long string that happens to contain newline characters in it. It is thus best to avoid anchor characters in the value of @code{RS}. @end quotation @cindex differences in @command{awk} and @command{gawk}, @code{RS}/@code{RT} variables The use of @code{RS} as a regular expression and the @code{RT} variable are @command{gawk} extensions; they are not available in compatibility mode (@pxref{Options}). In compatibility mode, only the first character of the value of @code{RS} is used to determine the end of the record. @c fakenode --- for prepinfo @subheading Advanced Notes: @code{RS = "\0"} Is Not Portable @cindex advanced features, @value{DF}s as single record @cindex portability, @value{DF}s as single record There are times when you might want to treat an entire @value{DF} as a single record. The only way to make this happen is to give @code{RS} a value that you know doesn't occur in the input file. This is hard to do in a general way, such that a program always works for arbitrary input files. @c can you say `understatement' boys and girls? You might think that for text files, the @sc{nul} character, which consists of a character with all bits equal to zero, is a good value to use for @code{RS} in this case: @example BEGIN @{ RS = "\0" @} # whole file becomes one record? @end example @cindex differences in @command{awk} and @command{gawk}, strings, storing @command{gawk} in fact accepts this, and uses the @sc{nul} character for the record separator. However, this usage is @emph{not} portable to other @command{awk} implementations. @cindex dark corner, strings, storing All other @command{awk} implementations@footnote{At least that we know about.} store strings internally as C-style strings. C strings use the @sc{nul} character as the string terminator. In effect, this means that @samp{RS = "\0"} is the same as @samp{RS = ""}. @value{DARKCORNER} @cindex records, treating files as @cindex files, as single records The best way to treat a whole file as a single record is to simply read the file in, one record at a time, concatenating each record onto the end of the previous ones. @c ENDOFRANGE inspl @c ENDOFRANGE recspl @node Fields @section Examining Fields @cindex examining fields @cindex fields @cindex accessing fields @c STARTOFRANGE fiex @cindex fields, examining @cindex POSIX @command{awk}, field separators and @cindex field separators, POSIX and @cindex separators, field, POSIX and When @command{awk} reads an input record, the record is automatically @dfn{parsed} or separated by the @command{awk} utility into chunks called @dfn{fields}. By default, fields are separated by @dfn{whitespace}, like words in a line. Whitespace in @command{awk} means any string of one or more spaces, TABs, or newlines;@footnote{In POSIX @command{awk}, newlines are not considered whitespace for separating fields.} other characters, such as formfeed, vertical tab, etc., that are considered whitespace by other languages, are @emph{not} considered whitespace by @command{awk}. The purpose of fields is to make it more convenient for you to refer to these pieces of the record. You don't have to use them---you can operate on the whole record if you want---but fields are what make simple @command{awk} programs so powerful. @cindex field operator @code{$} @cindex @code{$} (dollar sign), @code{$} field operator @cindex dollar sign (@code{$}), @code{$} field operator @cindex field operators@comma{} dollar sign as A dollar-sign (@samp{$}) is used to refer to a field in an @command{awk} program, followed by the number of the field you want. Thus, @code{$1} refers to the first field, @code{$2} to the second, and so on. (Unlike the Unix shells, the field numbers are not limited to single digits. @code{$127} is the one hundred twenty-seventh field in the record.) For example, suppose the following is a line of input: @example This seems like a pretty nice example. @end example @noindent Here the first field, or @code{$1}, is @samp{This}, the second field, or @code{$2}, is @samp{seems}, and so on. Note that the last field, @code{$7}, is @samp{example.}. Because there is no space between the @samp{e} and the @samp{.}, the period is considered part of the seventh field. @cindex @code{NF} variable @cindex fields, number of @code{NF} is a built-in variable whose value is the number of fields in the current record. @command{awk} automatically updates the value of @code{NF} each time it reads a record. No matter how many fields there are, the last field in a record can be represented by @code{$NF}. So, @code{$NF} is the same as @code{$7}, which is @samp{example.}. If you try to reference a field beyond the last one (such as @code{$8} when the record has only seven fields), you get the empty string. (If used in a numeric operation, you get zero.) The use of @code{$0}, which looks like a reference to the ``zero-th'' field, is a special case: it represents the whole input record when you are not interested in specific fields. Here are some more examples: @example $ @kbd{awk '$1 ~ /foo/ @{ print $0 @}' BBS-list} @print{} fooey 555-1234 2400/1200/300 B @print{} foot 555-6699 1200/300 B @print{} macfoo 555-6480 1200/300 A @print{} sabafoo 555-2127 1200/300 C @end example @noindent This example prints each record in the file @file{BBS-list} whose first field contains the string @samp{foo}. The operator @samp{~} is called a @dfn{matching operator} (@pxref{Regexp Usage}); it tests whether a string (here, the field @code{$1}) matches a given regular expression. By contrast, the following example looks for @samp{foo} in @emph{the entire record} and prints the first field and the last field for each matching input record: @example $ @kbd{awk '/foo/ @{ print $1, $NF @}' BBS-list} @print{} fooey B @print{} foot B @print{} macfoo A @print{} sabafoo C @end example @c ENDOFRANGE fiex @node Nonconstant Fields @section Nonconstant Field Numbers @cindex fields, numbers @cindex field numbers The number of a field does not need to be a constant. Any expression in the @command{awk} language can be used after a @samp{$} to refer to a field. The value of the expression specifies the field number. If the value is a string, rather than a number, it is converted to a number. Consider this example: @example awk '@{ print $NR @}' @end example @noindent Recall that @code{NR} is the number of records read so far: one in the first record, two in the second, etc. So this example prints the first field of the first record, the second field of the second record, and so on. For the twentieth record, field number 20 is printed; most likely, the record has fewer than 20 fields, so this prints a blank line. Here is another example of using expressions as field numbers: @example awk '@{ print $(2*2) @}' BBS-list @end example @command{awk} evaluates the expression @samp{(2*2)} and uses its value as the number of the field to print. The @samp{*} sign represents multiplication, so the expression @samp{2*2} evaluates to four. The parentheses are used so that the multiplication is done before the @samp{$} operation; they are necessary whenever there is a binary operator in the field-number expression. This example, then, prints the hours of operation (the fourth field) for every line of the file @file{BBS-list}. (All of the @command{awk} operators are listed, in order of decreasing precedence, in @ref{Precedence}.) If the field number you compute is zero, you get the entire record. Thus, @samp{$(2-2)} has the same value as @code{$0}. Negative field numbers are not allowed; trying to reference one usually terminates the program. (The POSIX standard does not define what happens when you reference a negative field number. @command{gawk} notices this and terminates your program. Other @command{awk} implementations may behave differently.) As mentioned in @ref{Fields}, @command{awk} stores the current record's number of fields in the built-in variable @code{NF} (also @pxref{Built-in Variables}). The expression @code{$NF} is not a special feature---it is the direct consequence of evaluating @code{NF} and using its value as a field number. @node Changing Fields @section Changing the Contents of a Field @c STARTOFRANGE ficon @cindex fields, changing contents of The contents of a field, as seen by @command{awk}, can be changed within an @command{awk} program; this changes what @command{awk} perceives as the current input record. (The actual input is untouched; @command{awk} @emph{never} modifies the input file.) Consider the following example and its output: @example $ @kbd{awk '@{ nboxes = $3 ; $3 = $3 - 10} > @kbd{print nboxes, $3 @}' inventory-shipped} @print{} 25 15 @print{} 32 22 @print{} 24 14 @dots{} @end example @noindent The program first saves the original value of field three in the variable @code{nboxes}. The @samp{-} sign represents subtraction, so this program reassigns field three, @code{$3}, as the original value of field three minus ten: @samp{$3 - 10}. (@xref{Arithmetic Ops}.) Then it prints the original and new values for field three. (Someone in the warehouse made a consistent mistake while inventorying the red boxes.) For this to work, the text in field @code{$3} must make sense as a number; the string of characters must be converted to a number for the computer to do arithmetic on it. The number resulting from the subtraction is converted back to a string of characters that then becomes field three. @xref{Conversion}. When the value of a field is changed (as perceived by @command{awk}), the text of the input record is recalculated to contain the new field where the old one was. In other words, @code{$0} changes to reflect the altered field. Thus, this program prints a copy of the input file, with 10 subtracted from the second field of each line: @example $ @kbd{awk '@{ $2 = $2 - 10; print $0 @}' inventory-shipped} @print{} Jan 3 25 15 115 @print{} Feb 5 32 24 226 @print{} Mar 5 24 34 228 @dots{} @end example It is also possible to also assign contents to fields that are out of range. For example: @example $ awk '@{ $6 = ($5 + $4 + $3 + $2) > print $6 @}' inventory-shipped @print{} 168 @print{} 297 @print{} 301 @dots{} @end example @cindex adding, fields @cindex fields, adding @noindent We've just created @code{$6}, whose value is the sum of fields @code{$2}, @code{$3}, @code{$4}, and @code{$5}. The @samp{+} sign represents addition. For the file @file{inventory-shipped}, @code{$6} represents the total number of parcels shipped for a particular month. Creating a new field changes @command{awk}'s internal copy of the current input record, which is the value of @code{$0}. Thus, if you do @samp{print $0} after adding a field, the record printed includes the new field, with the appropriate number of field separators between it and the previously existing fields. @cindex @code{OFS} variable @cindex output field separator, See @code{OFS} variable @cindex field separators, See Also @code{OFS} This recomputation affects and is affected by @code{NF} (the number of fields; @pxref{Fields}). For example, the value of @code{NF} is set to the number of the highest field you create. The exact format of @code{$0} is also affected by a feature that has not been discussed yet: the @dfn{output field separator}, @code{OFS}, used to separate the fields (@pxref{Output Separators}). Note, however, that merely @emph{referencing} an out-of-range field does @emph{not} change the value of either @code{$0} or @code{NF}. Referencing an out-of-range field only produces an empty string. For example: @example if ($(NF+1) != "") print "can't happen" else print "everything is normal" @end example @noindent should print @samp{everything is normal}, because @code{NF+1} is certain to be out of range. (@xref{If Statement}, for more information about @command{awk}'s @code{if-else} statements. @xref{Typing and Comparison}, for more information about the @samp{!=} operator.) It is important to note that making an assignment to an existing field changes the value of @code{$0} but does not change the value of @code{NF}, even when you assign the empty string to a field. For example: @example $ @kbd{echo a b c d | awk '@{ OFS = ":"; $2 = ""} > @kbd{print $0; print NF @}'} @print{} a::c:d @print{} 4 @end example @noindent The field is still there; it just has an empty value, denoted by the two colons between @samp{a} and @samp{c}. This example shows what happens if you create a new field: @example $ @kbd{echo a b c d | awk '@{ OFS = ":"; $2 = ""; $6 = "new"} > @kbd{print $0; print NF @}'} @print{} a::c:d::new @print{} 6 @end example @noindent The intervening field, @code{$5}, is created with an empty value (indicated by the second pair of adjacent colons), and @code{NF} is updated with the value six. @cindex dark corner, @code{NF} variable, decrementing @cindex @code{NF} variable, decrementing Decrementing @code{NF} throws away the values of the fields after the new value of @code{NF} and recomputes @code{$0}. @value{DARKCORNER} Here is an example: @example $ echo a b c d e f | awk '@{ print "NF =", NF; > NF = 3; print $0 @}' @print{} NF = 6 @print{} a b c @end example @cindex portability, @code{NF} variable@comma{} decrementing @quotation CAUTION Some versions of @command{awk} don't rebuild @code{$0} when @code{NF} is decremented. Caveat emptor. @end quotation Finally, there are times when it is convenient to force @command{awk} to rebuild the entire record, using the current value of the fields and @code{OFS}. To do this, use the seemingly innocuous assignment: @example $1 = $1 # force record to be reconstituted print $0 # or whatever else with $0 @end example @noindent This forces @command{awk} to rebuild the record. It does help to add a comment, as we've shown here. There is a flip side to the relationship between @code{$0} and the fields. Any assignment to @code{$0} causes the record to be reparsed into fields using the @emph{current} value of @code{FS}. This also applies to any built-in function that updates @code{$0}, such as @code{sub()} and @code{gsub()} (@pxref{String Functions}). @c fakenode --- for prepinfo @subheading Advanced Notes: Understanding @code{$0} It is important to remember that @code{$0} is the @emph{full} record, exactly as it was read from the input. This includes any leading or trailing whitespace, and the exact whitespace (or other characters) that separate the fields. It is a not-uncommon error to try to change the field separators in a record simply by setting @code{FS} and @code{OFS}, and then expecting a plain @samp{print} or @samp{print $0} to print the modified record. But this does not work, since nothing was done to change the record itself. Instead, you must force the record to be rebuilt, typically with a statement such as @samp{$1 = $1}, as described earlier. @c ENDOFRANGE ficon @node Field Separators @section Specifying How Fields Are Separated @menu * Default Field Splitting:: How fields are normally separated. * Regexp Field Splitting:: Using regexps as the field separator. * Single Character Fields:: Making each character a separate field. * Command Line Field Separator:: Setting @code{FS} from the command-line. * Field Splitting Summary:: Some final points and a summary table. @end menu @cindex @code{FS} variable @cindex fields, separating @c STARTOFRANGE fisepr @cindex field separators @c STARTOFRANGE fisepg @cindex fields, separating The @dfn{field separator}, which is either a single character or a regular expression, controls the way @command{awk} splits an input record into fields. @command{awk} scans the input record for character sequences that match the separator; the fields themselves are the text between the matches. In the examples that follow, we use the bullet symbol (@bullet{}) to represent spaces in the output. If the field separator is @samp{oo}, then the following line: @example moo goo gai pan @end example @noindent is split into three fields: @samp{m}, @samp{@bullet{}g}, and @samp{@bullet{}gai@bullet{}pan}. Note the leading spaces in the values of the second and third fields. @cindex troubleshooting, @command{awk} uses @code{FS} not @code{IFS} The field separator is represented by the built-in variable @code{FS}. Shell programmers take note: @command{awk} does @emph{not} use the name @code{IFS} that is used by the POSIX-compliant shells (such as the Unix Bourne shell, @command{sh}, or Bash). @cindex @code{FS} variable, changing value of The value of @code{FS} can be changed in the @command{awk} program with the assignment operator, @samp{=} (@pxref{Assignment Ops}). Often the right time to do this is at the beginning of execution before any input has been processed, so that the very first record is read with the proper separator. To do this, use the special @code{BEGIN} pattern (@pxref{BEGIN/END}). For example, here we set the value of @code{FS} to the string @code{","}: @example awk 'BEGIN @{ FS = "," @} ; @{ print $2 @}' @end example @cindex @code{BEGIN} pattern @noindent Given the input line: @example John Q. Smith, 29 Oak St., Walamazoo, MI 42139 @end example @noindent this @command{awk} program extracts and prints the string @samp{@bullet{}29@bullet{}Oak@bullet{}St.}. @cindex field separators, choice of @cindex regular expressions as field separators @cindex field separators, regular expressions as Sometimes the input data contains separator characters that don't separate fields the way you thought they would. For instance, the person's name in the example we just used might have a title or suffix attached, such as: @example John Q. Smith, LXIX, 29 Oak St., Walamazoo, MI 42139 @end example @noindent The same program would extract @samp{@bullet{}LXIX}, instead of @samp{@bullet{}29@bullet{}Oak@bullet{}St.}. If you were expecting the program to print the address, you would be surprised. The moral is to choose your data layout and separator characters carefully to prevent such problems. (If the data is not in a form that is easy to process, perhaps you can massage it first with a separate @command{awk} program.) @node Default Field Splitting @subsection Whitespace Normally Separates Fields @cindex newlines, as field separators @cindex whitespace, as field separators Fields are normally separated by whitespace sequences (spaces, TABs, and newlines), not by single spaces. Two spaces in a row do not delimit an empty field. The default value of the field separator @code{FS} is a string containing a single space, @w{@code{" "}}. If @command{awk} interpreted this value in the usual way, each space character would separate fields, so two spaces in a row would make an empty field between them. The reason this does not happen is that a single space as the value of @code{FS} is a special case---it is taken to specify the default manner of delimiting fields. If @code{FS} is any other single character, such as @code{","}, then each occurrence of that character separates two fields. Two consecutive occurrences delimit an empty field. If the character occurs at the beginning or the end of the line, that too delimits an empty field. The space character is the only single character that does not follow these rules. @node Regexp Field Splitting @subsection Using Regular Expressions to Separate Fields @c STARTOFRANGE regexpfs @cindex regular expressions, as field separators @c STARTOFRANGE fsregexp @cindex field separators, regular expressions as The previous @value{SUBSECTION} discussed the use of single characters or simple strings as the value of @code{FS}. More generally, the value of @code{FS} may be a string containing any regular expression. In this case, each match in the record for the regular expression separates fields. For example, the assignment: @example FS = ", \t" @end example @noindent makes every area of an input line that consists of a comma followed by a space and a TAB into a field separator. @ifinfo (@samp{\t} is an @dfn{escape sequence} that stands for a TAB; @pxref{Escape Sequences}, for the complete list of similar escape sequences.) @end ifinfo For a less trivial example of a regular expression, try using single spaces to separate fields the way single commas are used. @code{FS} can be set to @w{@code{"[@ ]"}} (left bracket, space, right bracket). This regular expression matches a single space and nothing else (@pxref{Regexp}). There is an important difference between the two cases of @samp{FS = @w{" "}} (a single space) and @samp{FS = @w{"[ \t\n]+"}} (a regular expression matching one or more spaces, TABs, or newlines). For both values of @code{FS}, fields are separated by @dfn{runs} (multiple adjacent occurrences) of spaces, TABs, and/or newlines. However, when the value of @code{FS} is @w{@code{" "}}, @command{awk} first strips leading and trailing whitespace from the record and then decides where the fields are. For example, the following pipeline prints @samp{b}: @example $ @kbd{echo ' a b c d ' | awk '@{ print $2 @}'} @print{} b @end example @noindent However, this pipeline prints @samp{a} (note the extra spaces around each letter): @example $ @kbd{echo ' a b c d ' | awk 'BEGIN @{ FS = "[ \t\n]+" @}} > @kbd{@{ print $2 @}'} @print{} a @end example @noindent @cindex null strings @cindex strings, null @cindex empty strings, See null strings In this case, the first field is @dfn{null} or empty. The stripping of leading and trailing whitespace also comes into play whenever @code{$0} is recomputed. For instance, study this pipeline: @example $ @kbd{echo ' a b c d' | awk '@{ print; $2 = $2; print @}'} @print{} a b c d @print{} a b c d @end example @noindent The first @code{print} statement prints the record as it was read, with leading whitespace intact. The assignment to @code{$2} rebuilds @code{$0} by concatenating @code{$1} through @code{$NF} together, separated by the value of @code{OFS}. Because the leading whitespace was ignored when finding @code{$1}, it is not part of the new @code{$0}. Finally, the last @code{print} statement prints the new @code{$0}. @cindex @code{FS}, containing @code{^} @cindex @code{^}, in @code{FS} @cindex dark corner, @code{^}, in @code{FS} There is an additional subtlety to be aware of when using regular expressions for field splitting. It is not well-specified in the POSIX standard, or anywhere else, what @samp{^} means when splitting fields. Does the @samp{^} match only at the beginning of the entire record? Or is each field separator a new string? It turns out that different @command{awk} versions answer this question differently, and you should not rely on any specific behavior in your programs. @value{DARKCORNER} As a point of information, Brian Kernighan's @command{awk} allows @samp{^} to match only at the beginning of the record. @command{gawk} also works this way. For example: @example $ @kbd{echo 'xxAA xxBxx C' |} > @kbd{gawk -F '(^x+)|( +)' '@{ for (i = 1; i <= NF; i++)} > @kbd{printf "-->%s<--\n", $i @}'} @print{} --><-- @print{} -->AA<-- @print{} -->xxBxx<-- @print{} -->C<-- @end example @c ENDOFRANGE regexpfs @c ENDOFRANGE fsregexp @node Single Character Fields @subsection Making Each Character a Separate Field @cindex common extensions, single character fields @cindex extensions, common@comma{} single character fields @cindex differences in @command{awk} and @command{gawk}, single-character fields @cindex single-character fields @cindex fields, single-character There are times when you may want to examine each character of a record separately. This can be done in @command{gawk} by simply assigning the null string (@code{""}) to @code{FS}. @value{COMMONEXT} In this case, each individual character in the record becomes a separate field. For example: @example $ @kbd{echo a b | gawk 'BEGIN @{ FS = "" @}} > @kbd{@{} > @kbd{for (i = 1; i <= NF; i = i + 1)} > @kbd{print "Field", i, "is", $i} > @kbd{@}'} @print{} Field 1 is a @print{} Field 2 is @print{} Field 3 is b @end example @cindex dark corner, @code{FS} as null string @cindex FS variable, as null string Traditionally, the behavior of @code{FS} equal to @code{""} was not defined. In this case, most versions of Unix @command{awk} simply treat the entire record as only having one field. @value{DARKCORNER} In compatibility mode (@pxref{Options}), if @code{FS} is the null string, then @command{gawk} also behaves this way. @node Command Line Field Separator @subsection Setting @code{FS} from the Command Line @cindex @code{-F} option @cindex options, command-line @cindex command line, options @cindex field separators, on command line @cindex command line, @code{FS} on@comma{} setting @cindex @code{FS} variable, setting from command line @code{FS} can be set on the command line. Use the @option{-F} option to do so. For example: @example awk -F, '@var{program}' @var{input-files} @end example @noindent sets @code{FS} to the @samp{,} character. Notice that the option uses an uppercase @samp{F} instead of a lowercase @samp{f}. The latter option (@option{-f}) specifies a file containing an @command{awk} program. Case is significant in command-line options: the @option{-F} and @option{-f} options have nothing to do with each other. You can use both options at the same time to set the @code{FS} variable @emph{and} get an @command{awk} program from a file. The value used for the argument to @option{-F} is processed in exactly the same way as assignments to the built-in variable @code{FS}. Any special characters in the field separator must be escaped appropriately. For example, to use a @samp{\} as the field separator on the command line, you would have to type: @example # same as FS = "\\" awk -F\\\\ '@dots{}' files @dots{} @end example @noindent @cindex @code{\} (backslash), as field separators @cindex backslash (@code{\}), as field separators Because @samp{\} is used for quoting in the shell, @command{awk} sees @samp{-F\\}. Then @command{awk} processes the @samp{\\} for escape characters (@pxref{Escape Sequences}), finally yielding a single @samp{\} to use for the field separator. @c @cindex historical features As a special case, in compatibility mode (@pxref{Options}), if the argument to @option{-F} is @samp{t}, then @code{FS} is set to the TAB character. If you type @samp{-F\t} at the shell, without any quotes, the @samp{\} gets deleted, so @command{awk} figures that you really want your fields to be separated with TABs and not @samp{t}s. Use @samp{-v FS="t"} or @samp{-F"[t]"} on the command line if you really do want to separate your fields with @samp{t}s. As an example, let's use an @command{awk} program file called @file{baud.awk} that contains the pattern @code{/300/} and the action @samp{print $1}: @example /300/ @{ print $1 @} @end example Let's also set @code{FS} to be the @samp{-} character and run the program on the file @file{BBS-list}. The following command prints a list of the names of the bulletin boards that operate at 300 baud and the first three digits of their phone numbers: @c tweaked to make the tex output look better in @smallbook @example $ @kbd{awk -F- -f baud.awk BBS-list} @print{} aardvark 555 @print{} alpo @print{} barfly 555 @print{} bites 555 @print{} camelot 555 @print{} core 555 @print{} fooey 555 @print{} foot 555 @print{} macfoo 555 @print{} sdace 555 @print{} sabafoo 555 @end example @noindent Note the second line of output. The second line in the original file looked like this: @example alpo-net 555-3412 2400/1200/300 A @end example The @samp{-} as part of the system's name was used as the field separator, instead of the @samp{-} in the phone number that was originally intended. This demonstrates why you have to be careful in choosing your field and record separators. @cindex Unix @command{awk}, password files@comma{} field separators and Perhaps the most common use of a single character as the field separator occurs when processing the Unix system password file. On many Unix systems, each user has a separate entry in the system password file, one line per user. The information in these lines is separated by colons. The first field is the user's login name and the second is the user's (encrypted or shadow) password. A password file entry might look like this: @cindex Robbins, Arnold @example arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/bash @end example The following program searches the system password file and prints the entries for users who have no password: @example awk -F: '$2 == ""' /etc/passwd @end example @node Field Splitting Summary @subsection Field-Splitting Summary It is important to remember that when you assign a string constant as the value of @code{FS}, it undergoes normal @command{awk} string processing. For example, with Unix @command{awk} and @command{gawk}, the assignment @samp{FS = "\.."} assigns the character string @code{".."} to @code{FS} (the backslash is stripped). This creates a regexp meaning ``fields are separated by occurrences of any two characters.'' If instead you want fields to be separated by a literal period followed by any single character, use @samp{FS = "\\.."}. The following table summarizes how fields are split, based on the value of @code{FS} (@samp{==} means ``is equal to''): @table @code @item FS == " " Fields are separated by runs of whitespace. Leading and trailing whitespace are ignored. This is the default. @item FS == @var{any other single character} Fields are separated by each occurrence of the character. Multiple successive occurrences delimit empty fields, as do leading and trailing occurrences. The character can even be a regexp metacharacter; it does not need to be escaped. @item FS == @var{regexp} Fields are separated by occurrences of characters that match @var{regexp}. Leading and trailing matches of @var{regexp} delimit empty fields. @item FS == "" Each individual character in the record becomes a separate field. (This is a @command{gawk} extension; it is not specified by the POSIX standard.) @end table @c fakenode --- for prepinfo @subheading Advanced Notes: Changing @code{FS} Does Not Affect the Fields @cindex POSIX @command{awk}, field separators and @cindex field separators, POSIX and According to the POSIX standard, @command{awk} is supposed to behave as if each record is split into fields at the time it is read. In particular, this means that if you change the value of @code{FS} after a record is read, the value of the fields (i.e., how they were split) should reflect the old value of @code{FS}, not the new one. @cindex dark corner, field separators @cindex @command{sed} utility @cindex stream editors However, many older implementations of @command{awk} do not work this way. Instead, they defer splitting the fields until a field is actually referenced. The fields are split using the @emph{current} value of @code{FS}! @value{DARKCORNER} This behavior can be difficult to diagnose. The following example illustrates the difference between the two methods. (The @command{sed}@footnote{The @command{sed} utility is a ``stream editor.'' Its behavior is also defined by the POSIX standard.} command prints just the first line of @file{/etc/passwd}.) @example sed 1q /etc/passwd | awk '@{ FS = ":" ; print $1 @}' @end example @noindent which usually prints: @example root @end example @noindent on an incorrect implementation of @command{awk}, while @command{gawk} prints something like: @example root:nSijPlPhZZwgE:0:0:Root:/: @end example @c fakenode --- for prepinfo @subheading Advanced Notes: @code{FS} and @code{IGNORECASE} The @code{IGNORECASE} variable (@pxref{User-modified}) affects field splitting @emph{only} when the value of @code{FS} is a regexp. It has no effect when @code{FS} is a single character, even if that character is a letter. Thus, in the following code: @example FS = "c" IGNORECASE = 1 $0 = "aCa" print $1 @end example @noindent The output is @samp{aCa}. If you really want to split fields on an alphabetic character while ignoring case, use a regexp that will do it for you. E.g., @samp{FS = "[c]"}. In this case, @code{IGNORECASE} will take effect. @c ENDOFRANGE fisepr @c ENDOFRANGE fisepg @node Constant Size @section Reading Fixed-Width Data @ifnotinfo @quotation NOTE This @value{SECTION} discusses an advanced feature of @command{gawk}. If you are a novice @command{awk} user, you might want to skip it on the first reading. @end quotation @end ifnotinfo @ifinfo (This @value{SECTION} discusses an advanced feature of @command{awk}. If you are a novice @command{awk} user, you might want to skip it on the first reading.) @end ifinfo @cindex data, fixed-width @cindex fixed-width data @cindex advanced features, fixed-width data @command{gawk} provides a facility for dealing with fixed-width fields with no distinctive field separator. For example, data of this nature arises in the input for old Fortran programs where numbers are run together, or in the output of programs that did not anticipate the use of their output as input for other programs. An example of the latter is a table where all the columns are lined up by the use of a variable number of spaces and @emph{empty fields are just spaces}. Clearly, @command{awk}'s normal field splitting based on @code{FS} does not work well in this case. Although a portable @command{awk} program can use a series of @code{substr()} calls on @code{$0} (@pxref{String Functions}), this is awkward and inefficient for a large number of fields. @cindex troubleshooting, fatal errors, field widths@comma{} specifying @cindex @command{w} utility @cindex @code{FIELDWIDTHS} variable @cindex @command{gawk}, @code{FIELDWIDTHS} variable in The splitting of an input record into fixed-width fields is specified by assigning a string containing space-separated numbers to the built-in variable @code{FIELDWIDTHS}. Each number specifies the width of the field, @emph{including} columns between fields. If you want to ignore the columns between fields, you can specify the width as a separate field that is subsequently ignored. It is a fatal error to supply a field width that is not a positive number. The following data is the output of the Unix @command{w} utility. It is useful to illustrate the use of @code{FIELDWIDTHS}: @example @group 10:06pm up 21 days, 14:04, 23 users User tty login@ idle JCPU PCPU what hzuo ttyV0 8:58pm 9 5 vi p24.tex hzang ttyV3 6:37pm 50 -csh eklye ttyV5 9:53pm 7 1 em thes.tex dportein ttyV6 8:17pm 1:47 -csh gierd ttyD3 10:00pm 1 elm dave ttyD4 9:47pm 4 4 w brent ttyp0 26Jun91 4:46 26:46 4:41 bash dave ttyq4 26Jun9115days 46 46 wnewmail @end group @end example The following program takes the above input, converts the idle time to number of seconds, and prints out the first two fields and the calculated idle time: @quotation NOTE This program uses a number of @command{awk} features that haven't been introduced yet. @end quotation @example BEGIN @{ FIELDWIDTHS = "9 6 10 6 7 7 35" @} NR > 2 @{ idle = $4 sub(/^ */, "", idle) # strip leading spaces if (idle == "") idle = 0 if (idle ~ /:/) @{ split(idle, t, ":") idle = t[1] * 60 + t[2] @} if (idle ~ /days/) idle *= 24 * 60 * 60 print $1, $2, idle @} @end example Running the program on the data produces the following results: @example hzuo ttyV0 0 hzang ttyV3 50 eklye ttyV5 0 dportein ttyV6 107 gierd ttyD3 1 dave ttyD4 0 brent ttyp0 286 dave ttyq4 1296000 @end example Another (possibly more practical) example of fixed-width input data is the input from a deck of balloting cards. In some parts of the United States, voters mark their choices by punching holes in computer cards. These cards are then processed to count the votes for any particular candidate or on any particular issue. Because a voter may choose not to vote on some issue, any column on the card may be empty. An @command{awk} program for processing such data could use the @code{FIELDWIDTHS} feature to simplify reading the data. (Of course, getting @command{gawk} to run on a system with card readers is another story!) @ignore Exercise: Write a ballot card reading program @end ignore @cindex @command{gawk}, splitting fields and Assigning a value to @code{FS} causes @command{gawk} to use @code{FS} for field splitting again. Use @samp{FS = FS} to make this happen, without having to know the current value of @code{FS}. In order to tell which kind of field splitting is in effect, use @code{PROCINFO["FS"]} (@pxref{Auto-set}). The value is @code{"FS"} if regular field splitting is being used, or it is @code{"FIELDWIDTHS"} if fixed-width field splitting is being used: @example if (PROCINFO["FS"] == "FS") @var{regular field splitting} @dots{} else if (PROCINFO["FS"] == "FIELDWIDTHS") @var{fixed-width field splitting} @dots{} else @var{content-based field splitting} @dots{} (see next @value{SECTION}) @end example This information is useful when writing a function that needs to temporarily change @code{FS} or @code{FIELDWIDTHS}, read some records, and then restore the original settings (@pxref{Passwd Functions}, for an example of such a function). @node Splitting By Content @section Defining Fields By Content @ifnotinfo @quotation NOTE This @value{SECTION} discusses an advanced feature of @command{gawk}. If you are a novice @command{awk} user, you might want to skip it on the first reading. @end quotation @end ifnotinfo @ifinfo (This @value{SECTION} discusses an advanced feature of @command{awk}. If you are a novice @command{awk} user, you might want to skip it on the first reading.) @end ifinfo @cindex advanced features, specifying field content Normally, when using @code{FS}, @command{gawk} defines the fields as the parts of the record that occur in between each field separator. In other words, @code{FS} defines what a field @emph{is not}, instead of what a field @emph{is}. However, there are times when you really want to define the fields by what they are, and not by what they are not. The most notorious such case is so-called @dfn{comma separated value} (CSV) data. Many spreadsheet programs, for example, can export their data into text files, where each record is terminated with a newline, and fields are separated by commas. If only commas separated the data, there wouldn't be an issue. The problem comes when one of the fields contains an @emph{embedded} comma. While there is no formal standard specification for CSV data@footnote{At least, we don't know of one.}, in such cases, most programs embed the field in double quotes. So we might have data like this: @example @c file eg/misc/addresses.csv Robbins,Arnold,"1234 A Pretty Street, NE",MyTown,MyState,12345-6789,USA @c endfile @end example @cindex @command{gawk}, @code{FPAT} variable in @cindex @code{FPAT} variable The @code{FPAT} variable offers a solution for cases like this. The value of @code{FPAT} should be a string that provides a regular expression. This regular expression describes the contents of each field. In the case of CSV data as presented above, each field is either ``anything that is not a comma,'' or ``a double quote, anything that is not a double quote, and a closing double quote.'' If written as a regular expression constant (@pxref{Regexp}), we would have @code{/([^,]+)|("[^"]+")/}. Writing this as a string requires us to escape the double quotes, leading to: @example FPAT = "([^,]+)|(\"[^\"]+\")" @end example Putting this to use, here is a simple program to parse the data: @example @c file eg/misc/simple-csv.awk BEGIN @{ FPAT = "([^,]+)|(\"[^\"]+\")" @} @{ print "NF = ", NF for (i = 1; i <= NF; i++) @{ printf("$%d = <%s>\n", i, $i) @} @} @c endfile @end example When run, we get the following: @example $ @kbd{gawk -f simple-csv.awk addresses.csv} NF = 7 $1 = $2 = $3 = <"1234 A Pretty Street, NE"> $4 = $5 = $6 = <12345-6789> $7 = @end example Note the embedded comma in the value of @code{$3}. A straightforward improvement when processing CSV data of this sort would be to remove the quotes when they occur, with something like this: @example if (substr($i, 1, 1) == "\"") @{ len = length($i) $i = substr($i, 2, len - 2) # Get text within the two quotes @} @end example As with @code{FS}, the @code{IGNORECASE} variable (@pxref{User-modified}) affects field splitting with @code{FPAT}. Similar to @code{FIELDWIDTHS}, the value of @code{PROCINFO["FS"]} will be @code{"FPAT"} if content-based field splitting is being used. @quotation NOTE Some programs export CSV data that contains embedded newlines between the double quotes. @command{gawk} provides no way to deal with this. Since there is no formal specification for CSV data, there isn't much more to be done; the @code{FPAT} mechanism provides an elegant solution for the majority of cases, and the @command{gawk} maintainer is satisfied with that. @end quotation As written, the regexp used for @code{FPAT} requires that each field have a least one character. A straightforward modification (changing changed the first @samp{+} to @samp{*}) allows fields to be empty: @example FPAT = "([^,]*)|(\"[^\"]+\")" @end example Finally, the @code{patsplit()} function makes the same functionality available for splitting regular strings (@pxref{String Functions}). @node Multiple Line @section Multiple-Line Records @c STARTOFRANGE recm @cindex records, multiline @c STARTOFRANGE imr @cindex input, multiline records @c STARTOFRANGE frm @cindex files, reading, multiline records @cindex input, files, See input files In some databases, a single line cannot conveniently hold all the information in one entry. In such cases, you can use multiline records. The first step in doing this is to choose your data format. @cindex record separators, with multiline records One technique is to use an unusual character or string to separate records. For example, you could use the formfeed character (written @samp{\f} in @command{awk}, as in C) to separate them, making each record a page of the file. To do this, just set the variable @code{RS} to @code{"\f"} (a string containing the formfeed character). Any other character could equally well be used, as long as it won't be part of the data in a record. @cindex @code{RS} variable, multiline records and Another technique is to have blank lines separate records. By a special dispensation, an empty string as the value of @code{RS} indicates that records are separated by one or more blank lines. When @code{RS} is set to the empty string, each record always ends at the first blank line encountered. The next record doesn't start until the first nonblank line that follows. No matter how many blank lines appear in a row, they all act as one record separator. (Blank lines must be completely empty; lines that contain only whitespace do not count.) @cindex leftmost longest match @cindex matching, leftmost longest You can achieve the same effect as @samp{RS = ""} by assigning the string @code{"\n\n+"} to @code{RS}. This regexp matches the newline at the end of the record and one or more blank lines after the record. In addition, a regular expression always matches the longest possible sequence when there is a choice (@pxref{Leftmost Longest}). So the next record doesn't start until the first nonblank line that follows---no matter how many blank lines appear in a row, they are considered one record separator. @cindex dark corner, multiline records There is an important difference between @samp{RS = ""} and @samp{RS = "\n\n+"}. In the first case, leading newlines in the input @value{DF} are ignored, and if a file ends without extra blank lines after the last record, the final newline is removed from the record. In the second case, this special processing is not done. @value{DARKCORNER} @cindex field separators, in multiline records Now that the input is separated into records, the second step is to separate the fields in the record. One way to do this is to divide each of the lines into fields in the normal manner. This happens by default as the result of a special feature. When @code{RS} is set to the empty string, @emph{and} @code{FS} is set to a single character, the newline character @emph{always} acts as a field separator. This is in addition to whatever field separations result from @code{FS}.@footnote{When @code{FS} is the null string (@code{""}) or a regexp, this special feature of @code{RS} does not apply. It does apply to the default field separator of a single space: @samp{FS = @w{" "}}.} The original motivation for this special exception was probably to provide useful behavior in the default case (i.e., @code{FS} is equal to @w{@code{" "}}). This feature can be a problem if you really don't want the newline character to separate fields, because there is no way to prevent it. However, you can work around this by using the @code{split()} function to break up the record manually (@pxref{String Functions}). If you have a single character field separator, you can work around the special feature in a different way, by making @code{FS} into a regexp for that single character. For example, if the field separator is a percent character, instead of @samp{FS = "%"}, use @samp{FS = "[%]"}. Another way to separate fields is to put each field on a separate line: to do this, just set the variable @code{FS} to the string @code{"\n"}. (This single character separator matches a single newline.) A practical example of a @value{DF} organized this way might be a mailing list, where each entry is separated by blank lines. Consider a mailing list in a file named @file{addresses}, which looks like this: @example Jane Doe 123 Main Street Anywhere, SE 12345-6789 John Smith 456 Tree-lined Avenue Smallville, MW 98765-4321 @dots{} @end example @noindent A simple program to process this file is as follows: @example # addrs.awk --- simple mailing list program # Records are separated by blank lines. # Each line is one field. BEGIN @{ RS = "" ; FS = "\n" @} @{ print "Name is:", $1 print "Address is:", $2 print "City and State are:", $3 print "" @} @end example Running the program produces the following output: @example $ awk -f addrs.awk addresses @print{} Name is: Jane Doe @print{} Address is: 123 Main Street @print{} City and State are: Anywhere, SE 12345-6789 @print{} @print{} Name is: John Smith @print{} Address is: 456 Tree-lined Avenue @print{} City and State are: Smallville, MW 98765-4321 @print{} @dots{} @end example @xref{Labels Program}, for a more realistic program that deals with address lists. The following table summarizes how records are split, based on the value of @ifinfo @code{RS}. (@samp{==} means ``is equal to.'') @end ifinfo @ifnotinfo @code{RS}: @end ifnotinfo @table @code @item RS == "\n" Records are separated by the newline character (@samp{\n}). In effect, every line in the @value{DF} is a separate record, including blank lines. This is the default. @item RS == @var{any single character} Records are separated by each occurrence of the character. Multiple successive occurrences delimit empty records. @item RS == "" Records are separated by runs of blank lines. When @code{FS} is a single character, then the newline character always serves as a field separator, in addition to whatever value @code{FS} may have. Leading and trailing newlines in a file are ignored. @item RS == @var{regexp} Records are separated by occurrences of characters that match @var{regexp}. Leading and trailing matches of @var{regexp} delimit empty records. (This is a @command{gawk} extension; it is not specified by the POSIX standard.) @end table @cindex @command{gawk}, @code{RT} variable in @cindex @code{RT} variable In all cases, @command{gawk} sets @code{RT} to the input text that matched the value specified by @code{RS}. But if the input file ended without any text that matches @code{RS}, then @command{gawk} sets @code{RT} to the null string. @c ENDOFRANGE recm @c ENDOFRANGE imr @c ENDOFRANGE frm @node Getline @section Explicit Input with @code{getline} @c STARTOFRANGE getl @cindex @code{getline} command, explicit input with @cindex input, explicit So far we have been getting our input data from @command{awk}'s main input stream---either the standard input (usually your terminal, sometimes the output from another program) or from the files specified on the command line. The @command{awk} language has a special built-in command called @code{getline} that can be used to read input under your explicit control. The @code{getline} command is used in several different ways and should @emph{not} be used by beginners. The examples that follow the explanation of the @code{getline} command include material that has not been covered yet. Therefore, come back and study the @code{getline} command @emph{after} you have reviewed the rest of this @value{DOCUMENT} and have a good knowledge of how @command{awk} works. @cindex @command{gawk}, @code{ERRNO} variable in @cindex @code{ERRNO} variable @cindex differences in @command{awk} and @command{gawk}, @code{getline} command @cindex @code{getline} command, return values @cindex @code{--sandbox} option, input redirection with @command{getline} The @code{getline} command returns one if it finds a record and zero if it encounters the end of the file. If there is some error in getting a record, such as a file that cannot be opened, then @code{getline} returns @minus{}1. In this case, @command{gawk} sets the variable @code{ERRNO} to a string describing the error that occurred. In the following examples, @var{command} stands for a string value that represents a shell command. @quotation NOTE When @option{--sandbox} is specified (@pxref{Options}), reading lines from files, pipes and coprocesses is disabled. @end quotation @menu * Plain Getline:: Using @code{getline} with no arguments. * Getline/Variable:: Using @code{getline} into a variable. * Getline/File:: Using @code{getline} from a file. * Getline/Variable/File:: Using @code{getline} into a variable from a file. * Getline/Pipe:: Using @code{getline} from a pipe. * Getline/Variable/Pipe:: Using @code{getline} into a variable from a pipe. * Getline/Coprocess:: Using @code{getline} from a coprocess. * Getline/Variable/Coprocess:: Using @code{getline} into a variable from a coprocess. * Getline Notes:: Important things to know about @code{getline}. * Getline Summary:: Summary of @code{getline} Variants. @end menu @node Plain Getline @subsection Using @code{getline} with No Arguments The @code{getline} command can be used without arguments to read input from the current input file. All it does in this case is read the next input record and split it up into fields. This is useful if you've finished processing the current record, but want to do some special processing on the next record @emph{right now}. For example: @example @{ if ((t = index($0, "/*")) != 0) @{ # value of `tmp' will be "" if t is 1 tmp = substr($0, 1, t - 1) u = index(substr($0, t + 2), "*/") offset = t + 2 while (u == 0) @{ if (getline <= 0) @{ m = "unexpected EOF or error" m = (m ": " ERRNO) print m > "/dev/stderr" exit @} u = index($0, "*/") offset = 0 @} # substr() expression will be "" if */ # occurred at end of line $0 = tmp substr($0, offset + u + 2) @} print $0 @} @end example This @command{awk} program deletes C-style comments (@samp{/* @dots{} */}) from the input. By replacing the @samp{print $0} with other statements, you could perform more complicated processing on the decommented input, such as searching for matches of a regular expression. (This program has a subtle problem---it does not work if one comment ends and another begins on the same line.) @ignore Exercise, write a program that does handle multiple comments on the line. @end ignore This form of the @code{getline} command sets @code{NF}, @code{NR}, @code{FNR}, and the value of @code{$0}. @quotation NOTE The new value of @code{$0} is used to test the patterns of any subsequent rules. The original value of @code{$0} that triggered the rule that executed @code{getline} is lost. By contrast, the @code{next} statement reads a new record but immediately begins processing it normally, starting with the first rule in the program. @xref{Next Statement}. @end quotation @node Getline/Variable @subsection Using @code{getline} into a Variable @cindex variables, @code{getline} command into@comma{} using You can use @samp{getline @var{var}} to read the next record from @command{awk}'s input into the variable @var{var}. No other processing is done. For example, suppose the next line is a comment or a special string, and you want to read it without triggering any rules. This form of @code{getline} allows you to read that line and store it in a variable so that the main read-a-line-and-check-each-rule loop of @command{awk} never sees it. The following example swaps every two lines of input: @example @{ if ((getline tmp) > 0) @{ print tmp print $0 @} else print $0 @} @end example @noindent It takes the following list: @example wan tew free phore @end example @noindent and produces these results: @example tew wan phore free @end example The @code{getline} command used in this way sets only the variables @code{NR} and @code{FNR} (and of course, @var{var}). The record is not split into fields, so the values of the fields (including @code{$0}) and the value of @code{NF} do not change. @node Getline/File @subsection Using @code{getline} from a File @cindex input redirection @cindex redirection of input @cindex @code{<} (left angle bracket), @code{<} operator (I/O) @cindex left angle bracket (@code{<}), @code{<} operator (I/O) @cindex operators, input/output Use @samp{getline < @var{file}} to read the next record from @var{file}. Here @var{file} is a string-valued expression that specifies the @value{FN}. @samp{< @var{file}} is called a @dfn{redirection} because it directs input to come from a different place. For example, the following program reads its input record from the file @file{secondary.input} when it encounters a first field with a value equal to 10 in the current input file: @example @{ if ($1 == 10) @{ getline < "secondary.input" print @} else print @} @end example Because the main input stream is not used, the values of @code{NR} and @code{FNR} are not changed. However, the record it reads is split into fields in the normal manner, so the values of @code{$0} and the other fields are changed, resulting in a new value of @code{NF}. @cindex POSIX @command{awk}, @code{<} operator and @c Thanks to Paul Eggert for initial wording here According to POSIX, @samp{getline < @var{expression}} is ambiguous if @var{expression} contains unparenthesized operators other than @samp{$}; for example, @samp{getline < dir "/" file} is ambiguous because the concatenation operator is not parenthesized. You should write it as @samp{getline < (dir "/" file)} if you want your program to be portable to all @command{awk} implementations. @node Getline/Variable/File @subsection Using @code{getline} into a Variable from a File @cindex variables, @code{getline} command into@comma{} using Use @samp{getline @var{var} < @var{file}} to read input from the file @var{file}, and put it in the variable @var{var}. As above, @var{file} is a string-valued expression that specifies the file from which to read. @cindex @command{gawk}, @code{RT} variable in @cindex @code{RT} variable In this version of @code{getline}, none of the built-in variables are changed and the record is not split into fields. The only variable changed is @var{var}.@footnote{This is not quite true. @code{RT} could be changed if @code{RS} is a regular expression.} For example, the following program copies all the input files to the output, except for records that say @w{@samp{@@include @var{filename}}}. Such a record is replaced by the contents of the file @var{filename}: @example @{ if (NF == 2 && $1 == "@@include") @{ while ((getline line < $2) > 0) print line close($2) @} else print @} @end example Note here how the name of the extra input file is not built into the program; it is taken directly from the data, specifically from the second field on the @samp{@@include} line. @cindex @code{close()} function The @code{close()} function is called to ensure that if two identical @samp{@@include} lines appear in the input, the entire specified file is included twice. @xref{Close Files And Pipes}. One deficiency of this program is that it does not process nested @samp{@@include} statements (i.e., @samp{@@include} statements in included files) the way a true macro preprocessor would. @xref{Igawk Program}, for a program that does handle nested @samp{@@include} statements. @node Getline/Pipe @subsection Using @code{getline} from a Pipe @cindex @code{|} (vertical bar), @code{|} operator (I/O) @cindex vertical bar (@code{|}), @code{|} operator (I/O) @cindex input pipeline @cindex pipes, input @cindex operators, input/output The output of a command can also be piped into @code{getline}, using @samp{@var{command} | getline}. In this case, the string @var{command} is run as a shell command and its output is piped into @command{awk} to be used as input. This form of @code{getline} reads one record at a time from the pipe. For example, the following program copies its input to its output, except for lines that begin with @samp{@@execute}, which are replaced by the output produced by running the rest of the line as a shell command: @example @{ if ($1 == "@@execute") @{ tmp = substr($0, 10) # Remove "@@execute" while ((tmp | getline) > 0) print close(tmp) @} else print @} @end example @noindent @cindex @code{close()} function The @code{close()} function is called to ensure that if two identical @samp{@@execute} lines appear in the input, the command is run for each one. @ifnottex @xref{Close Files And Pipes}. @end ifnottex @c Exercise!! @c This example is unrealistic, since you could just use system Given the input: @example foo bar baz @@execute who bletch @end example @noindent the program might produce: @cindex Robbins, Bill @cindex Robbins, Miriam @cindex Robbins, Arnold @example foo bar baz arnold ttyv0 Jul 13 14:22 miriam ttyp0 Jul 13 14:23 (murphy:0) bill ttyp1 Jul 13 14:23 (murphy:0) bletch @end example @noindent Notice that this program ran the command @command{who} and printed the previous result. (If you try this program yourself, you will of course get different results, depending upon who is logged in on your system.) This variation of @code{getline} splits the record into fields, sets the value of @code{NF}, and recomputes the value of @code{$0}. The values of @code{NR} and @code{FNR} are not changed. @cindex POSIX @command{awk}, @code{|} I/O operator and @c Thanks to Paul Eggert for initial wording here According to POSIX, @samp{@var{expression} | getline} is ambiguous if @var{expression} contains unparenthesized operators other than @samp{$}---for example, @samp{@w{"echo "} "date" | getline} is ambiguous because the concatenation operator is not parenthesized. You should write it as @samp{(@w{"echo "} "date") | getline} if you want your program to be portable to all @command{awk} implementations. @quotation NOTE Unfortunately, @command{gawk} has not been consistent in its treatment of a construct like @samp{@w{"echo "} "date" | getline}. Most versions, including the current version, treat it at as @samp{@w{("echo "} "date") | getline}. (This how Brian Kernighan's @command{awk} behaves.) Some versions changed and treated it as @samp{@w{"echo "} ("date" | getline)}. (This is how @command{mawk} behaves.) In short, @emph{always} use explicit parentheses, and then you won't have to worry. @end quotation @node Getline/Variable/Pipe @subsection Using @code{getline} into a Variable from a Pipe @cindex variables, @code{getline} command into@comma{} using When you use @samp{@var{command} | getline @var{var}}, the output of @var{command} is sent through a pipe to @code{getline} and into the variable @var{var}. For example, the following program reads the current date and time into the variable @code{current_time}, using the @command{date} utility, and then prints it: @example BEGIN @{ "date" | getline current_time close("date") print "Report printed on " current_time @} @end example In this version of @code{getline}, none of the built-in variables are changed and the record is not split into fields. @ifinfo @c Thanks to Paul Eggert for initial wording here According to POSIX, @samp{@var{expression} | getline @var{var}} is ambiguous if @var{expression} contains unparenthesized operators other than @samp{$}; for example, @samp{@w{"echo "} "date" | getline @var{var}} is ambiguous because the concatenation operator is not parenthesized. You should write it as @samp{(@w{"echo "} "date") | getline @var{var}} if you want your program to be portable to other @command{awk} implementations. @end ifinfo @node Getline/Coprocess @subsection Using @code{getline} from a Coprocess @cindex coprocesses, @code{getline} from @cindex @code{getline} command, coprocesses@comma{} using from @cindex @code{|} (vertical bar), @code{|&} operator (I/O) @cindex vertical bar (@code{|}), @code{|&} operator (I/O) @cindex operators, input/output @cindex differences in @command{awk} and @command{gawk}, input/output operators Input into @code{getline} from a pipe is a one-way operation. The command that is started with @samp{@var{command} | getline} only sends data @emph{to} your @command{awk} program. On occasion, you might want to send data to another program for processing and then read the results back. @command{gawk} allows you to start a @dfn{coprocess}, with which two-way communications are possible. This is done with the @samp{|&} operator. Typically, you write data to the coprocess first and then read results back, as shown in the following: @example print "@var{some query}" |& "db_server" "db_server" |& getline @end example @noindent which sends a query to @command{db_server} and then reads the results. The values of @code{NR} and @code{FNR} are not changed, because the main input stream is not used. However, the record is split into fields in the normal manner, thus changing the values of @code{$0}, of the other fields, and of @code{NF}. Coprocesses are an advanced feature. They are discussed here only because this is the @value{SECTION} on @code{getline}. @xref{Two-way I/O}, where coprocesses are discussed in more detail. @node Getline/Variable/Coprocess @subsection Using @code{getline} into a Variable from a Coprocess @cindex variables, @code{getline} command into@comma{} using When you use @samp{@var{command} |& getline @var{var}}, the output from the coprocess @var{command} is sent through a two-way pipe to @code{getline} and into the variable @var{var}. In this version of @code{getline}, none of the built-in variables are changed and the record is not split into fields. The only variable changed is @var{var}. @ifinfo Coprocesses are an advanced feature. They are discussed here only because this is the @value{SECTION} on @code{getline}. @xref{Two-way I/O}, where coprocesses are discussed in more detail. @end ifinfo @node Getline Notes @subsection Points to Remember About @code{getline} Here are some miscellaneous points about @code{getline} that you should bear in mind: @itemize @bullet @item When @code{getline} changes the value of @code{$0} and @code{NF}, @command{awk} does @emph{not} automatically jump to the start of the program and start testing the new record against every pattern. However, the new record is tested against any subsequent rules. @cindex differences in @command{awk} and @command{gawk}, implementation limitations @cindex implementation issues, @command{gawk}, limits @cindex @command{awk}, implementations, limits @cindex @command{gawk}, implementation issues, limits @item Many @command{awk} implementations limit the number of pipelines that an @command{awk} program may have open to just one. In @command{gawk}, there is no such limit. You can open as many pipelines (and coprocesses) as the underlying operating system permits. @cindex side effects, @code{FILENAME} variable @cindex @code{FILENAME} variable, @code{getline}@comma{} setting with @cindex dark corner, @code{FILENAME} variable @cindex @code{getline} command, @code{FILENAME} variable and @cindex @code{BEGIN} pattern, @code{getline} and @item An interesting side effect occurs if you use @code{getline} without a redirection inside a @code{BEGIN} rule. Because an unredirected @code{getline} reads from the command-line @value{DF}s, the first @code{getline} command causes @command{awk} to set the value of @code{FILENAME}. Normally, @code{FILENAME} does not have a value inside @code{BEGIN} rules, because you have not yet started to process the command-line @value{DF}s. @value{DARKCORNER} (@xref{BEGIN/END}, also @pxref{Auto-set}.) @item Using @code{FILENAME} with @code{getline} (@samp{getline < FILENAME}) is likely to be a source for confusion. @command{awk} opens a separate input stream from the current input file. However, by not using a variable, @code{$0} and @code{NR} are still updated. If you're doing this, it's probably by accident, and you should reconsider what it is you're trying to accomplish. @item @ref{Getline Summary}, presents a table summarizing the @code{getline} variants and which variables they can affect. It is worth noting that those variants which do not use redirection can cause @code{FILENAME} to be updated if they cause @command{awk} to start reading a new input file. @end itemize @node Getline Summary @subsection Summary of @code{getline} Variants @cindex @code{getline} command, variants @ref{table-getline-variants} summarizes the eight variants of @code{getline}, listing which built-in variables are set by each one, and whether the variant is standard or a @command{gawk} extension. @float Table,table-getline-variants @caption{getline Variants and What They Set} @multitable @columnfractions .33 .38 .27 @headitem Variant @tab Effect @tab Standard / Extension @item @code{getline} @tab Sets @code{$0}, @code{NF}, @code{FNR}, and @code{NR} @tab Standard @item @code{getline} @var{var} @tab Sets @var{var}, @code{FNR}, and @code{NR} @tab Standard @item @code{getline <} @var{file} @tab Sets @code{$0} and @code{NF} @tab Standard @item @code{getline @var{var} < @var{file}} @tab Sets @var{var} @tab Standard @item @var{command} @code{| getline} @tab Sets @code{$0} and @code{NF} @tab Standard @item @var{command} @code{| getline} @var{var} @tab Sets @var{var} @tab Standard @item @var{command} @code{|& getline} @tab Sets @code{$0} and @code{NF} @tab Extension @item @var{command} @code{|& getline} @var{var} @tab Sets @var{var} @tab Extension @end multitable @end float @c ENDOFRANGE getl @c ENDOFRANGE inex @c ENDOFRANGE infir @node Command line directories @section Directories On The Command Line @cindex directories, command line @cindex command line, directories on According to the POSIX standard, files named on the @command{awk} command line must be text files. It is a fatal error if they are not. Most versions of @command{awk} treat a directory on the command line as a fatal error. By default, @command{gawk} produces a warning for a directory on the command line, but otherwise ignores it. If either of the @option{--posix} or @option{--traditional} options is given, then @command{gawk} reverts to treating a directory on the command line as a fatal error. @node Printing @chapter Printing Output @c STARTOFRANGE prnt @cindex printing @cindex output, printing, See printing One of the most common programming actions is to @dfn{print}, or output, some or all of the input. Use the @code{print} statement for simple output, and the @code{printf} statement for fancier formatting. The @code{print} statement is not limited when computing @emph{which} values to print. However, with two exceptions, you cannot specify @emph{how} to print them---how many columns, whether to use exponential notation or not, and so on. (For the exceptions, @pxref{Output Separators}, and @ref{OFMT}.) For printing with specifications, you need the @code{printf} statement (@pxref{Printf}). @c STARTOFRANGE prnts @cindex @code{print} statement @cindex @code{printf} statement Besides basic and formatted printing, this @value{CHAPTER} also covers I/O redirections to files and pipes, introduces the special @value{FN}s that @command{gawk} processes internally, and discusses the @code{close()} built-in function. @menu * Print:: The @code{print} statement. * Print Examples:: Simple examples of @code{print} statements. * Output Separators:: The output separators and how to change them. * OFMT:: Controlling Numeric Output With @code{print}. * Printf:: The @code{printf} statement. * Redirection:: How to redirect output to multiple files and pipes. * Special Files:: File name interpretation in @command{gawk}. @command{gawk} allows access to inherited file descriptors. * Close Files And Pipes:: Closing Input and Output Files and Pipes. @end menu @node Print @section The @code{print} Statement The @code{print} statement is used for producing output with simple, standardized formatting. Specify only the strings or numbers to print, in a list separated by commas. They are output, separated by single spaces, followed by a newline. The statement looks like this: @example print @var{item1}, @var{item2}, @dots{} @end example @noindent The entire list of items may be optionally enclosed in parentheses. The parentheses are necessary if any of the item expressions uses the @samp{>} relational operator; otherwise it could be confused with an output redirection (@pxref{Redirection}). The items to print can be constant strings or numbers, fields of the current record (such as @code{$1}), variables, or any @command{awk} expression. Numeric values are converted to strings and then printed. @cindex records, printing @cindex lines, blank, printing @cindex text, printing The simple statement @samp{print} with no items is equivalent to @samp{print $0}: it prints the entire current record. To print a blank line, use @samp{print ""}, where @code{""} is the empty string. To print a fixed piece of text, use a string constant, such as @w{@code{"Don't Panic"}}, as one item. If you forget to use the double-quote characters, your text is taken as an @command{awk} expression, and you will probably get an error. Keep in mind that a space is printed between any two items. @node Print Examples @section @code{print} Statement Examples Each @code{print} statement makes at least one line of output. However, it isn't limited to only one line. If an item value is a string containing a newline, the newline is output along with the rest of the string. A single @code{print} statement can make any number of lines this way. @cindex newlines, printing The following is an example of printing a string that contains embedded newlines (the @samp{\n} is an escape sequence, used to represent the newline character; @pxref{Escape Sequences}): @example $ @kbd{awk 'BEGIN @{ print "line one\nline two\nline three" @}'} @print{} line one @print{} line two @print{} line three @end example @cindex fields, printing The next example, which is run on the @file{inventory-shipped} file, prints the first two fields of each input record, with a space between them: @example $ @kbd{awk '@{ print $1, $2 @}' inventory-shipped} @print{} Jan 13 @print{} Feb 15 @print{} Mar 15 @dots{} @end example @cindex @code{print} statement, commas, omitting @cindex troubleshooting, @code{print} statement@comma{} omitting commas A common mistake in using the @code{print} statement is to omit the comma between two items. This often has the effect of making the items run together in the output, with no space. The reason for this is that juxtaposing two string expressions in @command{awk} means to concatenate them. Here is the same program, without the comma: @example $ @kbd{awk '@{ print $1 $2 @}' inventory-shipped} @print{} Jan13 @print{} Feb15 @print{} Mar15 @dots{} @end example @cindex @code{BEGIN} pattern, headings@comma{} adding To someone unfamiliar with the @file{inventory-shipped} file, neither example's output makes much sense. A heading line at the beginning would make it clearer. Let's add some headings to our table of months (@code{$1}) and green crates shipped (@code{$2}). We do this using the @code{BEGIN} pattern (@pxref{BEGIN/END}) so that the headings are only printed once: @example awk 'BEGIN @{ print "Month Crates" print "----- ------" @} @{ print $1, $2 @}' inventory-shipped @end example @noindent When run, the program prints the following: @example Month Crates ----- ------ Jan 13 Feb 15 Mar 15 @dots{} @end example @noindent The only problem, however, is that the headings and the table data don't line up! We can fix this by printing some spaces between the two fields: @example @group awk 'BEGIN @{ print "Month Crates" print "----- ------" @} @{ print $1, " ", $2 @}' inventory-shipped @end group @end example @cindex @code{printf} statement, columns@comma{} aligning @cindex columns, aligning Lining up columns this way can get pretty complicated when there are many columns to fix. Counting spaces for two or three columns is simple, but any more than this can take up a lot of time. This is why the @code{printf} statement was created (@pxref{Printf}); one of its specialties is lining up columns of data. @cindex line continuations, in @code{print} statement @cindex @code{print} statement, line continuations and @quotation NOTE You can continue either a @code{print} or @code{printf} statement simply by putting a newline after any comma (@pxref{Statements/Lines}). @end quotation @c ENDOFRANGE prnts @node Output Separators @section Output Separators @cindex @code{OFS} variable As mentioned previously, a @code{print} statement contains a list of items separated by commas. In the output, the items are normally separated by single spaces. However, this doesn't need to be the case; a single space is simply the default. Any string of characters may be used as the @dfn{output field separator} by setting the built-in variable @code{OFS}. The initial value of this variable is the string @w{@code{" "}}---that is, a single space. The output from an entire @code{print} statement is called an @dfn{output record}. Each @code{print} statement outputs one output record, and then outputs a string called the @dfn{output record separator} (or @code{ORS}). The initial value of @code{ORS} is the string @code{"\n"}; i.e., a newline character. Thus, each @code{print} statement normally makes a separate line. @cindex output, records @cindex output record separator, See @code{ORS} variable @cindex @code{ORS} variable @cindex @code{BEGIN} pattern, @code{OFS}/@code{ORS} variables, assigning values to In order to change how output fields and records are separated, assign new values to the variables @code{OFS} and @code{ORS}. The usual place to do this is in the @code{BEGIN} rule (@pxref{BEGIN/END}), so that it happens before any input is processed. It can also be done with assignments on the command line, before the names of the input files, or using the @option{-v} command-line option (@pxref{Options}). The following example prints the first and second fields of each input record, separated by a semicolon, with a blank line added after each newline: @ignore Exercise, Rewrite the @example awk 'BEGIN @{ print "Month Crates" print "----- ------" @} @{ print $1, " ", $2 @}' inventory-shipped @end example program by using a new value of @code{OFS}. @end ignore @example $ @kbd{awk 'BEGIN @{ OFS = ";"; ORS = "\n\n" @}} > @kbd{@{ print $1, $2 @}' BBS-list} @print{} aardvark;555-5553 @print{} @print{} alpo-net;555-3412 @print{} @print{} barfly;555-7685 @dots{} @end example If the value of @code{ORS} does not contain a newline, the program's output runs together on a single line. @node OFMT @section Controlling Numeric Output with @code{print} @cindex numeric, output format @cindex formats@comma{} numeric output When printing numeric values with the @code{print} statement, @command{awk} internally converts the number to a string of characters and prints that string. @command{awk} uses the @code{sprintf()} function to do this conversion (@pxref{String Functions}). For now, it suffices to say that the @code{sprintf()} function accepts a @dfn{format specification} that tells it how to format numbers (or strings), and that there are a number of different ways in which numbers can be formatted. The different format specifications are discussed more fully in @ref{Control Letters}. @cindex @code{sprintf()} function @cindex @code{OFMT} variable @cindex output, format specifier@comma{} @code{OFMT} The built-in variable @code{OFMT} contains the default format specification that @code{print} uses with @code{sprintf()} when it wants to convert a number to a string for printing. The default value of @code{OFMT} is @code{"%.6g"}. The way @code{print} prints numbers can be changed by supplying different format specifications as the value of @code{OFMT}, as shown in the following example: @example $ @kbd{awk 'BEGIN @{} > @kbd{OFMT = "%.0f" # print numbers as integers (rounds)} > @kbd{print 17.23, 17.54 @}'} @print{} 17 18 @end example @noindent @cindex dark corner, @code{OFMT} variable @cindex POSIX @command{awk}, @code{OFMT} variable and @cindex @code{OFMT} variable, POSIX @command{awk} and According to the POSIX standard, @command{awk}'s behavior is undefined if @code{OFMT} contains anything but a floating-point conversion specification. @value{DARKCORNER} @node Printf @section Using @code{printf} Statements for Fancier Printing @c STARTOFRANGE printfs @cindex @code{printf} statement @cindex output, formatted @cindex formatting output For more precise control over the output format than what is provided by @code{print}, use @code{printf}. With @code{printf} you can specify the width to use for each item, as well as various formatting choices for numbers (such as what output base to use, whether to print an exponent, whether to print a sign, and how many digits to print after the decimal point). You do this by supplying a string, called the @dfn{format string}, that controls how and where to print the other arguments. @menu * Basic Printf:: Syntax of the @code{printf} statement. * Control Letters:: Format-control letters. * Format Modifiers:: Format-specification modifiers. * Printf Examples:: Several examples. @end menu @node Basic Printf @subsection Introduction to the @code{printf} Statement @cindex @code{printf} statement, syntax of A simple @code{printf} statement looks like this: @example printf @var{format}, @var{item1}, @var{item2}, @dots{} @end example @noindent The entire list of arguments may optionally be enclosed in parentheses. The parentheses are necessary if any of the item expressions use the @samp{>} relational operator; otherwise, it can be confused with an output redirection (@pxref{Redirection}). @cindex format strings The difference between @code{printf} and @code{print} is the @var{format} argument. This is an expression whose value is taken as a string; it specifies how to output each of the other arguments. It is called the @dfn{format string}. The format string is very similar to that in the ISO C library function @code{printf()}. Most of @var{format} is text to output verbatim. Scattered among this text are @dfn{format specifiers}---one per item. Each format specifier says to output the next item in the argument list at that place in the format. The @code{printf} statement does not automatically append a newline to its output. It outputs only what the format string specifies. So if a newline is needed, you must include one in the format string. The output separator variables @code{OFS} and @code{ORS} have no effect on @code{printf} statements. For example: @example $ @kbd{awk 'BEGIN @{} > @kbd{ORS = "\nOUCH!\n"; OFS = "+"} > @kbd{msg = "Dont Panic!"} > @kbd{printf "%s\n", msg} > @kbd{@}'} @print{} Dont Panic! @end example @noindent Here, neither the @samp{+} nor the @samp{OUCH} appear in the output message. @node Control Letters @subsection Format-Control Letters @cindex @code{printf} statement, format-control characters @cindex format specifiers, @code{printf} statement A format specifier starts with the character @samp{%} and ends with a @dfn{format-control letter}---it tells the @code{printf} statement how to output one item. The format-control letter specifies what @emph{kind} of value to print. The rest of the format specifier is made up of optional @dfn{modifiers} that control @emph{how} to print the value, such as the field width. Here is a list of the format-control letters: @table @code @item %c Print a number as an ASCII character; thus, @samp{printf "%c", 65} outputs the letter @samp{A}. The output for a string value is the first character of the string. @cindex dark corner, format-control characters @cindex @command{gawk}, format-control characters @quotation NOTE @ignore The @samp{%c} format does @emph{not} handle values outside the range 0--255. On most systems, values from 0--127 are within the range of ASCII and will yield an ASCII character. Values in the range 128--255 may format as characters in some extended character set, or they may not. System 390 (IBM architecture mainframe) systems use 8-bit characters, and thus values from 0--255 yield the corresponding EBCDIC character. Any value above 255 is treated as modulo 255; i.e., the lowest eight bits of the value are used. The locale and character set are always ignored. @end ignore The POSIX standard says the first character of a string is printed. In locales with multibyte characters, @command{gawk} attempts to convert the leading bytes of the string into a valid wide character and then to print the multibyte encoding of that character. Similarly, when printing a numeric value, @command{gawk} allows the value to be within the numeric range of values that can be held in a wide character. Other @command{awk} versions generally restrict themselves to printing the first byte of a string or to numeric values within the range of a single byte (0--255). @end quotation @item %d@r{,} %i Print a decimal integer. The two control letters are equivalent. (The @samp{%i} specification is for compatibility with ISO C.) @item %e@r{,} %E Print a number in scientific (exponential) notation; for example: @example printf "%4.3e\n", 1950 @end example @noindent prints @samp{1.950e+03}, with a total of four significant figures, three of which follow the decimal point. (The @samp{4.3} represents two modifiers, discussed in the next @value{SUBSECTION}.) @samp{%E} uses @samp{E} instead of @samp{e} in the output. @item %f Print a number in floating-point notation. For example: @example printf "%4.3f", 1950 @end example @noindent prints @samp{1950.000}, with a total of four significant figures, three of which follow the decimal point. (The @samp{4.3} represents two modifiers, discussed in the next @value{SUBSECTION}.) On systems supporting IEEE 754 floating point format, values representing negative infinity are formatted as @samp{-inf} or @samp{-infinity}, and positive infinity as @samp{inf} and @samp{infinity}. The special ``not a number'' value formats as @samp{-nan} or @samp{nan}. @item %F Like @samp{%f} but the infinity and ``not a number'' values are spelled using uppercase letters. The @samp{%F} format is a POSIX extension to ISO C; not all systems support it. On those that don't, @command{gawk} uses @samp{%f} instead. @item %g@r{,} %G Print a number in either scientific notation or in floating-point notation, whichever uses fewer characters; if the result is printed in scientific notation, @samp{%G} uses @samp{E} instead of @samp{e}. @item %o Print an unsigned octal integer (@pxref{Nondecimal-numbers}). @item %s Print a string. @item %u Print an unsigned decimal integer. (This format is of marginal use, because all numbers in @command{awk} are floating-point; it is provided primarily for compatibility with C.) @item %x@r{,} %X Print an unsigned hexadecimal integer; @samp{%X} uses the letters @samp{A} through @samp{F} instead of @samp{a} through @samp{f} (@pxref{Nondecimal-numbers}). @item %% Print a single @samp{%}. This does not consume an argument and it ignores any modifiers. @end table @cindex dark corner, format-control characters @cindex @command{gawk}, format-control characters @quotation NOTE When using the integer format-control letters for values that are outside the range of the widest C integer type, @command{gawk} switches to the @samp{%g} format specifier. If @option{--lint} is provided on the command line (@pxref{Options}), @command{gawk} warns about this. Other versions of @command{awk} may print invalid values or do something else entirely. @value{DARKCORNER} @end quotation @node Format Modifiers @subsection Modifiers for @code{printf} Formats @c STARTOFRANGE pfm @cindex @code{printf} statement, modifiers @cindex modifiers@comma{} in format specifiers A format specification can also include @dfn{modifiers} that can control how much of the item's value is printed, as well as how much space it gets. The modifiers come between the @samp{%} and the format-control letter. We will use the bullet symbol ``@bullet{}'' in the following examples to represent spaces in the output. Here are the possible modifiers, in the order in which they may appear: @table @code @cindex differences in @command{awk} and @command{gawk}, @code{print}/@code{printf} statements @cindex @code{printf} statement, positional specifiers @c the command does NOT start a secondary @cindex positional specifiers, @code{printf} statement @item @var{N}$ An integer constant followed by a @samp{$} is a @dfn{positional specifier}. Normally, format specifications are applied to arguments in the order given in the format string. With a positional specifier, the format specification is applied to a specific argument, instead of what would be the next argument in the list. Positional specifiers begin counting with one. Thus: @example printf "%s %s\n", "don't", "panic" printf "%2$s %1$s\n", "panic", "don't" @end example @noindent prints the famous friendly message twice. At first glance, this feature doesn't seem to be of much use. It is in fact a @command{gawk} extension, intended for use in translating messages at runtime. @xref{Printf Ordering}, which describes how and why to use positional specifiers. For now, we will not use them. @item - The minus sign, used before the width modifier (see later on in this list), says to left-justify the argument within its specified width. Normally, the argument is printed right-justified in the specified width. Thus: @example printf "%-4s", "foo" @end example @noindent prints @samp{foo@bullet{}}. @item @var{space} For numeric conversions, prefix positive values with a space and negative values with a minus sign. @item + The plus sign, used before the width modifier (see later on in this list), says to always supply a sign for numeric conversions, even if the data to format is positive. The @samp{+} overrides the space modifier. @item # Use an ``alternate form'' for certain control letters. For @samp{%o}, supply a leading zero. For @samp{%x} and @samp{%X}, supply a leading @samp{0x} or @samp{0X} for a nonzero result. For @samp{%e}, @samp{%E}, @samp{%f}, and @samp{%F}, the result always contains a decimal point. For @samp{%g} and @samp{%G}, trailing zeros are not removed from the result. @item 0 A leading @samp{0} (zero) acts as a flag that indicates that output should be padded with zeros instead of spaces. This applies only to the numeric output formats. This flag only has an effect when the field width is wider than the value to print. @item ' A single quote or apostrophe character is a POSIX extension to ISO C. It indicates that the integer part of a floating point value, or the entire part of an integer decimal value, should have a thousands-separator character in it. This only works in locales that support such characters. For example: @example $ @kbd{cat thousands.awk} @ii{Show source program} @print{} BEGIN @{ printf "%'d\n", 1234567 @} $ @kbd{LC_ALL=C gawk -f thousands.awk} @print{} 1234567 @ii{Results in "C" locale} $ @kbd{LC_ALL=en_US.UTF-8 gawk -f thousands.awk} @print{} 1,234,567 @ii{Results in US English UTF locale} @end example @noindent For more information about locales and internationalization issues, see @ref{Locales}. @quotation NOTE The @samp{'} flag is a nice feature, but its use complicates things: it becomes difficult to use it in command-line programs. For information on appropriate quoting tricks, see @ref{Quoting}. @end quotation @item @var{width} This is a number specifying the desired minimum width of a field. Inserting any number between the @samp{%} sign and the format-control character forces the field to expand to this width. The default way to do this is to pad with spaces on the left. For example: @example printf "%4s", "foo" @end example @noindent prints @samp{@bullet{}foo}. The value of @var{width} is a minimum width, not a maximum. If the item value requires more than @var{width} characters, it can be as wide as necessary. Thus, the following: @example printf "%4s", "foobar" @end example @noindent prints @samp{foobar}. Preceding the @var{width} with a minus sign causes the output to be padded with spaces on the right, instead of on the left. @item .@var{prec} A period followed by an integer constant specifies the precision to use when printing. The meaning of the precision varies by control letter: @table @asis @item @code{%d}, @code{%i}, @code{%o}, @code{%u}, @code{%x}, @code{%X} Minimum number of digits to print. @item @code{%e}, @code{%E}, @code{%f}, @code{%F} Number of digits to the right of the decimal point. @item @code{%g}, @code{%G} Maximum number of significant digits. @item @code{%s} Maximum number of characters from the string that should print. @end table Thus, the following: @example printf "%.4s", "foobar" @end example @noindent prints @samp{foob}. @end table The C library @code{printf}'s dynamic @var{width} and @var{prec} capability (for example, @code{"%*.*s"}) is supported. Instead of supplying explicit @var{width} and/or @var{prec} values in the format string, they are passed in the argument list. For example: @example w = 5 p = 3 s = "abcdefg" printf "%*.*s\n", w, p, s @end example @noindent is exactly equivalent to: @example s = "abcdefg" printf "%5.3s\n", s @end example @noindent Both programs output @samp{@w{@bullet{}@bullet{}abc}}. Earlier versions of @command{awk} did not support this capability. If you must use such a version, you may simulate this feature by using concatenation to build up the format string, like so: @example w = 5 p = 3 s = "abcdefg" printf "%" w "." p "s\n", s @end example @noindent This is not particularly easy to read but it does work. @c @cindex lint checks @cindex troubleshooting, fatal errors, @code{printf} format strings @cindex POSIX @command{awk}, @code{printf} format strings and C programmers may be used to supplying additional @samp{l}, @samp{L}, and @samp{h} modifiers in @code{printf} format strings. These are not valid in @command{awk}. Most @command{awk} implementations silently ignore them. If @option{--lint} is provided on the command line (@pxref{Options}), @command{gawk} warns about their use. If @option{--posix} is supplied, their use is a fatal error. @c ENDOFRANGE pfm @node Printf Examples @subsection Examples Using @code{printf} The following simple example shows how to use @code{printf} to make an aligned table: @example awk '@{ printf "%-10s %s\n", $1, $2 @}' BBS-list @end example @noindent This command prints the names of the bulletin boards (@code{$1}) in the file @file{BBS-list} as a string of 10 characters that are left-justified. It also prints the phone numbers (@code{$2}) next on the line. This produces an aligned two-column table of names and phone numbers, as shown here: @example $ @kbd{awk '@{ printf "%-10s %s\n", $1, $2 @}' BBS-list} @print{} aardvark 555-5553 @print{} alpo-net 555-3412 @print{} barfly 555-7685 @print{} bites 555-1675 @print{} camelot 555-0542 @print{} core 555-2912 @print{} fooey 555-1234 @print{} foot 555-6699 @print{} macfoo 555-6480 @print{} sdace 555-3430 @print{} sabafoo 555-2127 @end example In this case, the phone numbers had to be printed as strings because the numbers are separated by a dash. Printing the phone numbers as numbers would have produced just the first three digits: @samp{555}. This would have been pretty confusing. It wasn't necessary to specify a width for the phone numbers because they are last on their lines. They don't need to have spaces after them. The table could be made to look even nicer by adding headings to the tops of the columns. This is done using the @code{BEGIN} pattern (@pxref{BEGIN/END}) so that the headers are only printed once, at the beginning of the @command{awk} program: @example awk 'BEGIN @{ print "Name Number" print "---- ------" @} @{ printf "%-10s %s\n", $1, $2 @}' BBS-list @end example The above example mixes @code{print} and @code{printf} statements in the same program. Using just @code{printf} statements can produce the same results: @example awk 'BEGIN @{ printf "%-10s %s\n", "Name", "Number" printf "%-10s %s\n", "----", "------" @} @{ printf "%-10s %s\n", $1, $2 @}' BBS-list @end example @noindent Printing each column heading with the same format specification used for the column elements ensures that the headings are aligned just like the columns. The fact that the same format specification is used three times can be emphasized by storing it in a variable, like this: @example awk 'BEGIN @{ format = "%-10s %s\n" printf format, "Name", "Number" printf format, "----", "------" @} @{ printf format, $1, $2 @}' BBS-list @end example @c !!! exercise At this point, it would be a worthwhile exercise to use the @code{printf} statement to line up the headings and table data for the @file{inventory-shipped} example that was covered earlier in the @value{SECTION} on the @code{print} statement (@pxref{Print}). @c ENDOFRANGE printfs @node Redirection @section Redirecting Output of @code{print} and @code{printf} @cindex output redirection @cindex redirection of output @cindex @code{--sandbox} option, output redirection with @code{print}, @code{printf} So far, the output from @code{print} and @code{printf} has gone to the standard output, usually the screen. Both @code{print} and @code{printf} can also send their output to other places. This is called @dfn{redirection}. @quotation NOTE When @option{--sandbox} is specified (@pxref{Options}), redirecting output to files and pipes is disabled. @end quotation A redirection appears after the @code{print} or @code{printf} statement. Redirections in @command{awk} are written just like redirections in shell commands, except that they are written inside the @command{awk} program. @c the commas here are part of the see also @cindex @code{print} statement, See Also redirection, of output @cindex @code{printf} statement, See Also redirection, of output There are four forms of output redirection: output to a file, output appended to a file, output through a pipe to another command, and output to a coprocess. They are all shown for the @code{print} statement, but they work identically for @code{printf}: @table @code @cindex @code{>} (right angle bracket), @code{>} operator (I/O) @cindex right angle bracket (@code{>}), @code{>} operator (I/O) @cindex operators, input/output @item print @var{items} > @var{output-file} This redirection prints the items into the output file named @var{output-file}. The @value{FN} @var{output-file} can be any expression. Its value is changed to a string and then used as a @value{FN} (@pxref{Expressions}). When this type of redirection is used, the @var{output-file} is erased before the first output is written to it. Subsequent writes to the same @var{output-file} do not erase @var{output-file}, but append to it. (This is different from how you use redirections in shell scripts.) If @var{output-file} does not exist, it is created. For example, here is how an @command{awk} program can write a list of BBS names to one file named @file{name-list}, and a list of phone numbers to another file named @file{phone-list}: @example $ @kbd{awk '@{ print $2 > "phone-list"} > @kbd{print $1 > "name-list" @}' BBS-list} $ @kbd{cat phone-list} @print{} 555-5553 @print{} 555-3412 @dots{} $ @kbd{cat name-list} @print{} aardvark @print{} alpo-net @dots{} @end example @noindent Each output file contains one name or number per line. @cindex @code{>} (right angle bracket), @code{>>} operator (I/O) @cindex right angle bracket (@code{>}), @code{>>} operator (I/O) @item print @var{items} >> @var{output-file} This redirection prints the items into the pre-existing output file named @var{output-file}. The difference between this and the single-@samp{>} redirection is that the old contents (if any) of @var{output-file} are not erased. Instead, the @command{awk} output is appended to the file. If @var{output-file} does not exist, then it is created. @cindex @code{|} (vertical bar), @code{|} operator (I/O) @cindex pipes, output @cindex output, pipes @item print @var{items} | @var{command} It is possible to send output to another program through a pipe instead of into a file. This redirection opens a pipe to @var{command}, and writes the values of @var{items} through this pipe to another process created to execute @var{command}. The redirection argument @var{command} is actually an @command{awk} expression. Its value is converted to a string whose contents give the shell command to be run. For example, the following produces two files, one unsorted list of BBS names, and one list sorted in reverse alphabetical order: @ignore 10/2000: This isn't the best style, since COMMAND is assigned for each record. It's done to avoid overfull hboxes in TeX. Leave it alone for now and let's hope no-one notices. @end ignore @example awk '@{ print $1 > "names.unsorted" command = "sort -r > names.sorted" print $1 | command @}' BBS-list @end example The unsorted list is written with an ordinary redirection, while the sorted list is written by piping through the @command{sort} utility. The next example uses redirection to mail a message to the mailing list @samp{bug-system}. This might be useful when trouble is encountered in an @command{awk} script run periodically for system maintenance: @example report = "mail bug-system" print "Awk script failed:", $0 | report m = ("at record number " FNR " of " FILENAME) print m | report close(report) @end example The message is built using string concatenation and saved in the variable @code{m}. It's then sent down the pipeline to the @command{mail} program. (The parentheses group the items to concatenate---see @ref{Concatenation}.) The @code{close()} function is called here because it's a good idea to close the pipe as soon as all the intended output has been sent to it. @xref{Close Files And Pipes}, for more information. This example also illustrates the use of a variable to represent a @var{file} or @var{command}---it is not necessary to always use a string constant. Using a variable is generally a good idea, because (if you mean to refer to that same file or command) @command{awk} requires that the string value be spelled identically every time. @cindex coprocesses @cindex @code{|} (vertical bar), @code{|&} operator (I/O) @cindex operators, input/output @cindex differences in @command{awk} and @command{gawk}, input/output operators @item print @var{items} |& @var{command} This redirection prints the items to the input of @var{command}. The difference between this and the single-@samp{|} redirection is that the output from @var{command} can be read with @code{getline}. Thus @var{command} is a @dfn{coprocess}, which works together with, but subsidiary to, the @command{awk} program. This feature is a @command{gawk} extension, and is not available in POSIX @command{awk}. @xref{Getline/Coprocess}, for a brief discussion. @xref{Two-way I/O}, for a more complete discussion. @end table Redirecting output using @samp{>}, @samp{>>}, @samp{|}, or @samp{|&} asks the system to open a file, pipe, or coprocess only if the particular @var{file} or @var{command} you specify has not already been written to by your program or if it has been closed since it was last written to. @cindex troubleshooting, printing It is a common error to use @samp{>} redirection for the first @code{print} to a file, and then to use @samp{>>} for subsequent output: @example # clear the file print "Don't panic" > "guide.txt" @dots{} # append print "Avoid improbability generators" >> "guide.txt" @end example @noindent This is indeed how redirections must be used from the shell. But in @command{awk}, it isn't necessary. In this kind of case, a program should use @samp{>} for all the @code{print} statements, since the output file is only opened once. (It happens that if you mix @samp{>} and @samp{>>} that output is produced in the expected order. However, mixing the operators for the same file is definitely poor style, and is confusing to readers of your program.) @cindex differences in @command{awk} and @command{gawk}, implementation limitations @cindex implementation issues, @command{gawk}, limits @cindex @command{awk}, implementation issues, pipes @cindex @command{gawk}, implementation issues, pipes @ifnotinfo As mentioned earlier (@pxref{Getline Notes}), many @end ifnotinfo @ifnottex Many @end ifnottex older @command{awk} implementations limit the number of pipelines that an @command{awk} program may have open to just one! In @command{gawk}, there is no such limit. @command{gawk} allows a program to open as many pipelines as the underlying operating system permits. @c fakenode --- for prepinfo @subheading Advanced Notes: Piping into @command{sh} @cindex advanced features, piping into @command{sh} @cindex shells, piping commands into A particularly powerful way to use redirection is to build command lines and pipe them into the shell, @command{sh}. For example, suppose you have a list of files brought over from a system where all the @value{FN}s are stored in uppercase, and you wish to rename them to have names in all lowercase. The following program is both simple and efficient: @c @cindex @command{mv} utility @example @{ printf("mv %s %s\n", $0, tolower($0)) | "sh" @} END @{ close("sh") @} @end example The @code{tolower()} function returns its argument string with all uppercase characters converted to lowercase (@pxref{String Functions}). The program builds up a list of command lines, using the @command{mv} utility to rename the files. It then sends the list to the shell for execution. @c ENDOFRANGE outre @c ENDOFRANGE reout @node Special Files @section Special @value{FFN}s in @command{gawk} @c STARTOFRANGE gfn @cindex @command{gawk}, @value{FN}s in @command{gawk} provides a number of special @value{FN}s that it interprets internally. These @value{FN}s provide access to standard file descriptors and TCP/IP networking. @menu * Special FD:: Special files for I/O. * Special Network:: Special files for network communications. * Special Caveats:: Things to watch out for. @end menu @node Special FD @subsection Special Files for Standard Descriptors @cindex standard input @cindex input, standard @cindex standard output @cindex output, standard @cindex error output @cindex standard error @cindex file descriptors @cindex files, descriptors, See file descriptors Running programs conventionally have three input and output streams already available to them for reading and writing. These are known as the @dfn{standard input}, @dfn{standard output}, and @dfn{standard error output}. These streams are, by default, connected to your keyboard and screen, but they are often redirected with the shell, via the @samp{<}, @samp{<<}, @samp{>}, @samp{>>}, @samp{>&}, and @samp{|} operators. Standard error is typically used for writing error messages; the reason there are two separate streams, standard output and standard error, is so that they can be redirected separately. @cindex differences in @command{awk} and @command{gawk}, error messages @cindex error handling In other implementations of @command{awk}, the only way to write an error message to standard error in an @command{awk} program is as follows: @example print "Serious error detected!" | "cat 1>&2" @end example @noindent This works by opening a pipeline to a shell command that can access the standard error stream that it inherits from the @command{awk} process. This is far from elegant, and it is also inefficient, because it requires a separate process. So people writing @command{awk} programs often don't do this. Instead, they send the error messages to the screen, like this: @example print "Serious error detected!" > "/dev/tty" @end example @noindent (@file{/dev/tty} is a special file supplied by the operating system that is connected to your keyboard and screen. It represents the ``terminal,''@footnote{The ``tty'' in @file{/dev/tty} stands for ``Teletype,'' a serial terminal.} which on modern systems is a keyboard and screen, not a serial console.) This usually has the same effect but not always: although the standard error stream is usually the screen, it can be redirected; when that happens, writing to the screen is not correct. In fact, if @command{awk} is run from a background job, it may not have a terminal at all. Then opening @file{/dev/tty} fails. @command{gawk} provides special @value{FN}s for accessing the three standard streams. @value{COMMONEXT}. It also provides syntax for accessing any other inherited open files. If the @value{FN} matches one of these special names when @command{gawk} redirects input or output, then it directly uses the stream that the @value{FN} stands for. These special @value{FN}s work for all operating systems that @command{gawk} has been ported to, not just those that are POSIX-compliant: @cindex common extensions, @code{/dev/stdin} special file @cindex common extensions, @code{/dev/stdout} special file @cindex common extensions, @code{/dev/stderr} special file @cindex extensions, common@comma{} @code{/dev/stdin} special file @cindex extensions, common@comma{} @code{/dev/stdout} special file @cindex extensions, common@comma{} @code{/dev/stderr} special file @cindex @value{FN}s, standard streams in @command{gawk} @cindex @code{/dev/@dots{}} special files (@command{gawk}) @cindex files, @code{/dev/@dots{}} special files @cindex @code{/dev/fd/@var{N}} special files @table @file @item /dev/stdin The standard input (file descriptor 0). @item /dev/stdout The standard output (file descriptor 1). @item /dev/stderr The standard error output (file descriptor 2). @item /dev/fd/@var{N} The file associated with file descriptor @var{N}. Such a file must be opened by the program initiating the @command{awk} execution (typically the shell). Unless special pains are taken in the shell from which @command{gawk} is invoked, only descriptors 0, 1, and 2 are available. @end table The @value{FN}s @file{/dev/stdin}, @file{/dev/stdout}, and @file{/dev/stderr} are aliases for @file{/dev/fd/0}, @file{/dev/fd/1}, and @file{/dev/fd/2}, respectively. However, they are more self-explanatory. The proper way to write an error message in a @command{gawk} program is to use @file{/dev/stderr}, like this: @example print "Serious error detected!" > "/dev/stderr" @end example @cindex troubleshooting, quotes with @value{FN}s Note the use of quotes around the @value{FN}. Like any other redirection, the value must be a string. It is a common error to omit the quotes, which leads to confusing results. @c Exercise: What does it do? :-) Finally, using the @code{close()} function on a @value{FN} of the form @code{"/dev/fd/@var{N}"}, for file descriptor numbers above two, will actually close the given file descriptor. The @file{/dev/stdin}, @file{/dev/stdout}, and @file{/dev/stderr} special files are also recognized internally by several other versions of @command{awk}. @node Special Network @subsection Special Files for Network Communications @cindex networks, support for @cindex TCP/IP, support for @command{gawk} programs can open a two-way TCP/IP connection, acting as either a client or a server. This is done using a special @value{FN} of the form: @example @file{/@var{net-type}/@var{protocol}/@var{local-port}/@var{remote-host}/@var{remote-port}} @end example The @var{net-type} is one of @samp{inet}, @samp{inet4} or @samp{inet6}. The @var{protocol} is one of @samp{tcp} or @samp{udp}, and the other fields represent the other essential pieces of information for making a networking connection. These @value{FN}s are used with the @samp{|&} operator for communicating with a coprocess (@pxref{Two-way I/O}). This is an advanced feature, mentioned here only for completeness. Full discussion is delayed until @ref{TCP/IP Networking}. @node Special Caveats @subsection Special @value{FFN} Caveats Here is a list of things to bear in mind when using the special @value{FN}s that @command{gawk} provides: @itemize @bullet @cindex compatibility mode (@command{gawk}), @value{FN}s @cindex @value{FN}s, in compatibility mode @item Recognition of these special @value{FN}s is disabled if @command{gawk} is in compatibility mode (@pxref{Options}). @item @command{gawk} @emph{always} interprets these special @value{FN}s. For example, using @samp{/dev/fd/4} for output actually writes on file descriptor 4, and not on a new file descriptor that is @code{dup()}'ed from file descriptor 4. Most of the time this does not matter; however, it is important to @emph{not} close any of the files related to file descriptors 0, 1, and 2. Doing so results in unpredictable behavior. @end itemize @c ENDOFRANGE gfn @node Close Files And Pipes @section Closing Input and Output Redirections @cindex files, output, See output files @c STARTOFRANGE ifc @cindex input files, closing @c STARTOFRANGE ofc @cindex output, files@comma{} closing @c STARTOFRANGE pc @cindex pipes, closing @c STARTOFRANGE cc @cindex coprocesses, closing @cindex @code{getline} command, coprocesses@comma{} using from If the same @value{FN} or the same shell command is used with @code{getline} more than once during the execution of an @command{awk} program (@pxref{Getline}), the file is opened (or the command is executed) the first time only. At that time, the first record of input is read from that file or command. The next time the same file or command is used with @code{getline}, another record is read from it, and so on. Similarly, when a file or pipe is opened for output, @command{awk} remembers the @value{FN} or command associated with it, and subsequent writes to the same file or command are appended to the previous writes. The file or pipe stays open until @command{awk} exits. @cindex @code{close()} function This implies that special steps are necessary in order to read the same file again from the beginning, or to rerun a shell command (rather than reading more output from the same command). The @code{close()} function makes these things possible: @example close(@var{filename}) @end example @noindent or: @example close(@var{command}) @end example The argument @var{filename} or @var{command} can be any expression. Its value must @emph{exactly} match the string that was used to open the file or start the command (spaces and other ``irrelevant'' characters included). For example, if you open a pipe with this: @example "sort -r names" | getline foo @end example @noindent then you must close it with this: @example close("sort -r names") @end example Once this function call is executed, the next @code{getline} from that file or command, or the next @code{print} or @code{printf} to that file or command, reopens the file or reruns the command. Because the expression that you use to close a file or pipeline must exactly match the expression used to open the file or run the command, it is good practice to use a variable to store the @value{FN} or command. The previous example becomes the following: @example sortcom = "sort -r names" sortcom | getline foo @dots{} close(sortcom) @end example @noindent This helps avoid hard-to-find typographical errors in your @command{awk} programs. Here are some of the reasons for closing an output file: @itemize @bullet @item To write a file and read it back later on in the same @command{awk} program. Close the file after writing it, then begin reading it with @code{getline}. @item To write numerous files, successively, in the same @command{awk} program. If the files aren't closed, eventually @command{awk} may exceed a system limit on the number of open files in one process. It is best to close each one when the program has finished writing it. @item To make a command finish. When output is redirected through a pipe, the command reading the pipe normally continues to try to read input as long as the pipe is open. Often this means the command cannot really do its work until the pipe is closed. For example, if output is redirected to the @command{mail} program, the message is not actually sent until the pipe is closed. @item To run the same program a second time, with the same arguments. This is not the same thing as giving more input to the first run! For example, suppose a program pipes output to the @command{mail} program. If it outputs several lines redirected to this pipe without closing it, they make a single message of several lines. By contrast, if the program closes the pipe after each line of output, then each line makes a separate message. @end itemize @cindex differences in @command{awk} and @command{gawk}, @code{close()} function @cindex portability, @code{close()} function and If you use more files than the system allows you to have open, @command{gawk} attempts to multiplex the available open files among your @value{DF}s. @command{gawk}'s ability to do this depends upon the facilities of your operating system, so it may not always work. It is therefore both good practice and good portability advice to always use @code{close()} on your files when you are done with them. In fact, if you are using a lot of pipes, it is essential that you close commands when done. For example, consider something like this: @example @{ @dots{} command = ("grep " $1 " /some/file | my_prog -q " $3) while ((command | getline) > 0) @{ @var{process output of} command @} # need close(command) here @} @end example This example creates a new pipeline based on data in @emph{each} record. Without the call to @code{close()} indicated in the comment, @command{awk} creates child processes to run the commands, until it eventually runs out of file descriptors for more pipelines. Even though each command has finished (as indicated by the end-of-file return status from @code{getline}), the child process is not terminated;@footnote{The technical terminology is rather morbid. The finished child is called a ``zombie,'' and cleaning up after it is referred to as ``reaping.''} @c Good old UNIX: give the marketing guys fits, that's the ticket more importantly, the file descriptor for the pipe is not closed and released until @code{close()} is called or @command{awk} exits. @code{close()} will silently do nothing if given an argument that does not represent a file, pipe or coprocess that was opened with a redirection. Note also that @samp{close(FILENAME)} has no ``magic'' effects on the implicit loop that reads through the files named on the command line. It is, more likely, a close of a file that was never opened, so @command{awk} silently does nothing. @cindex @code{|} (vertical bar), @code{|&} operator (I/O), pipes@comma{} closing When using the @samp{|&} operator to communicate with a coprocess, it is occasionally useful to be able to close one end of the two-way pipe without closing the other. This is done by supplying a second argument to @code{close()}. As in any other call to @code{close()}, the first argument is the name of the command or special file used to start the coprocess. The second argument should be a string, with either of the values @code{"to"} or @code{"from"}. Case does not matter. As this is an advanced feature, a more complete discussion is delayed until @ref{Two-way I/O}, which discusses it in more detail and gives an example. @c fakenode --- for prepinfo @subheading Advanced Notes: Using @code{close()}'s Return Value @cindex advanced features, @code{close()} function @cindex dark corner, @code{close()} function @cindex @code{close()} function, return values @cindex return values@comma{} @code{close()} function @cindex differences in @command{awk} and @command{gawk}, @code{close()} function @cindex Unix @command{awk}, @code{close()} function and In many versions of Unix @command{awk}, the @code{close()} function is actually a statement. It is a syntax error to try and use the return value from @code{close()}: @value{DARKCORNER} @example command = "@dots{}" command | getline info retval = close(command) # syntax error in many Unix awks @end example @cindex @command{gawk}, @code{ERRNO} variable in @cindex @code{ERRNO} variable @command{gawk} treats @code{close()} as a function. The return value is @minus{}1 if the argument names something that was never opened with a redirection, or if there is a system problem closing the file or process. In these cases, @command{gawk} sets the built-in variable @code{ERRNO} to a string describing the problem. In @command{gawk}, when closing a pipe or coprocess (input or output), the return value is the exit status of the command.@footnote{ This is a full 16-bit value as returned by the @code{wait()} system call. See the system manual pages for information on how to decode this value.} Otherwise, it is the return value from the system's @code{close()} or @code{fclose()} C functions when closing input or output files, respectively. This value is zero if the close succeeds, or @minus{}1 if it fails. The POSIX standard is very vague; it says that @code{close()} returns zero on success and nonzero otherwise. In general, different implementations vary in what they report when closing pipes; thus the return value cannot be used portably. @value{DARKCORNER} In POSIX mode (@pxref{Options}), @command{gawk} just returns zero when closing a pipe. @c ENDOFRANGE ifc @c ENDOFRANGE ofc @c ENDOFRANGE pc @c ENDOFRANGE cc @c ENDOFRANGE prnt @node Expressions @chapter Expressions @c STARTOFRANGE exps @cindex expressions Expressions are the basic building blocks of @command{awk} patterns and actions. An expression evaluates to a value that you can print, test, or pass to a function. Additionally, an expression can assign a new value to a variable or a field by using an assignment operator. An expression can serve as a pattern or action statement on its own. Most other kinds of statements contain one or more expressions that specify the data on which to operate. As in other languages, expressions in @command{awk} include variables, array references, constants, and function calls, as well as combinations of these with various operators. @menu * Values:: Constants, Variables, and Regular Expressions. * All Operators:: @command{gawk}'s operators. * Truth Values and Conditions:: Testing for true and false. * Function Calls:: A function call is an expression. * Precedence:: How various operators nest. * Locales:: How the locale affects things. @end menu @node Values @section Constants, Variables and Conversions Expressions are built up from values and the operations performed upon them. This @value{SECTION} describes the elementary objects which provide the values used in expressions. @menu * Constants:: String, numeric and regexp constants. * Using Constant Regexps:: When and how to use a regexp constant. * Variables:: Variables give names to values for later use. * Conversion:: The conversion of strings to numbers and vice versa. @end menu @node Constants @subsection Constant Expressions @cindex constants, types of The simplest type of expression is the @dfn{constant}, which always has the same value. There are three types of constants: numeric, string, and regular expression. Each is used in the appropriate context when you need a data value that isn't going to change. Numeric constants can have different forms, but are stored identically internally. @menu * Scalar Constants:: Numeric and string constants. * Nondecimal-numbers:: What are octal and hex numbers. * Regexp Constants:: Regular Expression constants. @end menu @node Scalar Constants @subsubsection Numeric and String Constants @cindex numeric, constants A @dfn{numeric constant} stands for a number. This number can be an integer, a decimal fraction, or a number in scientific (exponential) notation.@footnote{The internal representation of all numbers, including integers, uses double precision floating-point numbers. On most modern systems, these are in IEEE 754 standard format.} Here are some examples of numeric constants that all have the same value: @example 105 1.05e+2 1050e-1 @end example @cindex string constants A string constant consists of a sequence of characters enclosed in double-quotation marks. For example: @example "parrot" @end example @noindent @cindex differences in @command{awk} and @command{gawk}, strings @cindex strings, length of represents the string whose contents are @samp{parrot}. Strings in @command{gawk} can be of any length, and they can contain any of the possible eight-bit ASCII characters including ASCII @sc{nul} (character code zero). Other @command{awk} implementations may have difficulty with some character codes. @node Nondecimal-numbers @subsubsection Octal and Hexadecimal Numbers @cindex octal numbers @cindex hexadecimal numbers @cindex numbers, octal @cindex numbers, hexadecimal In @command{awk}, all numbers are in decimal; i.e., base 10. Many other programming languages allow you to specify numbers in other bases, often octal (base 8) and hexadecimal (base 16). In octal, the numbers go 0, 1, 2, 3, 4, 5, 6, 7, 10, 11, 12, etc. Just as @samp{11}, in decimal, is 1 times 10 plus 1, so @samp{11}, in octal, is 1 times 8, plus 1. This equals 9 in decimal. In hexadecimal, there are 16 digits. Since the everyday decimal number system only has ten digits (@samp{0}--@samp{9}), the letters @samp{a} through @samp{f} are used to represent the rest. (Case in the letters is usually irrelevant; hexadecimal @samp{a} and @samp{A} have the same value.) Thus, @samp{11}, in hexadecimal, is 1 times 16 plus 1, which equals 17 in decimal. Just by looking at plain @samp{11}, you can't tell what base it's in. So, in C, C++, and other languages derived from C, @c such as PERL, but we won't mention that.... there is a special notation to signify the base. Octal numbers start with a leading @samp{0}, and hexadecimal numbers start with a leading @samp{0x} or @samp{0X}: @table @code @item 11 Decimal value 11. @item 011 Octal 11, decimal value 9. @item 0x11 Hexadecimal 11, decimal value 17. @end table This example shows the difference: @example $ @kbd{gawk 'BEGIN @{ printf "%d, %d, %d\n", 011, 11, 0x11 @}'} @print{} 9, 11, 17 @end example Being able to use octal and hexadecimal constants in your programs is most useful when working with data that cannot be represented conveniently as characters or as regular numbers, such as binary data of various sorts. @cindex @command{gawk}, octal numbers and @cindex @command{gawk}, hexadecimal numbers and @command{gawk} allows the use of octal and hexadecimal constants in your program text. However, such numbers in the input data are not treated differently; doing so by default would break old programs. (If you really need to do this, use the @option{--non-decimal-data} command-line option; @pxref{Nondecimal Data}.) If you have octal or hexadecimal data, you can use the @code{strtonum()} function (@pxref{String Functions}) to convert the data into a number. Most of the time, you will want to use octal or hexadecimal constants when working with the built-in bit manipulation functions; see @ref{Bitwise Functions}, for more information. Unlike some early C implementations, @samp{8} and @samp{9} are not valid in octal constants; e.g., @command{gawk} treats @samp{018} as decimal 18: @example $ @kbd{gawk 'BEGIN @{ print "021 is", 021 ; print 018 @}'} @print{} 021 is 17 @print{} 18 @end example @cindex compatibility mode (@command{gawk}), octal numbers @cindex compatibility mode (@command{gawk}), hexadecimal numbers Octal and hexadecimal source code constants are a @command{gawk} extension. If @command{gawk} is in compatibility mode (@pxref{Options}), they are not available. @c fakenode --- for prepinfo @subheading Advanced Notes: A Constant's Base Does Not Affect Its Value @cindex advanced features, constants@comma{} values of Once a numeric constant has been converted internally into a number, @command{gawk} no longer remembers what the original form of the constant was; the internal value is always used. This has particular consequences for conversion of numbers to strings: @example $ @kbd{gawk 'BEGIN @{ printf "0x11 is <%s>\n", 0x11 @}'} @print{} 0x11 is <17> @end example @node Regexp Constants @subsubsection Regular Expression Constants @c STARTOFRANGE rec @cindex regexp constants @cindex @code{~} (tilde), @code{~} operator @cindex tilde (@code{~}), @code{~} operator @cindex @code{!} (exclamation point), @code{!~} operator @cindex exclamation point (@code{!}), @code{!~} operator A regexp constant is a regular expression description enclosed in slashes, such as @code{@w{/^beginning and end$/}}. Most regexps used in @command{awk} programs are constant, but the @samp{~} and @samp{!~} matching operators can also match computed or dynamic regexps (which are just ordinary strings or variables that contain a regexp). @c ENDOFRANGE cnst @node Using Constant Regexps @subsection Using Regular Expression Constants @cindex dark corner, regexp constants When used on the righthand side of the @samp{~} or @samp{!~} operators, a regexp constant merely stands for the regexp that is to be matched. However, regexp constants (such as @code{/foo/}) may be used like simple expressions. When a regexp constant appears by itself, it has the same meaning as if it appeared in a pattern, i.e., @samp{($0 ~ /foo/)} @value{DARKCORNER} @xref{Expression Patterns}. This means that the following two code segments: @example if ($0 ~ /barfly/ || $0 ~ /camelot/) print "found" @end example @noindent and: @example if (/barfly/ || /camelot/) print "found" @end example @noindent are exactly equivalent. One rather bizarre consequence of this rule is that the following Boolean expression is valid, but does not do what the user probably intended: @example # Note that /foo/ is on the left of the ~ if (/foo/ ~ $1) print "found foo" @end example @c @cindex automatic warnings @c @cindex warnings, automatic @cindex @command{gawk}, regexp constants and @cindex regexp constants, in @command{gawk} @noindent This code is ``obviously'' testing @code{$1} for a match against the regexp @code{/foo/}. But in fact, the expression @samp{/foo/ ~ $1} really means @samp{($0 ~ /foo/) ~ $1}. In other words, first match the input record against the regexp @code{/foo/}. The result is either zero or one, depending upon the success or failure of the match. That result is then matched against the first field in the record. Because it is unlikely that you would ever really want to make this kind of test, @command{gawk} issues a warning when it sees this construct in a program. Another consequence of this rule is that the assignment statement: @example matches = /foo/ @end example @noindent assigns either zero or one to the variable @code{matches}, depending upon the contents of the current input record. @cindex differences in @command{awk} and @command{gawk}, regexp constants @cindex dark corner, regexp constants, as arguments to user-defined functions @cindex @code{gensub()} function (@command{gawk}) @cindex @code{sub()} function @cindex @code{gsub()} function Constant regular expressions are also used as the first argument for the @code{gensub()}, @code{sub()}, and @code{gsub()} functions, as the second argument of the @code{match()} function, and as the third argument of the @code{patsplit()} function (@pxref{String Functions}). Modern implementations of @command{awk}, including @command{gawk}, allow the third argument of @code{split()} to be a regexp constant, but some older implementations do not. @value{DARKCORNER} This can lead to confusion when attempting to use regexp constants as arguments to user-defined functions (@pxref{User-defined}). For example: @example function mysub(pat, repl, str, global) @{ if (global) gsub(pat, repl, str) else sub(pat, repl, str) return str @} @{ @dots{} text = "hi! hi yourself!" mysub(/hi/, "howdy", text, 1) @dots{} @} @end example @c @cindex automatic warnings @c @cindex warnings, automatic In this example, the programmer wants to pass a regexp constant to the user-defined function @code{mysub}, which in turn passes it on to either @code{sub()} or @code{gsub()}. However, what really happens is that the @code{pat} parameter is either one or zero, depending upon whether or not @code{$0} matches @code{/hi/}. @command{gawk} issues a warning when it sees a regexp constant used as a parameter to a user-defined function, since passing a truth value in this way is probably not what was intended. @c ENDOFRANGE rec @node Variables @subsection Variables @cindex variables, user-defined @cindex user-defined, variables Variables are ways of storing values at one point in your program for use later in another part of your program. They can be manipulated entirely within the program text, and they can also be assigned values on the @command{awk} command line. @menu * Using Variables:: Using variables in your programs. * Assignment Options:: Setting variables on the command-line and a summary of command-line syntax. This is an advanced method of input. @end menu @node Using Variables @subsubsection Using Variables in a Program Variables let you give names to values and refer to them later. Variables have already been used in many of the examples. The name of a variable must be a sequence of letters, digits, or underscores, and it may not begin with a digit. Case is significant in variable names; @code{a} and @code{A} are distinct variables. A variable name is a valid expression by itself; it represents the variable's current value. Variables are given new values with @dfn{assignment operators}, @dfn{increment operators}, and @dfn{decrement operators}. @xref{Assignment Ops}. In addition, the @code{sub()} and @code{gsub()} functions can change a variable's value, and the @code{match()}, @code{patsplit()} and @code{split()} functions can change the contents of their array parameters. @xref{String Functions}. @cindex variables, built-in @cindex variables, initializing A few variables have special built-in meanings, such as @code{FS} (the field separator), and @code{NF} (the number of fields in the current input record). @xref{Built-in Variables}, for a list of the built-in variables. These built-in variables can be used and assigned just like all other variables, but their values are also used or changed automatically by @command{awk}. All built-in variables' names are entirely uppercase. Variables in @command{awk} can be assigned either numeric or string values. The kind of value a variable holds can change over the life of a program. By default, variables are initialized to the empty string, which is zero if converted to a number. There is no need to explicitly ``initialize'' a variable in @command{awk}, which is what you would do in C and in most other traditional languages. @node Assignment Options @subsubsection Assigning Variables on the Command Line @cindex variables, assigning on command line @cindex command line, variables@comma{} assigning on Any @command{awk} variable can be set by including a @dfn{variable assignment} among the arguments on the command line when @command{awk} is invoked (@pxref{Other Arguments}). Such an assignment has the following form: @example @var{variable}=@var{text} @end example @cindex @code{-v} option, variables@comma{} assigning @noindent With it, a variable is set either at the beginning of the @command{awk} run or in between input files. When the assignment is preceded with the @option{-v} option, as in the following: @example -v @var{variable}=@var{text} @end example @noindent the variable is set at the very beginning, even before the @code{BEGIN} rules execute. The @option{-v} option and its assignment must precede all the @value{FN} arguments, as well as the program text. (@xref{Options}, for more information about the @option{-v} option.) Otherwise, the variable assignment is performed at a time determined by its position among the input file arguments---after the processing of the preceding input file argument. For example: @example awk '@{ print $n @}' n=4 inventory-shipped n=2 BBS-list @end example @noindent prints the value of field number @code{n} for all input records. Before the first file is read, the command line sets the variable @code{n} equal to four. This causes the fourth field to be printed in lines from @file{inventory-shipped}. After the first file has finished, but before the second file is started, @code{n} is set to two, so that the second field is printed in lines from @file{BBS-list}: @example $ @kbd{awk '@{ print $n @}' n=4 inventory-shipped n=2 BBS-list} @print{} 15 @print{} 24 @dots{} @print{} 555-5553 @print{} 555-3412 @dots{} @end example @cindex dark corner, command-line arguments Command-line arguments are made available for explicit examination by the @command{awk} program in the @code{ARGV} array (@pxref{ARGC and ARGV}). @command{awk} processes the values of command-line assignments for escape sequences (@pxref{Escape Sequences}). @value{DARKCORNER} @node Conversion @subsection Conversion of Strings and Numbers @cindex converting, strings to numbers @cindex strings, converting @cindex numbers, converting @cindex converting, numbers to strings Strings are converted to numbers and numbers are converted to strings, if the context of the @command{awk} program demands it. For example, if the value of either @code{foo} or @code{bar} in the expression @samp{foo + bar} happens to be a string, it is converted to a number before the addition is performed. If numeric values appear in string concatenation, they are converted to strings. Consider the following: @example two = 2; three = 3 print (two three) + 4 @end example @noindent This prints the (numeric) value 27. The numeric values of the variables @code{two} and @code{three} are converted to strings and concatenated together. The resulting string is converted back to the number 23, to which 4 is then added. @cindex null strings, converting numbers to strings @cindex type conversion If, for some reason, you need to force a number to be converted to a string, concatenate that number with the empty string, @code{""}. To force a string to be converted to a number, add zero to that string. A string is converted to a number by interpreting any numeric prefix of the string as numerals: @code{"2.5"} converts to 2.5, @code{"1e3"} converts to 1000, and @code{"25fix"} has a numeric value of 25. Strings that can't be interpreted as valid numbers convert to zero. @cindex @code{CONVFMT} variable The exact manner in which numbers are converted into strings is controlled by the @command{awk} built-in variable @code{CONVFMT} (@pxref{Built-in Variables}). Numbers are converted using the @code{sprintf()} function with @code{CONVFMT} as the format specifier (@pxref{String Functions}). @code{CONVFMT}'s default value is @code{"%.6g"}, which prints a value with at most six significant digits. For some applications, you might want to change it to specify more precision. On most modern machines, 17 digits is usually enough to capture a floating-point number's value exactly.@footnote{Pathological cases can require up to 752 digits (!), but we doubt that you need to worry about this.} @cindex dark corner, @code{CONVFMT} variable Strange results can occur if you set @code{CONVFMT} to a string that doesn't tell @code{sprintf()} how to format floating-point numbers in a useful way. For example, if you forget the @samp{%} in the format, @command{awk} converts all numbers to the same constant string. As a special case, if a number is an integer, then the result of converting it to a string is @emph{always} an integer, no matter what the value of @code{CONVFMT} may be. Given the following code fragment: @example CONVFMT = "%2.2f" a = 12 b = a "" @end example @noindent @code{b} has the value @code{"12"}, not @code{"12.00"}. @value{DARKCORNER} @cindex POSIX @command{awk}, @code{OFMT} variable and @cindex @code{OFMT} variable @cindex portability, new @command{awk} vs.@: old @command{awk} @cindex @command{awk}, new vs.@: old, @code{OFMT} variable Prior to the POSIX standard, @command{awk} used the value of @code{OFMT} for converting numbers to strings. @code{OFMT} specifies the output format to use when printing numbers with @code{print}. @code{CONVFMT} was introduced in order to separate the semantics of conversion from the semantics of printing. Both @code{CONVFMT} and @code{OFMT} have the same default value: @code{"%.6g"}. In the vast majority of cases, old @command{awk} programs do not change their behavior. However, these semantics for @code{OFMT} are something to keep in mind if you must port your new-style program to older implementations of @command{awk}. We recommend that instead of changing your programs, just port @command{gawk} itself. @xref{Print}, for more information on the @code{print} statement. And, once again, where you are can matter when it comes to converting between numbers and strings. In @ref{Locales}, we mentioned that the local character set and language (the locale) can affect how @command{gawk} matches characters. The locale also affects numeric formats. In particular, for @command{awk} programs, it affects the decimal point character. The @code{"C"} locale, and most English-language locales, use the period character (@samp{.}) as the decimal point. However, many (if not most) European and non-English locales use the comma (@samp{,}) as the decimal point character. The POSIX standard says that @command{awk} always uses the period as the decimal point when reading the @command{awk} program source code, and for command-line variable assignments (@pxref{Other Arguments}). However, when interpreting input data, for @code{print} and @code{printf} output, and for number to string conversion, the local decimal point character is used. Here are some examples indicating the difference in behavior, on a GNU/Linux system: @example $ @kbd{gawk 'BEGIN @{ printf "%g\n", 3.1415927 @}'} @print{} 3.14159 $ @kbd{LC_ALL=en_DK gawk 'BEGIN @{ printf "%g\n", 3.1415927 @}'} @print{} 3,14159 $ @kbd{echo 4,321 | gawk '@{ print $1 + 1 @}'} @print{} 5 $ @kbd{echo 4,321 | LC_ALL=en_DK gawk '@{ print $1 + 1 @}'} @print{} 5,321 @end example @noindent The @samp{en_DK} locale is for English in Denmark, where the comma acts as the decimal point separator. In the normal @code{"C"} locale, @command{gawk} treats @samp{4,321} as @samp{4}, while in the Danish locale, it's treated as the full number, 4.321. Some earlier versions of @command{gawk} fully complied with this aspect of the standard. However, many users in non-English locales complained about this behavior, since their data used a period as the decimal point, so the default behavior was restored to use a period as the decimal point character. You can use the @option{--use-lc-numeric} option (@pxref{Options}) to force @command{gawk} to use the locale's decimal point character. (@command{gawk} also uses the locale's decimal point character when in POSIX mode, either via @option{--posix}, or the @env{POSIXLY_CORRECT} environment variable.) @ref{table-locale-affects} describes the cases in which the locale's decimal point character is used and when a period is used. Some of these features have not been described yet. @float Table,table-locale-affects @caption{Locale Decimal Point versus A Period} @multitable @columnfractions .15 .20 .45 @headitem Feature @tab Default @tab @option{--posix} or @option{--use-lc-numeric} @item @code{%'g} @tab Use locale @tab Use locale @item @code{%g} @tab Use period @tab Use locale @item Input @tab Use period @tab Use locale @item @code{strtonum()} @tab Use period @tab Use locale @end multitable @end float Finally, modern day formal standards and IEEE standard floating point representation can have an unusual but important effect on the way @command{gawk} converts some special string values to numbers. The details are presented in @ref{POSIX Floating Point Problems}. @node All Operators @section Operators: Doing Something With Values This @value{SECTION} introduces the @dfn{operators} which make use of the values provided by constants and variables. @menu * Arithmetic Ops:: Arithmetic operations (@samp{+}, @samp{-}, etc.) * Concatenation:: Concatenating strings. * Assignment Ops:: Changing the value of a variable or a field. * Increment Ops:: Incrementing the numeric value of a variable. @end menu @node Arithmetic Ops @subsection Arithmetic Operators @cindex arithmetic operators @cindex operators, arithmetic @c @cindex addition @c @cindex subtraction @c @cindex multiplication @c @cindex division @c @cindex remainder @c @cindex quotient @c @cindex exponentiation The @command{awk} language uses the common arithmetic operators when evaluating expressions. All of these arithmetic operators follow normal precedence rules and work as you would expect them to. The following example uses a file named @file{grades}, which contains a list of student names as well as three test scores per student (it's a small class): @example Pat 100 97 58 Sandy 84 72 93 Chris 72 92 89 @end example @noindent This program takes the file @file{grades} and prints the average of the scores: @example $ @kbd{awk '@{ sum = $2 + $3 + $4 ; avg = sum / 3} > @kbd{print $1, avg @}' grades} @print{} Pat 85 @print{} Sandy 83 @print{} Chris 84.3333 @end example The following list provides the arithmetic operators in @command{awk}, in order from the highest precedence to the lowest: @table @code @item - @var{x} Negation. @item + @var{x} Unary plus; the expression is converted to a number. @cindex common extensions, @code{**} operator @cindex extensions, common@comma{} @code{**} operator @cindex POSIX @command{awk}, arithmetic operators and @item @var{x} ^ @var{y} @itemx @var{x} ** @var{y} Exponentiation; @var{x} raised to the @var{y} power. @samp{2 ^ 3} has the value eight; the character sequence @samp{**} is equivalent to @samp{^}. @value{COMMONEXT} @item @var{x} * @var{y} Multiplication. @cindex troubleshooting, division @cindex division @item @var{x} / @var{y} Division; because all numbers in @command{awk} are floating-point numbers, the result is @emph{not} rounded to an integer---@samp{3 / 4} has the value 0.75. (It is a common mistake, especially for C programmers, to forget that @emph{all} numbers in @command{awk} are floating-point, and that division of integer-looking constants produces a real number, not an integer.) @item @var{x} % @var{y} Remainder; further discussion is provided in the text, just after this list. @item @var{x} + @var{y} Addition. @item @var{x} - @var{y} Subtraction. @end table Unary plus and minus have the same precedence, the multiplication operators all have the same precedence, and addition and subtraction have the same precedence. @cindex differences in @command{awk} and @command{gawk}, trunc-mod operation @cindex trunc-mod operation When computing the remainder of @samp{@var{x} % @var{y}}, the quotient is rounded toward zero to an integer and multiplied by @var{y}. This result is subtracted from @var{x}; this operation is sometimes known as ``trunc-mod.'' The following relation always holds: @example b * int(a / b) + (a % b) == a @end example One possibly undesirable effect of this definition of remainder is that @code{@var{x} % @var{y}} is negative if @var{x} is negative. Thus: @example -17 % 8 = -1 @end example In other @command{awk} implementations, the signedness of the remainder may be machine-dependent. @c !!! what does posix say? @cindex portability, @code{**} operator and @cindex @code{*} (asterisk), @code{**} operator @cindex asterisk (@code{*}), @code{**} operator @quotation NOTE The POSIX standard only specifies the use of @samp{^} for exponentiation. For maximum portability, do not use the @samp{**} operator. @end quotation @node Concatenation @subsection String Concatenation @cindex Kernighan, Brian @quotation @i{It seemed like a good idea at the time.}@* Brian Kernighan @end quotation @cindex string operators @cindex operators, string @cindex concatenating There is only one string operation: concatenation. It does not have a specific operator to represent it. Instead, concatenation is performed by writing expressions next to one another, with no operator. For example: @example $ @kbd{awk '@{ print "Field number one: " $1 @}' BBS-list} @print{} Field number one: aardvark @print{} Field number one: alpo-net @dots{} @end example Without the space in the string constant after the @samp{:}, the line runs together. For example: @example $ @kbd{awk '@{ print "Field number one:" $1 @}' BBS-list} @print{} Field number one:aardvark @print{} Field number one:alpo-net @dots{} @end example @cindex troubleshooting, string concatenation Because string concatenation does not have an explicit operator, it is often necessary to insure that it happens at the right time by using parentheses to enclose the items to concatenate. For example, you might expect that the following code fragment concatenates @code{file} and @code{name}: @example file = "file" name = "name" print "something meaningful" > file name @end example @noindent This produces a syntax error with some versions of Unix @command{awk}.@footnote{It happens that Brian Kernighan's @command{awk}, @command{gawk} and @command{mawk} all ``get it right,'' but you should not rely on this.} It is necessary to use the following: @example print "something meaningful" > (file name) @end example @cindex order of evaluation, concatenation @cindex evaluation order, concatenation @cindex side effects Parentheses should be used around concatenation in all but the most common contexts, such as on the righthand side of @samp{=}. Be careful about the kinds of expressions used in string concatenation. In particular, the order of evaluation of expressions used for concatenation is undefined in the @command{awk} language. Consider this example: @example BEGIN @{ a = "don't" print (a " " (a = "panic")) @} @end example @noindent It is not defined whether the assignment to @code{a} happens before or after the value of @code{a} is retrieved for producing the concatenated value. The result could be either @samp{don't panic}, or @samp{panic panic}. @c see test/nasty.awk for a worse example The precedence of concatenation, when mixed with other operators, is often counter-intuitive. Consider this example: @ignore > To: bug-gnu-utils@@gnu.org > CC: arnold@@gnu.org > Subject: gawk 3.0.4 bug with {print -12 " " -24} > From: Russell Schulz > Date: Tue, 8 Feb 2000 19:56:08 -0700 > > gawk 3.0.4 on NT gives me: > > prompt> cat bad.awk > BEGIN { print -12 " " -24; } > > prompt> gawk -f bad.awk > -12-24 > > when I would expect > > -12 -24 > > I have not investigated the source, or other implementations. The > bug is there on my NT and DOS versions 2.15.6 . @end ignore @example $ @kbd{awk 'BEGIN @{ print -12 " " -24 @}'} @print{} -12-24 @end example This ``obviously'' is concatenating @minus{}12, a space, and @minus{}24. But where did the space disappear to? The answer lies in the combination of operator precedences and @command{awk}'s automatic conversion rules. To get the desired result, write the program this way: @example $ @kbd{awk 'BEGIN @{ print -12 " " (-24) @}'} @print{} -12 -24 @end example This forces @command{awk} to treat the @samp{-} on the @samp{-24} as unary. Otherwise, it's parsed as follows: @display @minus{}12 (@code{"@ "} @minus{} 24) @result{} @minus{}12 (0 @minus{} 24) @result{} @minus{}12 (@minus{}24) @result{} @minus{}12@minus{}24 @end display As mentioned earlier, when doing concatenation, @emph{parenthesize}. Otherwise, you're never quite sure what you'll get. @node Assignment Ops @subsection Assignment Expressions @c STARTOFRANGE asop @cindex assignment operators @c STARTOFRANGE opas @cindex operators, assignment @c STARTOFRANGE exas @cindex expressions, assignment @cindex @code{=} (equals sign), @code{=} operator @cindex equals sign (@code{=}), @code{=} operator An @dfn{assignment} is an expression that stores a (usually different) value into a variable. For example, let's assign the value one to the variable @code{z}: @example z = 1 @end example After this expression is executed, the variable @code{z} has the value one. Whatever old value @code{z} had before the assignment is forgotten. Assignments can also store string values. For example, the following stores the value @code{"this food is good"} in the variable @code{message}: @example thing = "food" predicate = "good" message = "this " thing " is " predicate @end example @noindent @cindex side effects, assignment expressions This also illustrates string concatenation. The @samp{=} sign is called an @dfn{assignment operator}. It is the simplest assignment operator because the value of the righthand operand is stored unchanged. Most operators (addition, concatenation, and so on) have no effect except to compute a value. If the value isn't used, there's no reason to use the operator. An assignment operator is different; it does produce a value, but even if you ignore it, the assignment still makes itself felt through the alteration of the variable. We call this a @dfn{side effect}. @cindex lvalues/rvalues @cindex rvalues/lvalues @cindex assignment operators, lvalues/rvalues @cindex operators, assignment The lefthand operand of an assignment need not be a variable (@pxref{Variables}); it can also be a field (@pxref{Changing Fields}) or an array element (@pxref{Arrays}). These are all called @dfn{lvalues}, which means they can appear on the lefthand side of an assignment operator. The righthand operand may be any expression; it produces the new value that the assignment stores in the specified variable, field, or array element. (Such values are called @dfn{rvalues}.) @cindex variables, types of It is important to note that variables do @emph{not} have permanent types. A variable's type is simply the type of whatever value it happens to hold at the moment. In the following program fragment, the variable @code{foo} has a numeric value at first, and a string value later on: @example foo = 1 print foo foo = "bar" print foo @end example @noindent When the second assignment gives @code{foo} a string value, the fact that it previously had a numeric value is forgotten. String values that do not begin with a digit have a numeric value of zero. After executing the following code, the value of @code{foo} is five: @example foo = "a string" foo = foo + 5 @end example @quotation NOTE Using a variable as a number and then later as a string can be confusing and is poor programming style. The previous two examples illustrate how @command{awk} works, @emph{not} how you should write your programs! @end quotation An assignment is an expression, so it has a value---the same value that is assigned. Thus, @samp{z = 1} is an expression with the value one. One consequence of this is that you can write multiple assignments together, such as: @example x = y = z = 5 @end example @noindent This example stores the value five in all three variables (@code{x}, @code{y}, and @code{z}). It does so because the value of @samp{z = 5}, which is five, is stored into @code{y} and then the value of @samp{y = z = 5}, which is five, is stored into @code{x}. Assignments may be used anywhere an expression is called for. For example, it is valid to write @samp{x != (y = 1)} to set @code{y} to one, and then test whether @code{x} equals one. But this style tends to make programs hard to read; such nesting of assignments should be avoided, except perhaps in a one-shot program. @cindex @code{+} (plus sign), @code{+=} operator @cindex plus sign (@code{+}), @code{+=} operator Aside from @samp{=}, there are several other assignment operators that do arithmetic with the old value of the variable. For example, the operator @samp{+=} computes a new value by adding the righthand value to the old value of the variable. Thus, the following assignment adds five to the value of @code{foo}: @example foo += 5 @end example @noindent This is equivalent to the following: @example foo = foo + 5 @end example @noindent Use whichever makes the meaning of your program clearer. There are situations where using @samp{+=} (or any assignment operator) is @emph{not} the same as simply repeating the lefthand operand in the righthand expression. For example: @cindex Rankin, Pat @example # Thanks to Pat Rankin for this example BEGIN @{ foo[rand()] += 5 for (x in foo) print x, foo[x] bar[rand()] = bar[rand()] + 5 for (x in bar) print x, bar[x] @} @end example @cindex operators, assignment, evaluation order @cindex assignment operators, evaluation order @noindent The indices of @code{bar} are practically guaranteed to be different, because @code{rand()} returns different values each time it is called. (Arrays and the @code{rand()} function haven't been covered yet. @xref{Arrays}, and see @ref{Numeric Functions}, for more information). This example illustrates an important fact about assignment operators: the lefthand expression is only evaluated @emph{once}. It is up to the implementation as to which expression is evaluated first, the lefthand or the righthand. Consider this example: @example i = 1 a[i += 2] = i + 1 @end example @noindent The value of @code{a[3]} could be either two or four. @ref{table-assign-ops} lists the arithmetic assignment operators. In each case, the righthand operand is an expression whose value is converted to a number. @cindex @code{-} (hyphen), @code{-=} operator @cindex hyphen (@code{-}), @code{-=} operator @cindex @code{*} (asterisk), @code{*=} operator @cindex asterisk (@code{*}), @code{*=} operator @cindex @code{/} (forward slash), @code{/=} operator @cindex forward slash (@code{/}), @code{/=} operator @cindex @code{%} (percent sign), @code{%=} operator @cindex percent sign (@code{%}), @code{%=} operator @cindex @code{^} (caret), @code{^=} operator @cindex caret (@code{^}), @code{^=} operator @cindex @code{*} (asterisk), @code{**=} operator @cindex asterisk (@code{*}), @code{**=} operator @float Table,table-assign-ops @caption{Arithmetic Assignment Operators} @multitable @columnfractions .30 .70 @headitem Operator @tab Effect @item @var{lvalue} @code{+=} @var{increment} @tab Adds @var{increment} to the value of @var{lvalue}. @item @var{lvalue} @code{-=} @var{decrement} @tab Subtracts @var{decrement} from the value of @var{lvalue}. @item @var{lvalue} @code{*=} @var{coefficient} @tab Multiplies the value of @var{lvalue} by @var{coefficient}. @item @var{lvalue} @code{/=} @var{divisor} @tab Divides the value of @var{lvalue} by @var{divisor}. @item @var{lvalue} @code{%=} @var{modulus} @tab Sets @var{lvalue} to its remainder by @var{modulus}. @cindex common extensions, @code{**=} operator @cindex extensions, common@comma{} @code{**=} operator @cindex @command{awk} language, POSIX version @cindex POSIX @command{awk} @item @var{lvalue} @code{^=} @var{power} @tab @item @var{lvalue} @code{**=} @var{power} @tab Raises @var{lvalue} to the power @var{power}. @value{COMMONEXT} @end multitable @end float @cindex POSIX @command{awk}, @code{**=} operator and @cindex portability, @code{**=} operator and @quotation NOTE Only the @samp{^=} operator is specified by POSIX. For maximum portability, do not use the @samp{**=} operator. @end quotation @c fakenode --- for prepinfo @subheading Advanced Notes: Syntactic Ambiguities Between @samp{/=} and Regular Expressions @cindex advanced features, regexp constants @cindex dark corner, regexp constants, @code{/=} operator and @cindex @code{/} (forward slash), @code{/=} operator, vs. @code{/=@dots{}/} regexp constant @cindex forward slash (@code{/}), @code{/=} operator, vs. @code{/=@dots{}/} regexp constant @cindex regexp constants, @code{/=@dots{}/}, @code{/=} operator and @c derived from email from "Nelson H. F. Beebe" @c Date: Mon, 1 Sep 1997 13:38:35 -0600 (MDT) @cindex dark corner @cindex ambiguity, syntactic: @code{/=} operator vs. @code{/=@dots{}/} regexp constant @cindex syntactic ambiguity: @code{/=} operator vs. @code{/=@dots{}/} regexp constant @cindex @code{/=} operator vs. @code{/=@dots{}/} regexp constant There is a syntactic ambiguity between the @code{/=} assignment operator and regexp constants whose first character is an @samp{=}. @value{DARKCORNER} This is most notable in commercial @command{awk} versions. For example: @example $ awk /==/ /dev/null @error{} awk: syntax error at source line 1 @error{} context is @error{} >>> /= <<< @error{} awk: bailing out at source line 1 @end example @noindent A workaround is: @example awk '/[=]=/' /dev/null @end example @command{gawk} does not have this problem, nor do the other freely available versions described in @ref{Other Versions}. @c ENDOFRANGE exas @c ENDOFRANGE opas @c ENDOFRANGE asop @node Increment Ops @subsection Increment and Decrement Operators @c STARTOFRANGE inop @cindex increment operators @c STARTOFRANGE opde @cindex operators, decrement/increment @dfn{Increment} and @dfn{decrement operators} increase or decrease the value of a variable by one. An assignment operator can do the same thing, so the increment operators add no power to the @command{awk} language; however, they are convenient abbreviations for very common operations. @cindex side effects @cindex @code{+} (plus sign), @code{++} (decrement/increment operators) @cindex plus sign (@code{+}), @code{++} (decrement/increment operators) @cindex side effects, decrement/increment operators The operator used for adding one is written @samp{++}. It can be used to increment a variable either before or after taking its value. To pre-increment a variable @code{v}, write @samp{++v}. This adds one to the value of @code{v}---that new value is also the value of the expression. (The assignment expression @samp{v += 1} is completely equivalent.) Writing the @samp{++} after the variable specifies post-increment. This increments the variable value just the same; the difference is that the value of the increment expression itself is the variable's @emph{old} value. Thus, if @code{foo} has the value four, then the expression @samp{foo++} has the value four, but it changes the value of @code{foo} to five. In other words, the operator returns the old value of the variable, but with the side effect of incrementing it. The post-increment @samp{foo++} is nearly the same as writing @samp{(foo += 1) - 1}. It is not perfectly equivalent because all numbers in @command{awk} are floating-point---in floating-point, @samp{foo + 1 - 1} does not necessarily equal @code{foo}. But the difference is minute as long as you stick to numbers that are fairly small (less than 10e12). @cindex @code{$} (dollar sign), incrementing fields and arrays @cindex dollar sign (@code{$}), incrementing fields and arrays Fields and array elements are incremented just like variables. (Use @samp{$(i++)} when you want to do a field reference and a variable increment at the same time. The parentheses are necessary because of the precedence of the field reference operator @samp{$}.) @cindex decrement operators The decrement operator @samp{--} works just like @samp{++}, except that it subtracts one instead of adding it. As with @samp{++}, it can be used before the lvalue to pre-decrement or after it to post-decrement. Following is a summary of increment and decrement expressions: @table @code @cindex @code{+} (plus sign), @code{++} operator @cindex plus sign (@code{+}), @code{++} operator @item ++@var{lvalue} Increment @var{lvalue}, returning the new value as the value of the expression. @item @var{lvalue}++ Increment @var{lvalue}, returning the @emph{old} value of @var{lvalue} as the value of the expression. @cindex @code{-} (hyphen), @code{--} operator @cindex hyphen (@code{-}), @code{--} operator @item --@var{lvalue} Decrement @var{lvalue}, returning the new value as the value of the expression. (This expression is like @samp{++@var{lvalue}}, but instead of adding, it subtracts.) @item @var{lvalue}-- Decrement @var{lvalue}, returning the @emph{old} value of @var{lvalue} as the value of the expression. (This expression is like @samp{@var{lvalue}++}, but instead of adding, it subtracts.) @end table @c fakenode --- for prepinfo @subheading Advanced Notes: Operator Evaluation Order @cindex advanced features, operators@comma{} precedence @cindex precedence @cindex operators, precedence @cindex portability, operators @cindex evaluation order @cindex Marx, Groucho @quotation @i{Doctor, doctor! It hurts when I do this!@* So don't do that!}@* Groucho Marx @end quotation @noindent What happens for something like the following? @example b = 6 print b += b++ @end example @noindent Or something even stranger? @example b = 6 b += ++b + b++ print b @end example @cindex side effects In other words, when do the various side effects prescribed by the postfix operators (@samp{b++}) take effect? When side effects happen is @dfn{implementation defined}. In other words, it is up to the particular version of @command{awk}. The result for the first example may be 12 or 13, and for the second, it may be 22 or 23. In short, doing things like this is not recommended and definitely not anything that you can rely upon for portability. You should avoid such things in your own programs. @c You'll sleep better at night and be able to look at yourself @c in the mirror in the morning. @c ENDOFRANGE inop @c ENDOFRANGE opde @c ENDOFRANGE deop @node Truth Values and Conditions @section Truth Values and Conditions In certain contexts, expression values also serve as ``truth values;'' i.e., they determine what should happen next as the program runs. This @value{SECTION} describes how @command{awk} defines ``true'' and ``false'' and how values are compared. @menu * Truth Values:: What is ``true'' and what is ``false''. * Typing and Comparison:: How variables acquire types and how this affects comparison of numbers and strings with @samp{<}, etc. * Boolean Ops:: Combining comparison expressions using boolean operators @samp{||} (``or''), @samp{&&} (``and'') and @samp{!} (``not''). * Conditional Exp:: Conditional expressions select between two subexpressions under control of a third subexpression. @end menu @node Truth Values @subsection True and False in @command{awk} @cindex truth values @cindex logical false/true @cindex false, logical @cindex true, logical @cindex null strings Many programming languages have a special representation for the concepts of ``true'' and ``false.'' Such languages usually use the special constants @code{true} and @code{false}, or perhaps their uppercase equivalents. However, @command{awk} is different. It borrows a very simple concept of true and false from C. In @command{awk}, any nonzero numeric value @emph{or} any nonempty string value is true. Any other value (zero or the null string, @code{""}) is false. The following program prints @samp{A strange truth value} three times: @example BEGIN @{ if (3.1415927) print "A strange truth value" if ("Four Score And Seven Years Ago") print "A strange truth value" if (j = 57) print "A strange truth value" @} @end example @cindex dark corner There is a surprising consequence of the ``nonzero or non-null'' rule: the string constant @code{"0"} is actually true, because it is non-null. @value{DARKCORNER} @node Typing and Comparison @subsection Variable Typing and Comparison Expressions @quotation @i{The Guide is definitive. Reality is frequently inaccurate.}@* The Hitchhiker's Guide to the Galaxy @end quotation @c STARTOFRANGE comex @cindex comparison expressions @c STARTOFRANGE excom @cindex expressions, comparison @cindex expressions, matching, See comparison expressions @cindex matching, expressions, See comparison expressions @cindex relational operators, See comparison operators @cindex operators, relational, See operators@comma{} comparison @c STARTOFRANGE varting @cindex variable typing @c STARTOFRANGE vartypc @cindex variables, types of, comparison expressions and Unlike other programming languages, @command{awk} variables do not have a fixed type. Instead, they can be either a number or a string, depending upon the value that is assigned to them. We look now at how variables are typed, and how @command{awk} compares variables. @menu * Variable Typing:: String type versus numeric type. * Comparison Operators:: The comparison operators. * POSIX String Comparison:: String comparison with POSIX rules. @end menu @node Variable Typing @subsubsection String Type Versus Numeric Type @cindex numeric, strings @cindex strings, numeric @cindex POSIX @command{awk}, numeric strings and The 1992 POSIX standard introduced the concept of a @dfn{numeric string}, which is simply a string that looks like a number---for example, @code{@w{" +2"}}. This concept is used for determining the type of a variable. The type of the variable is important because the types of two variables determine how they are compared. The various versions of the POSIX standard did not get the rules quite right for several editions. Fortunately, as of at least the 2008 standard (and possibly earlier), the standard has been fixed, and variable typing follows these rules:@footnote{@command{gawk} has followed these rules for many years, and it is gratifying that the POSIX standard is also now correct.} @itemize @bullet @item A numeric constant or the result of a numeric operation has the @var{numeric} attribute. @item A string constant or the result of a string operation has the @var{string} attribute. @item Fields, @code{getline} input, @code{FILENAME}, @code{ARGV} elements, @code{ENVIRON} elements, and the elements of an array created by @code{patsplit()}, @code{split()} and @code{match()} that are numeric strings have the @var{strnum} attribute. Otherwise, they have the @var{string} attribute. Uninitialized variables also have the @var{strnum} attribute. @item Attributes propagate across assignments but are not changed by any use. @c (Although a use may cause the entity to acquire an additional @c value such that it has both a numeric and string value, this leaves the @c attribute unchanged.) @c This is important but not relevant @end itemize The last rule is particularly important. In the following program, @code{a} has numeric type, even though it is later used in a string operation: @example BEGIN @{ a = 12.345 b = a " is a cute number" print b @} @end example When two operands are compared, either string comparison or numeric comparison may be used. This depends upon the attributes of the operands, according to the following symmetric matrix: @c thanks to Karl Berry, kb@cs.umb.edu, for major help with TeX tables @tex \centerline{ \vbox{\bigskip % space above the table (about 1 linespace) % Because we have vertical rules, we can't let TeX insert interline space % in its usual way. \offinterlineskip % % Define the table template. & separates columns, and \cr ends the % template (and each row). # is replaced by the text of that entry on % each row. The template for the first column breaks down like this: % \strut -- a way to make each line have the height and depth % of a normal line of type, since we turned off interline spacing. % \hfil -- infinite glue; has the effect of right-justifying in this case. % # -- replaced by the text (for instance, `STRNUM', in the last row). % \quad -- about the width of an `M'. Just separates the columns. % % The second column (\vrule#) is what generates the vertical rule that % spans table rows. % % The doubled && before the next entry means `repeat the following % template as many times as necessary on each line' -- in our case, twice. % % The template itself, \quad#\hfil, left-justifies with a little space before. % \halign{\strut\hfil#\quad&\vrule#&&\quad#\hfil\cr &&STRING &NUMERIC &STRNUM\cr % The \omit tells TeX to skip inserting the template for this column on % this particular row. In this case, we only want a little extra space % to separate the heading row from the rule below it. the depth 2pt -- % `\vrule depth 2pt' is that little space. \omit &depth 2pt\cr % This is the horizontal rule below the heading. Since it has nothing to % do with the columns of the table, we use \noalign to get it in there. \noalign{\hrule} % Like above, this time a little more space. \omit &depth 4pt\cr % The remaining rows have nothing special about them. STRING &&string &string &string\cr NUMERIC &&string &numeric &numeric\cr STRNUM &&string &numeric &numeric\cr }}} @end tex @ifnottex @display +---------------------------------------------- | STRING NUMERIC STRNUM --------+---------------------------------------------- | STRING | string string string | NUMERIC | string numeric numeric | STRNUM | string numeric numeric --------+---------------------------------------------- @end display @end ifnottex The basic idea is that user input that looks numeric---and @emph{only} user input---should be treated as numeric, even though it is actually made of characters and is therefore also a string. Thus, for example, the string constant @w{@code{" +3.14"}}, when it appears in program source code, is a string---even though it looks numeric---and is @emph{never} treated as number for comparison purposes. In short, when one operand is a ``pure'' string, such as a string constant, then a string comparison is performed. Otherwise, a numeric comparison is performed. This point bears additional emphasis: All user input is made of characters, and so is first and foremost of @var{string} type; input strings that look numeric are additionally given the @var{strnum} attribute. Thus, the six-character input string @w{@samp{ +3.14}} receives the @var{strnum} attribute. In contrast, the eight-character literal @w{@code{" +3.14"}} appearing in program text is a string constant. The following examples print @samp{1} when the comparison between the two different constants is true, @samp{0} otherwise: @example $ @kbd{echo ' +3.14' | gawk '@{ print $0 == " +3.14" @}'} @ii{True} @print{} 1 $ @kbd{echo ' +3.14' | gawk '@{ print $0 == "+3.14" @}'} @ii{False} @print{} 0 $ @kbd{echo ' +3.14' | gawk '@{ print $0 == "3.14" @}'} @ii{False} @print{} 0 $ @kbd{echo ' +3.14' | gawk '@{ print $0 == 3.14 @}'} @ii{True} @print{} 1 $ @kbd{echo ' +3.14' | gawk '@{ print $1 == " +3.14" @}'} @ii{False} @print{} 0 $ @kbd{echo ' +3.14' | gawk '@{ print $1 == "+3.14" @}'} @ii{True} @print{} 1 $ @kbd{echo ' +3.14' | gawk '@{ print $1 == "3.14" @}'} @ii{False} @print{} 0 $ @kbd{echo ' +3.14' | gawk '@{ print $1 == 3.14 @}'} @ii{True} @print{} 1 @end example @node Comparison Operators @subsubsection Comparison Operators @dfn{Comparison expressions} compare strings or numbers for relationships such as equality. They are written using @dfn{relational operators}, which are a superset of those in C. @ref{table-relational-ops} describes them. @cindex @code{<} (left angle bracket), @code{<} operator @cindex left angle bracket (@code{<}), @code{<} operator @cindex @code{<} (left angle bracket), @code{<=} operator @cindex left angle bracket (@code{<}), @code{<=} operator @cindex @code{>} (right angle bracket), @code{>=} operator @cindex right angle bracket (@code{>}), @code{>=} operator @cindex @code{>} (right angle bracket), @code{>} operator @cindex right angle bracket (@code{>}), @code{>} operator @cindex @code{=} (equals sign), @code{==} operator @cindex equals sign (@code{=}), @code{==} operator @cindex @code{!} (exclamation point), @code{!=} operator @cindex exclamation point (@code{!}), @code{!=} operator @cindex @code{~} (tilde), @code{~} operator @cindex tilde (@code{~}), @code{~} operator @cindex @code{!} (exclamation point), @code{!~} operator @cindex exclamation point (@code{!}), @code{!~} operator @cindex @code{in} operator @float Table,table-relational-ops @caption{Relational Operators} @multitable @columnfractions .25 .75 @headitem Expression @tab Result @item @var{x} @code{<} @var{y} @tab True if @var{x} is less than @var{y}. @item @var{x} @code{<=} @var{y} @tab True if @var{x} is less than or equal to @var{y}. @item @var{x} @code{>} @var{y} @tab True if @var{x} is greater than @var{y}. @item @var{x} @code{>=} @var{y} @tab True if @var{x} is greater than or equal to @var{y}. @item @var{x} @code{==} @var{y} @tab True if @var{x} is equal to @var{y}. @item @var{x} @code{!=} @var{y} @tab True if @var{x} is not equal to @var{y}. @item @var{x} @code{~} @var{y} @tab True if the string @var{x} matches the regexp denoted by @var{y}. @item @var{x} @code{!~} @var{y} @tab True if the string @var{x} does not match the regexp denoted by @var{y}. @item @var{subscript} @code{in} @var{array} @tab True if the array @var{array} has an element with the subscript @var{subscript}. @end multitable @end float Comparison expressions have the value one if true and zero if false. When comparing operands of mixed types, numeric operands are converted to strings using the value of @code{CONVFMT} (@pxref{Conversion}). Strings are compared by comparing the first character of each, then the second character of each, and so on. Thus, @code{"10"} is less than @code{"9"}. If there are two strings where one is a prefix of the other, the shorter string is less than the longer one. Thus, @code{"abc"} is less than @code{"abcd"}. @cindex troubleshooting, @code{==} operator It is very easy to accidentally mistype the @samp{==} operator and leave off one of the @samp{=} characters. The result is still valid @command{awk} code, but the program does not do what is intended: @example if (a = b) # oops! should be a == b @dots{} else @dots{} @end example @noindent Unless @code{b} happens to be zero or the null string, the @code{if} part of the test always succeeds. Because the operators are so similar, this kind of error is very difficult to spot when scanning the source code. @cindex @command{gawk}, comparison operators and The following table of expressions illustrates the kind of comparison @command{gawk} performs, as well as what the result of the comparison is: @table @code @item 1.5 <= 2.0 numeric comparison (true) @item "abc" >= "xyz" string comparison (false) @item 1.5 != " +2" string comparison (true) @item "1e2" < "3" string comparison (true) @item a = 2; b = "2" @itemx a == b string comparison (true) @item a = 2; b = " +2" @item a == b string comparison (false) @end table In this example: @example $ @kbd{echo 1e2 3 | awk '@{ print ($1 < $2) ? "true" : "false" @}'} @print{} false @end example @cindex comparison expressions, string vs.@: regexp @c @cindex string comparison vs.@: regexp comparison @c @cindex regexp comparison vs.@: string comparison @noindent the result is @samp{false} because both @code{$1} and @code{$2} are user input. They are numeric strings---therefore both have the @var{strnum} attribute, dictating a numeric comparison. The purpose of the comparison rules and the use of numeric strings is to attempt to produce the behavior that is ``least surprising,'' while still ``doing the right thing.'' String comparisons and regular expression comparisons are very different. For example: @example x == "foo" @end example @noindent has the value one, or is true if the variable @code{x} is precisely @samp{foo}. By contrast: @example x ~ /foo/ @end example @noindent has the value one if @code{x} contains @samp{foo}, such as @code{"Oh, what a fool am I!"}. @cindex @code{~} (tilde), @code{~} operator @cindex tilde (@code{~}), @code{~} operator @cindex @code{!} (exclamation point), @code{!~} operator @cindex exclamation point (@code{!}), @code{!~} operator The righthand operand of the @samp{~} and @samp{!~} operators may be either a regexp constant (@code{/@dots{}/}) or an ordinary expression. In the latter case, the value of the expression as a string is used as a dynamic regexp (@pxref{Regexp Usage}; also @pxref{Computed Regexps}). @cindex @command{awk}, regexp constants and @cindex regexp constants In modern implementations of @command{awk}, a constant regular expression in slashes by itself is also an expression. The regexp @code{/@var{regexp}/} is an abbreviation for the following comparison expression: @example $0 ~ /@var{regexp}/ @end example One special place where @code{/foo/} is @emph{not} an abbreviation for @samp{$0 ~ /foo/} is when it is the righthand operand of @samp{~} or @samp{!~}. @xref{Using Constant Regexps}, where this is discussed in more detail. @node POSIX String Comparison @subsubsection String Comparison With POSIX Rules The POSIX standard says that string comparison is performed based on the locale's collating order. This is usually very different from the results obtained when doing straight character-by-character comparison.@footnote{Technically, string comparison is supposed to behave the same way as if the strings are compared with the C @code{strcoll()} function.} Because this behavior differs considerably from existing practice, @command{gawk} only implements it when in POSIX mode (@pxref{Options}). Here is an example to illustrate the difference, in an @samp{en_US.UTF-8} locale: @example $ @kbd{gawk 'BEGIN @{ printf("ABC < abc = %s\n",} > @kbd{("ABC" < "abc" ? "TRUE" : "FALSE")) @}'} @print{} ABC < abc = TRUE $ @kbd{gawk --posix 'BEGIN @{ printf("ABC < abc = %s\n",} > @kbd{("ABC" < "abc" ? "TRUE" : "FALSE")) @}'} @print{} ABC < abc = FALSE @end example @c ENDOFRANGE comex @c ENDOFRANGE excom @c ENDOFRANGE vartypc @c ENDOFRANGE varting @node Boolean Ops @subsection Boolean Expressions @cindex and Boolean-logic operator @cindex or Boolean-logic operator @cindex not Boolean-logic operator @c STARTOFRANGE exbo @cindex expressions, Boolean @c STARTOFRANGE boex @cindex Boolean expressions @cindex operators, Boolean, See Boolean expressions @cindex Boolean operators, See Boolean expressions @cindex logical operators, See Boolean expressions @cindex operators, logical, See Boolean expressions A @dfn{Boolean expression} is a combination of comparison expressions or matching expressions, using the Boolean operators ``or'' (@samp{||}), ``and'' (@samp{&&}), and ``not'' (@samp{!}), along with parentheses to control nesting. The truth value of the Boolean expression is computed by combining the truth values of the component expressions. Boolean expressions are also referred to as @dfn{logical expressions}. The terms are equivalent. Boolean expressions can be used wherever comparison and matching expressions can be used. They can be used in @code{if}, @code{while}, @code{do}, and @code{for} statements (@pxref{Statements}). They have numeric values (one if true, zero if false) that come into play if the result of the Boolean expression is stored in a variable or used in arithmetic. In addition, every Boolean expression is also a valid pattern, so you can use one as a pattern to control the execution of rules. The Boolean operators are: @table @code @item @var{boolean1} && @var{boolean2} True if both @var{boolean1} and @var{boolean2} are true. For example, the following statement prints the current input record if it contains both @samp{2400} and @samp{foo}: @example if ($0 ~ /2400/ && $0 ~ /foo/) print @end example @cindex side effects, Boolean operators The subexpression @var{boolean2} is evaluated only if @var{boolean1} is true. This can make a difference when @var{boolean2} contains expressions that have side effects. In the case of @samp{$0 ~ /foo/ && ($2 == bar++)}, the variable @code{bar} is not incremented if there is no substring @samp{foo} in the record. @item @var{boolean1} || @var{boolean2} True if at least one of @var{boolean1} or @var{boolean2} is true. For example, the following statement prints all records in the input that contain @emph{either} @samp{2400} or @samp{foo} or both: @example if ($0 ~ /2400/ || $0 ~ /foo/) print @end example The subexpression @var{boolean2} is evaluated only if @var{boolean1} is false. This can make a difference when @var{boolean2} contains expressions that have side effects. @item ! @var{boolean} True if @var{boolean} is false. For example, the following program prints @samp{no home!} in the unusual event that the @env{HOME} environment variable is not defined: @example BEGIN @{ if (! ("HOME" in ENVIRON)) print "no home!" @} @end example (The @code{in} operator is described in @ref{Reference to Elements}.) @end table @cindex short-circuit operators @cindex operators, short-circuit @cindex @code{&} (ampersand), @code{&&} operator @cindex ampersand (@code{&}), @code{&&} operator @cindex @code{|} (vertical bar), @code{||} operator @cindex vertical bar (@code{|}), @code{||} operator The @samp{&&} and @samp{||} operators are called @dfn{short-circuit} operators because of the way they work. Evaluation of the full expression is ``short-circuited'' if the result can be determined part way through its evaluation. @cindex line continuations Statements that use @samp{&&} or @samp{||} can be continued simply by putting a newline after them. But you cannot put a newline in front of either of these operators without using backslash continuation (@pxref{Statements/Lines}). @cindex @code{!} (exclamation point), @code{!} operator @cindex exclamation point (@code{!}), @code{!} operator @cindex newlines @cindex variables, flag @cindex flag variables The actual value of an expression using the @samp{!} operator is either one or zero, depending upon the truth value of the expression it is applied to. The @samp{!} operator is often useful for changing the sense of a flag variable from false to true and back again. For example, the following program is one way to print lines in between special bracketing lines: @example $1 == "START" @{ interested = ! interested; next @} interested == 1 @{ print @} $1 == "END" @{ interested = ! interested; next @} @end example @noindent The variable @code{interested}, as with all @command{awk} variables, starts out initialized to zero, which is also false. When a line is seen whose first field is @samp{START}, the value of @code{interested} is toggled to true, using @samp{!}. The next rule prints lines as long as @code{interested} is true. When a line is seen whose first field is @samp{END}, @code{interested} is toggled back to false.@footnote{This program has a bug; it prints lines starting with @samp{END}. How would you fix it?} @ignore Scott Deifik points out that this program isn't robust against bogus input data, but the point is to illustrate the use of `!', so we'll leave well enough alone. @end ignore @cindex @code{next} statement @quotation NOTE The @code{next} statement is discussed in @ref{Next Statement}. @code{next} tells @command{awk} to skip the rest of the rules, get the next record, and start processing the rules over again at the top. The reason it's there is to avoid printing the bracketing @samp{START} and @samp{END} lines. @end quotation @c ENDOFRANGE exbo @c ENDOFRANGE boex @node Conditional Exp @subsection Conditional Expressions @cindex conditional expressions @cindex expressions, conditional @cindex expressions, selecting A @dfn{conditional expression} is a special kind of expression that has three operands. It allows you to use one expression's value to select one of two other expressions. The conditional expression is the same as in the C language, as shown here: @example @var{selector} ? @var{if-true-exp} : @var{if-false-exp} @end example @noindent There are three subexpressions. The first, @var{selector}, is always computed first. If it is ``true'' (not zero or not null), then @var{if-true-exp} is computed next and its value becomes the value of the whole expression. Otherwise, @var{if-false-exp} is computed next and its value becomes the value of the whole expression. For example, the following expression produces the absolute value of @code{x}: @example x >= 0 ? x : -x @end example @cindex side effects, conditional expressions Each time the conditional expression is computed, only one of @var{if-true-exp} and @var{if-false-exp} is used; the other is ignored. This is important when the expressions have side effects. For example, this conditional expression examines element @code{i} of either array @code{a} or array @code{b}, and increments @code{i}: @example x == y ? a[i++] : b[i++] @end example @noindent This is guaranteed to increment @code{i} exactly once, because each time only one of the two increment expressions is executed and the other is not. @xref{Arrays}, for more information about arrays. @cindex differences in @command{awk} and @command{gawk}, line continuations @cindex line continuations, @command{gawk} @cindex @command{gawk}, line continuation in As a minor @command{gawk} extension, a statement that uses @samp{?:} can be continued simply by putting a newline after either character. However, putting a newline in front of either character does not work without using backslash continuation (@pxref{Statements/Lines}). If @option{--posix} is specified (@pxref{Options}), then this extension is disabled. @node Function Calls @section Function Calls @cindex function calls A @dfn{function} is a name for a particular calculation. This enables you to ask for it by name at any point in the program. For example, the function @code{sqrt()} computes the square root of a number. @cindex functions, built-in A fixed set of functions are @dfn{built-in}, which means they are available in every @command{awk} program. The @code{sqrt()} function is one of these. @xref{Built-in}, for a list of built-in functions and their descriptions. In addition, you can define functions for use in your program. @xref{User-defined}, for instructions on how to do this. @cindex arguments, in function calls The way to use a function is with a @dfn{function call} expression, which consists of the function name followed immediately by a list of @dfn{arguments} in parentheses. The arguments are expressions that provide the raw materials for the function's calculations. When there is more than one argument, they are separated by commas. If there are no arguments, just write @samp{()} after the function name. The following examples show function calls with and without arguments: @example sqrt(x^2 + y^2) @ii{one argument} atan2(y, x) @ii{two arguments} rand() @ii{no arguments} @end example @cindex troubleshooting, function call syntax @quotation CAUTION Do not put any space between the function name and the open-parenthesis! A user-defined function name looks just like the name of a variable---a space would make the expression look like concatenation of a variable with an expression inside parentheses. With built-in functions, space before the parenthesis is harmless, but it is best not to get into the habit of using space to avoid mistakes with user-defined functions. @end quotation Each function expects a particular number of arguments. For example, the @code{sqrt()} function must be called with a single argument, the number of which to take the square root: @example sqrt(@var{argument}) @end example Some of the built-in functions have one or more optional arguments. If those arguments are not supplied, the functions use a reasonable default value. @xref{Built-in}, for full details. If arguments are omitted in calls to user-defined functions, then those arguments are treated as local variables and initialized to the empty string (@pxref{User-defined}). As an advanced feature, @command{gawk} provides indirect function calls, which is a way to choose the function to call at runtime, instead of when you write the source code to your program. We defer discussion of this feature until later; see @ref{Indirect Calls}. @cindex side effects, function calls Like every other expression, the function call has a value, which is computed by the function based on the arguments you give it. In this example, the value of @samp{sqrt(@var{argument})} is the square root of @var{argument}. The following program reads numbers, one number per line, and prints the square root of each one: @example $ @kbd{awk '@{ print "The square root of", $1, "is", sqrt($1) @}'} @kbd{1} @print{} The square root of 1 is 1 @kbd{3} @print{} The square root of 3 is 1.73205 @kbd{5} @print{} The square root of 5 is 2.23607 @kbd{@value{CTL}-d} @end example A function can also have side effects, such as assigning values to certain variables or doing I/O. This program shows how the @code{match()} function (@pxref{String Functions}) changes the variables @code{RSTART} and @code{RLENGTH}: @example @{ if (match($1, $2)) print RSTART, RLENGTH else print "no match" @} @end example @noindent Here is a sample run: @example $ @kbd{awk -f matchit.awk} @kbd{aaccdd c+} @print{} 3 2 @kbd{foo bar} @print{} no match @kbd{abcdefg e} @print{} 5 1 @end example @node Precedence @section Operator Precedence (How Operators Nest) @c STARTOFRANGE prec @cindex precedence @c STARTOFRANGE oppr @cindex operators, precedence @dfn{Operator precedence} determines how operators are grouped when different operators appear close by in one expression. For example, @samp{*} has higher precedence than @samp{+}; thus, @samp{a + b * c} means to multiply @code{b} and @code{c}, and then add @code{a} to the product (i.e., @samp{a + (b * c)}). The normal precedence of the operators can be overruled by using parentheses. Think of the precedence rules as saying where the parentheses are assumed to be. In fact, it is wise to always use parentheses whenever there is an unusual combination of operators, because other people who read the program may not remember what the precedence is in this case. Even experienced programmers occasionally forget the exact rules, which leads to mistakes. Explicit parentheses help prevent any such mistakes. When operators of equal precedence are used together, the leftmost operator groups first, except for the assignment, conditional, and exponentiation operators, which group in the opposite order. Thus, @samp{a - b + c} groups as @samp{(a - b) + c} and @samp{a = b = c} groups as @samp{a = (b = c)}. Normally the precedence of prefix unary operators does not matter, because there is only one way to interpret them: innermost first. Thus, @samp{$++i} means @samp{$(++i)} and @samp{++$x} means @samp{++($x)}. However, when another operator follows the operand, then the precedence of the unary operators can matter. @samp{$x^2} means @samp{($x)^2}, but @samp{-x^2} means @samp{-(x^2)}, because @samp{-} has lower precedence than @samp{^}, whereas @samp{$} has higher precedence. Also, operators cannot be combined in a way that violates the precedence rules; for example, @samp{$$0++--} is not a valid expression because the first @samp{$} has higher precedence than the @samp{++}; to avoid the problem the expression can be rewritten as @samp{$($0++)--}. This table presents @command{awk}'s operators, in order of highest to lowest precedence: @c use @code in the items, looks better in TeX w/o all the quotes @table @code @item (@dots{}) Grouping. @cindex @code{$} (dollar sign), @code{$} field operator @cindex dollar sign (@code{$}), @code{$} field operator @item $ Field reference. @cindex @code{+} (plus sign), @code{++} operator @cindex plus sign (@code{+}), @code{++} operator @cindex @code{-} (hyphen), @code{--} (decrement/increment) operator @cindex hyphen (@code{-}), @code{--} (decrement/increment) operators @item ++ -- Increment, decrement. @cindex @code{^} (caret), @code{^} operator @cindex caret (@code{^}), @code{^} operator @cindex @code{*} (asterisk), @code{**} operator @cindex asterisk (@code{*}), @code{**} operator @item ^ ** Exponentiation. These operators group right-to-left. @cindex @code{+} (plus sign), @code{+} operator @cindex plus sign (@code{+}), @code{+} operator @cindex @code{-} (hyphen), @code{-} operator @cindex hyphen (@code{-}), @code{-} operator @cindex @code{!} (exclamation point), @code{!} operator @cindex exclamation point (@code{!}), @code{!} operator @item + - ! Unary plus, minus, logical ``not.'' @cindex @code{*} (asterisk), @code{*} operator, as multiplication operator @cindex asterisk (@code{*}), @code{*} operator, as multiplication operator @cindex @code{/} (forward slash), @code{/} operator @cindex forward slash (@code{/}), @code{/} operator @cindex @code{%} (percent sign), @code{%} operator @cindex percent sign (@code{%}), @code{%} operator @item * / % Multiplication, division, remainder. @cindex @code{+} (plus sign), @code{+} operator @cindex plus sign (@code{+}), @code{+} operator @cindex @code{-} (hyphen), @code{-} operator @cindex hyphen (@code{-}), @code{-} operator @item + - Addition, subtraction. @item @r{String Concatenation} There is no special symbol for concatenation. The operands are simply written side by side (@pxref{Concatenation}). @cindex @code{<} (left angle bracket), @code{<} operator @cindex left angle bracket (@code{<}), @code{<} operator @cindex @code{<} (left angle bracket), @code{<=} operator @cindex left angle bracket (@code{<}), @code{<=} operator @cindex @code{>} (right angle bracket), @code{>=} operator @cindex right angle bracket (@code{>}), @code{>=} operator @cindex @code{>} (right angle bracket), @code{>} operator @cindex right angle bracket (@code{>}), @code{>} operator @cindex @code{=} (equals sign), @code{==} operator @cindex equals sign (@code{=}), @code{==} operator @cindex @code{!} (exclamation point), @code{!=} operator @cindex exclamation point (@code{!}), @code{!=} operator @cindex @code{>} (right angle bracket), @code{>>} operator (I/O) @cindex right angle bracket (@code{>}), @code{>>} operator (I/O) @cindex operators, input/output @cindex @code{|} (vertical bar), @code{|} operator (I/O) @cindex vertical bar (@code{|}), @code{|} operator (I/O) @cindex operators, input/output @cindex @code{|} (vertical bar), @code{|&} operator (I/O) @cindex vertical bar (@code{|}), @code{|&} operator (I/O) @cindex operators, input/output @item < <= == != > >= >> | |& Relational and redirection. The relational operators and the redirections have the same precedence level. Characters such as @samp{>} serve both as relationals and as redirections; the context distinguishes between the two meanings. @cindex @code{print} statement, I/O operators in @cindex @code{printf} statement, I/O operators in Note that the I/O redirection operators in @code{print} and @code{printf} statements belong to the statement level, not to expressions. The redirection does not produce an expression that could be the operand of another operator. As a result, it does not make sense to use a redirection operator near another operator of lower precedence without parentheses. Such combinations (for example, @samp{print foo > a ? b : c}), result in syntax errors. The correct way to write this statement is @samp{print foo > (a ? b : c)}. @cindex @code{~} (tilde), @code{~} operator @cindex tilde (@code{~}), @code{~} operator @cindex @code{!} (exclamation point), @code{!~} operator @cindex exclamation point (@code{!}), @code{!~} operator @item ~ !~ Matching, nonmatching. @cindex @code{in} operator @item in Array membership. @cindex @code{&} (ampersand), @code{&&} operator @cindex ampersand (@code{&}), @code{&&} operator @item && Logical ``and''. @cindex @code{|} (vertical bar), @code{||} operator @cindex vertical bar (@code{|}), @code{||} operator @item || Logical ``or''. @cindex @code{?} (question mark), @code{?:} operator @cindex question mark (@code{?}), @code{?:} operator @item ?: Conditional. This operator groups right-to-left. @cindex @code{+} (plus sign), @code{+=} operator @cindex plus sign (@code{+}), @code{+=} operator @cindex @code{-} (hyphen), @code{-=} operator @cindex hyphen (@code{-}), @code{-=} operator @cindex @code{*} (asterisk), @code{*=} operator @cindex asterisk (@code{*}), @code{*=} operator @cindex @code{*} (asterisk), @code{**=} operator @cindex asterisk (@code{*}), @code{**=} operator @cindex @code{/} (forward slash), @code{/=} operator @cindex forward slash (@code{/}), @code{/=} operator @cindex @code{%} (percent sign), @code{%=} operator @cindex percent sign (@code{%}), @code{%=} operator @cindex @code{^} (caret), @code{^=} operator @cindex caret (@code{^}), @code{^=} operator @item = += -= *= /= %= ^= **= Assignment. These operators group right-to-left. @end table @cindex POSIX @command{awk}, @code{**} operator and @cindex portability, operators, not in POSIX @command{awk} @quotation NOTE The @samp{|&}, @samp{**}, and @samp{**=} operators are not specified by POSIX. For maximum portability, do not use them. @end quotation @c ENDOFRANGE prec @c ENDOFRANGE oppr @node Locales @section Where You Are Makes A Difference @cindex locale, definition of Modern systems support the notion of @dfn{locales}: a way to tell the system about the local character set and language. Once upon a time, the locale setting used to affect regexp matching (@pxref{Ranges and Locales}), but this is no longer true. Locales can affect record splitting. For the normal case of @samp{RS = "\n"}, the locale is largely irrelevant. For other single-character record separators, setting @samp{LC_ALL=C} in the environment will give you much better performance when reading records. Otherwise, @command{gawk} has to make several function calls, @emph{per input character}, to find the record terminator. According to POSIX, string comparison is also affected by locales (similar to regular expressions). The details are presented in @ref{POSIX String Comparison}. Finally, the locale affects the value of the decimal point character used when @command{gawk} parses input data. This is discussed in detail in @ref{Conversion}. @c ENDOFRANGE exps @node Patterns and Actions @chapter Patterns, Actions, and Variables @c STARTOFRANGE pat @cindex patterns As you have already seen, each @command{awk} statement consists of a pattern with an associated action. This @value{CHAPTER} describes how you build patterns and actions, what kinds of things you can do within actions, and @command{awk}'s built-in variables. The pattern-action rules and the statements available for use within actions form the core of @command{awk} programming. In a sense, everything covered up to here has been the foundation that programs are built on top of. Now it's time to start building something useful. @menu * Pattern Overview:: What goes into a pattern. * Using Shell Variables:: How to use shell variables with @command{awk}. * Action Overview:: What goes into an action. * Statements:: Describes the various control statements in detail. * Built-in Variables:: Summarizes the built-in variables. @end menu @node Pattern Overview @section Pattern Elements @menu * Regexp Patterns:: Using regexps as patterns. * Expression Patterns:: Any expression can be used as a pattern. * Ranges:: Pairs of patterns specify record ranges. * BEGIN/END:: Specifying initialization and cleanup rules. * BEGINFILE/ENDFILE:: Two special patterns for advanced control. * Empty:: The empty pattern, which matches every record. @end menu @cindex patterns, types of Patterns in @command{awk} control the execution of rules---a rule is executed when its pattern matches the current input record. The following is a summary of the types of @command{awk} patterns: @table @code @item /@var{regular expression}/ A regular expression. It matches when the text of the input record fits the regular expression. (@xref{Regexp}.) @item @var{expression} A single expression. It matches when its value is nonzero (if a number) or non-null (if a string). (@xref{Expression Patterns}.) @item @var{pat1}, @var{pat2} A pair of patterns separated by a comma, specifying a range of records. The range includes both the initial record that matches @var{pat1} and the final record that matches @var{pat2}. (@xref{Ranges}.) @item BEGIN @itemx END Special patterns for you to supply startup or cleanup actions for your @command{awk} program. (@xref{BEGIN/END}.) @item BEGINFILE @itemx ENDFILE Special patterns for you to supply startup or cleanup actions to be done on a per file basis. (@xref{BEGINFILE/ENDFILE}.) @item @var{empty} The empty pattern matches every input record. (@xref{Empty}.) @end table @node Regexp Patterns @subsection Regular Expressions as Patterns @cindex patterns, expressions as @cindex regular expressions, as patterns Regular expressions are one of the first kinds of patterns presented in this book. This kind of pattern is simply a regexp constant in the pattern part of a rule. Its meaning is @samp{$0 ~ /@var{pattern}/}. The pattern matches when the input record matches the regexp. For example: @example /foo|bar|baz/ @{ buzzwords++ @} END @{ print buzzwords, "buzzwords seen" @} @end example @node Expression Patterns @subsection Expressions as Patterns @cindex expressions, as patterns Any @command{awk} expression is valid as an @command{awk} pattern. The pattern matches if the expression's value is nonzero (if a number) or non-null (if a string). The expression is reevaluated each time the rule is tested against a new input record. If the expression uses fields such as @code{$1}, the value depends directly on the new input record's text; otherwise, it depends on only what has happened so far in the execution of the @command{awk} program. @cindex comparison expressions, as patterns @cindex patterns, comparison expressions as Comparison expressions, using the comparison operators described in @ref{Typing and Comparison}, are a very common kind of pattern. Regexp matching and nonmatching are also very common expressions. The left operand of the @samp{~} and @samp{!~} operators is a string. The right operand is either a constant regular expression enclosed in slashes (@code{/@var{regexp}/}), or any expression whose string value is used as a dynamic regular expression (@pxref{Computed Regexps}). The following example prints the second field of each input record whose first field is precisely @samp{foo}: @cindex @code{/} (forward slash), patterns and @cindex forward slash (@code{/}), patterns and @cindex @code{~} (tilde), @code{~} operator @cindex tilde (@code{~}), @code{~} operator @cindex @code{!} (exclamation point), @code{!~} operator @cindex exclamation point (@code{!}), @code{!~} operator @example $ @kbd{awk '$1 == "foo" @{ print $2 @}' BBS-list} @end example @noindent (There is no output, because there is no BBS site with the exact name @samp{foo}.) Contrast this with the following regular expression match, which accepts any record with a first field that contains @samp{foo}: @example $ @kbd{awk '$1 ~ /foo/ @{ print $2 @}' BBS-list} @print{} 555-1234 @print{} 555-6699 @print{} 555-6480 @print{} 555-2127 @end example @cindex regexp constants, as patterns @cindex patterns, regexp constants as A regexp constant as a pattern is also a special case of an expression pattern. The expression @code{/foo/} has the value one if @samp{foo} appears in the current input record. Thus, as a pattern, @code{/foo/} matches any record containing @samp{foo}. @cindex Boolean expressions, as patterns Boolean expressions are also commonly used as patterns. Whether the pattern matches an input record depends on whether its subexpressions match. For example, the following command prints all the records in @file{BBS-list} that contain both @samp{2400} and @samp{foo}: @example $ @kbd{awk '/2400/ && /foo/' BBS-list} @print{} fooey 555-1234 2400/1200/300 B @end example The following command prints all records in @file{BBS-list} that contain @emph{either} @samp{2400} or @samp{foo} (or both, of course): @example $ @kbd{awk '/2400/ || /foo/' BBS-list} @print{} alpo-net 555-3412 2400/1200/300 A @print{} bites 555-1675 2400/1200/300 A @print{} fooey 555-1234 2400/1200/300 B @print{} foot 555-6699 1200/300 B @print{} macfoo 555-6480 1200/300 A @print{} sdace 555-3430 2400/1200/300 A @print{} sabafoo 555-2127 1200/300 C @end example The following command prints all records in @file{BBS-list} that do @emph{not} contain the string @samp{foo}: @example $ @kbd{awk '! /foo/' BBS-list} @print{} aardvark 555-5553 1200/300 B @print{} alpo-net 555-3412 2400/1200/300 A @print{} barfly 555-7685 1200/300 A @print{} bites 555-1675 2400/1200/300 A @print{} camelot 555-0542 300 C @print{} core 555-2912 1200/300 C @print{} sdace 555-3430 2400/1200/300 A @end example @cindex @code{BEGIN} pattern, Boolean patterns and @cindex @code{END} pattern, Boolean patterns and @cindex @code{BEGINFILE} pattern, Boolean patterns and @cindex @code{ENDFILE} pattern, Boolean patterns and The subexpressions of a Boolean operator in a pattern can be constant regular expressions, comparisons, or any other @command{awk} expressions. Range patterns are not expressions, so they cannot appear inside Boolean patterns. Likewise, the special patterns @code{BEGIN}, @code{END}, @code{BEGINFILE} and @code{ENDFILE}, which never match any input record, are not expressions and cannot appear inside Boolean patterns. The precedence of the different operators which can appear in patterns is described in @ref{Precedence}. @node Ranges @subsection Specifying Record Ranges with Patterns @cindex range patterns @cindex patterns, ranges in @cindex lines, matching ranges of @cindex @code{,} (comma), in range patterns @cindex comma (@code{,}), in range patterns A @dfn{range pattern} is made of two patterns separated by a comma, in the form @samp{@var{begpat}, @var{endpat}}. It is used to match ranges of consecutive input records. The first pattern, @var{begpat}, controls where the range begins, while @var{endpat} controls where the pattern ends. For example, the following: @example awk '$1 == "on", $1 == "off"' myfile @end example @noindent prints every record in @file{myfile} between @samp{on}/@samp{off} pairs, inclusive. A range pattern starts out by matching @var{begpat} against every input record. When a record matches @var{begpat}, the range pattern is @dfn{turned on} and the range pattern matches this record as well. As long as the range pattern stays turned on, it automatically matches every input record read. The range pattern also matches @var{endpat} against every input record; when this succeeds, the range pattern is turned off again for the following record. Then the range pattern goes back to checking @var{begpat} against each record. @cindex @code{if} statement, actions@comma{} changing The record that turns on the range pattern and the one that turns it off both match the range pattern. If you don't want to operate on these records, you can write @code{if} statements in the rule's action to distinguish them from the records you are interested in. It is possible for a pattern to be turned on and off by the same record. If the record satisfies both conditions, then the action is executed for just that record. For example, suppose there is text between two identical markers (e.g., the @samp{%} symbol), each on its own line, that should be ignored. A first attempt would be to combine a range pattern that describes the delimited text with the @code{next} statement (not discussed yet, @pxref{Next Statement}). This causes @command{awk} to skip any further processing of the current record and start over again with the next input record. Such a program looks like this: @example /^%$/,/^%$/ @{ next @} @{ print @} @end example @noindent @cindex lines, skipping between markers @c @cindex flag variables This program fails because the range pattern is both turned on and turned off by the first line, which just has a @samp{%} on it. To accomplish this task, write the program in the following manner, using a flag: @cindex @code{!} (exclamation point), @code{!} operator @example /^%$/ @{ skip = ! skip; next @} skip == 1 @{ next @} # skip lines with `skip' set @end example In a range pattern, the comma (@samp{,}) has the lowest precedence of all the operators (i.e., it is evaluated last). Thus, the following program attempts to combine a range pattern with another, simpler test: @example echo Yes | awk '/1/,/2/ || /Yes/' @end example The intent of this program is @samp{(/1/,/2/) || /Yes/}. However, @command{awk} interprets this as @samp{/1/, (/2/ || /Yes/)}. This cannot be changed or worked around; range patterns do not combine with other patterns: @example $ @kbd{echo Yes | gawk '(/1/,/2/) || /Yes/'} @error{} gawk: cmd. line:1: (/1/,/2/) || /Yes/ @error{} gawk: cmd. line:1: ^ syntax error @end example @node BEGIN/END @subsection The @code{BEGIN} and @code{END} Special Patterns @c STARTOFRANGE beg @cindex @code{BEGIN} pattern @c STARTOFRANGE end @cindex @code{END} pattern All the patterns described so far are for matching input records. The @code{BEGIN} and @code{END} special patterns are different. They supply startup and cleanup actions for @command{awk} programs. @code{BEGIN} and @code{END} rules must have actions; there is no default action for these rules because there is no current record when they run. @code{BEGIN} and @code{END} rules are often referred to as ``@code{BEGIN} and @code{END} blocks'' by long-time @command{awk} programmers. @menu * Using BEGIN/END:: How and why to use BEGIN/END rules. * I/O And BEGIN/END:: I/O issues in BEGIN/END rules. @end menu @node Using BEGIN/END @subsubsection Startup and Cleanup Actions A @code{BEGIN} rule is executed once only, before the first input record is read. Likewise, an @code{END} rule is executed once only, after all the input is read. For example: @example $ @kbd{awk '} > @kbd{BEGIN @{ print "Analysis of \"foo\"" @}} > @kbd{/foo/ @{ ++n @}} > @kbd{END @{ print "\"foo\" appears", n, "times." @}' BBS-list} @print{} Analysis of "foo" @print{} "foo" appears 4 times. @end example @cindex @code{BEGIN} pattern, operators and @cindex @code{END} pattern, operators and This program finds the number of records in the input file @file{BBS-list} that contain the string @samp{foo}. The @code{BEGIN} rule prints a title for the report. There is no need to use the @code{BEGIN} rule to initialize the counter @code{n} to zero, since @command{awk} does this automatically (@pxref{Variables}). The second rule increments the variable @code{n} every time a record containing the pattern @samp{foo} is read. The @code{END} rule prints the value of @code{n} at the end of the run. The special patterns @code{BEGIN} and @code{END} cannot be used in ranges or with Boolean operators (indeed, they cannot be used with any operators). An @command{awk} program may have multiple @code{BEGIN} and/or @code{END} rules. They are executed in the order in which they appear: all the @code{BEGIN} rules at startup and all the @code{END} rules at termination. @code{BEGIN} and @code{END} rules may be intermixed with other rules. This feature was added in the 1987 version of @command{awk} and is included in the POSIX standard. The original (1978) version of @command{awk} required the @code{BEGIN} rule to be placed at the beginning of the program, the @code{END} rule to be placed at the end, and only allowed one of each. This is no longer required, but it is a good idea to follow this template in terms of program organization and readability. Multiple @code{BEGIN} and @code{END} rules are useful for writing library functions, because each library file can have its own @code{BEGIN} and/or @code{END} rule to do its own initialization and/or cleanup. The order in which library functions are named on the command line controls the order in which their @code{BEGIN} and @code{END} rules are executed. Therefore, you have to be careful when writing such rules in library files so that the order in which they are executed doesn't matter. @xref{Options}, for more information on using library functions. @xref{Library Functions}, for a number of useful library functions. If an @command{awk} program has only @code{BEGIN} rules and no other rules, then the program exits after the @code{BEGIN} rule is run.@footnote{The original version of @command{awk} kept reading and ignoring input until the end of the file was seen.} However, if an @code{END} rule exists, then the input is read, even if there are no other rules in the program. This is necessary in case the @code{END} rule checks the @code{FNR} and @code{NR} variables. @node I/O And BEGIN/END @subsubsection Input/Output from @code{BEGIN} and @code{END} Rules @cindex input/output, from @code{BEGIN} and @code{END} There are several (sometimes subtle) points to remember when doing I/O from a @code{BEGIN} or @code{END} rule. The first has to do with the value of @code{$0} in a @code{BEGIN} rule. Because @code{BEGIN} rules are executed before any input is read, there simply is no input record, and therefore no fields, when executing @code{BEGIN} rules. References to @code{$0} and the fields yield a null string or zero, depending upon the context. One way to give @code{$0} a real value is to execute a @code{getline} command without a variable (@pxref{Getline}). Another way is simply to assign a value to @code{$0}. @cindex differences in @command{awk} and @command{gawk}, @code{BEGIN}/@code{END} patterns @cindex POSIX @command{awk}, @code{BEGIN}/@code{END} patterns @cindex @code{print} statement, @code{BEGIN}/@code{END} patterns and @cindex @code{BEGIN} pattern, @code{print} statement and @cindex @code{END} pattern, @code{print} statement and The second point is similar to the first but from the other direction. Traditionally, due largely to implementation issues, @code{$0} and @code{NF} were @emph{undefined} inside an @code{END} rule. The POSIX standard specifies that @code{NF} is available in an @code{END} rule. It contains the number of fields from the last input record. Most probably due to an oversight, the standard does not say that @code{$0} is also preserved, although logically one would think that it should be. In fact, @command{gawk} does preserve the value of @code{$0} for use in @code{END} rules. Be aware, however, that Brian Kernighan's @command{awk}, and possibly other implementations, do not. The third point follows from the first two. The meaning of @samp{print} inside a @code{BEGIN} or @code{END} rule is the same as always: @samp{print $0}. If @code{$0} is the null string, then this prints an empty record. Many long time @command{awk} programmers use an unadorned @samp{print} in @code{BEGIN} and @code{END} rules, to mean @samp{@w{print ""}}, relying on @code{$0} being null. Although one might generally get away with this in @code{BEGIN} rules, it is a very bad idea in @code{END} rules, at least in @command{gawk}. It is also poor style, since if an empty line is needed in the output, the program should print one explicitly. @cindex @code{next} statement, @code{BEGIN}/@code{END} patterns and @cindex @code{nextfile} statement, @code{BEGIN}/@code{END} patterns and @cindex @code{BEGIN} pattern, @code{next}/@code{nextfile} statements and @cindex @code{END} pattern, @code{next}/@code{nextfile} statements and Finally, the @code{next} and @code{nextfile} statements are not allowed in a @code{BEGIN} rule, because the implicit read-a-record-and-match-against-the-rules loop has not started yet. Similarly, those statements are not valid in an @code{END} rule, since all the input has been read. (@xref{Next Statement}, and see @ref{Nextfile Statement}.) @c ENDOFRANGE beg @c ENDOFRANGE end @node BEGINFILE/ENDFILE @subsection The @code{BEGINFILE} and @code{ENDFILE} Special Patterns @cindex @code{BEGINFILE} pattern @cindex @code{ENDFILE} pattern This @value{SECTION} describes a @command{gawk}-specific feature. Two special kinds of rule, @code{BEGINFILE} and @code{ENDFILE}, give you ``hooks'' into @command{gawk}'s command-line file processing loop. As with the @code{BEGIN} and @code{END} rules (@pxref{BEGIN/END}), all @code{BEGINFILE} rules in a program are merged, in the order they are read by @command{gawk}, and all @code{ENDFILE} rules are merged as well. The body of the @code{BEGINFILE} rules is executed just before @command{gawk} reads the first record from a file. @code{FILENAME} is set to the name of the current file, and @code{FNR} is set to zero. The @code{BEGINFILE} rule provides you the opportunity for two tasks that would otherwise be difficult or impossible to perform: @itemize @bullet @item You can test if the file is readable. Normally, it is a fatal error if a file named on the command line cannot be opened for reading. However, you can bypass the fatal error and move on to the next file on the command line. @cindex @command{gawk}, @code{ERRNO} variable in @cindex @code{ERRNO} variable @cindex @code{nextfile} statement, @code{BEGINFILE}/@code{ENDFILE} patterns and You do this by checking if the @code{ERRNO} variable is not the empty string; if so, then @command{gawk} was not able to open the file. In this case, your program can execute the @code{nextfile} statement (@pxref{Nextfile Statement}). This causes @command{gawk} to skip the file entirely. Otherwise, @command{gawk} exits with the usual fatal error. @item If you have written extensions that modify the record handling (by inserting an ``open hook''), you can invoke them at this point, before @command{gawk} has started processing the file. (This is a @emph{very} advanced feature, currently used only by the @uref{http://xmlgawk.sourceforge.net, XMLgawk project}.) @end itemize The @code{ENDFILE} rule is called when @command{gawk} has finished processing the last record in an input file. For the last input file, it will be called before any @code{END} rules. The @code{ENDFILE} rule is executed even for empty input files. Normally, when an error occurs when reading input in the normal input processing loop, the error is fatal. However, if an @code{ENDFILE} rule is present, the error becomes non-fatal, and instead @code{ERRNO} is set. This makes it possible to catch and process I/O errors at the level of the @command{awk} program. @cindex @code{next} statement, @code{BEGINFILE}/@code{ENDFILE} patterns and The @code{next} statement (@pxref{Next Statement}) is not allowed inside either a @code{BEGINFILE} or and @code{ENDFILE} rule. The @code{nextfile} statement (@pxref{Nextfile Statement}) is allowed only inside a @code{BEGINFILE} rule, but not inside an @code{ENDFILE} rule. @cindex @code{getline} statement, @code{BEGINFILE}/@code{ENDFILE} patterns and The @code{getline} statement (@pxref{Getline}) is restricted inside both @code{BEGINFILE} and @code{ENDFILE}. Only the @samp{getline @var{variable} < @var{file}} form is allowed. @code{BEGINFILE} and @code{ENDFILE} are @command{gawk} extensions. In most other @command{awk} implementations, or if @command{gawk} is in compatibility mode (@pxref{Options}), they are not special. @c FIXME: For 4.1 maybe deal with this? @ignore Date: Tue, 17 May 2011 02:06:10 PDT From: rankin@pactechdata.com (Pat Rankin) Message-Id: <110517015127.20240f4a@pactechdata.com> Subject: BEGINFILE To: arnold@skeeve.com The documentation for BEGINFILE states that FNR is 0, which seems pretty obvious. It doesn't mention what the value of $0 is, and that's not obvious. I think setting it to null before starting the BEGINFILE action would be preferable to leaving whatever was there in the last record of the previous file. ENDFILE can retain the last record in $0. I guess it has to if the END rule's actions see that value too. But the beginning of a new file doesn't just mean that the old one has been closed; the old file is being superseded, so leaving the old data around feels wrong to me. [If the user wants to keep it on hand, he or she can use an ENDFILE rule to grab it before moving on to the next file.] @end ignore @node Empty @subsection The Empty Pattern @cindex empty pattern @cindex patterns, empty An empty (i.e., nonexistent) pattern is considered to match @emph{every} input record. For example, the program: @example awk '@{ print $1 @}' BBS-list @end example @noindent prints the first field of every record. @c ENDOFRANGE pat @node Using Shell Variables @section Using Shell Variables in Programs @cindex shells, variables @cindex @command{awk} programs, shell variables in @c @cindex shell and @command{awk} interaction @command{awk} programs are often used as components in larger programs written in shell. For example, it is very common to use a shell variable to hold a pattern that the @command{awk} program searches for. There are two ways to get the value of the shell variable into the body of the @command{awk} program. @cindex shells, quoting The most common method is to use shell quoting to substitute the variable's value into the program inside the script. For example, in the following program: @example printf "Enter search pattern: " read pattern awk "/$pattern/ "'@{ nmatches++ @} END @{ print nmatches, "found" @}' /path/to/data @end example @noindent the @command{awk} program consists of two pieces of quoted text that are concatenated together to form the program. The first part is double-quoted, which allows substitution of the @code{pattern} shell variable inside the quotes. The second part is single-quoted. Variable substitution via quoting works, but can be potentially messy. It requires a good understanding of the shell's quoting rules (@pxref{Quoting}), and it's often difficult to correctly match up the quotes when reading the program. A better method is to use @command{awk}'s variable assignment feature (@pxref{Assignment Options}) to assign the shell variable's value to an @command{awk} variable's value. Then use dynamic regexps to match the pattern (@pxref{Computed Regexps}). The following shows how to redo the previous example using this technique: @example printf "Enter search pattern: " read pattern awk -v pat="$pattern" '$0 ~ pat @{ nmatches++ @} END @{ print nmatches, "found" @}' /path/to/data @end example @noindent Now, the @command{awk} program is just one single-quoted string. The assignment @samp{-v pat="$pattern"} still requires double quotes, in case there is whitespace in the value of @code{$pattern}. The @command{awk} variable @code{pat} could be named @code{pattern} too, but that would be more confusing. Using a variable also provides more flexibility, since the variable can be used anywhere inside the program---for printing, as an array subscript, or for any other use---without requiring the quoting tricks at every point in the program. @node Action Overview @section Actions @c @cindex action, definition of @c @cindex curly braces @c @cindex action, curly braces @c @cindex action, separating statements @cindex actions An @command{awk} program or script consists of a series of rules and function definitions interspersed. (Functions are described later. @xref{User-defined}.) A rule contains a pattern and an action, either of which (but not both) may be omitted. The purpose of the @dfn{action} is to tell @command{awk} what to do once a match for the pattern is found. Thus, in outline, an @command{awk} program generally looks like this: @example @r{[}@var{pattern}@r{]} @{ @var{action} @} @var{pattern} @r{[}@{ @var{action} @}@r{]} @dots{} function @var{name}(@var{args}) @{ @dots{} @} @dots{} @end example @cindex @code{@{@}} (braces), actions and @cindex braces (@code{@{@}}), actions and @cindex separators, for statements in actions @cindex newlines, separating statements in actions @cindex @code{;} (semicolon), separating statements in actions @cindex semicolon (@code{;}), separating statements in actions An action consists of one or more @command{awk} @dfn{statements}, enclosed in curly braces (@samp{@{@dots{}@}}). Each statement specifies one thing to do. The statements are separated by newlines or semicolons. The curly braces around an action must be used even if the action contains only one statement, or if it contains no statements at all. However, if you omit the action entirely, omit the curly braces as well. An omitted action is equivalent to @samp{@{ print $0 @}}: @example /foo/ @{ @} @ii{match @code{foo}, do nothing --- empty action} /foo/ @ii{match @code{foo}, print the record --- omitted action} @end example The following types of statements are supported in @command{awk}: @table @asis @cindex side effects, statements @item Expressions Call functions or assign values to variables (@pxref{Expressions}). Executing this kind of statement simply computes the value of the expression. This is useful when the expression has side effects (@pxref{Assignment Ops}). @item Control statements Specify the control flow of @command{awk} programs. The @command{awk} language gives you C-like constructs (@code{if}, @code{for}, @code{while}, and @code{do}) as well as a few special ones (@pxref{Statements}). @item Compound statements Consist of one or more statements enclosed in curly braces. A compound statement is used in order to put several statements together in the body of an @code{if}, @code{while}, @code{do}, or @code{for} statement. @item Input statements Use the @code{getline} command (@pxref{Getline}). Also supplied in @command{awk} are the @code{next} statement (@pxref{Next Statement}), and the @code{nextfile} statement (@pxref{Nextfile Statement}). @item Output statements Such as @code{print} and @code{printf}. @xref{Printing}. @item Deletion statements For deleting array elements. @xref{Delete}. @end table @node Statements @section Control Statements in Actions @c STARTOFRANGE csta @cindex control statements @c STARTOFRANGE acs @cindex statements, control, in actions @c STARTOFRANGE accs @cindex actions, control statements in @dfn{Control statements}, such as @code{if}, @code{while}, and so on, control the flow of execution in @command{awk} programs. Most of @command{awk}'s control statements are patterned after similar statements in C. @cindex compound statements@comma{} control statements and @cindex statements, compound@comma{} control statements and @cindex body, in actions @cindex @code{@{@}} (braces), statements, grouping @cindex braces (@code{@{@}}), statements, grouping @cindex newlines, separating statements in actions @cindex @code{;} (semicolon), separating statements in actions @cindex semicolon (@code{;}), separating statements in actions All the control statements start with special keywords, such as @code{if} and @code{while}, to distinguish them from simple expressions. Many control statements contain other statements. For example, the @code{if} statement contains another statement that may or may not be executed. The contained statement is called the @dfn{body}. To include more than one statement in the body, group them into a single @dfn{compound statement} with curly braces, separating them with newlines or semicolons. @menu * If Statement:: Conditionally execute some @command{awk} statements. * While Statement:: Loop until some condition is satisfied. * Do Statement:: Do specified action while looping until some condition is satisfied. * For Statement:: Another looping statement, that provides initialization and increment clauses. * Switch Statement:: Switch/case evaluation for conditional execution of statements based on a value. * Break Statement:: Immediately exit the innermost enclosing loop. * Continue Statement:: Skip to the end of the innermost enclosing loop. * Next Statement:: Stop processing the current input record. * Nextfile Statement:: Stop processing the current file. * Exit Statement:: Stop execution of @command{awk}. @end menu @node If Statement @subsection The @code{if}-@code{else} Statement @cindex @code{if} statement The @code{if}-@code{else} statement is @command{awk}'s decision-making statement. It looks like this: @example if (@var{condition}) @var{then-body} @r{[}else @var{else-body}@r{]} @end example @noindent The @var{condition} is an expression that controls what the rest of the statement does. If the @var{condition} is true, @var{then-body} is executed; otherwise, @var{else-body} is executed. The @code{else} part of the statement is optional. The condition is considered false if its value is zero or the null string; otherwise, the condition is true. Refer to the following: @example if (x % 2 == 0) print "x is even" else print "x is odd" @end example In this example, if the expression @samp{x % 2 == 0} is true (that is, if the value of @code{x} is evenly divisible by two), then the first @code{print} statement is executed; otherwise, the second @code{print} statement is executed. If the @code{else} keyword appears on the same line as @var{then-body} and @var{then-body} is not a compound statement (i.e., not surrounded by curly braces), then a semicolon must separate @var{then-body} from the @code{else}. To illustrate this, the previous example can be rewritten as: @example if (x % 2 == 0) print "x is even"; else print "x is odd" @end example @noindent If the @samp{;} is left out, @command{awk} can't interpret the statement and it produces a syntax error. Don't actually write programs this way, because a human reader might fail to see the @code{else} if it is not the first thing on its line. @node While Statement @subsection The @code{while} Statement @cindex @code{while} statement @cindex loops @cindex loops, See Also @code{while} statement In programming, a @dfn{loop} is a part of a program that can be executed two or more times in succession. The @code{while} statement is the simplest looping statement in @command{awk}. It repeatedly executes a statement as long as a condition is true. For example: @example while (@var{condition}) @var{body} @end example @cindex body, in loops @noindent @var{body} is a statement called the @dfn{body} of the loop, and @var{condition} is an expression that controls how long the loop keeps running. The first thing the @code{while} statement does is test the @var{condition}. If the @var{condition} is true, it executes the statement @var{body}. @ifinfo (The @var{condition} is true when the value is not zero and not a null string.) @end ifinfo After @var{body} has been executed, @var{condition} is tested again, and if it is still true, @var{body} is executed again. This process repeats until the @var{condition} is no longer true. If the @var{condition} is initially false, the body of the loop is never executed and @command{awk} continues with the statement following the loop. This example prints the first three fields of each record, one per line: @example awk '@{ i = 1 while (i <= 3) @{ print $i i++ @} @}' inventory-shipped @end example @noindent The body of this loop is a compound statement enclosed in braces, containing two statements. The loop works in the following manner: first, the value of @code{i} is set to one. Then, the @code{while} statement tests whether @code{i} is less than or equal to three. This is true when @code{i} equals one, so the @code{i}-th field is printed. Then the @samp{i++} increments the value of @code{i} and the loop repeats. The loop terminates when @code{i} reaches four. A newline is not required between the condition and the body; however using one makes the program clearer unless the body is a compound statement or else is very simple. The newline after the open-brace that begins the compound statement is not required either, but the program is harder to read without it. @node Do Statement @subsection The @code{do}-@code{while} Statement @cindex @code{do}-@code{while} statement The @code{do} loop is a variation of the @code{while} looping statement. The @code{do} loop executes the @var{body} once and then repeats the @var{body} as long as the @var{condition} is true. It looks like this: @example do @var{body} while (@var{condition}) @end example Even if the @var{condition} is false at the start, the @var{body} is executed at least once (and only once, unless executing @var{body} makes @var{condition} true). Contrast this with the corresponding @code{while} statement: @example while (@var{condition}) @var{body} @end example @noindent This statement does not execute @var{body} even once if the @var{condition} is false to begin with. The following is an example of a @code{do} statement: @example @{ i = 1 do @{ print $0 i++ @} while (i <= 10) @} @end example @noindent This program prints each input record 10 times. However, it isn't a very realistic example, since in this case an ordinary @code{while} would do just as well. This situation reflects actual experience; only occasionally is there a real use for a @code{do} statement. @node For Statement @subsection The @code{for} Statement @cindex @code{for} statement The @code{for} statement makes it more convenient to count iterations of a loop. The general form of the @code{for} statement looks like this: @example for (@var{initialization}; @var{condition}; @var{increment}) @var{body} @end example @noindent The @var{initialization}, @var{condition}, and @var{increment} parts are arbitrary @command{awk} expressions, and @var{body} stands for any @command{awk} statement. The @code{for} statement starts by executing @var{initialization}. Then, as long as the @var{condition} is true, it repeatedly executes @var{body} and then @var{increment}. Typically, @var{initialization} sets a variable to either zero or one, @var{increment} adds one to it, and @var{condition} compares it against the desired number of iterations. For example: @example awk '@{ for (i = 1; i <= 3; i++) print $i @}' inventory-shipped @end example @noindent This prints the first three fields of each input record, with one field per line. It isn't possible to set more than one variable in the @var{initialization} part without using a multiple assignment statement such as @samp{x = y = 0}. This makes sense only if all the initial values are equal. (But it is possible to initialize additional variables by writing their assignments as separate statements preceding the @code{for} loop.) @c @cindex comma operator, not supported The same is true of the @var{increment} part. Incrementing additional variables requires separate statements at the end of the loop. The C compound expression, using C's comma operator, is useful in this context but it is not supported in @command{awk}. Most often, @var{increment} is an increment expression, as in the previous example. But this is not required; it can be any expression whatsoever. For example, the following statement prints all the powers of two between 1 and 100: @example for (i = 1; i <= 100; i *= 2) print i @end example If there is nothing to be done, any of the three expressions in the parentheses following the @code{for} keyword may be omitted. Thus, @w{@samp{for (; x > 0;)}} is equivalent to @w{@samp{while (x > 0)}}. If the @var{condition} is omitted, it is treated as true, effectively yielding an @dfn{infinite loop} (i.e., a loop that never terminates). In most cases, a @code{for} loop is an abbreviation for a @code{while} loop, as shown here: @example @var{initialization} while (@var{condition}) @{ @var{body} @var{increment} @} @end example @cindex loops, @code{continue} statements and @noindent The only exception is when the @code{continue} statement (@pxref{Continue Statement}) is used inside the loop. Changing a @code{for} statement to a @code{while} statement in this way can change the effect of the @code{continue} statement inside the loop. The @command{awk} language has a @code{for} statement in addition to a @code{while} statement because a @code{for} loop is often both less work to type and more natural to think of. Counting the number of iterations is very common in loops. It can be easier to think of this counting as part of looping rather than as something to do inside the loop. @cindex @code{in} operator There is an alternate version of the @code{for} loop, for iterating over all the indices of an array: @example for (i in array) @var{do something with} array[i] @end example @noindent @xref{Scanning an Array}, for more information on this version of the @code{for} loop. @node Switch Statement @subsection The @code{switch} Statement @cindex @code{switch} statement @cindex @code{case} keyword @cindex @code{default} keyword The @code{switch} statement allows the evaluation of an expression and the execution of statements based on a @code{case} match. Case statements are checked for a match in the order they are defined. If no suitable @code{case} is found, the @code{default} section is executed, if supplied. Each @code{case} contains a single constant, be it numeric, string, or regexp. The @code{switch} expression is evaluated, and then each @code{case}'s constant is compared against the result in turn. The type of constant determines the comparison: numeric or string do the usual comparisons. A regexp constant does a regular expression match against the string value of the original expression. The general form of the @code{switch} statement looks like this: @example switch (@var{expression}) @{ case @var{value or regular expression}: @var{case-body} default: @var{default-body} @} @end example Control flow in the @code{switch} statement works as it does in C. Once a match to a given case is made, the case statement bodies execute until a @code{break}, @code{continue}, @code{next}, @code{nextfile} or @code{exit} is encountered, or the end of the @code{switch} statement itself. For example: @example switch (NR * 2 + 1) @{ case 3: case "11": print NR - 1 break case /2[[:digit:]]+/: print NR default: print NR + 1 case -1: print NR * -1 @} @end example Note that if none of the statements specified above halt execution of a matched @code{case} statement, execution falls through to the next @code{case} until execution halts. In the above example, for any case value starting with @samp{2} followed by one or more digits, the @code{print} statement is executed and then falls through into the @code{default} section, executing its @code{print} statement. In turn, the @minus{}1 case will also be executed since the @code{default} does not halt execution. This @code{switch} statement is a @command{gawk} extension. If @command{gawk} is in compatibility mode (@pxref{Options}), it is not available. @node Break Statement @subsection The @code{break} Statement @cindex @code{break} statement @cindex loops, exiting The @code{break} statement jumps out of the innermost @code{for}, @code{while}, or @code{do} loop that encloses it. The following example finds the smallest divisor of any integer, and also identifies prime numbers: @example # find smallest divisor of num @{ num = $1 for (div = 2; div * div <= num; div++) @{ if (num % div == 0) break @} if (num % div == 0) printf "Smallest divisor of %d is %d\n", num, div else printf "%d is prime\n", num @} @end example When the remainder is zero in the first @code{if} statement, @command{awk} immediately @dfn{breaks out} of the containing @code{for} loop. This means that @command{awk} proceeds immediately to the statement following the loop and continues processing. (This is very different from the @code{exit} statement, which stops the entire @command{awk} program. @xref{Exit Statement}.) The following program illustrates how the @var{condition} of a @code{for} or @code{while} statement could be replaced with a @code{break} inside an @code{if}: @example # find smallest divisor of num @{ num = $1 for (div = 2; ; div++) @{ if (num % div == 0) @{ printf "Smallest divisor of %d is %d\n", num, div break @} if (div * div > num) @{ printf "%d is prime\n", num break @} @} @} @end example The @code{break} statement is also used to break out of the @code{switch} statement. This is discussed in @ref{Switch Statement}. @c @cindex @code{break}, outside of loops @c @cindex historical features @c @cindex @command{awk} language, POSIX version @cindex POSIX @command{awk}, @code{break} statement and @cindex dark corner, @code{break} statement @cindex @command{gawk}, @code{break} statement in The @code{break} statement has no meaning when used outside the body of a loop or @code{switch}. However, although it was never documented, historical implementations of @command{awk} treated the @code{break} statement outside of a loop as if it were a @code{next} statement (@pxref{Next Statement}). @value{DARKCORNER} Recent versions of Brian Kernighan's @command{awk} no longer allow this usage, nor does @command{gawk}. @node Continue Statement @subsection The @code{continue} Statement @cindex @code{continue} statement Similar to @code{break}, the @code{continue} statement is used only inside @code{for}, @code{while}, and @code{do} loops. It skips over the rest of the loop body, causing the next cycle around the loop to begin immediately. Contrast this with @code{break}, which jumps out of the loop altogether. The @code{continue} statement in a @code{for} loop directs @command{awk} to skip the rest of the body of the loop and resume execution with the increment-expression of the @code{for} statement. The following program illustrates this fact: @example BEGIN @{ for (x = 0; x <= 20; x++) @{ if (x == 5) continue printf "%d ", x @} print "" @} @end example @noindent This program prints all the numbers from 0 to 20---except for 5, for which the @code{printf} is skipped. Because the increment @samp{x++} is not skipped, @code{x} does not remain stuck at 5. Contrast the @code{for} loop from the previous example with the following @code{while} loop: @example BEGIN @{ x = 0 while (x <= 20) @{ if (x == 5) continue printf "%d ", x x++ @} print "" @} @end example @noindent This program loops forever once @code{x} reaches 5. @c @cindex @code{continue}, outside of loops @c @cindex historical features @c @cindex @command{awk} language, POSIX version @cindex POSIX @command{awk}, @code{continue} statement and @cindex dark corner, @code{continue} statement @cindex @command{gawk}, @code{continue} statement in The @code{continue} statement has no special meaning with respect to the @code{switch} statement, nor does it have any meaning when used outside the body of a loop. Historical versions of @command{awk} treated a @code{continue} statement outside a loop the same way they treated a @code{break} statement outside a loop: as if it were a @code{next} statement (@pxref{Next Statement}). @value{DARKCORNER} Recent versions of Brian Kernighan's @command{awk} no longer work this way, nor does @command{gawk}. @node Next Statement @subsection The @code{next} Statement @cindex @code{next} statement The @code{next} statement forces @command{awk} to immediately stop processing the current record and go on to the next record. This means that no further rules are executed for the current record, and the rest of the current rule's action isn't executed. Contrast this with the effect of the @code{getline} function (@pxref{Getline}). That also causes @command{awk} to read the next record immediately, but it does not alter the flow of control in any way (i.e., the rest of the current action executes with a new input record). @cindex @command{awk} programs, execution of At the highest level, @command{awk} program execution is a loop that reads an input record and then tests each rule's pattern against it. If you think of this loop as a @code{for} statement whose body contains the rules, then the @code{next} statement is analogous to a @code{continue} statement. It skips to the end of the body of this implicit loop and executes the increment (which reads another record). For example, suppose an @command{awk} program works only on records with four fields, and it shouldn't fail when given bad input. To avoid complicating the rest of the program, write a ``weed out'' rule near the beginning, in the following manner: @example NF != 4 @{ err = sprintf("%s:%d: skipped: NF != 4\n", FILENAME, FNR) print err > "/dev/stderr" next @} @end example @noindent Because of the @code{next} statement, the program's subsequent rules won't see the bad record. The error message is redirected to the standard error output stream, as error messages should be. For more detail see @ref{Special Files}. If the @code{next} statement causes the end of the input to be reached, then the code in any @code{END} rules is executed. @xref{BEGIN/END}. The @code{next} statement is not allowed inside @code{BEGINFILE} and @code{ENDFILE} rules. @xref{BEGINFILE/ENDFILE}. @c @cindex @command{awk} language, POSIX version @c @cindex @code{next}, inside a user-defined function @cindex @code{BEGIN} pattern, @code{next}/@code{nextfile} statements and @cindex @code{END} pattern, @code{next}/@code{nextfile} statements and @cindex POSIX @command{awk}, @code{next}/@code{nextfile} statements and @cindex @code{next} statement, user-defined functions and @cindex functions, user-defined, @code{next}/@code{nextfile} statements and According to the POSIX standard, the behavior is undefined if the @code{next} statement is used in a @code{BEGIN} or @code{END} rule. @command{gawk} treats it as a syntax error. Although POSIX permits it, some other @command{awk} implementations don't allow the @code{next} statement inside function bodies (@pxref{User-defined}). Just as with any other @code{next} statement, a @code{next} statement inside a function body reads the next record and starts processing it with the first rule in the program. @node Nextfile Statement @subsection Using @command{gawk}'s @code{nextfile} Statement @cindex @code{nextfile} statement @cindex differences in @command{awk} and @command{gawk}, @code{next}/@code{nextfile} statements @cindex common extensions, @code{nextfile} statement @cindex extensions, common@comma{} @code{nextfile} statement @command{gawk} provides the @code{nextfile} statement, which is similar to the @code{next} statement. @value{COMMONEXT} However, instead of abandoning processing of the current record, the @code{nextfile} statement instructs @command{gawk} to stop processing the current @value{DF}. The @code{nextfile} statement is a @command{gawk} extension. In most other @command{awk} implementations, or if @command{gawk} is in compatibility mode (@pxref{Options}), @code{nextfile} is not special. Upon execution of the @code{nextfile} statement, any @code{ENDFILE} rules are executed except in the case as mentioned below, @code{FILENAME} is updated to the name of the next @value{DF} listed on the command line, @code{FNR} is reset to one, @code{ARGIND} is incremented, any @code{BEGINFILE} rules are executed, and processing starts over with the first rule in the program. (@code{ARGIND} hasn't been introduced yet. @xref{Built-in Variables}.) If the @code{nextfile} statement causes the end of the input to be reached, then the code in any @code{END} rules is executed. An exception to this is when the @code{nextfile} is invoked during execution of any statement in an @code{END} rule; In this case, it causes the program to stop immediately. @xref{BEGIN/END}. The @code{nextfile} statement is useful when there are many @value{DF}s to process but it isn't necessary to process every record in every file. Normally, in order to move on to the next @value{DF}, a program has to continue scanning the unwanted records. The @code{nextfile} statement accomplishes this much more efficiently. In addition, @code{nextfile} is useful inside a @code{BEGINFILE} rule to skip over a file that would otherwise cause @command{gawk} to exit with a fatal error. In this case, @code{ENDFILE} rules are not executed. @xref{BEGINFILE/ENDFILE}. While one might think that @samp{close(FILENAME)} would accomplish the same as @code{nextfile}, this isn't true. @code{close()} is reserved for closing files, pipes, and coprocesses that are opened with redirections. It is not related to the main processing that @command{awk} does with the files listed in @code{ARGV}. @cindex functions, user-defined, @code{next}/@code{nextfile} statements and @cindex @code{nextfile} statement, user-defined functions and The current version of the Brian Kernighan's @command{awk} (@pxref{Other Versions}) also supports @code{nextfile}. However, it doesn't allow the @code{nextfile} statement inside function bodies (@pxref{User-defined}). @command{gawk} does; a @code{nextfile} inside a function body reads the next record and starts processing it with the first rule in the program, just as any other @code{nextfile} statement. @node Exit Statement @subsection The @code{exit} Statement @cindex @code{exit} statement The @code{exit} statement causes @command{awk} to immediately stop executing the current rule and to stop processing input; any remaining input is ignored. The @code{exit} statement is written as follows: @example exit @r{[}@var{return code}@r{]} @end example @cindex @code{BEGIN} pattern, @code{exit} statement and @cindex @code{END} pattern, @code{exit} statement and When an @code{exit} statement is executed from a @code{BEGIN} rule, the program stops processing everything immediately. No input records are read. However, if an @code{END} rule is present, as part of executing the @code{exit} statement, the @code{END} rule is executed (@pxref{BEGIN/END}). If @code{exit} is used in the body of an @code{END} rule, it causes the program to stop immediately. An @code{exit} statement that is not part of a @code{BEGIN} or @code{END} rule stops the execution of any further automatic rules for the current record, skips reading any remaining input records, and executes the @code{END} rule if there is one. Any @code{ENDFILE} rules are also skipped; they are not executed. In such a case, if you don't want the @code{END} rule to do its job, set a variable to nonzero before the @code{exit} statement and check that variable in the @code{END} rule. @xref{Assert Function}, for an example that does this. @cindex dark corner, @code{exit} statement If an argument is supplied to @code{exit}, its value is used as the exit status code for the @command{awk} process. If no argument is supplied, @code{exit} causes @command{awk} to return a ``success'' status. In the case where an argument is supplied to a first @code{exit} statement, and then @code{exit} is called a second time from an @code{END} rule with no argument, @command{awk} uses the previously supplied exit value. @value{DARKCORNER} @xref{Exit Status}, for more information. @cindex programming conventions, @code{exit} statement For example, suppose an error condition occurs that is difficult or impossible to handle. Conventionally, programs report this by exiting with a nonzero status. An @command{awk} program can do this using an @code{exit} statement with a nonzero argument, as shown in the following example: @example BEGIN @{ if (("date" | getline date_now) <= 0) @{ print "Can't get system date" > "/dev/stderr" exit 1 @} print "current date is", date_now close("date") @} @end example @quotation NOTE For full portability, exit values should be between zero and 126, inclusive. Negative values, and values of 127 or greater, may not produce consistent results across different operating systems. @end quotation @c ENDOFRANGE csta @c ENDOFRANGE acs @c ENDOFRANGE accs @node Built-in Variables @section Built-in Variables @c STARTOFRANGE bvar @cindex built-in variables @c STARTOFRANGE varb @cindex variables, built-in Most @command{awk} variables are available to use for your own purposes; they never change unless your program assigns values to them, and they never affect anything unless your program examines them. However, a few variables in @command{awk} have special built-in meanings. @command{awk} examines some of these automatically, so that they enable you to tell @command{awk} how to do certain things. Others are set automatically by @command{awk}, so that they carry information from the internal workings of @command{awk} to your program. @cindex @command{gawk}, built-in variables and This @value{SECTION} documents all the built-in variables of @command{gawk}, most of which are also documented in the chapters describing their areas of activity. @menu * User-modified:: Built-in variables that you change to control @command{awk}. * Auto-set:: Built-in variables where @command{awk} gives you information. * ARGC and ARGV:: Ways to use @code{ARGC} and @code{ARGV}. @end menu @node User-modified @subsection Built-in Variables That Control @command{awk} @c STARTOFRANGE bvaru @cindex built-in variables, user-modifiable @c STARTOFRANGE nmbv @cindex user-modifiable variables The following is an alphabetical list of variables that you can change to control how @command{awk} does certain things. The variables that are specific to @command{gawk} are marked with a pound sign@w{ (@samp{#}).} @table @code @cindex @code{BINMODE} variable @cindex binary input/output @cindex input/output, binary @item BINMODE # On non-POSIX systems, this variable specifies use of binary mode for all I/O. Numeric values of one, two, or three specify that input files, output files, or all files, respectively, should use binary I/O. A numeric value less than zero is treated as zero, and a numeric value greater than three is treated as three. Alternatively, string values of @code{"r"} or @code{"w"} specify that input files and output files, respectively, should use binary I/O. A string value of @code{"rw"} or @code{"wr"} indicates that all files should use binary I/O. Any other string value is treated the same as @code{"rw"}, but causes @command{gawk} to generate a warning message. @code{BINMODE} is described in more detail in @ref{PC Using}. @cindex differences in @command{awk} and @command{gawk}, @code{BINMODE} variable This variable is a @command{gawk} extension. In other @command{awk} implementations (except @command{mawk}, @pxref{Other Versions}), or if @command{gawk} is in compatibility mode (@pxref{Options}), it is not special. @cindex @code{CONVFMT} variable @cindex POSIX @command{awk}, @code{CONVFMT} variable and @cindex numbers, converting, to strings @cindex strings, converting, numbers to @item CONVFMT This string controls conversion of numbers to strings (@pxref{Conversion}). It works by being passed, in effect, as the first argument to the @code{sprintf()} function (@pxref{String Functions}). Its default value is @code{"%.6g"}. @code{CONVFMT} was introduced by the POSIX standard. @cindex @command{gawk}, @code{FIELDWIDTHS} variable in @cindex @code{FIELDWIDTHS} variable @cindex differences in @command{awk} and @command{gawk}, @code{FIELDWIDTHS} variable @cindex field separators, @code{FIELDWIDTHS} variable and @cindex separators, field, @code{FIELDWIDTHS} variable and @item FIELDWIDTHS # This is a space-separated list of columns that tells @command{gawk} how to split input with fixed columnar boundaries. Assigning a value to @code{FIELDWIDTHS} overrides the use of @code{FS} and @code{FPAT} for field splitting. @xref{Constant Size}, for more information. If @command{gawk} is in compatibility mode (@pxref{Options}), then @code{FIELDWIDTHS} has no special meaning, and field-splitting operations occur based exclusively on the value of @code{FS}. @cindex @command{gawk}, @code{FPAT} variable in @cindex @code{FPAT} variable @cindex differences in @command{awk} and @command{gawk}, @code{FPAT} variable @cindex field separators, @code{FPAT} variable and @cindex separators, field, @code{FPAT} variable and @item FPAT # This is a regular expression (as a string) that tells @command{gawk} to create the fields based on text that matches the regular expression. Assigning a value to @code{FPAT} overrides the use of @code{FS} and @code{FIELDWIDTHS} for field splitting. @xref{Splitting By Content}, for more information. If @command{gawk} is in compatibility mode (@pxref{Options}), then @code{FPAT} has no special meaning, and field-splitting operations occur based exclusively on the value of @code{FS}. @cindex @code{FS} variable @cindex separators, field @cindex field separators @item FS This is the input field separator (@pxref{Field Separators}). The value is a single-character string or a multi-character regular expression that matches the separations between fields in an input record. If the value is the null string (@code{""}), then each character in the record becomes a separate field. (This behavior is a @command{gawk} extension. POSIX @command{awk} does not specify the behavior when @code{FS} is the null string. Nonetheless, some other versions of @command{awk} also treat @code{""} specially.) @cindex POSIX @command{awk}, @code{FS} variable and The default value is @w{@code{" "}}, a string consisting of a single space. As a special exception, this value means that any sequence of spaces, TABs, and/or newlines is a single separator.@footnote{In POSIX @command{awk}, newline does not count as whitespace.} It also causes spaces, TABs, and newlines at the beginning and end of a record to be ignored. You can set the value of @code{FS} on the command line using the @option{-F} option: @example awk -F, '@var{program}' @var{input-files} @end example @cindex @command{gawk}, field separators and If @command{gawk} is using @code{FIELDWIDTHS} or @code{FPAT} for field splitting, assigning a value to @code{FS} causes @command{gawk} to return to the normal, @code{FS}-based field splitting. An easy way to do this is to simply say @samp{FS = FS}, perhaps with an explanatory comment. @cindex @command{gawk}, @code{IGNORECASE} variable in @cindex @code{IGNORECASE} variable @cindex differences in @command{awk} and @command{gawk}, @code{IGNORECASE} variable @cindex case sensitivity, string comparisons and @cindex case sensitivity, regexps and @cindex regular expressions, case sensitivity @item IGNORECASE # If @code{IGNORECASE} is nonzero or non-null, then all string comparisons and all regular expression matching are case independent. Thus, regexp matching with @samp{~} and @samp{!~}, as well as the @code{gensub()}, @code{gsub()}, @code{index()}, @code{match()}, @code{patsplit()}, @code{split()}, and @code{sub()} functions, record termination with @code{RS}, and field splitting with @code{FS} and @code{FPAT}, all ignore case when doing their particular regexp operations. However, the value of @code{IGNORECASE} does @emph{not} affect array subscripting and it does not affect field splitting when using a single-character field separator. @xref{Case-sensitivity}. If @command{gawk} is in compatibility mode (@pxref{Options}), then @code{IGNORECASE} has no special meaning. Thus, string and regexp operations are always case-sensitive. @cindex @command{gawk}, @code{LINT} variable in @cindex @code{LINT} variable @cindex differences in @command{awk} and @command{gawk}, @code{LINT} variable @cindex lint checking @item LINT # When this variable is true (nonzero or non-null), @command{gawk} behaves as if the @option{--lint} command-line option is in effect. (@pxref{Options}). With a value of @code{"fatal"}, lint warnings become fatal errors. With a value of @code{"invalid"}, only warnings about things that are actually invalid are issued. (This is not fully implemented yet.) Any other true value prints nonfatal warnings. Assigning a false value to @code{LINT} turns off the lint warnings. This variable is a @command{gawk} extension. It is not special in other @command{awk} implementations. Unlike the other special variables, changing @code{LINT} does affect the production of lint warnings, even if @command{gawk} is in compatibility mode. Much as the @option{--lint} and @option{--traditional} options independently control different aspects of @command{gawk}'s behavior, the control of lint warnings during program execution is independent of the flavor of @command{awk} being executed. @cindex @code{OFMT} variable @cindex numbers, converting, to strings @cindex strings, converting, numbers to @item OFMT This string controls conversion of numbers to strings (@pxref{Conversion}) for printing with the @code{print} statement. It works by being passed as the first argument to the @code{sprintf()} function (@pxref{String Functions}). Its default value is @code{"%.6g"}. Earlier versions of @command{awk} also used @code{OFMT} to specify the format for converting numbers to strings in general expressions; this is now done by @code{CONVFMT}. @cindex @code{sprintf()} function, @code{OFMT} variable and @cindex @code{print} statement, @code{OFMT} variable and @cindex @code{OFS} variable @cindex separators, field @cindex field separators @item OFS This is the output field separator (@pxref{Output Separators}). It is output between the fields printed by a @code{print} statement. Its default value is @w{@code{" "}}, a string consisting of a single space. @cindex @code{ORS} variable @item ORS This is the output record separator. It is output at the end of every @code{print} statement. Its default value is @code{"\n"}, the newline character. (@xref{Output Separators}.) @cindex @code{RS} variable @cindex separators, for records @cindex record separators @item RS This is @command{awk}'s input record separator. Its default value is a string containing a single newline character, which means that an input record consists of a single line of text. It can also be the null string, in which case records are separated by runs of blank lines. If it is a regexp, records are separated by matches of the regexp in the input text. (@xref{Records}.) The ability for @code{RS} to be a regular expression is a @command{gawk} extension. In most other @command{awk} implementations, or if @command{gawk} is in compatibility mode (@pxref{Options}), just the first character of @code{RS}'s value is used. @cindex @code{SUBSEP} variable @cindex separators, subscript @cindex subscript separators @item SUBSEP This is the subscript separator. It has the default value of @code{"\034"} and is used to separate the parts of the indices of a multidimensional array. Thus, the expression @code{@w{foo["A", "B"]}} really accesses @code{foo["A\034B"]} (@pxref{Multi-dimensional}). @cindex @command{gawk}, @code{TEXTDOMAIN} variable in @cindex @code{TEXTDOMAIN} variable @cindex differences in @command{awk} and @command{gawk}, @code{TEXTDOMAIN} variable @cindex internationalization, localization @item TEXTDOMAIN # This variable is used for internationalization of programs at the @command{awk} level. It sets the default text domain for specially marked string constants in the source text, as well as for the @code{dcgettext()}, @code{dcngettext()} and @code{bindtextdomain()} functions (@pxref{Internationalization}). The default value of @code{TEXTDOMAIN} is @code{"messages"}. This variable is a @command{gawk} extension. In other @command{awk} implementations, or if @command{gawk} is in compatibility mode (@pxref{Options}), it is not special. @end table @c ENDOFRANGE bvar @c ENDOFRANGE varb @c ENDOFRANGE bvaru @c ENDOFRANGE nmbv @node Auto-set @subsection Built-in Variables That Convey Information @c STARTOFRANGE bvconi @cindex built-in variables, conveying information @c STARTOFRANGE vbconi @cindex variables, built-in, conveying information The following is an alphabetical list of variables that @command{awk} sets automatically on certain occasions in order to provide information to your program. The variables that are specific to @command{gawk} are marked with a pound sign@w{ (@samp{#}).} @table @code @cindex @code{ARGC}/@code{ARGV} variables @cindex arguments, command-line @cindex command line, arguments @item ARGC@r{,} ARGV The command-line arguments available to @command{awk} programs are stored in an array called @code{ARGV}. @code{ARGC} is the number of command-line arguments present. @xref{Other Arguments}. Unlike most @command{awk} arrays, @code{ARGV} is indexed from 0 to @code{ARGC} @minus{} 1. In the following example: @example $ @kbd{awk 'BEGIN @{} > @kbd{for (i = 0; i < ARGC; i++)} > @kbd{print ARGV[i]} > @kbd{@}' inventory-shipped BBS-list} @print{} awk @print{} inventory-shipped @print{} BBS-list @end example @noindent @code{ARGV[0]} contains @samp{awk}, @code{ARGV[1]} contains @samp{inventory-shipped}, and @code{ARGV[2]} contains @samp{BBS-list}. The value of @code{ARGC} is three, one more than the index of the last element in @code{ARGV}, because the elements are numbered from zero. @cindex programming conventions, @code{ARGC}/@code{ARGV} variables The names @code{ARGC} and @code{ARGV}, as well as the convention of indexing the array from 0 to @code{ARGC} @minus{} 1, are derived from the C language's method of accessing command-line arguments. @cindex dark corner, value of @code{ARGV[0]} The value of @code{ARGV[0]} can vary from system to system. Also, you should note that the program text is @emph{not} included in @code{ARGV}, nor are any of @command{awk}'s command-line options. @xref{ARGC and ARGV}, for information about how @command{awk} uses these variables. @value{DARKCORNER} @cindex @code{ARGIND} variable @cindex differences in @command{awk} and @command{gawk}, @code{ARGIND} variable @item ARGIND # The index in @code{ARGV} of the current file being processed. Every time @command{gawk} opens a new @value{DF} for processing, it sets @code{ARGIND} to the index in @code{ARGV} of the @value{FN}. When @command{gawk} is processing the input files, @samp{FILENAME == ARGV[ARGIND]} is always true. @cindex files, processing@comma{} @code{ARGIND} variable and This variable is useful in file processing; it allows you to tell how far along you are in the list of @value{DF}s as well as to distinguish between successive instances of the same @value{FN} on the command line. @cindex @value{FN}s, distinguishing While you can change the value of @code{ARGIND} within your @command{awk} program, @command{gawk} automatically sets it to a new value when the next file is opened. This variable is a @command{gawk} extension. In other @command{awk} implementations, or if @command{gawk} is in compatibility mode (@pxref{Options}), it is not special. @cindex @code{ENVIRON} array @cindex environment variables @item ENVIRON An associative array containing the values of the environment. The array indices are the environment variable names; the elements are the values of the particular environment variables. For example, @code{ENVIRON["HOME"]} might be @file{/home/arnold}. Changing this array does not affect the environment passed on to any programs that @command{awk} may spawn via redirection or the @code{system()} function. @c (In a future version of @command{gawk}, it may do so.) Some operating systems may not have environment variables. On such systems, the @code{ENVIRON} array is empty (except for @w{@code{ENVIRON["AWKPATH"]}}, @pxref{AWKPATH Variable}). @cindex @command{gawk}, @code{ERRNO} variable in @cindex @code{ERRNO} variable @cindex differences in @command{awk} and @command{gawk}, @code{ERRNO} variable @cindex error handling, @code{ERRNO} variable and @item ERRNO # If a system error occurs during a redirection for @code{getline}, during a read for @code{getline}, or during a @code{close()} operation, then @code{ERRNO} contains a string describing the error. In addition, @command{gawk} clears @code{ERRNO} before opening each command-line input file. This enables checking if the file is readable inside a @code{BEGINFILE} pattern (@pxref{BEGINFILE/ENDFILE}). Otherwise, @code{ERRNO} works similarly to the C variable @code{errno}. Except for the case just mentioned, @command{gawk} @emph{never} clears it (sets it to zero or @code{""}). Thus, you should only expect its value to be meaningful when an I/O operation returns a failure value, such as @code{getline} returning @minus{}1. You are, of course, free to clear it yourself before doing an I/O operation. This variable is a @command{gawk} extension. In other @command{awk} implementations, or if @command{gawk} is in compatibility mode (@pxref{Options}), it is not special. @cindex @code{FILENAME} variable @cindex dark corner, @code{FILENAME} variable @item FILENAME The name of the file that @command{awk} is currently reading. When no @value{DF}s are listed on the command line, @command{awk} reads from the standard input and @code{FILENAME} is set to @code{"-"}. @code{FILENAME} is changed each time a new file is read (@pxref{Reading Files}). Inside a @code{BEGIN} rule, the value of @code{FILENAME} is @code{""}, since there are no input files being processed yet.@footnote{Some early implementations of Unix @command{awk} initialized @code{FILENAME} to @code{"-"}, even if there were @value{DF}s to be processed. This behavior was incorrect and should not be relied upon in your programs.} @value{DARKCORNER} Note, though, that using @code{getline} (@pxref{Getline}) inside a @code{BEGIN} rule can give @code{FILENAME} a value. @cindex @code{FNR} variable @item FNR The current record number in the current file. @code{FNR} is incremented each time a new record is read (@pxref{Records}). It is reinitialized to zero each time a new input file is started. @cindex @code{NF} variable @item NF The number of fields in the current input record. @code{NF} is set each time a new record is read, when a new field is created or when @code{$0} changes (@pxref{Fields}). Unlike most of the variables described in this @ifnotinfo section, @end ifnotinfo @ifinfo node, @end ifinfo assigning a value to @code{NF} has the potential to affect @command{awk}'s internal workings. In particular, assignments to @code{NF} can be used to create or remove fields from the current record. @xref{Changing Fields}. @cindex @code{NR} variable @item NR The number of input records @command{awk} has processed since the beginning of the program's execution (@pxref{Records}). @code{NR} is incremented each time a new record is read. @cindex @command{gawk}, @code{PROCINFO} array in @cindex @code{PROCINFO} array @cindex differences in @command{awk} and @command{gawk}, @code{PROCINFO} array @item PROCINFO # The elements of this array provide access to information about the running @command{awk} program. The following elements (listed alphabetically) are guaranteed to be available: @table @code @item PROCINFO["egid"] The value of the @code{getegid()} system call. @item PROCINFO["euid"] The value of the @code{geteuid()} system call. @item PROCINFO["FS"] This is @code{"FS"} if field splitting with @code{FS} is in effect, @code{"FIELDWIDTHS"} if field splitting with @code{FIELDWIDTHS} is in effect, or @code{"FPAT"} if field matching with @code{FPAT} is in effect. @item PROCINFO["gid"] The value of the @code{getgid()} system call. @item PROCINFO["pgrpid"] The process group ID of the current process. @item PROCINFO["pid"] The process ID of the current process. @item PROCINFO["ppid"] The parent process ID of the current process. @item PROCINFO["sorted_in"] If this element exists in @code{PROCINFO}, its value controls the order in which array indices will be processed by @samp{for (index in array) @dots{}} loops. Since this is an advanced feature, we defer the full description until later; see @ref{Scanning an Array}. @item PROCINFO["strftime"] The default time format string for @code{strftime()}. Assigning a new value to this element changes the default. @xref{Time Functions}. @item PROCINFO["uid"] The value of the @code{getuid()} system call. @item PROCINFO["version"] The version of @command{gawk}. @end table On some systems, there may be elements in the array, @code{"group1"} through @code{"group@var{N}"} for some @var{N}. @var{N} is the number of supplementary groups that the process has. Use the @code{in} operator to test for these elements (@pxref{Reference to Elements}). @cindex @command{gawk}, @code{PROCINFO} array in @cindex @code{PROCINFO} array The @code{PROCINFO} array is also used to cause coprocesses to communicate over pseudo-ttys instead of through two-way pipes; this is discussed further in @ref{Two-way I/O}. This array is a @command{gawk} extension. In other @command{awk} implementations, or if @command{gawk} is in compatibility mode (@pxref{Options}), it is not special. @cindex @code{RLENGTH} variable @item RLENGTH The length of the substring matched by the @code{match()} function (@pxref{String Functions}). @code{RLENGTH} is set by invoking the @code{match()} function. Its value is the length of the matched string, or @minus{}1 if no match is found. @cindex @code{RSTART} variable @item RSTART The start-index in characters of the substring that is matched by the @code{match()} function (@pxref{String Functions}). @code{RSTART} is set by invoking the @code{match()} function. Its value is the position of the string where the matched substring starts, or zero if no match was found. @cindex @command{gawk}, @code{RT} variable in @cindex @code{RT} variable @cindex differences in @command{awk} and @command{gawk}, @code{RT} variable @item RT # This is set each time a record is read. It contains the input text that matched the text denoted by @code{RS}, the record separator. This variable is a @command{gawk} extension. In other @command{awk} implementations, or if @command{gawk} is in compatibility mode (@pxref{Options}), it is not special. @end table @c ENDOFRANGE bvconi @c ENDOFRANGE vbconi @c fakenode --- for prepinfo @subheading Advanced Notes: Changing @code{NR} and @code{FNR} @cindex @code{NR} variable, changing @cindex @code{FNR} variable, changing @cindex advanced features, @code{FNR}/@code{NR} variables @cindex dark corner, @code{FNR}/@code{NR} variables @command{awk} increments @code{NR} and @code{FNR} each time it reads a record, instead of setting them to the absolute value of the number of records read. This means that a program can change these variables and their new values are incremented for each record. @value{DARKCORNER} The following example shows this: @example $ @kbd{echo '1} > @kbd{2} > @kbd{3} > @kbd{4' | awk 'NR == 2 @{ NR = 17 @}} > @kbd{@{ print NR @}'} @print{} 1 @print{} 17 @print{} 18 @print{} 19 @end example @noindent Before @code{FNR} was added to the @command{awk} language (@pxref{V7/SVR3.1}), many @command{awk} programs used this feature to track the number of records in a file by resetting @code{NR} to zero when @code{FILENAME} changed. @node ARGC and ARGV @subsection Using @code{ARGC} and @code{ARGV} @cindex @code{ARGC}/@code{ARGV} variables @cindex arguments, command-line @cindex command line, arguments @ref{Auto-set}, presented the following program describing the information contained in @code{ARGC} and @code{ARGV}: @example $ @kbd{awk 'BEGIN @{} > @kbd{for (i = 0; i < ARGC; i++)} > @kbd{print ARGV[i]} > @kbd{@}' inventory-shipped BBS-list} @print{} awk @print{} inventory-shipped @print{} BBS-list @end example @noindent In this example, @code{ARGV[0]} contains @samp{awk}, @code{ARGV[1]} contains @samp{inventory-shipped}, and @code{ARGV[2]} contains @samp{BBS-list}. Notice that the @command{awk} program is not entered in @code{ARGV}. The other command-line options, with their arguments, are also not entered. This includes variable assignments done with the @option{-v} option (@pxref{Options}). Normal variable assignments on the command line @emph{are} treated as arguments and do show up in the @code{ARGV} array. Given the following program in a file named @file{showargs.awk}: @example BEGIN @{ printf "A=%d, B=%d\n", A, B for (i = 0; i < ARGC; i++) printf "\tARGV[%d] = %s\n", i, ARGV[i] @} END @{ printf "A=%d, B=%d\n", A, B @} @end example @noindent Running it produces the following: @example $ @kbd{awk -v A=1 -f showargs.awk B=2 /dev/null} @print{} A=1, B=0 @print{} ARGV[0] = awk @print{} ARGV[1] = B=2 @print{} ARGV[2] = /dev/null @print{} A=1, B=2 @end example A program can alter @code{ARGC} and the elements of @code{ARGV}. Each time @command{awk} reaches the end of an input file, it uses the next element of @code{ARGV} as the name of the next input file. By storing a different string there, a program can change which files are read. Use @code{"-"} to represent the standard input. Storing additional elements and incrementing @code{ARGC} causes additional files to be read. If the value of @code{ARGC} is decreased, that eliminates input files from the end of the list. By recording the old value of @code{ARGC} elsewhere, a program can treat the eliminated arguments as something other than @value{FN}s. To eliminate a file from the middle of the list, store the null string (@code{""}) into @code{ARGV} in place of the file's name. As a special feature, @command{awk} ignores @value{FN}s that have been replaced with the null string. Another option is to use the @code{delete} statement to remove elements from @code{ARGV} (@pxref{Delete}). All of these actions are typically done in the @code{BEGIN} rule, before actual processing of the input begins. @xref{Split Program}, and see @ref{Tee Program}, for examples of each way of removing elements from @code{ARGV}. The following fragment processes @code{ARGV} in order to examine, and then remove, command-line options: @example BEGIN @{ for (i = 1; i < ARGC; i++) @{ if (ARGV[i] == "-v") verbose = 1 else if (ARGV[i] == "-q") debug = 1 else if (ARGV[i] ~ /^-./) @{ e = sprintf("%s: unrecognized option -- %c", ARGV[0], substr(ARGV[i], 2, 1)) print e > "/dev/stderr" @} else break delete ARGV[i] @} @} @end example To actually get the options into the @command{awk} program, end the @command{awk} options with @option{--} and then supply the @command{awk} program's options, in the following manner: @example awk -f myprog -- -v -q file1 file2 @dots{} @end example @cindex differences in @command{awk} and @command{gawk}, @code{ARGC}/@code{ARGV} variables This is not necessary in @command{gawk}. Unless @option{--posix} has been specified, @command{gawk} silently puts any unrecognized options into @code{ARGV} for the @command{awk} program to deal with. As soon as it sees an unknown option, @command{gawk} stops looking for other options that it might otherwise recognize. The previous example with @command{gawk} would be: @example gawk -f myprog -q -v file1 file2 @dots{} @end example @noindent Because @option{-q} is not a valid @command{gawk} option, it and the following @option{-v} are passed on to the @command{awk} program. (@xref{Getopt Function}, for an @command{awk} library function that parses command-line options.) @node Arrays @chapter Arrays in @command{awk} @c STARTOFRANGE arrs @cindex arrays An @dfn{array} is a table of values called @dfn{elements}. The elements of an array are distinguished by their @dfn{indices}. Indices may be either numbers or strings. This @value{CHAPTER} describes how arrays work in @command{awk}, how to use array elements, how to scan through every element in an array, and how to remove array elements. It also describes how @command{awk} simulates multidimensional arrays, as well as some of the less obvious points about array usage. The @value{CHAPTER} moves on to discuss @command{gawk}'s facility for sorting arrays, and ends with a brief description of @command{gawk}'s ability to support true multidimensional arrays. @cindex variables, names of @cindex functions, names of @cindex arrays, names of @cindex names, arrays/variables @cindex namespace issues @command{awk} maintains a single set of names that may be used for naming variables, arrays, and functions (@pxref{User-defined}). Thus, you cannot have a variable and an array with the same name in the same @command{awk} program. @menu * Array Basics:: The basics of arrays. * Delete:: The @code{delete} statement removes an element from an array. * Numeric Array Subscripts:: How to use numbers as subscripts in @command{awk}. * Uninitialized Subscripts:: Using Uninitialized variables as subscripts. * Multi-dimensional:: Emulating multidimensional arrays in @command{awk}. * Arrays of Arrays:: True multidimensional arrays. @end menu @node Array Basics @section The Basics of Arrays This @value{SECTION} presents the basics: working with elements in arrays one at a time, and traversing all of the elements in an array. @menu * Array Intro:: Introduction to Arrays * Reference to Elements:: How to examine one element of an array. * Assigning Elements:: How to change an element of an array. * Array Example:: Basic Example of an Array * Scanning an Array:: A variation of the @code{for} statement. It loops through the indices of an array's existing elements. * Controlling Scanning:: Controlling the order in which arrays are scanned. @end menu @node Array Intro @subsection Introduction to Arrays @cindex Wall, Larry @quotation @i{Doing linear scans over an associative array is like trying to club someone to death with a loaded Uzi.}@* Larry Wall @end quotation The @command{awk} language provides one-dimensional arrays for storing groups of related strings or numbers. Every @command{awk} array must have a name. Array names have the same syntax as variable names; any valid variable name would also be a valid array name. But one name cannot be used in both ways (as an array and as a variable) in the same @command{awk} program. Arrays in @command{awk} superficially resemble arrays in other programming languages, but there are fundamental differences. In @command{awk}, it isn't necessary to specify the size of an array before starting to use it. Additionally, any number or string in @command{awk}, not just consecutive integers, may be used as an array index. In most other languages, arrays must be @dfn{declared} before use, including a specification of how many elements or components they contain. In such languages, the declaration causes a contiguous block of memory to be allocated for that many elements. Usually, an index in the array must be a positive integer. For example, the index zero specifies the first element in the array, which is actually stored at the beginning of the block of memory. Index one specifies the second element, which is stored in memory right after the first element, and so on. It is impossible to add more elements to the array, because it has room only for as many elements as given in the declaration. (Some languages allow arbitrary starting and ending indices---e.g., @samp{15 .. 27}---but the size of the array is still fixed when the array is declared.) A contiguous array of four elements might look like the following example, conceptually, if the element values are 8, @code{"foo"}, @code{""}, and 30: @c @strong{FIXME: NEXT ED:} Use real images here @iftex @c from Karl Berry, much thanks for the help. @tex \bigskip % space above the table (about 1 linespace) \offinterlineskip \newdimen\width \width = 1.5cm \newdimen\hwidth \hwidth = 4\width \advance\hwidth by 2pt % 5 * 0.4pt \centerline{\vbox{ \halign{\strut\hfil\ignorespaces#&&\vrule#&\hbox to\width{\hfil#\unskip\hfil}\cr \noalign{\hrule width\hwidth} &&{\tt 8} &&{\tt "foo"} &&{\tt ""} &&{\tt 30} &&\quad Value\cr \noalign{\hrule width\hwidth} \noalign{\smallskip} &\omit&0&\omit &1 &\omit&2 &\omit&3 &\omit&\quad Index\cr } }} @end tex @end iftex @ifnottex @example +---------+---------+--------+---------+ | 8 | "foo" | "" | 30 | @r{Value} +---------+---------+--------+---------+ 0 1 2 3 @r{Index} @end example @end ifnottex @noindent Only the values are stored; the indices are implicit from the order of the values. Here, 8 is the value at index zero, because 8 appears in the position with zero elements before it. @c STARTOFRANGE arrin @cindex arrays, indexing @c STARTOFRANGE inarr @cindex indexing arrays @cindex associative arrays @cindex arrays, associative Arrays in @command{awk} are different---they are @dfn{associative}. This means that each array is a collection of pairs: an index and its corresponding array element value: @example @r{Index} 3 @r{Value} 30 @r{Index} 1 @r{Value} "foo" @r{Index} 0 @r{Value} 8 @r{Index} 2 @r{Value} "" @end example @noindent The pairs are shown in jumbled order because their order is irrelevant. One advantage of associative arrays is that new pairs can be added at any time. For example, suppose a tenth element is added to the array whose value is @w{@code{"number ten"}}. The result is: @example @r{Index} 10 @r{Value} "number ten" @r{Index} 3 @r{Value} 30 @r{Index} 1 @r{Value} "foo" @r{Index} 0 @r{Value} 8 @r{Index} 2 @r{Value} "" @end example @noindent @cindex sparse arrays @cindex arrays, sparse Now the array is @dfn{sparse}, which just means some indices are missing. It has elements 0--3 and 10, but doesn't have elements 4, 5, 6, 7, 8, or 9. Another consequence of associative arrays is that the indices don't have to be positive integers. Any number, or even a string, can be an index. For example, the following is an array that translates words from English to French: @example @r{Index} "dog" @r{Value} "chien" @r{Index} "cat" @r{Value} "chat" @r{Index} "one" @r{Value} "un" @r{Index} 1 @r{Value} "un" @end example @noindent Here we decided to translate the number one in both spelled-out and numeric form---thus illustrating that a single array can have both numbers and strings as indices. In fact, array subscripts are always strings; this is discussed in more detail in @ref{Numeric Array Subscripts}. Here, the number @code{1} isn't double-quoted, since @command{awk} automatically converts it to a string. @cindex @command{gawk}, @code{IGNORECASE} variable in @cindex @code{IGNORECASE} variable @cindex case sensitivity, array indices and @cindex arrays, @code{IGNORECASE} variable and @cindex @code{IGNORECASE} variable, array subscripts and The value of @code{IGNORECASE} has no effect upon array subscripting. The identical string value used to store an array element must be used to retrieve it. When @command{awk} creates an array (e.g., with the @code{split()} built-in function), that array's indices are consecutive integers starting at one. (@xref{String Functions}.) @command{awk}'s arrays are efficient---the time to access an element is independent of the number of elements in the array. @c ENDOFRANGE arrin @c ENDOFRANGE inarr @node Reference to Elements @subsection Referring to an Array Element @cindex arrays, elements, referencing @cindex elements in arrays The principal way to use an array is to refer to one of its elements. An array reference is an expression as follows: @example @var{array}[@var{index-expression}] @end example @noindent Here, @var{array} is the name of an array. The expression @var{index-expression} is the index of the desired element of the array. The value of the array reference is the current value of that array element. For example, @code{foo[4.3]} is an expression for the element of array @code{foo} at index @samp{4.3}. A reference to an array element that has no recorded value yields a value of @code{""}, the null string. This includes elements that have not been assigned any value as well as elements that have been deleted (@pxref{Delete}). @quotation NOTE A reference to an element that does not exist @emph{automatically} creates that array element, with the null string as its value. (In some cases, this is unfortunate, because it might waste memory inside @command{awk}.) Novice @command{awk} programmers often make the mistake of checking if an element exists by checking if the value is empty: @example # Check if "foo" exists in a: @ii{Incorrect!} if (a["foo"] != "") @dots{} @end example @noindent This is incorrect, since this will @emph{create} @code{a["foo"]} if it didn't exist before! @end quotation @c @cindex arrays, @code{in} operator and @cindex @code{in} operator, arrays and To determine whether an element exists in an array at a certain index, use the following expression: @example @var{ind} in @var{array} @end example @cindex side effects, array indexing @noindent This expression tests whether the particular index @var{ind} exists, without the side effect of creating that element if it is not present. The expression has the value one (true) if @code{@var{array}[@var{ind}]} exists and zero (false) if it does not exist. For example, this statement tests whether the array @code{frequencies} contains the index @samp{2}: @example if (2 in frequencies) print "Subscript 2 is present." @end example Note that this is @emph{not} a test of whether the array @code{frequencies} contains an element whose @emph{value} is two. There is no way to do that except to scan all the elements. Also, this @emph{does not} create @code{frequencies[2]}, while the following (incorrect) alternative does: @example if (frequencies[2] != "") print "Subscript 2 is present." @end example @node Assigning Elements @subsection Assigning Array Elements @cindex arrays, elements, assigning @cindex elements in arrays, assigning Array elements can be assigned values just like @command{awk} variables: @example @var{array}[@var{index-expression}] = @var{value} @end example @noindent @var{array} is the name of an array. The expression @var{index-expression} is the index of the element of the array that is assigned a value. The expression @var{value} is the value to assign to that element of the array. @node Array Example @subsection Basic Array Example The following program takes a list of lines, each beginning with a line number, and prints them out in order of line number. The line numbers are not in order when they are first read---instead they are scrambled. This program sorts the lines by making an array using the line numbers as subscripts. The program then prints out the lines in sorted order of their numbers. It is a very simple program and gets confused upon encountering repeated numbers, gaps, or lines that don't begin with a number: @example @c file eg/misc/arraymax.awk @{ if ($1 > max) max = $1 arr[$1] = $0 @} END @{ for (x = 1; x <= max; x++) print arr[x] @} @c endfile @end example The first rule keeps track of the largest line number seen so far; it also stores each line into the array @code{arr}, at an index that is the line's number. The second rule runs after all the input has been read, to print out all the lines. When this program is run with the following input: @example @c file eg/misc/arraymax.data 5 I am the Five man 2 Who are you? The new number two! 4 . . . And four on the floor 1 Who is number one? 3 I three you. @c endfile @end example @noindent Its output is: @example 1 Who is number one? 2 Who are you? The new number two! 3 I three you. 4 . . . And four on the floor 5 I am the Five man @end example If a line number is repeated, the last line with a given number overrides the others. Gaps in the line numbers can be handled with an easy improvement to the program's @code{END} rule, as follows: @example END @{ for (x = 1; x <= max; x++) if (x in arr) print arr[x] @} @end example @node Scanning an Array @subsection Scanning All Elements of an Array @cindex elements in arrays, scanning @cindex arrays, scanning In programs that use arrays, it is often necessary to use a loop that executes once for each element of an array. In other languages, where arrays are contiguous and indices are limited to positive integers, this is easy: all the valid indices can be found by counting from the lowest index up to the highest. This technique won't do the job in @command{awk}, because any number or string can be an array index. So @command{awk} has a special kind of @code{for} statement for scanning an array: @example for (@var{var} in @var{array}) @var{body} @end example @noindent @cindex @code{in} operator, arrays and This loop executes @var{body} once for each index in @var{array} that the program has previously used, with the variable @var{var} set to that index. @cindex arrays, @code{for} statement and @cindex @code{for} statement, in arrays The following program uses this form of the @code{for} statement. The first rule scans the input records and notes which words appear (at least once) in the input, by storing a one into the array @code{used} with the word as index. The second rule scans the elements of @code{used} to find all the distinct words that appear in the input. It prints each word that is more than 10 characters long and also prints the number of such words. @xref{String Functions}, for more information on the built-in function @code{length()}. @example # Record a 1 for each word that is used at least once @{ for (i = 1; i <= NF; i++) used[$i] = 1 @} # Find number of distinct words more than 10 characters long END @{ for (x in used) @{ if (length(x) > 10) @{ ++num_long_words print x @} @} print num_long_words, "words longer than 10 characters" @} @end example @noindent @xref{Word Sorting}, for a more detailed example of this type. @cindex arrays, elements, order of @cindex elements in arrays, order of The order in which elements of the array are accessed by this statement is determined by the internal arrangement of the array elements within @command{awk} and normally cannot be controlled or changed. This can lead to problems if new elements are added to @var{array} by statements in the loop body; it is not predictable whether the @code{for} loop will reach them. Similarly, changing @var{var} inside the loop may produce strange results. It is best to avoid such things. @node Controlling Scanning @subsection Using Predefined Array Scanning Orders By default, when a @code{for} loop traverses an array, the order is undefined, meaning that the @command{awk} implementation determines the order in which the array is traversed. This order is usually based on the internal implementation of arrays and will vary from one version of @command{awk} to the next. Often, though, you may wish to do something simple, such as ``traverse the array by comparing the indices in ascending order,'' or ``traverse the array by on comparing the values in descending order.'' @command{gawk} provides two mechanisms which give you this control. @itemize @bullet @item Set @code{PROCINFO["sorted_in"]} to one of a set of predefined values. We describe this now. @item Set @code{PROCINFO["sorted_in"]} to the name of a user-defined function to be used for comparison of array elements. This advanced feature is described later, in @ref{Array Sorting}. @end itemize The following special values for @code{PROCINFO["sorted_in"]} are available: @table @code @item "@@unsorted" Array elements are processed in arbitrary order, which is the default @command{awk} behavior. @item "@@ind_str_asc" Order by indices compared as strings; this is the most basic sort. (Internally, array indices are always strings, so with @samp{a[2*5] = 1} the index is @code{"10"} rather than numeric 10.) @item "@@ind_num_asc" Order by indices but force them to be treated as numbers in the process. Any index with a non-numeric value will end up positioned as if it were zero. @item "@@val_type_asc" Order by element values rather than indices. Ordering is by the type assigned to the element (@pxref{Typing and Comparison}). All numeric values come before all string values, which in turn come before all subarrays. (Subarrays have not been described yet; @pxref{Arrays of Arrays}). @item "@@val_str_asc" Order by element values rather than by indices. Scalar values are compared as strings. Subarrays, if present, come out last. @item "@@val_num_asc" Order by element values rather than by indices. Scalar values are compared as numbers. Subarrays, if present, come out last. When numeric values are equal, the string values are used to provide an ordering: this guarantees consistent results across different versions of the C @code{qsort()} function,@footnote{When two elements compare as equal, the C @code{qsort()} function does not guarantee that they will maintain their original relative order after sorting. Using the string value to provide a unique ordering when the numeric values are equal ensures that @command{gawk} behaves consistently across different environments.} which @command{gawk} uses internally to perform the sorting. @item "@@ind_str_desc" Reverse order from the most basic sort. @item "@@ind_num_desc" Numeric indices ordered from high to low. @item "@@val_type_desc" Element values, based on type, in descending order. @item "@@val_str_desc" Element values, treated as strings, ordered from high to low. Subarrays, if present, come out first. @item "@@val_num_desc" Element values, treated as numbers, ordered from high to low. Subarrays, if present, come out first. @end table The array traversal order is determined before the @code{for} loop starts to run. Changing @code{PROCINFO["sorted_in"]} in the loop body will not affect the loop. For example: @example $ @kbd{gawk 'BEGIN @{} > @kbd{ a[4] = 4} > @kbd{ a[3] = 3} > @kbd{ for (i in a)} > @kbd{ print i, a[i]} > @kbd{@}'} @print{} 4 4 @print{} 3 3 $ @kbd{gawk 'BEGIN @{} > @kbd{ PROCINFO["sorted_in"] = "@@ind_str_asc"} > @kbd{ a[4] = 4} > @kbd{ a[3] = 3} > @kbd{ for (i in a)} > @kbd{ print i, a[i]} > @kbd{@}'} @print{} 3 3 @print{} 4 4 @end example When sorting an array by element values, if a value happens to be a subarray then it is considered to be greater than any string or numeric value, regardless of what the subarray itself contains, and all subarrays are treated as being equal to each other. Their order relative to each other is determined by their index strings. Here are some additional things to bear in mind about sorted array traversal. @itemize @bullet @item The value of @code{PROCINFO["sorted_in"]} is global. That is, it affects all array traversal @code{for} loops. If you need to change it within your own code, you should see if it's defined and save and restore the value: @example @dots{} if ("sorted_in" in PROCINFO) @{ save_sorted = PROCINFO["sorted_in"] PROCINFO["sorted_in"] = "@@val_str_desc" # or whatever @} @dots{} if (save_sorted) PROCINFO["sorted_in"] = save_sorted @end example @item As mentioned, the default array traversal order is represented by @code{"@@unsorted"}. You can also get the default behavior by assigning the null string to @code{PROCINFO["sorted_in"]} or by just deleting the @code{"sorted_in"} element from the @code{PROCINFO} array with the @code{delete} statement. (The @code{delete} statement hasn't been described yet; @pxref{Delete}.) @end itemize In addition, @command{gawk} provides built-in functions for sorting arrays; see @ref{Array Sorting Functions}. @node Delete @section The @code{delete} Statement @cindex @code{delete} statement @cindex deleting elements in arrays @cindex arrays, elements, deleting @cindex elements in arrays, deleting To remove an individual element of an array, use the @code{delete} statement: @example delete @var{array}[@var{index-expression}] @end example Once an array element has been deleted, any value the element once had is no longer available. It is as if the element had never been referred to or been given a value. The following is an example of deleting elements in an array: @example for (i in frequencies) delete frequencies[i] @end example @noindent This example removes all the elements from the array @code{frequencies}. Once an element is deleted, a subsequent @code{for} statement to scan the array does not report that element and the @code{in} operator to check for the presence of that element returns zero (i.e., false): @example delete foo[4] if (4 in foo) print "This will never be printed" @end example @cindex null strings, array elements and It is important to note that deleting an element is @emph{not} the same as assigning it a null value (the empty string, @code{""}). For example: @example foo[4] = "" if (4 in foo) print "This is printed, even though foo[4] is empty" @end example @cindex lint checking, array elements It is not an error to delete an element that does not exist. However, if @option{--lint} is provided on the command line (@pxref{Options}), @command{gawk} issues a warning message when an element that is not in the array is deleted. @cindex common extensions, @code{delete} to delete entire arrays @cindex extensions, common@comma{} @code{delete} to delete entire arrays @cindex arrays, deleting entire contents @cindex deleting entire arrays @cindex differences in @command{awk} and @command{gawk}, array elements, deleting All the elements of an array may be deleted with a single statement @value{COMMONEXT} by leaving off the subscript in the @code{delete} statement, as follows: @example delete @var{array} @end example This ability is a @command{gawk} extension; it is not available in compatibility mode (@pxref{Options}). Using this version of the @code{delete} statement is about three times more efficient than the equivalent loop that deletes each element one at a time. @cindex portability, deleting array elements @cindex Brennan, Michael The following statement provides a portable but nonobvious way to clear out an array:@footnote{Thanks to Michael Brennan for pointing this out.} @example split("", array) @end example @cindex @code{split()} function, array elements@comma{} deleting The @code{split()} function (@pxref{String Functions}) clears out the target array first. This call asks it to split apart the null string. Because there is no data to split out, the function simply clears the array and then returns. @quotation CAUTION Deleting an array does not change its type; you cannot delete an array and then use the array's name as a scalar (i.e., a regular variable). For example, the following does not work: @example a[1] = 3 delete a a = 3 @end example @end quotation @node Numeric Array Subscripts @section Using Numbers to Subscript Arrays @cindex numbers, as array subscripts @cindex arrays, subscripts @cindex subscripts in arrays, numbers as @cindex @code{CONVFMT} variable, array subscripts and An important aspect to remember about arrays is that @emph{array subscripts are always strings}. When a numeric value is used as a subscript, it is converted to a string value before being used for subscripting (@pxref{Conversion}). This means that the value of the built-in variable @code{CONVFMT} can affect how your program accesses elements of an array. For example: @example xyz = 12.153 data[xyz] = 1 CONVFMT = "%2.2f" if (xyz in data) printf "%s is in data\n", xyz else printf "%s is not in data\n", xyz @end example @noindent This prints @samp{12.15 is not in data}. The first statement gives @code{xyz} a numeric value. Assigning to @code{data[xyz]} subscripts @code{data} with the string value @code{"12.153"} (using the default conversion value of @code{CONVFMT}, @code{"%.6g"}). Thus, the array element @code{data["12.153"]} is assigned the value one. The program then changes the value of @code{CONVFMT}. The test @samp{(xyz in data)} generates a new string value from @code{xyz}---this time @code{"12.15"}---because the value of @code{CONVFMT} only allows two significant digits. This test fails, since @code{"12.15"} is different from @code{"12.153"}. @cindex converting, during subscripting According to the rules for conversions (@pxref{Conversion}), integer values are always converted to strings as integers, no matter what the value of @code{CONVFMT} may happen to be. So the usual case of the following works: @example for (i = 1; i <= maxsub; i++) @ii{do something with} array[i] @end example The ``integer values always convert to strings as integers'' rule has an additional consequence for array indexing. Octal and hexadecimal constants (@pxref{Nondecimal-numbers}) are converted internally into numbers, and their original form is forgotten. This means, for example, that @code{array[17]}, @code{array[021]}, and @code{array[0x11]} all refer to the same element! As with many things in @command{awk}, the majority of the time things work as one would expect them to. But it is useful to have a precise knowledge of the actual rules since they can sometimes have a subtle effect on your programs. @node Uninitialized Subscripts @section Using Uninitialized Variables as Subscripts @cindex variables, uninitialized@comma{} as array subscripts @cindex uninitialized variables, as array subscripts @cindex subscripts in arrays, uninitialized variables as @cindex arrays, subscripts, uninitialized variables as Suppose it's necessary to write a program to print the input data in reverse order. A reasonable attempt to do so (with some test data) might look like this: @example $ @kbd{echo 'line 1} > @kbd{line 2} > @kbd{line 3' | awk '@{ l[lines] = $0; ++lines @}} > @kbd{END @{} > @kbd{for (i = lines-1; i >= 0; --i)} > @kbd{print l[i]} > @kbd{@}'} @print{} line 3 @print{} line 2 @end example Unfortunately, the very first line of input data did not come out in the output! Upon first glance, we would think that this program should have worked. The variable @code{lines} is uninitialized, and uninitialized variables have the numeric value zero. So, @command{awk} should have printed the value of @code{l[0]}. The issue here is that subscripts for @command{awk} arrays are @emph{always} strings. Uninitialized variables, when used as strings, have the value @code{""}, not zero. Thus, @samp{line 1} ends up stored in @code{l[""]}. The following version of the program works correctly: @example @{ l[lines++] = $0 @} END @{ for (i = lines - 1; i >= 0; --i) print l[i] @} @end example Here, the @samp{++} forces @code{lines} to be numeric, thus making the ``old value'' numeric zero. This is then converted to @code{"0"} as the array subscript. @cindex null strings, as array subscripts @cindex dark corner, array subscripts @cindex lint checking, array subscripts Even though it is somewhat unusual, the null string (@code{""}) is a valid array subscript. @value{DARKCORNER} @command{gawk} warns about the use of the null string as a subscript if @option{--lint} is provided on the command line (@pxref{Options}). @node Multi-dimensional @section Multidimensional Arrays @menu * Multi-scanning:: Scanning multidimensional arrays. @end menu @cindex subscripts in arrays, multidimensional @cindex arrays, multidimensional A multidimensional array is an array in which an element is identified by a sequence of indices instead of a single index. For example, a two-dimensional array requires two indices. The usual way (in most languages, including @command{awk}) to refer to an element of a two-dimensional array named @code{grid} is with @code{grid[@var{x},@var{y}]}. @cindex @code{SUBSEP} variable, multidimensional arrays Multidimensional arrays are supported in @command{awk} through concatenation of indices into one string. @command{awk} converts the indices into strings (@pxref{Conversion}) and concatenates them together, with a separator between them. This creates a single string that describes the values of the separate indices. The combined string is used as a single index into an ordinary, one-dimensional array. The separator used is the value of the built-in variable @code{SUBSEP}. For example, suppose we evaluate the expression @samp{foo[5,12] = "value"} when the value of @code{SUBSEP} is @code{"@@"}. The numbers 5 and 12 are converted to strings and concatenated with an @samp{@@} between them, yielding @code{"5@@12"}; thus, the array element @code{foo["5@@12"]} is set to @code{"value"}. Once the element's value is stored, @command{awk} has no record of whether it was stored with a single index or a sequence of indices. The two expressions @samp{foo[5,12]} and @w{@samp{foo[5 SUBSEP 12]}} are always equivalent. The default value of @code{SUBSEP} is the string @code{"\034"}, which contains a nonprinting character that is unlikely to appear in an @command{awk} program or in most input data. The usefulness of choosing an unlikely character comes from the fact that index values that contain a string matching @code{SUBSEP} can lead to combined strings that are ambiguous. Suppose that @code{SUBSEP} is @code{"@@"}; then @w{@samp{foo["a@@b", "c"]}} and @w{@samp{foo["a", "b@@c"]}} are indistinguishable because both are actually stored as @samp{foo["a@@b@@c"]}. To test whether a particular index sequence exists in a multidimensional array, use the same operator (@code{in}) that is used for single dimensional arrays. Write the whole sequence of indices in parentheses, separated by commas, as the left operand: @example (@var{subscript1}, @var{subscript2}, @dots{}) in @var{array} @end example The following example treats its input as a two-dimensional array of fields; it rotates this array 90 degrees clockwise and prints the result. It assumes that all lines have the same number of elements: @example @{ if (max_nf < NF) max_nf = NF max_nr = NR for (x = 1; x <= NF; x++) vector[x, NR] = $x @} END @{ for (x = 1; x <= max_nf; x++) @{ for (y = max_nr; y >= 1; --y) printf("%s ", vector[x, y]) printf("\n") @} @} @end example @noindent When given the input: @example 1 2 3 4 5 6 2 3 4 5 6 1 3 4 5 6 1 2 4 5 6 1 2 3 @end example @noindent the program produces the following output: @example 4 3 2 1 5 4 3 2 6 5 4 3 1 6 5 4 2 1 6 5 3 2 1 6 @end example @node Multi-scanning @subsection Scanning Multidimensional Arrays There is no special @code{for} statement for scanning a ``multidimensional'' array. There cannot be one, because, in truth, @command{awk} does not have multidimensional arrays or elements---there is only a multidimensional @emph{way of accessing} an array. @cindex subscripts in arrays, multidimensional, scanning @cindex arrays, multidimensional, scanning However, if your program has an array that is always accessed as multidimensional, you can get the effect of scanning it by combining the scanning @code{for} statement (@pxref{Scanning an Array}) with the built-in @code{split()} function (@pxref{String Functions}). It works in the following manner: @example for (combined in array) @{ split(combined, separate, SUBSEP) @dots{} @} @end example @noindent This sets the variable @code{combined} to each concatenated combined index in the array, and splits it into the individual indices by breaking it apart where the value of @code{SUBSEP} appears. The individual indices then become the elements of the array @code{separate}. Thus, if a value is previously stored in @code{array[1, "foo"]}, then an element with index @code{"1\034foo"} exists in @code{array}. (Recall that the default value of @code{SUBSEP} is the character with code 034.) Sooner or later, the @code{for} statement finds that index and does an iteration with the variable @code{combined} set to @code{"1\034foo"}. Then the @code{split()} function is called as follows: @example split("1\034foo", separate, "\034") @end example @noindent The result is to set @code{separate[1]} to @code{"1"} and @code{separate[2]} to @code{"foo"}. Presto! The original sequence of separate indices is recovered. @node Arrays of Arrays @section Arrays of Arrays @command{gawk} goes beyond standard @command{awk}'s multidimensional array access and provides true arrays of arrays. Elements of a subarray are referred to by their own indices enclosed in square brackets, just like the elements of the main array. For example, the following creates a two-element subarray at index @samp{1} of the main array @code{a}: @example a[1][1] = 1 a[1][2] = 2 @end example This simulates a true two-dimensional array. Each subarray element can contain another subarray as a value, which in turn can hold other arrays as well. In this way, you can create arrays of three or more dimensions. The indices can be any @command{awk} expression, including scalars separated by commas (that is, a regular @command{awk} simulated multidimensional subscript). So the following is valid in @command{gawk}: @example a[1][3][1, "name"] = "barney" @end example Each subarray and the main array can be of different length. In fact, the elements of an array or its subarray do not all have to have the same type. This means that the main array and any of its subarrays can be non-rectangular, or jagged in structure. One can assign a scalar value to the index @samp{4} of the main array @code{a}: @example a[4] = "An element in a jagged array" @end example The terms @dfn{dimension}, @dfn{row} and @dfn{column} are meaningless when applied to such an array, but we will use ``dimension'' henceforth to imply the maximum number of indices needed to refer to an existing element. The type of any element that has already been assigned cannot be changed by assigning a value of a different type. You have to first delete the current element, which effectively makes @command{gawk} forget about the element at that index: @example delete a[4] a[4][5][6][7] = "An element in a four-dimensional array" @end example @noindent This removes the scalar value from index @samp{4} and then inserts a subarray of subarray of subarray containing a scalar. You can also delete an entire subarray or subarray of subarrays: @example delete a[4][5] a[4][5] = "An element in subarray a[4]" @end example But recall that you can not delete the main array @code{a} and then use it as a scalar. The built-in functions which take array arguments can also be used with subarrays. For example, the following code fragment uses @code{length()} (@pxref{String Functions}) to determine the number of elements in the main array @code{a} and its subarrays: @example print length(a), length(a[1]), length(a[1][3]) @end example @noindent This results in the following output for our main array @code{a}: @example 2, 3, 1 @end example @noindent The @samp{@var{subscript} in @var{array}} expression (@pxref{Reference to Elements}) works similarly for both regular @command{awk}-style arrays and arrays of arrays. For example, the tests @samp{1 in a}, @samp{3 in a[1]}, and @samp{(1, "name") in a[1][3]} all evaluate to one (true) for our array @code{a}. The @samp{for (item in array)} statement (@pxref{Scanning an Array}) can be nested to scan all the elements of an array of arrays if it is rectangular in structure. In order to print the contents (scalar values) of a two-dimensional array of arrays (i.e., in which each first-level element is itself an array, not necessarily of the same length) you could use the following code: @example for (i in array) for (j in array[i]) print array[i][j] @end example The @code{isarray()} function (@pxref{Type Functions}) lets you test if an array element is itself an array: @example for (i in array) @{ if (isarray(array[i]) @{ for (j in array[i]) @{ print array[i][j] @} @} @} @end example If the structure of a jagged array of arrays is known in advance, you can often devise workarounds using control statements. For example, the following code prints the elements of our main array @code{a}: @example for (i in a) @{ for (j in a[i]) @{ if (j == 3) @{ for (k in a[i][j]) print a[i][j][k] @} else print a[i][j] @} @} @end example @noindent @xref{Walking Arrays}, for a user-defined function that will ``walk'' an arbitrarily-dimensioned array of arrays. Recall that a reference to an uninitialized array element yields a value of @code{""}, the null string. This has one important implication when you intend to use a subarray as an argument to a function, as illustrated by the following example: @example $ @kbd{gawk 'BEGIN @{ split("a b c d", b[1]); print b[1][1] @}'} @error{} gawk: cmd. line:1: fatal: split: second argument is not an array @end example The way to work around this is to first force @code{b[1]} to be an array by creating an arbitrary index: @example $ @kbd{gawk 'BEGIN @{ b[1][1] = ""; split("a b c d", b[1]); print b[1][1] @}'} @print{} a @end example @c ENDOFRANGE arrs @node Functions @chapter Functions @c STARTOFRANGE funcbi @cindex functions, built-in @c STARTOFRANGE bifunc @cindex built-in functions This @value{CHAPTER} describes @command{awk}'s built-in functions, which fall into three categories: numeric, string, and I/O. @command{gawk} provides additional groups of functions to work with values that represent time, do bit manipulation, sort arrays, and internationalize and localize programs. Besides the built-in functions, @command{awk} has provisions for writing new functions that the rest of a program can use. The second half of this @value{CHAPTER} describes these @dfn{user-defined} functions. @menu * Built-in:: Summarizes the built-in functions. * User-defined:: Describes User-defined functions in detail. * Indirect Calls:: Choosing the function to call at runtime. @end menu @node Built-in @section Built-in Functions @dfn{Built-in} functions are always available for your @command{awk} program to call. This @value{SECTION} defines all the built-in functions in @command{awk}; some of these are mentioned in other sections but are summarized here for your convenience. @menu * Calling Built-in:: How to call built-in functions. * Numeric Functions:: Functions that work with numbers, including @code{int()}, @code{sin()} and @code{rand()}. * String Functions:: Functions for string manipulation, such as @code{split()}, @code{match()} and @code{sprintf()}. * I/O Functions:: Functions for files and shell commands. * Time Functions:: Functions for dealing with timestamps. * Bitwise Functions:: Functions for bitwise operations. * Type Functions:: Functions for type information. * I18N Functions:: Functions for string translation. @end menu @node Calling Built-in @subsection Calling Built-in Functions To call one of @command{awk}'s built-in functions, write the name of the function followed by arguments in parentheses. For example, @samp{atan2(y + z, 1)} is a call to the function @code{atan2()} and has two arguments. @cindex programming conventions, functions, calling @cindex whitespace, functions@comma{} calling Whitespace is ignored between the built-in function name and the open parenthesis, but nonetheless it is good practice to avoid using whitespace there. User-defined functions do not permit whitespace in this way, and it is easier to avoid mistakes by following a simple convention that always works---no whitespace after a function name. @cindex troubleshooting, @command{gawk}, fatal errors@comma{} function arguments @cindex @command{gawk}, function arguments and @cindex differences in @command{awk} and @command{gawk}, function arguments (@command{gawk}) Each built-in function accepts a certain number of arguments. In some cases, arguments can be omitted. The defaults for omitted arguments vary from function to function and are described under the individual functions. In some @command{awk} implementations, extra arguments given to built-in functions are ignored. However, in @command{gawk}, it is a fatal error to give extra arguments to a built-in function. When a function is called, expressions that create the function's actual parameters are evaluated completely before the call is performed. For example, in the following code fragment: @example i = 4 j = sqrt(i++) @end example @cindex evaluation order, functions @cindex functions, built-in, evaluation order @cindex built-in functions, evaluation order @noindent the variable @code{i} is incremented to the value five before @code{sqrt()} is called with a value of four for its actual parameter. The order of evaluation of the expressions used for the function's parameters is undefined. Thus, avoid writing programs that assume that parameters are evaluated from left to right or from right to left. For example: @example i = 5 j = atan2(i++, i *= 2) @end example If the order of evaluation is left to right, then @code{i} first becomes 6, and then 12, and @code{atan2()} is called with the two arguments 6 and 12. But if the order of evaluation is right to left, @code{i} first becomes 10, then 11, and @code{atan2()} is called with the two arguments 11 and 10. @node Numeric Functions @subsection Numeric Functions The following list describes all of the built-in functions that work with numbers. Optional parameters are enclosed in square brackets@w{ ([ ]):} @table @code @item atan2(@var{y}, @var{x}) @cindex @code{atan2()} function Return the arctangent of @code{@var{y} / @var{x}} in radians. You can use @samp{pi = atan2(0, -1)} to retrieve the value of @tex $\pi$. @end tex @ifnottex pi. @end ifnottex @item cos(@var{x}) @cindex @code{cos()} function Return the cosine of @var{x}, with @var{x} in radians. @item exp(@var{x}) @cindex @code{exp()} function Return the exponential of @var{x} (@code{e ^ @var{x}}) or report an error if @var{x} is out of range. The range of values @var{x} can have depends on your machine's floating-point representation. @item int(@var{x}) @cindex @code{int()} function Return the nearest integer to @var{x}, located between @var{x} and zero and truncated toward zero. For example, @code{int(3)} is 3, @code{int(3.9)} is 3, @code{int(-3.9)} is @minus{}3, and @code{int(-3)} is @minus{}3 as well. @item log(@var{x}) @cindex @code{log()} function Return the natural logarithm of @var{x}, if @var{x} is positive; otherwise, report an error. @item rand() @cindex @code{rand()} function @cindex random numbers, @code{rand()}/@code{srand()} functions Return a random number. The values of @code{rand()} are uniformly distributed between zero and one. The value could be zero but is never one.@footnote{The C version of @code{rand()} on many Unix systems is known to produce fairly poor sequences of random numbers. However, nothing requires that an @command{awk} implementation use the C @code{rand()} to implement the @command{awk} version of @code{rand()}. In fact, @command{gawk} uses the BSD @code{random()} function, which is considerably better than @code{rand()}, to produce random numbers.} Often random integers are needed instead. Following is a user-defined function that can be used to obtain a random non-negative integer less than @var{n}: @example function randint(n) @{ return int(n * rand()) @} @end example @noindent The multiplication produces a random number greater than zero and less than @code{n}. Using @code{int()}, this result is made into an integer between zero and @code{n} @minus{} 1, inclusive. The following example uses a similar function to produce random integers between one and @var{n}. This program prints a new random number for each input record: @example # Function to roll a simulated die. function roll(n) @{ return 1 + int(rand() * n) @} # Roll 3 six-sided dice and # print total number of points. @{ printf("%d points\n", roll(6)+roll(6)+roll(6)) @} @end example @cindex numbers, random @cindex random numbers, seed of @quotation CAUTION In most @command{awk} implementations, including @command{gawk}, @code{rand()} starts generating numbers from the same starting number, or @dfn{seed}, each time you run @command{awk}.@footnote{@command{mawk} uses a different seed each time.} Thus, a program generates the same results each time you run it. The numbers are random within one @command{awk} run but predictable from run to run. This is convenient for debugging, but if you want a program to do different things each time it is used, you must change the seed to a value that is different in each run. To do this, use @code{srand()}. @end quotation @item sin(@var{x}) @cindex @code{sin()} function Return the sine of @var{x}, with @var{x} in radians. @item sqrt(@var{x}) @cindex @code{sqrt()} function Return the positive square root of @var{x}. @command{gawk} prints a warning message if @var{x} is negative. Thus, @code{sqrt(4)} is 2. @item srand(@r{[}@var{x}@r{]}) @cindex @code{srand()} function Set the starting point, or seed, for generating random numbers to the value @var{x}. Each seed value leads to a particular sequence of random numbers.@footnote{Computer-generated random numbers really are not truly random. They are technically known as ``pseudorandom.'' This means that while the numbers in a sequence appear to be random, you can in fact generate the same sequence of random numbers over and over again.} Thus, if the seed is set to the same value a second time, the same sequence of random numbers is produced again. @quotation CAUTION Different @command{awk} implementations use different random-number generators internally. Don't expect the same @command{awk} program to produce the same series of random numbers when executed by different versions of @command{awk}. @end quotation If the argument @var{x} is omitted, as in @samp{srand()}, then the current date and time of day are used for a seed. This is the way to get random numbers that are truly unpredictable. The return value of @code{srand()} is the previous seed. This makes it easy to keep track of the seeds in case you need to consistently reproduce sequences of random numbers. @end table @node String Functions @subsection String-Manipulation Functions The functions in this @value{SECTION} look at or change the text of one or more strings. @code{gawk} understands locales (@pxref{Locales}), and does all string processing in terms of @emph{characters}, not @emph{bytes}. This distinction is particularly important to understand for locales where one character may be represented by multiple bytes. Thus, for example, @code{length()} returns the number of characters in a string, and not the number of bytes used to represent those characters, Similarly, @code{index()} works with character indices, and not byte indices. In the following list, optional parameters are enclosed in square brackets@w{ ([ ]).} Several functions perform string substitution; the full discussion is provided in the description of the @code{sub()} function, which comes towards the end since the list is presented in alphabetic order. Those functions that are specific to @command{gawk} are marked with a pound sign@w{ (@samp{#}):} @menu * Gory Details:: More than you want to know about @samp{\} and @samp{&} with @code{sub()}, @code{gsub()}, and @code{gensub()}. @end menu @table @code @item asort(@var{source} @r{[}, @var{dest} @r{[}, @var{how} @r{]} @r{]}) # @cindex arrays, elements, retrieving number of @cindex @code{asort()} function (@command{gawk}) @cindex @command{gawk}, @code{IGNORECASE} variable in @cindex @code{IGNORECASE} variable Return the number of elements in the array @var{source}. @command{gawk} sorts the contents of @var{source} and replaces the indices of the sorted values of @var{source} with sequential integers starting with one. If the optional array @var{dest} is specified, then @var{source} is duplicated into @var{dest}. @var{dest} is then sorted, leaving the indices of @var{source} unchanged. The optional third argument @var{how} is a string which controls the rule for comparing values, and the sort direction. A single space is required between the comparison mode, @samp{string} or @samp{number}, and the direction specification, @samp{ascending} or @samp{descending}. You can omit direction and/or mode in which case it will default to @samp{ascending} and @samp{string}, respectively. An empty string "" is the same as the default @code{"ascending string"} for the value of @var{how}. If the @samp{source} array contains subarrays as values, they will come out last(first) in the @samp{dest} array for @samp{ascending}(@samp{descending}) order specification. The value of @code{IGNORECASE} affects the sorting. The third argument can also be a user-defined function name in which case the value returned by the function is used to order the array elements before constructing the result array. @xref{Array Sorting Functions}, for more information. For example, if the contents of @code{a} are as follows: @example a["last"] = "de" a["first"] = "sac" a["middle"] = "cul" @end example @noindent A call to @code{asort()}: @example asort(a) @end example @noindent results in the following contents of @code{a}: @example a[1] = "cul" a[2] = "de" a[3] = "sac" @end example In order to reverse the direction of the sorted results in the above example, @code{asort()} can be called with three arguments as follows: @example asort(a, a, "descending") @end example The @code{asort()} function is described in more detail in @ref{Array Sorting Functions}. @code{asort()} is a @command{gawk} extension; it is not available in compatibility mode (@pxref{Options}). @item asorti(@var{source} @r{[}, @var{dest} @r{[}, @var{how} @r{]} @r{]}) # @cindex @code{asorti()} function (@command{gawk}) Return the number of elements in the array @var{source}. It works similarly to @code{asort()}, however, the @emph{indices} are sorted, instead of the values. (Here too, @code{IGNORECASE} affects the sorting.) The @code{asorti()} function is described in more detail in @ref{Array Sorting Functions}. @code{asorti()} is a @command{gawk} extension; it is not available in compatibility mode (@pxref{Options}). @item gensub(@var{regexp}, @var{replacement}, @var{how} @r{[}, @var{target}@r{]}) # @cindex @code{gensub()} function (@command{gawk}) Search the target string @var{target} for matches of the regular expression @var{regexp}. If @var{how} is a string beginning with @samp{g} or @samp{G} (short for ``global''), then replace all matches of @var{regexp} with @var{replacement}. Otherwise, @var{how} is treated as a number indicating which match of @var{regexp} to replace. If no @var{target} is supplied, use @code{$0}. It returns the modified string as the result of the function and the original target string is @emph{not} changed. @code{gensub()} is a general substitution function. It's purpose is to provide more features than the standard @code{sub()} and @code{gsub()} functions. @code{gensub()} provides an additional feature that is not available in @code{sub()} or @code{gsub()}: the ability to specify components of a regexp in the replacement text. This is done by using parentheses in the regexp to mark the components and then specifying @samp{\@var{N}} in the replacement text, where @var{N} is a digit from 1 to 9. For example: @example $ @kbd{gawk '} > @kbd{BEGIN @{} > @kbd{a = "abc def"} > @kbd{b = gensub(/(.+) (.+)/, "\\2 \\1", "g", a)} > @kbd{print b} > @kbd{@}'} @print{} def abc @end example @noindent As with @code{sub()}, you must type two backslashes in order to get one into the string. In the replacement text, the sequence @samp{\0} represents the entire matched text, as does the character @samp{&}. The following example shows how you can use the third argument to control which match of the regexp should be changed: @example $ @kbd{echo a b c a b c |} > @kbd{gawk '@{ print gensub(/a/, "AA", 2) @}'} @print{} a b c AA b c @end example In this case, @code{$0} is the default target string. @code{gensub()} returns the new string as its result, which is passed directly to @code{print} for printing. @c @cindex automatic warnings @c @cindex warnings, automatic If the @var{how} argument is a string that does not begin with @samp{g} or @samp{G}, or if it is a number that is less than or equal to zero, only one substitution is performed. If @var{how} is zero, @command{gawk} issues a warning message. If @var{regexp} does not match @var{target}, @code{gensub()}'s return value is the original unchanged value of @var{target}. @code{gensub()} is a @command{gawk} extension; it is not available in compatibility mode (@pxref{Options}). @item gsub(@var{regexp}, @var{replacement} @r{[}, @var{target}@r{]}) @cindex @code{gsub()} function Search @var{target} for @emph{all} of the longest, leftmost, @emph{nonoverlapping} matching substrings it can find and replace them with @var{replacement}. The @samp{g} in @code{gsub()} stands for ``global,'' which means replace everywhere. For example: @example @{ gsub(/Britain/, "United Kingdom"); print @} @end example @noindent replaces all occurrences of the string @samp{Britain} with @samp{United Kingdom} for all input records. The @code{gsub()} function returns the number of substitutions made. If the variable to search and alter (@var{target}) is omitted, then the entire input record (@code{$0}) is used. As in @code{sub()}, the characters @samp{&} and @samp{\} are special, and the third argument must be assignable. @item index(@var{in}, @var{find}) @cindex @code{index()} function @cindex searching Search the string @var{in} for the first occurrence of the string @var{find}, and return the position in characters where that occurrence begins in the string @var{in}. Consider the following example: @example $ @kbd{awk 'BEGIN @{ print index("peanut", "an") @}'} @print{} 3 @end example @noindent If @var{find} is not found, @code{index()} returns zero. (Remember that string indices in @command{awk} start at one.) @item length(@r{[}@var{string}@r{]}) @cindex @code{length()} function Return the number of characters in @var{string}. If @var{string} is a number, the length of the digit string representing that number is returned. For example, @code{length("abcde")} is five. By contrast, @code{length(15 * 35)} works out to three. In this example, 15 * 35 = 525, and 525 is then converted to the string @code{"525"}, which has three characters. If no argument is supplied, @code{length()} returns the length of @code{$0}. @c @cindex historical features @cindex portability, @code{length()} function @cindex POSIX @command{awk}, functions and, @code{length()} @quotation NOTE In older versions of @command{awk}, the @code{length()} function could be called without any parentheses. Doing so is considered poor practice, although the 2008 POSIX standard explicitly allows it, to support historical practice. For programs to be maximally portable, always supply the parentheses. @end quotation @cindex dark corner, @code{length()} function If @code{length()} is called with a variable that has not been used, @command{gawk} forces the variable to be a scalar. Other implementations of @command{awk} leave the variable without a type. @value{DARKCORNER} Consider: @example $ @kbd{gawk 'BEGIN @{ print length(x) ; x[1] = 1 @}'} @print{} 0 @error{} gawk: fatal: attempt to use scalar `x' as array $ @kbd{nawk 'BEGIN @{ print length(x) ; x[1] = 1 @}'} @print{} 0 @end example @noindent If @option{--lint} has been specified on the command line, @command{gawk} issues a warning about this. @cindex common extensions, @code{length()} applied to an array @cindex extensions, common@comma{} @code{length()} applied to an array @cindex differences between @command{gawk} and @command{awk} With @command{gawk} and several other @command{awk} implementations, when given an array argument, the @code{length()} function returns the number of elements in the array. @value{COMMONEXT} This is less useful than it might seem at first, as the array is not guaranteed to be indexed from one to the number of elements in it. If @option{--lint} is provided on the command line (@pxref{Options}), @command{gawk} warns that passing an array argument is not portable. If @option{--posix} is supplied, using an array argument is a fatal error (@pxref{Arrays}). @item match(@var{string}, @var{regexp} @r{[}, @var{array}@r{]}) @cindex @code{match()} function Search @var{string} for the longest, leftmost substring matched by the regular expression, @var{regexp} and return the character position, or @dfn{index}, at which that substring begins (one, if it starts at the beginning of @var{string}). If no match is found, return zero. The @var{regexp} argument may be either a regexp constant (@code{/@dots{}/}) or a string constant (@code{"@dots{}"}). In the latter case, the string is treated as a regexp to be matched. @xref{Computed Regexps}, for a discussion of the difference between the two forms, and the implications for writing your program correctly. The order of the first two arguments is backwards from most other string functions that work with regular expressions, such as @code{sub()} and @code{gsub()}. It might help to remember that for @code{match()}, the order is the same as for the @samp{~} operator: @samp{@var{string} ~ @var{regexp}}. @cindex @code{RSTART} variable, @code{match()} function and @cindex @code{RLENGTH} variable, @code{match()} function and @cindex @code{match()} function, @code{RSTART}/@code{RLENGTH} variables The @code{match()} function sets the built-in variable @code{RSTART} to the index. It also sets the built-in variable @code{RLENGTH} to the length in characters of the matched substring. If no match is found, @code{RSTART} is set to zero, and @code{RLENGTH} to @minus{}1. For example: @example @c file eg/misc/findpat.awk @{ if ($1 == "FIND") regex = $2 else @{ where = match($0, regex) if (where != 0) print "Match of", regex, "found at", where, "in", $0 @} @} @c endfile @end example @noindent This program looks for lines that match the regular expression stored in the variable @code{regex}. This regular expression can be changed. If the first word on a line is @samp{FIND}, @code{regex} is changed to be the second word on that line. Therefore, if given: @example @c file eg/misc/findpat.data FIND ru+n My program runs but not very quickly FIND Melvin JF+KM This line is property of Reality Engineering Co. Melvin was here. @c endfile @end example @noindent @command{awk} prints: @example Match of ru+n found at 12 in My program runs Match of Melvin found at 1 in Melvin was here. @end example @cindex differences in @command{awk} and @command{gawk}, @code{match()} function If @var{array} is present, it is cleared, and then the zeroth element of @var{array} is set to the entire portion of @var{string} matched by @var{regexp}. If @var{regexp} contains parentheses, the integer-indexed elements of @var{array} are set to contain the portion of @var{string} matching the corresponding parenthesized subexpression. For example: @example $ @kbd{echo foooobazbarrrrr |} > @kbd{gawk '@{ match($0, /(fo+).+(bar*)/, arr)} > @kbd{print arr[1], arr[2] @}'} @print{} foooo barrrrr @end example In addition, multidimensional subscripts are available providing the start index and length of each matched subexpression: @example $ @kbd{echo foooobazbarrrrr |} > @kbd{gawk '@{ match($0, /(fo+).+(bar*)/, arr)} > @kbd{print arr[1], arr[2]} > @kbd{print arr[1, "start"], arr[1, "length"]} > @kbd{print arr[2, "start"], arr[2, "length"]} > @kbd{@}'} @print{} foooo barrrrr @print{} 1 5 @print{} 9 7 @end example There may not be subscripts for the start and index for every parenthesized subexpression, since they may not all have matched text; thus they should be tested for with the @code{in} operator (@pxref{Reference to Elements}). @cindex troubleshooting, @code{match()} function The @var{array} argument to @code{match()} is a @command{gawk} extension. In compatibility mode (@pxref{Options}), using a third argument is a fatal error. @item patsplit(@var{string}, @var{array} @r{[}, @var{fieldpat} @r{[}, @var{seps} @r{]} @r{]}) # @cindex @code{patsplit()} function Divide @var{string} into pieces defined by @var{fieldpat} and store the pieces in @var{array} and the separator strings in the @var{seps} array. The first piece is stored in @code{@var{array}[1]}, the second piece in @code{@var{array}[2]}, and so forth. The third argument, @var{fieldpat}, is a regexp describing the fields in @var{string} (just as @code{FPAT} is a regexp describing the fields in input records). It may be either a regexp constant or a string. If @var{fieldpat} is omitted, the value of @code{FPAT} is used. @code{patsplit()} returns the number of elements created. @code{@var{seps}[@var{i}]} is the separator string between @code{@var{array}[@var{i}]} and @code{@var{array}[@var{i}+1]}. Any leading separator will be in @code{@var{seps}[0]}. The @code{patsplit()} function splits strings into pieces in a manner similar to the way input lines are split into fields using @code{FPAT} (@pxref{Splitting By Content}. Before splitting the string, @code{patsplit()} deletes any previously existing elements in the arrays @var{array} and @var{seps}. @cindex troubleshooting, @code{patsplit()} function The @code{patsplit()} function is a @command{gawk} extension. In compatibility mode (@pxref{Options}), it is not available. @item split(@var{string}, @var{array} @r{[}, @var{fieldsep} @r{[}, @var{seps} @r{]} @r{]}) @cindex @code{split()} function Divide @var{string} into pieces separated by @var{fieldsep} and store the pieces in @var{array} and the separator strings in the @var{seps} array. The first piece is stored in @code{@var{array}[1]}, the second piece in @code{@var{array}[2]}, and so forth. The string value of the third argument, @var{fieldsep}, is a regexp describing where to split @var{string} (much as @code{FS} can be a regexp describing where to split input records; @pxref{Regexp Field Splitting}). If @var{fieldsep} is omitted, the value of @code{FS} is used. @code{split()} returns the number of elements created. @var{seps} is a @command{gawk} extension with @code{@var{seps}[@var{i}]} being the separator string between @code{@var{array}[@var{i}]} and @code{@var{array}[@var{i}+1]}. If @var{fieldsep} is a single space then any leading whitespace goes into @code{@var{seps}[0]} and any trailing whitespace goes into @code{@var{seps}[@var{n}]} where @var{n} is the return value of @code{split()} (that is, the number of elements in @var{array}). The @code{split()} function splits strings into pieces in a manner similar to the way input lines are split into fields. For example: @example split("cul-de-sac", a, "-", seps) @end example @noindent @cindex strings, splitting splits the string @samp{cul-de-sac} into three fields using @samp{-} as the separator. It sets the contents of the array @code{a} as follows: @example a[1] = "cul" a[2] = "de" a[3] = "sac" @end example and sets the contents of the array @code{seps} as follows: @example seps[1] = "-" seps[2] = "-" @end example @noindent The value returned by this call to @code{split()} is three. @cindex differences in @command{awk} and @command{gawk}, @code{split()} function As with input field-splitting, when the value of @var{fieldsep} is @w{@code{" "}}, leading and trailing whitespace is ignored in values assigned to the elements of @var{array} but not in @var{seps}, and the elements are separated by runs of whitespace. Also as with input field-splitting, if @var{fieldsep} is the null string, each individual character in the string is split into its own array element. @value{COMMONEXT} Note, however, that @code{RS} has no effect on the way @code{split()} works. Even though @samp{RS = ""} causes newline to also be an input field separator, this does not affect how @code{split()} splits strings. @cindex dark corner, @code{split()} function Modern implementations of @command{awk}, including @command{gawk}, allow the third argument to be a regexp constant (@code{/abc/}) as well as a string. @value{DARKCORNER} The POSIX standard allows this as well. @xref{Computed Regexps}, for a discussion of the difference between using a string constant or a regexp constant, and the implications for writing your program correctly. Before splitting the string, @code{split()} deletes any previously existing elements in the arrays @var{array} and @var{seps}. If @var{string} is null, the array has no elements. (So this is a portable way to delete an entire array with one statement. @xref{Delete}.) If @var{string} does not match @var{fieldsep} at all (but is not null), @var{array} has one element only. The value of that element is the original @var{string}. @item sprintf(@var{format}, @var{expression1}, @dots{}) @cindex @code{sprintf()} function Return (without printing) the string that @code{printf} would have printed out with the same arguments (@pxref{Printf}). For example: @example pival = sprintf("pi = %.2f (approx.)", 22/7) @end example @noindent assigns the string @w{@samp{pi = 3.14 (approx.)}} to the variable @code{pival}. @cindex @code{strtonum()} function (@command{gawk}) @item strtonum(@var{str}) # Examine @var{str} and return its numeric value. If @var{str} begins with a leading @samp{0}, @code{strtonum()} assumes that @var{str} is an octal number. If @var{str} begins with a leading @samp{0x} or @samp{0X}, @code{strtonum()} assumes that @var{str} is a hexadecimal number. For example: @example $ @kbd{echo 0x11 |} > @kbd{gawk '@{ printf "%d\n", strtonum($1) @}'} @print{} 17 @end example Using the @code{strtonum()} function is @emph{not} the same as adding zero to a string value; the automatic coercion of strings to numbers works only for decimal data, not for octal or hexadecimal.@footnote{Unless you use the @option{--non-decimal-data} option, which isn't recommended. @xref{Nondecimal Data}, for more information.} Note also that @code{strtonum()} uses the current locale's decimal point for recognizing numbers (@pxref{Locales}). @cindex differences in @command{awk} and @command{gawk}, @code{strtonum()} function (@command{gawk}) @code{strtonum()} is a @command{gawk} extension; it is not available in compatibility mode (@pxref{Options}). @item sub(@var{regexp}, @var{replacement} @r{[}, @var{target}@r{]}) @cindex @code{sub()} function Search @var{target}, which is treated as a string, for the leftmost, longest substring matched by the regular expression @var{regexp}. Modify the entire string by replacing the matched text with @var{replacement}. The modified string becomes the new value of @var{target}. Return the number of substitutions made (zero or one). The @var{regexp} argument may be either a regexp constant (@code{/@dots{}/}) or a string constant (@code{"@dots{}"}). In the latter case, the string is treated as a regexp to be matched. @xref{Computed Regexps}, for a discussion of the difference between the two forms, and the implications for writing your program correctly. This function is peculiar because @var{target} is not simply used to compute a value, and not just any expression will do---it must be a variable, field, or array element so that @code{sub()} can store a modified value there. If this argument is omitted, then the default is to use and alter @code{$0}.@footnote{Note that this means that the record will first be regenerated using the value of @code{OFS} if any fields have been changed, and that the fields will be updated after the substitution, even if the operation is a ``no-op'' such as @samp{sub(/^/, "")}.} For example: @example str = "water, water, everywhere" sub(/at/, "ith", str) @end example @noindent sets @code{str} to @w{@samp{wither, water, everywhere}}, by replacing the leftmost longest occurrence of @samp{at} with @samp{ith}. If the special character @samp{&} appears in @var{replacement}, it stands for the precise substring that was matched by @var{regexp}. (If the regexp can match more than one string, then this precise substring may vary.) For example: @example @{ sub(/candidate/, "& and his wife"); print @} @end example @noindent changes the first occurrence of @samp{candidate} to @samp{candidate and his wife} on each input line. Here is another example: @example $ @kbd{awk 'BEGIN @{} > @kbd{str = "daabaaa"} > @kbd{sub(/a+/, "C&C", str)} > @kbd{print str} > @kbd{@}'} @print{} dCaaCbaaa @end example @noindent This shows how @samp{&} can represent a nonconstant string and also illustrates the ``leftmost, longest'' rule in regexp matching (@pxref{Leftmost Longest}). The effect of this special character (@samp{&}) can be turned off by putting a backslash before it in the string. As usual, to insert one backslash in the string, you must write two backslashes. Therefore, write @samp{\\&} in a string constant to include a literal @samp{&} in the replacement. For example, the following shows how to replace the first @samp{|} on each line with an @samp{&}: @example @{ sub(/\|/, "\\&"); print @} @end example @cindex @code{sub()} function, arguments of @cindex @code{gsub()} function, arguments of As mentioned, the third argument to @code{sub()} must be a variable, field or array element. Some versions of @command{awk} allow the third argument to be an expression that is not an lvalue. In such a case, @code{sub()} still searches for the pattern and returns zero or one, but the result of the substitution (if any) is thrown away because there is no place to put it. Such versions of @command{awk} accept expressions like the following: @example sub(/USA/, "United States", "the USA and Canada") @end example @noindent @cindex troubleshooting, @code{gsub()}/@code{sub()} functions For historical compatibility, @command{gawk} accepts such erroneous code. However, using any other nonchangeable object as the third parameter causes a fatal error and your program will not run. Finally, if the @var{regexp} is not a regexp constant, it is converted into a string, and then the value of that string is treated as the regexp to match. @item substr(@var{string}, @var{start} @r{[}, @var{length}@r{]}) @cindex @code{substr()} function Return a @var{length}-character-long substring of @var{string}, starting at character number @var{start}. The first character of a string is character number one.@footnote{This is different from C and C++, in which the first character is number zero.} For example, @code{substr("washington", 5, 3)} returns @code{"ing"}. If @var{length} is not present, @code{substr()} returns the whole suffix of @var{string} that begins at character number @var{start}. For example, @code{substr("washington", 5)} returns @code{"ington"}. The whole suffix is also returned if @var{length} is greater than the number of characters remaining in the string, counting from character @var{start}. If @var{start} is less than one, @code{substr()} treats it as if it was one. (POSIX doesn't specify what to do in this case: Brian Kernighan's @command{awk} acts this way, and therefore @command{gawk} does too.) If @var{start} is greater than the number of characters in the string, @code{substr()} returns the null string. Similarly, if @var{length} is present but less than or equal to zero, the null string is returned. @cindex troubleshooting, @code{substr()} function The string returned by @code{substr()} @emph{cannot} be assigned. Thus, it is a mistake to attempt to change a portion of a string, as shown in the following example: @example string = "abcdef" # try to get "abCDEf", won't work substr(string, 3, 3) = "CDE" @end example @noindent It is also a mistake to use @code{substr()} as the third argument of @code{sub()} or @code{gsub()}: @example gsub(/xyz/, "pdq", substr($0, 5, 20)) # WRONG @end example @cindex portability, @code{substr()} function (Some commercial versions of @command{awk} treat @code{substr()} as assignable, but doing so is not portable.) If you need to replace bits and pieces of a string, combine @code{substr()} with string concatenation, in the following manner: @example string = "abcdef" @dots{} string = substr(string, 1, 2) "CDE" substr(string, 6) @end example @cindex case sensitivity, converting case @cindex converting, case @item tolower(@var{string}) @cindex @code{tolower()} function Return a copy of @var{string}, with each uppercase character in the string replaced with its corresponding lowercase character. Nonalphabetic characters are left unchanged. For example, @code{tolower("MiXeD cAsE 123")} returns @code{"mixed case 123"}. @item toupper(@var{string}) @cindex @code{toupper()} function Return a copy of @var{string}, with each lowercase character in the string replaced with its corresponding uppercase character. Nonalphabetic characters are left unchanged. For example, @code{toupper("MiXeD cAsE 123")} returns @code{"MIXED CASE 123"}. @end table @node Gory Details @subsubsection More About @samp{\} and @samp{&} with @code{sub()}, @code{gsub()}, and @code{gensub()} @cindex escape processing, @code{gsub()}/@code{gensub()}/@code{sub()} functions @cindex @code{sub()} function, escape processing @cindex @code{gsub()} function, escape processing @cindex @code{gensub()} function (@command{gawk}), escape processing @cindex @code{\} (backslash), @code{gsub()}/@code{gensub()}/@code{sub()} functions and @cindex backslash (@code{\}), @code{gsub()}/@code{gensub()}/@code{sub()} functions and @cindex @code{&} (ampersand), @code{gsub()}/@code{gensub()}/@code{sub()} functions and @cindex ampersand (@code{&}), @code{gsub()}/@code{gensub()}/@code{sub()} functions and When using @code{sub()}, @code{gsub()}, or @code{gensub()}, and trying to get literal backslashes and ampersands into the replacement text, you need to remember that there are several levels of @dfn{escape processing} going on. First, there is the @dfn{lexical} level, which is when @command{awk} reads your program and builds an internal copy of it that can be executed. Then there is the runtime level, which is when @command{awk} actually scans the replacement string to determine what to generate. At both levels, @command{awk} looks for a defined set of characters that can come after a backslash. At the lexical level, it looks for the escape sequences listed in @ref{Escape Sequences}. Thus, for every @samp{\} that @command{awk} processes at the runtime level, you must type two backslashes at the lexical level. When a character that is not valid for an escape sequence follows the @samp{\}, Brian Kernighan's @command{awk} and @command{gawk} both simply remove the initial @samp{\} and put the next character into the string. Thus, for example, @code{"a\qb"} is treated as @code{"aqb"}. At the runtime level, the various functions handle sequences of @samp{\} and @samp{&} differently. The situation is (sadly) somewhat complex. Historically, the @code{sub()} and @code{gsub()} functions treated the two character sequence @samp{\&} specially; this sequence was replaced in the generated text with a single @samp{&}. Any other @samp{\} within the @var{replacement} string that did not precede an @samp{&} was passed through unchanged. This is illustrated in @ref{table-sub-escapes}. @c Thank to Karl Berry for help with the TeX stuff. @float Table,table-sub-escapes @caption{Historical Escape Sequence Processing for @code{sub()} and @code{gsub()}} @tex \vbox{\bigskip % This table has lots of &'s and \'s, so unspecialize them. \catcode`\& = \other \catcode`\\ = \other % But then we need character for escape and tab. @catcode`! = 4 @halign{@hfil#!@qquad@hfil#!@qquad#@hfil@cr You type!@code{sub()} sees!@code{sub()} generates@cr @hrulefill!@hrulefill!@hrulefill@cr @code{\&}! @code{&}!the matched text@cr @code{\\&}! @code{\&}!a literal @samp{&}@cr @code{\\\&}! @code{\&}!a literal @samp{&}@cr @code{\\\\&}! @code{\\&}!a literal @samp{\&}@cr @code{\\\\\&}! @code{\\&}!a literal @samp{\&}@cr @code{\\\\\\&}! @code{\\\&}!a literal @samp{\\&}@cr @code{\\q}! @code{\q}!a literal @samp{\q}@cr } @bigskip} @end tex @ifdocbook @multitable @columnfractions .20 .20 .60 @headitem You type @tab @code{sub()} sees @tab @code{sub()} generates @item @code{\&} @tab @code{&} @tab the matched text @item @code{\\&} @tab @code{\&} @tab a literal @samp{&} @item @code{\\\&} @tab @code{\&} @tab a literal @samp{&} @item @code{\\\\&} @tab @code{\\&} @tab a literal @samp{\&} @item @code{\\\\\&} @tab @code{\\&} @tab a literal @samp{\&} @item @code{\\\\\\&} @tab @code{\\\&} @tab a literal @samp{\\&} @item @code{\\q} @tab @code{\q} @tab a literal @samp{\q} @end multitable @end ifdocbook @ifnottex @ifnotdocbook @display You type @code{sub()} sees @code{sub()} generates -------- ---------- --------------- @code{\&} @code{&} the matched text @code{\\&} @code{\&} a literal @samp{&} @code{\\\&} @code{\&} a literal @samp{&} @code{\\\\&} @code{\\&} a literal @samp{\&} @code{\\\\\&} @code{\\&} a literal @samp{\&} @code{\\\\\\&} @code{\\\&} a literal @samp{\\&} @code{\\q} @code{\q} a literal @samp{\q} @end display @end ifnotdocbook @end ifnottex @end float @noindent This table shows both the lexical-level processing, where an odd number of backslashes becomes an even number at the runtime level, as well as the runtime processing done by @code{sub()}. (For the sake of simplicity, the rest of the following tables only show the case of even numbers of backslashes entered at the lexical level.) The problem with the historical approach is that there is no way to get a literal @samp{\} followed by the matched text. @c @cindex @command{awk} language, POSIX version @cindex POSIX @command{awk}, functions and, @code{gsub()}/@code{sub()} The 1992 POSIX standard attempted to fix this problem. That standard says that @code{sub()} and @code{gsub()} look for either a @samp{\} or an @samp{&} after the @samp{\}. If either one follows a @samp{\}, that character is output literally. The interpretation of @samp{\} and @samp{&} then becomes as shown in @ref{table-sub-posix-92}. @float Table,table-sub-posix-92 @caption{1992 POSIX Rules for sub and gsub Escape Sequence Processing} @c thanks to Karl Berry for formatting this table @tex \vbox{\bigskip % This table has lots of &'s and \'s, so unspecialize them. \catcode`\& = \other \catcode`\\ = \other % But then we need character for escape and tab. @catcode`! = 4 @halign{@hfil#!@qquad@hfil#!@qquad#@hfil@cr You type!@code{sub()} sees!@code{sub()} generates@cr @hrulefill!@hrulefill!@hrulefill@cr @code{&}! @code{&}!the matched text@cr @code{\\&}! @code{\&}!a literal @samp{&}@cr @code{\\\\&}! @code{\\&}!a literal @samp{\}, then the matched text@cr @code{\\\\\\&}! @code{\\\&}!a literal @samp{\&}@cr } @bigskip} @end tex @ifdocbook @multitable @columnfractions .20 .20 .60 @headitem You type @tab @code{sub()} sees @tab @code{sub()} generates @item @code{&} @tab @code{&} @tab the matched text @item @code{\\&} @tab @code{\&} @tab a literal @samp{&} @item @code{\\\\&} @tab @code{\\&} @tab a literal @samp{\}, then the matched text @item @code{\\\\\\&} @tab @code{\\\&} @tab a literal @samp{\&} @end multitable @end ifdocbook @ifnottex @ifnotdocbook @display You type @code{sub()} sees @code{sub()} generates -------- ---------- --------------- @code{&} @code{&} the matched text @code{\\&} @code{\&} a literal @samp{&} @code{\\\\&} @code{\\&} a literal @samp{\}, then the matched text @code{\\\\\\&} @code{\\\&} a literal @samp{\&} @end display @end ifnotdocbook @end ifnottex @end float @noindent This appears to solve the problem. Unfortunately, the phrasing of the standard is unusual. It says, in effect, that @samp{\} turns off the special meaning of any following character, but for anything other than @samp{\} and @samp{&}, such special meaning is undefined. This wording leads to two problems: @itemize @bullet @item Backslashes must now be doubled in the @var{replacement} string, breaking historical @command{awk} programs. @item To make sure that an @command{awk} program is portable, @emph{every} character in the @var{replacement} string must be preceded with a backslash.@footnote{This consequence was certainly unintended.} @c I can say that, 'cause I was involved in making this change @end itemize Because of the problems just listed, in 1996, the @command{gawk} maintainer submitted proposed text for a revised standard that reverts to rules that correspond more closely to the original existing practice. The proposed rules have special cases that make it possible to produce a @samp{\} preceding the matched text. This is shown in @ref{table-sub-proposed}. @float Table,table-sub-proposed @caption{Proposed rules for sub and backslash} @tex \vbox{\bigskip % This table has lots of &'s and \'s, so unspecialize them. \catcode`\& = \other \catcode`\\ = \other % But then we need character for escape and tab. @catcode`! = 4 @halign{@hfil#!@qquad@hfil#!@qquad#@hfil@cr You type!@code{sub()} sees!@code{sub()} generates@cr @hrulefill!@hrulefill!@hrulefill@cr @code{\\\\\\&}! @code{\\\&}!a literal @samp{\&}@cr @code{\\\\&}! @code{\\&}!a literal @samp{\}, followed by the matched text@cr @code{\\&}! @code{\&}!a literal @samp{&}@cr @code{\\q}! @code{\q}!a literal @samp{\q}@cr @code{\\\\}! @code{\\}!@code{\\}@cr } @bigskip} @end tex @ifdocbook @multitable @columnfractions .20 .20 .60 @headitem You type @tab @code{sub()} sees @tab @code{sub()} generates @item @code{\\\\\\&} @tab @code{\\\&} @tab a literal @samp{\&} @item @code{\\\\&} @tab @code{\\&} @tab a literal @samp{\}, followed by the matched text @item @code{\\&} @tab @code{\&} @tab a literal @samp{&} @item @code{\\q} @tab @code{\q} @tab a literal @samp{\q} @item @code{\\\\} @tab @code{\\} @tab @code{\\} @end multitable @end ifdocbook @ifnottex @ifnotdocbook @display You type @code{sub()} sees @code{sub()} generates -------- ---------- --------------- @code{\\\\\\&} @code{\\\&} a literal @samp{\&} @code{\\\\&} @code{\\&} a literal @samp{\}, followed by the matched text @code{\\&} @code{\&} a literal @samp{&} @code{\\q} @code{\q} a literal @samp{\q} @code{\\\\} @code{\\} @code{\\} @end display @end ifnotdocbook @end ifnottex @end float In a nutshell, at the runtime level, there are now three special sequences of characters (@samp{\\\&}, @samp{\\&} and @samp{\&}) whereas historically there was only one. However, as in the historical case, any @samp{\} that is not part of one of these three sequences is not special and appears in the output literally. @command{gawk} 3.0 and 3.1 follow these proposed POSIX rules for @code{sub()} and @code{gsub()}. @c As much as we think it's a lousy idea. You win some, you lose some. Sigh. The POSIX standard took much longer to be revised than was expected in 1996. The 2001 standard does not follow the above rules. Instead, the rules there are somewhat simpler. The results are similar except for one case. The POSIX rules state that @samp{\&} in the replacement string produces a literal @samp{&}, @samp{\\} produces a literal @samp{\}, and @samp{\} followed by anything else is not special; the @samp{\} is placed straight into the output. These rules are presented in @ref{table-posix-sub}. @float Table,table-posix-sub @caption{POSIX rules for @code{sub()} and @code{gsub()}} @tex \vbox{\bigskip % This table has lots of &'s and \'s, so unspecialize them. \catcode`\& = \other \catcode`\\ = \other % But then we need character for escape and tab. @catcode`! = 4 @halign{@hfil#!@qquad@hfil#!@qquad#@hfil@cr You type!@code{sub()} sees!@code{sub()} generates@cr @hrulefill!@hrulefill!@hrulefill@cr @code{\\\\\\&}! @code{\\\&}!a literal @samp{\&}@cr @code{\\\\&}! @code{\\&}!a literal @samp{\}, followed by the matched text@cr @code{\\&}! @code{\&}!a literal @samp{&}@cr @code{\\q}! @code{\q}!a literal @samp{\q}@cr @code{\\\\}! @code{\\}!@code{\}@cr } @bigskip} @end tex @ifdocbook @multitable @columnfractions .20 .20 .60 @headitem You type @tab @code{sub()} sees @tab @code{sub()} generates @item @code{\\\\\\&} @tab @code{\\\&} @tab a literal @samp{\&} @item @code{\\\\&} @tab @code{\\&} @tab a literal @samp{\}, followed by the matched text @item @code{\\&} @tab @code{\&} @tab a literal @samp{&} @item @code{\\q} @tab @code{\q} @tab a literal @samp{\q} @item @code{\\\\} @tab @code{\\} @tab @code{\} @end multitable @end ifdocbook @ifnottex @ifnotdocbook @display You type @code{sub()} sees @code{sub()} generates -------- ---------- --------------- @code{\\\\\\&} @code{\\\&} a literal @samp{\&} @code{\\\\&} @code{\\&} a literal @samp{\}, followed by the matched text @code{\\&} @code{\&} a literal @samp{&} @code{\\q} @code{\q} a literal @samp{\q} @code{\\\\} @code{\\} @code{\} @end display @end ifnotdocbook @end ifnottex @end float The only case where the difference is noticeable is the last one: @samp{\\\\} is seen as @samp{\\} and produces @samp{\} instead of @samp{\\}. Starting with @value{PVERSION} 3.1.4, @command{gawk} followed the POSIX rules when @option{--posix} is specified (@pxref{Options}). Otherwise, it continued to follow the 1996 proposed rules, since that had been its behavior for many years. When @value{PVERSION} 4.0.0, was released, the @command{gawk} maintainer made the POSIX rules the default, breaking well over a decade's worth of backwards compatibility.@footnote{This was rather naive of him, despite there being a note in this section indicating that the next major version would move to the POSIX rules.} Needless to say, this was a bad idea, and as of @value{PVERSION} 4.0.1, @command{gawk} resumed its historical behavior, and only follows the POSIX rules when @option{--posix} is given. The rules for @code{gensub()} are considerably simpler. At the runtime level, whenever @command{gawk} sees a @samp{\}, if the following character is a digit, then the text that matched the corresponding parenthesized subexpression is placed in the generated output. Otherwise, no matter what character follows the @samp{\}, it appears in the generated text and the @samp{\} does not, as shown in @ref{table-gensub-escapes}. @float Table,table-gensub-escapes @caption{Escape Sequence Processing for @code{gensub()}} @tex \vbox{\bigskip % This table has lots of &'s and \'s, so unspecialize them. \catcode`\& = \other \catcode`\\ = \other % But then we need character for escape and tab. @catcode`! = 4 @halign{@hfil#!@qquad@hfil#!@qquad#@hfil@cr You type!@code{gensub()} sees!@code{gensub()} generates@cr @hrulefill!@hrulefill!@hrulefill@cr @code{&}! @code{&}!the matched text@cr @code{\\&}! @code{\&}!a literal @samp{&}@cr @code{\\\\}! @code{\\}!a literal @samp{\}@cr @code{\\\\&}! @code{\\&}!a literal @samp{\}, then the matched text@cr @code{\\\\\\&}! @code{\\\&}!a literal @samp{\&}@cr @code{\\q}! @code{\q}!a literal @samp{q}@cr } @bigskip} @end tex @ifdocbook @multitable @columnfractions .20 .20 .60 @headitem You type @tab @code{gensub()} sees @tab @code{gensub()} generates @item @code{&} @tab @code{&} @tab the matched text @item @code{\\&} @tab @code{\&} @tab a literal @samp{&} @item @code{\\\\} @tab @code{\\} @tab a literal @samp{\} @item @code{\\\\&} @tab @code{\\&} @tab a literal @samp{\}, then the matched text @item @code{\\\\\\&} @tab @code{\\\&} @tab a literal @samp{\&} @item @code{\\q} @tab @code{\q} @tab a literal @samp{q} @end multitable @end ifdocbook @ifnottex @ifnotdocbook @display You type @code{gensub()} sees @code{gensub()} generates -------- ------------- ------------------ @code{&} @code{&} the matched text @code{\\&} @code{\&} a literal @samp{&} @code{\\\\} @code{\\} a literal @samp{\} @code{\\\\&} @code{\\&} a literal @samp{\}, then the matched text @code{\\\\\\&} @code{\\\&} a literal @samp{\&} @code{\\q} @code{\q} a literal @samp{q} @end display @end ifnotdocbook @end ifnottex @end float Because of the complexity of the lexical and runtime level processing and the special cases for @code{sub()} and @code{gsub()}, we recommend the use of @command{gawk} and @code{gensub()} when you have to do substitutions. @c fakenode --- for prepinfo @subheading Advanced Notes: Matching the Null String @cindex advanced features, null strings@comma{} matching @cindex matching, null strings @cindex null strings, matching @cindex @code{*} (asterisk), @code{*} operator, null strings@comma{} matching @cindex asterisk (@code{*}), @code{*} operator, null strings@comma{} matching In @command{awk}, the @samp{*} operator can match the null string. This is particularly important for the @code{sub()}, @code{gsub()}, and @code{gensub()} functions. For example: @example $ @kbd{echo abc | awk '@{ gsub(/m*/, "X"); print @}'} @print{} XaXbXcX @end example @noindent Although this makes a certain amount of sense, it can be surprising. @node I/O Functions @subsection Input/Output Functions The following functions relate to input/output (I/O). Optional parameters are enclosed in square brackets ([ ]): @table @code @item close(@var{filename} @r{[}, @var{how}@r{]}) @cindex @code{close()} function @cindex files, closing Close the file @var{filename} for input or output. Alternatively, the argument may be a shell command that was used for creating a coprocess, or for redirecting to or from a pipe; then the coprocess or pipe is closed. @xref{Close Files And Pipes}, for more information. When closing a coprocess, it is occasionally useful to first close one end of the two-way pipe and then to close the other. This is done by providing a second argument to @code{close()}. This second argument should be one of the two string values @code{"to"} or @code{"from"}, indicating which end of the pipe to close. Case in the string does not matter. @xref{Two-way I/O}, which discusses this feature in more detail and gives an example. @item fflush(@r{[}@var{filename}@r{]}) @cindex @code{fflush()} function @cindex common extensions, @code{fflush()} function @cindex extensions, common@comma{} @code{fflush()} function Flush any buffered output associated with @var{filename}, which is either a file opened for writing or a shell command for redirecting output to a pipe or coprocess. @value{COMMONEXT}. @cindex portability, @code{fflush()} function and @cindex buffers, flushing @cindex output, buffering Many utility programs @dfn{buffer} their output; i.e., they save information to write to a disk file or the screen in memory until there is enough for it to be worthwhile to send the data to the output device. This is often more efficient than writing every little bit of information as soon as it is ready. However, sometimes it is necessary to force a program to @dfn{flush} its buffers; that is, write the information to its destination, even if a buffer is not full. This is the purpose of the @code{fflush()} function---@command{gawk} also buffers its output and the @code{fflush()} function forces @command{gawk} to flush its buffers. @code{fflush()} was added to Brian Kernighan's version of @command{awk} in 1994; it is not part of the POSIX standard and is not available if @option{--posix} has been specified on the command line (@pxref{Options}). @cindex @command{gawk}, @code{fflush()} function in @command{gawk} extends the @code{fflush()} function in two ways. The first is to allow no argument at all. In this case, the buffer for the standard output is flushed. The second is to allow the null string (@w{@code{""}}) as the argument. In this case, the buffers for @emph{all} open output files and pipes are flushed. Brian Kernighan's @command{awk} also supports these extensions. @c @cindex automatic warnings @c @cindex warnings, automatic @cindex troubleshooting, @code{fflush()} function @code{fflush()} returns zero if the buffer is successfully flushed; otherwise, it returns @minus{}1. In the case where all buffers are flushed, the return value is zero only if all buffers were flushed successfully. Otherwise, it is @minus{}1, and @command{gawk} warns about the problem @var{filename}. @command{gawk} also issues a warning message if you attempt to flush a file or pipe that was opened for reading (such as with @code{getline}), or if @var{filename} is not an open file, pipe, or coprocess. In such a case, @code{fflush()} returns @minus{}1, as well. @item system(@var{command}) @cindex @code{system()} function @cindex interacting with other programs Execute the operating-system command @var{command} and then return to the @command{awk} program. Return @var{command}'s exit status. For example, if the following fragment of code is put in your @command{awk} program: @example END @{ system("date | mail -s 'awk run done' root") @} @end example @noindent the system administrator is sent mail when the @command{awk} program finishes processing input and begins its end-of-input processing. Note that redirecting @code{print} or @code{printf} into a pipe is often enough to accomplish your task. If you need to run many commands, it is more efficient to simply print them down a pipeline to the shell: @example while (@var{more stuff to do}) print @var{command} | "/bin/sh" close("/bin/sh") @end example @noindent @cindex troubleshooting, @code{system()} function @cindex @code{--sandbox} option, disabling @code{system()} function However, if your @command{awk} program is interactive, @code{system()} is useful for running large self-contained programs, such as a shell or an editor. Some operating systems cannot implement the @code{system()} function. @code{system()} causes a fatal error if it is not supported. @quotation NOTE When @option{--sandbox} is specified, the @code{system()} function is disabled (@pxref{Options}). @end quotation @end table @c fakenode --- for prepinfo @subheading Advanced Notes: Interactive Versus Noninteractive Buffering @cindex advanced features, buffering @cindex buffering, interactive vs.@: noninteractive As a side point, buffering issues can be even more confusing, depending upon whether your program is @dfn{interactive}, i.e., communicating with a user sitting at a keyboard.@footnote{A program is interactive if the standard output is connected to a terminal device. On modern systems, this means your keyboard and screen.} @c Thanks to Walter.Mecky@dresdnerbank.de for this example, and for @c motivating me to write this section. Interactive programs generally @dfn{line buffer} their output; i.e., they write out every line. Noninteractive programs wait until they have a full buffer, which may be many lines of output. Here is an example of the difference: @example $ @kbd{awk '@{ print $1 + $2 @}'} @kbd{1 1} @print{} 2 @kbd{2 3} @print{} 5 @kbd{@value{CTL}-d} @end example @noindent Each line of output is printed immediately. Compare that behavior with this example: @example $ @kbd{awk '@{ print $1 + $2 @}' | cat} @kbd{1 1} @kbd{2 3} @kbd{@value{CTL}-d} @print{} 2 @print{} 5 @end example @noindent Here, no output is printed until after the @kbd{@value{CTL}-d} is typed, because it is all buffered and sent down the pipe to @command{cat} in one shot. @c fakenode --- for prepinfo @subheading Advanced Notes: Controlling Output Buffering with @code{system()} @cindex advanced features, buffering @cindex buffers, flushing @cindex buffering, input/output @cindex output, buffering The @code{fflush()} function provides explicit control over output buffering for individual files and pipes. However, its use is not portable to many other @command{awk} implementations. An alternative method to flush output buffers is to call @code{system()} with a null string as its argument: @example system("") # flush output @end example @noindent @command{gawk} treats this use of the @code{system()} function as a special case and is smart enough not to run a shell (or other command interpreter) with the empty command. Therefore, with @command{gawk}, this idiom is not only useful, it is also efficient. While this method should work with other @command{awk} implementations, it does not necessarily avoid starting an unnecessary shell. (Other implementations may only flush the buffer associated with the standard output and not necessarily all buffered output.) If you think about what a programmer expects, it makes sense that @code{system()} should flush any pending output. The following program: @example BEGIN @{ print "first print" system("echo system echo") print "second print" @} @end example @noindent must print: @example first print system echo second print @end example @noindent and not: @example system echo first print second print @end example If @command{awk} did not flush its buffers before calling @code{system()}, you would see the latter (undesirable) output. @node Time Functions @subsection Time Functions @c STARTOFRANGE tst @cindex timestamps @c STARTOFRANGE logftst @cindex log files, timestamps in @c STARTOFRANGE filogtst @cindex files, log@comma{} timestamps in @c STARTOFRANGE gawtst @cindex @command{gawk}, timestamps @cindex POSIX @command{awk}, timestamps and @code{awk} programs are commonly used to process log files containing timestamp information, indicating when a particular log record was written. Many programs log their timestamp in the form returned by the @code{time()} system call, which is the number of seconds since a particular epoch. On POSIX-compliant systems, it is the number of seconds since 1970-01-01 00:00:00 UTC, not counting leap seconds.@footnote{@xref{Glossary}, especially the entries ``Epoch'' and ``UTC.''} All known POSIX-compliant systems support timestamps from 0 through @math{2^{31} - 1}, which is sufficient to represent times through 2038-01-19 03:14:07 UTC. Many systems support a wider range of timestamps, including negative timestamps that represent times before the epoch. @cindex @command{date} utility, GNU @cindex time, retrieving In order to make it easier to process such log files and to produce useful reports, @command{gawk} provides the following functions for working with timestamps. They are @command{gawk} extensions; they are not specified in the POSIX standard, nor are they in any other known version of @command{awk}.@footnote{The GNU @command{date} utility can also do many of the things described here. Its use may be preferable for simple time-related operations in shell scripts.} Optional parameters are enclosed in square brackets ([ ]): @table @code @item mktime(@var{datespec}) @cindex @code{mktime()} function (@command{gawk}) Turn @var{datespec} into a timestamp in the same form as is returned by @code{systime()}. It is similar to the function of the same name in ISO C. The argument, @var{datespec}, is a string of the form @w{@code{"@var{YYYY} @var{MM} @var{DD} @var{HH} @var{MM} @var{SS} [@var{DST}]"}}. The string consists of six or seven numbers representing, respectively, the full year including century, the month from 1 to 12, the day of the month from 1 to 31, the hour of the day from 0 to 23, the minute from 0 to 59, the second from 0 to 60,@footnote{Occasionally there are minutes in a year with a leap second, which is why the seconds can go up to 60.} and an optional daylight-savings flag. The values of these numbers need not be within the ranges specified; for example, an hour of @minus{}1 means 1 hour before midnight. The origin-zero Gregorian calendar is assumed, with year 0 preceding year 1 and year @minus{}1 preceding year 0. The time is assumed to be in the local timezone. If the daylight-savings flag is positive, the time is assumed to be daylight savings time; if zero, the time is assumed to be standard time; and if negative (the default), @code{mktime()} attempts to determine whether daylight savings time is in effect for the specified time. If @var{datespec} does not contain enough elements or if the resulting time is out of range, @code{mktime()} returns @minus{}1. @cindex @command{gawk}, @code{PROCINFO} array in @cindex @code{PROCINFO} array @item strftime(@r{[}@var{format} @r{[}, @var{timestamp} @r{[}, @var{utc-flag}@r{]]]}) @c STARTOFRANGE strf @cindex @code{strftime()} function (@command{gawk}) Format the time specified by @var{timestamp} based on the contents of the @var{format} string and return the result. It is similar to the function of the same name in ISO C. If @var{utc-flag} is present and is either nonzero or non-null, the value is formatted as UTC (Coordinated Universal Time, formerly GMT or Greenwich Mean Time). Otherwise, the value is formatted for the local time zone. The @var{timestamp} is in the same format as the value returned by the @code{systime()} function. If no @var{timestamp} argument is supplied, @command{gawk} uses the current time of day as the timestamp. If no @var{format} argument is supplied, @code{strftime()} uses the value of @code{PROCINFO["strftime"]} as the format string (@pxref{Built-in Variables}). The default string value is @code{@w{"%a %b %e %H:%M:%S %Z %Y"}}. This format string produces output that is equivalent to that of the @command{date} utility. You can assign a new value to @code{PROCINFO["strftime"]} to change the default format. @item systime() @cindex @code{systime()} function (@command{gawk}) @cindex timestamps Return the current time as the number of seconds since the system epoch. On POSIX systems, this is the number of seconds since 1970-01-01 00:00:00 UTC, not counting leap seconds. It may be a different number on other systems. @end table The @code{systime()} function allows you to compare a timestamp from a log file with the current time of day. In particular, it is easy to determine how long ago a particular record was logged. It also allows you to produce log records using the ``seconds since the epoch'' format. @cindex converting, dates to timestamps @cindex dates, converting to timestamps @cindex timestamps, converting dates to The @code{mktime()} function allows you to convert a textual representation of a date and time into a timestamp. This makes it easy to do before/after comparisons of dates and times, particularly when dealing with date and time data coming from an external source, such as a log file. The @code{strftime()} function allows you to easily turn a timestamp into human-readable information. It is similar in nature to the @code{sprintf()} function (@pxref{String Functions}), in that it copies nonformat specification characters verbatim to the returned string, while substituting date and time values for format specifications in the @var{format} string. @cindex format specifiers, @code{strftime()} function (@command{gawk}) @code{strftime()} is guaranteed by the 1999 ISO C standard@footnote{Unfortunately, not every system's @code{strftime()} necessarily supports all of the conversions listed here.} to support the following date format specifications: @table @code @item %a The locale's abbreviated weekday name. @item %A The locale's full weekday name. @item %b The locale's abbreviated month name. @item %B The locale's full month name. @item %c The locale's ``appropriate'' date and time representation. (This is @samp{%A %B %d %T %Y} in the @code{"C"} locale.) @item %C The century part of the current year. This is the year divided by 100 and truncated to the next lower integer. @item %d The day of the month as a decimal number (01--31). @item %D Equivalent to specifying @samp{%m/%d/%y}. @item %e The day of the month, padded with a space if it is only one digit. @item %F Equivalent to specifying @samp{%Y-%m-%d}. This is the ISO 8601 date format. @item %g The year modulo 100 of the ISO 8601 week number, as a decimal number (00--99). For example, January 1, 1993 is in week 53 of 1992. Thus, the year of its ISO 8601 week number is 1992, even though its year is 1993. Similarly, December 31, 1973 is in week 1 of 1974. Thus, the year of its ISO week number is 1974, even though its year is 1973. @item %G The full year of the ISO week number, as a decimal number. @item %h Equivalent to @samp{%b}. @item %H The hour (24-hour clock) as a decimal number (00--23). @item %I The hour (12-hour clock) as a decimal number (01--12). @item %j The day of the year as a decimal number (001--366). @item %m The month as a decimal number (01--12). @item %M The minute as a decimal number (00--59). @item %n A newline character (ASCII LF). @item %p The locale's equivalent of the AM/PM designations associated with a 12-hour clock. @item %r The locale's 12-hour clock time. (This is @samp{%I:%M:%S %p} in the @code{"C"} locale.) @item %R Equivalent to specifying @samp{%H:%M}. @item %S The second as a decimal number (00--60). @item %t A TAB character. @item %T Equivalent to specifying @samp{%H:%M:%S}. @item %u The weekday as a decimal number (1--7). Monday is day one. @item %U The week number of the year (the first Sunday as the first day of week one) as a decimal number (00--53). @c @cindex ISO 8601 @item %V The week number of the year (the first Monday as the first day of week one) as a decimal number (01--53). The method for determining the week number is as specified by ISO 8601. (To wit: if the week containing January 1 has four or more days in the new year, then it is week one; otherwise it is week 53 of the previous year and the next week is week one.) @item %w The weekday as a decimal number (0--6). Sunday is day zero. @item %W The week number of the year (the first Monday as the first day of week one) as a decimal number (00--53). @item %x The locale's ``appropriate'' date representation. (This is @samp{%A %B %d %Y} in the @code{"C"} locale.) @item %X The locale's ``appropriate'' time representation. (This is @samp{%T} in the @code{"C"} locale.) @item %y The year modulo 100 as a decimal number (00--99). @item %Y The full year as a decimal number (e.g., 2011). @c @cindex RFC 822 @c @cindex RFC 1036 @item %z The timezone offset in a +HHMM format (e.g., the format necessary to produce RFC 822/RFC 1036 date headers). @item %Z The time zone name or abbreviation; no characters if no time zone is determinable. @item %Ec %EC %Ex %EX %Ey %EY %Od %Oe %OH @itemx %OI %Om %OM %OS %Ou %OU %OV %Ow %OW %Oy ``Alternate representations'' for the specifications that use only the second letter (@samp{%c}, @samp{%C}, and so on).@footnote{If you don't understand any of this, don't worry about it; these facilities are meant to make it easier to ``internationalize'' programs. Other internationalization features are described in @ref{Internationalization}.} (These facilitate compliance with the POSIX @command{date} utility.) @item %% A literal @samp{%}. @end table If a conversion specifier is not one of the above, the behavior is undefined.@footnote{This is because ISO C leaves the behavior of the C version of @code{strftime()} undefined and @command{gawk} uses the system's version of @code{strftime()} if it's there. Typically, the conversion specifier either does not appear in the returned string or appears literally.} @c @cindex locale, definition of Informally, a @dfn{locale} is the geographic place in which a program is meant to run. For example, a common way to abbreviate the date September 4, 2012 in the United States is ``9/4/12.'' In many countries in Europe, however, it is abbreviated ``4.9.12.'' Thus, the @samp{%x} specification in a @code{"US"} locale might produce @samp{9/4/12}, while in a @code{"EUROPE"} locale, it might produce @samp{4.9.12}. The ISO C standard defines a default @code{"C"} locale, which is an environment that is typical of what many C programmers are used to. For systems that are not yet fully standards-compliant, @command{gawk} supplies a copy of @code{strftime()} from the GNU C Library. It supports all of the just-listed format specifications. If that version is used to compile @command{gawk} (@pxref{Installation}), then the following additional format specifications are available: @table @code @item %k The hour (24-hour clock) as a decimal number (0--23). Single-digit numbers are padded with a space. @item %l The hour (12-hour clock) as a decimal number (1--12). Single-digit numbers are padded with a space. @ignore @item %N The ``Emperor/Era'' name. Equivalent to @code{%C}. @item %o The ``Emperor/Era'' year. Equivalent to @code{%y}. @end ignore @item %s The time as a decimal timestamp in seconds since the epoch. @ignore @item %v The date in VMS format (e.g., @samp{20-JUN-1991}). @end ignore @end table @c ENDOFRANGE strf Additionally, the alternate representations are recognized but their normal representations are used. @cindex @code{date} utility, POSIX @cindex POSIX @command{awk}, @code{date} utility and The following example is an @command{awk} implementation of the POSIX @command{date} utility. Normally, the @command{date} utility prints the current date and time of day in a well-known format. However, if you provide an argument to it that begins with a @samp{+}, @command{date} copies nonformat specifier characters to the standard output and interprets the current time according to the format specifiers in the string. For example: @example $ date '+Today is %A, %B %d, %Y.' @print{} Today is Wednesday, March 30, 2011. @end example Here is the @command{gawk} version of the @command{date} utility. It has a shell ``wrapper'' to handle the @option{-u} option, which requires that @command{date} run as if the time zone is set to UTC: @example #! /bin/sh # # date --- approximate the POSIX 'date' command case $1 in -u) TZ=UTC0 # use UTC export TZ shift ;; esac gawk 'BEGIN @{ format = "%a %b %e %H:%M:%S %Z %Y" exitval = 0 if (ARGC > 2) exitval = 1 else if (ARGC == 2) @{ format = ARGV[1] if (format ~ /^\+/) format = substr(format, 2) # remove leading + @} print strftime(format) exit exitval @}' "$@@" @end example @c ENDOFRANGE tst @c ENDOFRANGE logftst @c ENDOFRANGE filogtst @c ENDOFRANGE gawtst @node Bitwise Functions @subsection Bit-Manipulation Functions @c STARTOFRANGE bit @cindex bitwise, operations @c STARTOFRANGE and @cindex AND bitwise operation @c STARTOFRANGE oro @cindex OR bitwise operation @c STARTOFRANGE xor @cindex XOR bitwise operation @c STARTOFRANGE opbit @cindex operations, bitwise @quotation @i{I can explain it for you, but I can't understand it for you.}@* Anonymous @end quotation Many languages provide the ability to perform @dfn{bitwise} operations on two integer numbers. In other words, the operation is performed on each successive pair of bits in the operands. Three common operations are bitwise AND, OR, and XOR. The operations are described in @ref{table-bitwise-ops}. @float Table,table-bitwise-ops @caption{Bitwise Operations} @ifnottex @ifnotdocbook @display Bit Operator | AND | OR | XOR |---+---+---+---+---+--- Operands | 0 | 1 | 0 | 1 | 0 | 1 ----------+---+---+---+---+---+--- 0 | 0 0 | 0 1 | 0 1 1 | 0 1 | 1 1 | 1 0 @end display @end ifnotdocbook @end ifnottex @tex \centerline{ \vbox{\bigskip % space above the table (about 1 linespace) % Because we have vertical rules, we can't let TeX insert interline space % in its usual way. \offinterlineskip \halign{\strut\hfil#\quad\hfil % operands &\vrule#&\quad#\quad % rule, 0 (of and) &\vrule#&\quad#\quad % rule, 1 (of and) &\vrule# % rule between and and or &\quad#\quad % 0 (of or) &\vrule#&\quad#\quad % rule, 1 (of of) &\vrule# % rule between or and xor &\quad#\quad % 0 of xor &\vrule#&\quad#\quad % rule, 1 of xor \cr &\omit&\multispan{11}\hfil\bf Bit operator\hfil\cr \noalign{\smallskip} & &\multispan3\hfil AND\hfil&&\multispan3\hfil OR\hfil &&\multispan3\hfil XOR\hfil\cr \bf Operands&&0&&1&&0&&1&&0&&1\cr \noalign{\hrule} \omit&height 2pt&&\omit&&&&\omit&&&&\omit\cr \noalign{\hrule height0pt}% without this the rule does not extend; why? 0&&0&\omit&0&&0&\omit&1&&0&\omit&1\cr 1&&0&\omit&1&&1&\omit&1&&1&\omit&0\cr }}} @end tex @docbook Bitwise Operations Bit Operator AND OR XOR Operands 0 1 0 1 0 1 0 0 0 0 1 0 1 1 0 1 1 1 1 0
@end docbook @end float @cindex bitwise, complement @cindex complement, bitwise As you can see, the result of an AND operation is 1 only when @emph{both} bits are 1. The result of an OR operation is 1 if @emph{either} bit is 1. The result of an XOR operation is 1 if either bit is 1, but not both. The next operation is the @dfn{complement}; the complement of 1 is 0 and the complement of 0 is 1. Thus, this operation ``flips'' all the bits of a given value. @cindex bitwise, shift @cindex left shift, bitwise @cindex right shift, bitwise @cindex shift, bitwise Finally, two other common operations are to shift the bits left or right. For example, if you have a bit string @samp{10111001} and you shift it right by three bits, you end up with @samp{00010111}.@footnote{This example shows that 0's come in on the left side. For @command{gawk}, this is always true, but in some languages, it's possible to have the left side fill with 1's. Caveat emptor.} @c Purposely decided to use 0's and 1's here. 2/2001. If you start over again with @samp{10111001} and shift it left by three bits, you end up with @samp{11001000}. @command{gawk} provides built-in functions that implement the bitwise operations just described. They are: @cindex @command{gawk}, bitwise operations in @table @code @cindex @code{and()} function (@command{gawk}) @item and(@var{v1}, @var{v2}) Return the bitwise AND of the values provided by @var{v1} and @var{v2}. @cindex @code{compl()} function (@command{gawk}) @item compl(@var{val}) Return the bitwise complement of @var{val}. @cindex @code{lshift()} function (@command{gawk}) @item lshift(@var{val}, @var{count}) Return the value of @var{val}, shifted left by @var{count} bits. @cindex @code{or()} function (@command{gawk}) @item or(@var{v1}, @var{v2}) Return the bitwise OR of the values provided by @var{v1} and @var{v2}. @cindex @code{rshift()} function (@command{gawk}) @item rshift(@var{val}, @var{count}) Return the value of @var{val}, shifted right by @var{count} bits. @cindex @code{xor()} function (@command{gawk}) @item xor(@var{v1}, @var{v2}) Return the bitwise XOR of the values provided by @var{v1} and @var{v2}. @end table For all of these functions, first the double precision floating-point value is converted to the widest C unsigned integer type, then the bitwise operation is performed. If the result cannot be represented exactly as a C @code{double}, leading nonzero bits are removed one by one until it can be represented exactly. The result is then converted back into a C @code{double}. (If you don't understand this paragraph, don't worry about it.) Here is a user-defined function (@pxref{User-defined}) that illustrates the use of these functions: @cindex @code{bits2str()} user-defined function @cindex @code{testbits.awk} program @example @group @c file eg/lib/bits2str.awk # bits2str --- turn a byte into readable 1's and 0's function bits2str(bits, data, mask) @{ if (bits == 0) return "0" mask = 1 for (; bits != 0; bits = rshift(bits, 1)) data = (and(bits, mask) ? "1" : "0") data while ((length(data) % 8) != 0) data = "0" data return data @} @c endfile @end group @c this is a hack to make testbits.awk self-contained @ignore @c file eg/prog/testbits.awk # bits2str --- turn a byte into readable 1's and 0's function bits2str(bits, data, mask) @{ if (bits == 0) return "0" mask = 1 for (; bits != 0; bits = rshift(bits, 1)) data = (and(bits, mask) ? "1" : "0") data while ((length(data) % 8) != 0) data = "0" data return data @} @c endfile @end ignore @c file eg/prog/testbits.awk BEGIN @{ printf "123 = %s\n", bits2str(123) printf "0123 = %s\n", bits2str(0123) printf "0x99 = %s\n", bits2str(0x99) comp = compl(0x99) printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp) shift = lshift(0x99, 2) printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) shift = rshift(0x99, 2) printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) @} @c endfile @end example @noindent This program produces the following output when run: @example $ @kbd{gawk -f testbits.awk} @print{} 123 = 01111011 @print{} 0123 = 01010011 @print{} 0x99 = 10011001 @print{} compl(0x99) = 0xffffff66 = 11111111111111111111111101100110 @print{} lshift(0x99, 2) = 0x264 = 0000001001100100 @print{} rshift(0x99, 2) = 0x26 = 00100110 @end example @cindex converting, strings to numbers @cindex strings, converting @cindex numbers, converting @cindex converting, numbers to strings The @code{bits2str()} function turns a binary number into a string. The number @code{1} represents a binary value where the rightmost bit is set to 1. Using this mask, the function repeatedly checks the rightmost bit. ANDing the mask with the value indicates whether the rightmost bit is 1 or not. If so, a @code{"1"} is concatenated onto the front of the string. Otherwise, a @code{"0"} is added. The value is then shifted right by one bit and the loop continues until there are no more 1 bits. If the initial value is zero it returns a simple @code{"0"}. Otherwise, at the end, it pads the value with zeros to represent multiples of 8-bit quantities. This is typical in modern computers. The main code in the @code{BEGIN} rule shows the difference between the decimal and octal values for the same numbers (@pxref{Nondecimal-numbers}), and then demonstrates the results of the @code{compl()}, @code{lshift()}, and @code{rshift()} functions. @c ENDOFRANGE bit @c ENDOFRANGE and @c ENDOFRANGE oro @c ENDOFRANGE xor @c ENDOFRANGE opbit @node Type Functions @subsection Getting Type Information @command{gawk} provides a single function that lets you distinguish an array from a scalar variable. This is necessary for writing code that traverses every element of a true multidimensional array (@pxref{Arrays of Arrays}). @table @code @cindex @code{isarray()} function (@command{gawk}) @item isarray(@var{x}) Return a true value if @var{x} is an array. Otherwise return false. @end table @node I18N Functions @subsection String-Translation Functions @cindex @command{gawk}, string-translation functions @cindex functions, string-translation @cindex internationalization @cindex @command{awk} programs, internationalizing @command{gawk} provides facilities for internationalizing @command{awk} programs. These include the functions described in the following list. The descriptions here are purposely brief. @xref{Internationalization}, for the full story. Optional parameters are enclosed in square brackets ([ ]): @table @code @cindex @code{bindtextdomain()} function (@command{gawk}) @item bindtextdomain(@var{directory} @r{[}, @var{domain}@r{]}) Set the directory in which @command{gawk} will look for message translation files, in case they will not or cannot be placed in the ``standard'' locations (e.g., during testing). It returns the directory in which @var{domain} is ``bound.'' The default @var{domain} is the value of @code{TEXTDOMAIN}. If @var{directory} is the null string (@code{""}), then @code{bindtextdomain()} returns the current binding for the given @var{domain}. @cindex @code{dcgettext()} function (@command{gawk}) @item dcgettext(@var{string} @r{[}, @var{domain} @r{[}, @var{category}@r{]]}) Return the translation of @var{string} in text domain @var{domain} for locale category @var{category}. The default value for @var{domain} is the current value of @code{TEXTDOMAIN}. The default value for @var{category} is @code{"LC_MESSAGES"}. @cindex @code{dcngettext()} function (@command{gawk}) @item dcngettext(@var{string1}, @var{string2}, @var{number} @r{[}, @var{domain} @r{[}, @var{category}@r{]]}) Return the plural form used for @var{number} of the translation of @var{string1} and @var{string2} in text domain @var{domain} for locale category @var{category}. @var{string1} is the English singular variant of a message, and @var{string2} the English plural variant of the same message. The default value for @var{domain} is the current value of @code{TEXTDOMAIN}. The default value for @var{category} is @code{"LC_MESSAGES"}. @end table @c ENDOFRANGE funcbi @c ENDOFRANGE bifunc @node User-defined @section User-Defined Functions @c STARTOFRANGE udfunc @cindex user-defined, functions @c STARTOFRANGE funcud @cindex functions, user-defined Complicated @command{awk} programs can often be simplified by defining your own functions. User-defined functions can be called just like built-in ones (@pxref{Function Calls}), but it is up to you to define them, i.e., to tell @command{awk} what they should do. @menu * Definition Syntax:: How to write definitions and what they mean. * Function Example:: An example function definition and what it does. * Function Caveats:: Things to watch out for. * Return Statement:: Specifying the value a function returns. * Dynamic Typing:: How variable types can change at runtime. @end menu @node Definition Syntax @subsection Function Definition Syntax @c STARTOFRANGE fdef @cindex functions, defining Definitions of functions can appear anywhere between the rules of an @command{awk} program. Thus, the general form of an @command{awk} program is extended to include sequences of rules @emph{and} user-defined function definitions. There is no need to put the definition of a function before all uses of the function. This is because @command{awk} reads the entire program before starting to execute any of it. The definition of a function named @var{name} looks like this: @example function @var{name}(@r{[}@var{parameter-list}@r{]}) @{ @var{body-of-function} @} @end example @cindex names, functions @cindex functions, names of @cindex namespace issues, functions @noindent Here, @var{name} is the name of the function to define. A valid function name is like a valid variable name: a sequence of letters, digits, and underscores that doesn't start with a digit. Within a single @command{awk} program, any particular name can only be used as a variable, array, or function. @var{parameter-list} is an optional list of the function's arguments and local variable names, separated by commas. When the function is called, the argument names are used to hold the argument values given in the call. The local variables are initialized to the empty string. A function cannot have two parameters with the same name, nor may it have a parameter with the same name as the function itself. In addition, according to the POSIX standard, function parameters cannot have the same name as one of the special built-in variables (@pxref{Built-in Variables}. Not all versions of @command{awk} enforce this restriction. The @var{body-of-function} consists of @command{awk} statements. It is the most important part of the definition, because it says what the function should actually @emph{do}. The argument names exist to give the body a way to talk about the arguments; local variables exist to give the body places to keep temporary values. Argument names are not distinguished syntactically from local variable names. Instead, the number of arguments supplied when the function is called determines how many argument variables there are. Thus, if three argument values are given, the first three names in @var{parameter-list} are arguments and the rest are local variables. It follows that if the number of arguments is not the same in all calls to the function, some of the names in @var{parameter-list} may be arguments on some occasions and local variables on others. Another way to think of this is that omitted arguments default to the null string. @cindex programming conventions, functions, writing Usually when you write a function, you know how many names you intend to use for arguments and how many you intend to use as local variables. It is conventional to place some extra space between the arguments and the local variables, in order to document how your function is supposed to be used. @cindex variables, shadowing During execution of the function body, the arguments and local variable values hide, or @dfn{shadow}, any variables of the same names used in the rest of the program. The shadowed variables are not accessible in the function definition, because there is no way to name them while their names have been taken away for the local variables. All other variables used in the @command{awk} program can be referenced or set normally in the function's body. The arguments and local variables last only as long as the function body is executing. Once the body finishes, you can once again access the variables that were shadowed while the function was running. @cindex recursive functions @cindex functions, recursive The function body can contain expressions that call functions. They can even call this function, either directly or by way of another function. When this happens, we say the function is @dfn{recursive}. The act of a function calling itself is called @dfn{recursion}. All the built-in functions return a value to their caller. User-defined functions can do also, using the @code{return} statement, which is described in detail in @ref{Return Statement}. Many of the subsequent examples in this @value{SECTION} use the @code{return} statement. @cindex common extensions, @code{func} keyword @cindex extensions, common@comma{} @code{func} keyword @c @cindex @command{awk} language, POSIX version @c @cindex POSIX @command{awk} @cindex POSIX @command{awk}, @code{function} keyword in In many @command{awk} implementations, including @command{gawk}, the keyword @code{function} may be abbreviated @code{func}. @value{COMMONEXT} However, POSIX only specifies the use of the keyword @code{function}. This actually has some practical implications. If @command{gawk} is in POSIX-compatibility mode (@pxref{Options}), then the following statement does @emph{not} define a function: @example func foo() @{ a = sqrt($1) ; print a @} @end example @noindent Instead it defines a rule that, for each record, concatenates the value of the variable @samp{func} with the return value of the function @samp{foo}. If the resulting string is non-null, the action is executed. This is probably not what is desired. (@command{awk} accepts this input as syntactically valid, because functions may be used before they are defined in @command{awk} programs.@footnote{This program won't actually run, since @code{foo()} is undefined.}) @cindex portability, functions@comma{} defining To ensure that your @command{awk} programs are portable, always use the keyword @code{function} when defining a function. @node Function Example @subsection Function Definition Examples Here is an example of a user-defined function, called @code{myprint()}, that takes a number and prints it in a specific format: @example function myprint(num) @{ printf "%6.3g\n", num @} @end example @noindent To illustrate, here is an @command{awk} rule that uses our @code{myprint} function: @example $3 > 0 @{ myprint($3) @} @end example @noindent This program prints, in our special format, all the third fields that contain a positive number in our input. Therefore, when given the following input: @example 1.2 3.4 5.6 7.8 9.10 11.12 -13.14 15.16 17.18 19.20 21.22 23.24 @end example @noindent this program, using our function to format the results, prints: @example 5.6 21.2 @end example This function deletes all the elements in an array: @example function delarray(a, i) @{ for (i in a) delete a[i] @} @end example When working with arrays, it is often necessary to delete all the elements in an array and start over with a new list of elements (@pxref{Delete}). Instead of having to repeat this loop everywhere that you need to clear out an array, your program can just call @code{delarray}. (This guarantees portability. The use of @samp{delete @var{array}} to delete the contents of an entire array is a nonstandard extension.) The following is an example of a recursive function. It takes a string as an input parameter and returns the string in backwards order. Recursive functions must always have a test that stops the recursion. In this case, the recursion terminates when the starting position is zero, i.e., when there are no more characters left in the string. @cindex @code{rev()} user-defined function @example function rev(str, start) @{ if (start == 0) return "" return (substr(str, start, 1) rev(str, start - 1)) @} @end example If this function is in a file named @file{rev.awk}, it can be tested this way: @example $ @kbd{echo "Don't Panic!" |} > @kbd{gawk --source '@{ print rev($0, length($0)) @}' -f rev.awk} @print{} !cinaP t'noD @end example The C @code{ctime()} function takes a timestamp and returns it in a string, formatted in a well-known fashion. The following example uses the built-in @code{strftime()} function (@pxref{Time Functions}) to create an @command{awk} version of @code{ctime()}: @cindex @code{ctime()} user-defined function @example @c file eg/lib/ctime.awk # ctime.awk # # awk version of C ctime(3) function function ctime(ts, format) @{ format = "%a %b %e %H:%M:%S %Z %Y" if (ts == 0) ts = systime() # use current time as default return strftime(format, ts) @} @c endfile @end example @c ENDOFRANGE fdef @node Function Caveats @subsection Calling User-Defined Functions @c STARTOFRANGE fudc This section describes how to call a user-defined function. @menu * Calling A Function:: Don't use spaces. * Variable Scope:: Controlling variable scope. * Pass By Value/Reference:: Passing parameters. @end menu @node Calling A Function @subsubsection Writing A Function Call @cindex functions, user-defined, calling @dfn{Calling a function} means causing the function to run and do its job. A function call is an expression and its value is the value returned by the function. A function call consists of the function name followed by the arguments in parentheses. @command{awk} expressions are what you write in the call for the arguments. Each time the call is executed, these expressions are evaluated, and the values become the actual arguments. For example, here is a call to @code{foo()} with three arguments (the first being a string concatenation): @example foo(x y, "lose", 4 * z) @end example @quotation CAUTION Whitespace characters (spaces and TABs) are not allowed between the function name and the open-parenthesis of the argument list. If you write whitespace by mistake, @command{awk} might think that you mean to concatenate a variable with an expression in parentheses. However, it notices that you used a function name and not a variable name, and reports an error. @end quotation @node Variable Scope @subsubsection Controlling Variable Scope @cindex local variables @cindex variables, local There is no way to make a variable local to a @code{@{ @dots{} @}} block in @command{awk}, but you can make a variable local to a function. It is good practice to do so whenever a variable is needed only in that function. To make a variable local to a function, simply declare the variable as an argument after the actual function arguments (@pxref{Definition Syntax}). Look at the following example where variable @code{i} is a global variable used by both functions @code{foo()} and @code{bar()}: @example function bar() @{ for (i = 0; i < 3; i++) print "bar's i=" i @} function foo(j) @{ i = j + 1 print "foo's i=" i bar() print "foo's i=" i @} BEGIN @{ i = 10 print "top's i=" i foo(0) print "top's i=" i @} @end example Running this script produces the following, because the @code{i} in functions @code{foo()} and @code{bar()} and at the top level refer to the same variable instance: @example top's i=10 foo's i=1 bar's i=0 bar's i=1 bar's i=2 foo's i=3 top's i=3 @end example If you want @code{i} to be local to both @code{foo()} and @code{bar()} do as follows (the extra-space before @code{i} is a coding convention to indicate that @code{i} is a local variable, not an argument): @example function bar( i) @{ for (i = 0; i < 3; i++) print "bar's i=" i @} function foo(j, i) @{ i = j + 1 print "foo's i=" i bar() print "foo's i=" i @} BEGIN @{ i = 10 print "top's i=" i foo(0) print "top's i=" i @} @end example Running the corrected script produces the following: @example top's i=10 foo's i=1 bar's i=0 bar's i=1 bar's i=2 foo's i=1 top's i=10 @end example @node Pass By Value/Reference @subsubsection Passing Function Arguments By Value Or By Reference In @command{awk}, when you declare a function, there is no way to declare explicitly whether the arguments are passed @dfn{by value} or @dfn{by reference}. Instead the passing convention is determined at runtime when the function is called according to the following rule: @itemize @item If the argument is an array variable, then it is passed by reference, @item Otherwise the argument is passed by value. @end itemize @cindex call by value Passing an argument by value means that when a function is called, it is given a @emph{copy} of the value of this argument. The caller may use a variable as the expression for the argument, but the called function does not know this---it only knows what value the argument had. For example, if you write the following code: @example foo = "bar" z = myfunc(foo) @end example @noindent then you should not think of the argument to @code{myfunc()} as being ``the variable @code{foo}.'' Instead, think of the argument as the string value @code{"bar"}. If the function @code{myfunc()} alters the values of its local variables, this has no effect on any other variables. Thus, if @code{myfunc()} does this: @example function myfunc(str) @{ print str str = "zzz" print str @} @end example @noindent to change its first argument variable @code{str}, it does @emph{not} change the value of @code{foo} in the caller. The role of @code{foo} in calling @code{myfunc()} ended when its value (@code{"bar"}) was computed. If @code{str} also exists outside of @code{myfunc()}, the function body cannot alter this outer value, because it is shadowed during the execution of @code{myfunc()} and cannot be seen or changed from there. @cindex call by reference @cindex arrays, as parameters to functions @cindex functions, arrays as parameters to However, when arrays are the parameters to functions, they are @emph{not} copied. Instead, the array itself is made available for direct manipulation by the function. This is usually termed @dfn{call by reference}. Changes made to an array parameter inside the body of a function @emph{are} visible outside that function. @quotation NOTE Changing an array parameter inside a function can be very dangerous if you do not watch what you are doing. For example: @example function changeit(array, ind, nvalue) @{ array[ind] = nvalue @} BEGIN @{ a[1] = 1; a[2] = 2; a[3] = 3 changeit(a, 2, "two") printf "a[1] = %s, a[2] = %s, a[3] = %s\n", a[1], a[2], a[3] @} @end example @noindent prints @samp{a[1] = 1, a[2] = two, a[3] = 3}, because @code{changeit} stores @code{"two"} in the second element of @code{a}. @end quotation @cindex undefined functions @cindex functions, undefined Some @command{awk} implementations allow you to call a function that has not been defined. They only report a problem at runtime when the program actually tries to call the function. For example: @example BEGIN @{ if (0) foo() else bar() @} function bar() @{ @dots{} @} # note that `foo' is not defined @end example @noindent Because the @samp{if} statement will never be true, it is not really a problem that @code{foo()} has not been defined. Usually, though, it is a problem if a program calls an undefined function. @cindex lint checking, undefined functions If @option{--lint} is specified (@pxref{Options}), @command{gawk} reports calls to undefined functions. @cindex portability, @code{next} statement in user-defined functions Some @command{awk} implementations generate a runtime error if you use the @code{next} statement (@pxref{Next Statement}) inside a user-defined function. @command{gawk} does not have this limitation. @c ENDOFRANGE fudc @node Return Statement @subsection The @code{return} Statement @cindex @code{return} statement@comma{} user-defined functions As seen in several earlier examples, the body of a user-defined function can contain a @code{return} statement. This statement returns control to the calling part of the @command{awk} program. It can also be used to return a value for use in the rest of the @command{awk} program. It looks like this: @example return @r{[}@var{expression}@r{]} @end example The @var{expression} part is optional. Due most likely to an oversight, POSIX does not define what the return value is if you omit the @var{expression}. Technically speaking, this make the returned value undefined, and therefore, unpredictable. In practice, though, all versions of @command{awk} simply return the null string, which acts like zero if used in a numeric context. A @code{return} statement with no value expression is assumed at the end of every function definition. So if control reaches the end of the function body, then technically, the function returns an unpredictable value. In practice, it returns the empty string. @command{awk} does @emph{not} warn you if you use the return value of such a function. Sometimes, you want to write a function for what it does, not for what it returns. Such a function corresponds to a @code{void} function in C, C++ or Java, or to a @code{procedure} in Ada. Thus, it may be appropriate to not return any value; simply bear in mind that you should not be using the return value of such a function. The following is an example of a user-defined function that returns a value for the largest number among the elements of an array: @example function maxelt(vec, i, ret) @{ for (i in vec) @{ if (ret == "" || vec[i] > ret) ret = vec[i] @} return ret @} @end example @cindex programming conventions, function parameters @noindent You call @code{maxelt()} with one argument, which is an array name. The local variables @code{i} and @code{ret} are not intended to be arguments; while there is nothing to stop you from passing more than one argument to @code{maxelt()}, the results would be strange. The extra space before @code{i} in the function parameter list indicates that @code{i} and @code{ret} are local variables. You should follow this convention when defining functions. The following program uses the @code{maxelt()} function. It loads an array, calls @code{maxelt()}, and then reports the maximum number in that array: @example function maxelt(vec, i, ret) @{ for (i in vec) @{ if (ret == "" || vec[i] > ret) ret = vec[i] @} return ret @} # Load all fields of each record into nums. @{ for(i = 1; i <= NF; i++) nums[NR, i] = $i @} END @{ print maxelt(nums) @} @end example Given the following input: @example 1 5 23 8 16 44 3 5 2 8 26 256 291 1396 2962 100 -6 467 998 1101 99385 11 0 225 @end example @noindent the program reports (predictably) that 99,385 is the largest value in the array. @node Dynamic Typing @subsection Functions and Their Effects on Variable Typing @command{awk} is a very fluid language. It is possible that @command{awk} can't tell if an identifier represents a scalar variable or an array until runtime. Here is an annotated sample program: @example function foo(a) @{ a[1] = 1 # parameter is an array @} BEGIN @{ b = 1 foo(b) # invalid: fatal type mismatch foo(x) # x uninitialized, becomes an array dynamically x = 1 # now not allowed, runtime error @} @end example Usually, such things aren't a big issue, but it's worth being aware of them. @c ENDOFRANGE udfunc @node Indirect Calls @section Indirect Function Calls @cindex indirect function calls @cindex function calls, indirect @cindex function pointers @cindex pointers to functions @cindex differences in @command{awk} and @command{gawk}, indirect function calls This section describes a @command{gawk}-specific extension. Often, you may wish to defer the choice of function to call until runtime. For example, you may have different kinds of records, each of which should be processed differently. Normally, you would have to use a series of @code{if}-@code{else} statements to decide which function to call. By using @dfn{indirect} function calls, you can specify the name of the function to call as a string variable, and then call the function. Let's look at an example. Suppose you have a file with your test scores for the classes you are taking. The first field is the class name. The following fields are the functions to call to process the data, up to a ``marker'' field @samp{data:}. Following the marker, to the end of the record, are the various numeric test scores. Here is the initial file; you wish to get the sum and the average of your test scores: @example @c file eg/data/class_data1 Biology_101 sum average data: 87.0 92.4 78.5 94.9 Chemistry_305 sum average data: 75.2 98.3 94.7 88.2 English_401 sum average data: 100.0 95.6 87.1 93.4 @c endfile @end example To process the data, you might write initially: @example @{ class = $1 for (i = 2; $i != "data:"; i++) @{ if ($i == "sum") sum() # processes the whole record else if ($i == "average") average() @dots{} # and so on @} @} @end example @noindent This style of programming works, but can be awkward. With @dfn{indirect} function calls, you tell @command{gawk} to use the @emph{value} of a variable as the name of the function to call. The syntax is similar to that of a regular function call: an identifier immediately followed by a left parenthesis, any arguments, and then a closing right parenthesis, with the addition of a leading @samp{@@} character: @example the_func = "sum" result = @@the_func() # calls the `sum' function @end example Here is a full program that processes the previously shown data, using indirect function calls. @example @c file eg/prog/indirectcall.awk # indirectcall.awk --- Demonstrate indirect function calls @c endfile @ignore @c file eg/prog/indirectcall.awk # # Arnold Robbins, arnold@skeeve.com, Public Domain # January 2009 @c endfile @end ignore @c file eg/prog/indirectcall.awk # average --- return the average of the values in fields $first - $last function average(first, last, sum, i) @{ sum = 0; for (i = first; i <= last; i++) sum += $i return sum / (last - first + 1) @} # sum --- return the sum of the values in fields $first - $last function sum(first, last, ret, i) @{ ret = 0; for (i = first; i <= last; i++) ret += $i return ret @} @c endfile @end example These two functions expect to work on fields; thus the parameters @code{first} and @code{last} indicate where in the fields to start and end. Otherwise they perform the expected computations and are not unusual. @example @c file eg/prog/indirectcall.awk # For each record, print the class name and the requested statistics @{ class_name = $1 gsub(/_/, " ", class_name) # Replace _ with spaces # find start for (i = 1; i <= NF; i++) @{ if ($i == "data:") @{ start = i + 1 break @} @} printf("%s:\n", class_name) for (i = 2; $i != "data:"; i++) @{ the_function = $i printf("\t%s: <%s>\n", $i, @@the_function(start, NF) "") @} print "" @} @c endfile @end example This is the main processing for each record. It prints the class name (with underscores replaced with spaces). It then finds the start of the actual data, saving it in @code{start}. The last part of the code loops through each function name (from @code{$2} up to the marker, @samp{data:}), calling the function named by the field. The indirect function call itself occurs as a parameter in the call to @code{printf}. (The @code{printf} format string uses @samp{%s} as the format specifier so that we can use functions that return strings, as well as numbers. Note that the result from the indirect call is concatenated with the empty string, in order to force it to be a string value.) Here is the result of running the program: @example $ @kbd{gawk -f indirectcall.awk class_data1} @print{} Biology 101: @print{} sum: <352.8> @print{} average: <88.2> @print{} @print{} Chemistry 305: @print{} sum: <356.4> @print{} average: <89.1> @print{} @print{} English 401: @print{} sum: <376.1> @print{} average: <94.025> @end example The ability to use indirect function calls is more powerful than you may think at first. The C and C++ languages provide ``function pointers,'' which are a mechanism for calling a function chosen at runtime. One of the most well-known uses of this ability is the C @code{qsort()} function, which sorts an array using the famous ``quick sort'' algorithm (see @uref{http://en.wikipedia.org/wiki/Quick_sort, the Wikipedia article} for more information). To use this function, you supply a pointer to a comparison function. This mechanism allows you to sort arbitrary data in an arbitrary fashion. We can do something similar using @command{gawk}, like this: @example @c file eg/lib/quicksort.awk # quicksort.awk --- Quicksort algorithm, with user-supplied # comparison function @c endfile @ignore @c file eg/lib/quicksort.awk # # Arnold Robbins, arnold@skeeve.com, Public Domain # January 2009 @c endfile @end ignore @c file eg/lib/quicksort.awk # quicksort --- C.A.R. Hoare's quick sort algorithm. See Wikipedia # or almost any algorithms or computer science text @c endfile @ignore @c file eg/lib/quicksort.awk # # Adapted from K&R-II, page 110 @c endfile @end ignore @c file eg/lib/quicksort.awk function quicksort(data, left, right, less_than, i, last) @{ if (left >= right) # do nothing if array contains fewer return # than two elements quicksort_swap(data, left, int((left + right) / 2)) last = left for (i = left + 1; i <= right; i++) if (@@less_than(data[i], data[left])) quicksort_swap(data, ++last, i) quicksort_swap(data, left, last) quicksort(data, left, last - 1, less_than) quicksort(data, last + 1, right, less_than) @} # quicksort_swap --- helper function for quicksort, should really be inline function quicksort_swap(data, i, j, temp) @{ temp = data[i] data[i] = data[j] data[j] = temp @} @c endfile @end example The @code{quicksort()} function receives the @code{data} array, the starting and ending indices to sort (@code{left} and @code{right}), and the name of a function that performs a ``less than'' comparison. It then implements the quick sort algorithm. To make use of the sorting function, we return to our previous example. The first thing to do is write some comparison functions: @example @c file eg/prog/indirectcall.awk # num_lt --- do a numeric less than comparison function num_lt(left, right) @{ return ((left + 0) < (right + 0)) @} # num_ge --- do a numeric greater than or equal to comparison function num_ge(left, right) @{ return ((left + 0) >= (right + 0)) @} @c endfile @end example The @code{num_ge()} function is needed to perform a descending sort; when used to perform a ``less than'' test, it actually does the opposite (greater than or equal to), which yields data sorted in descending order. Next comes a sorting function. It is parameterized with the starting and ending field numbers and the comparison function. It builds an array with the data and calls @code{quicksort} appropriately, and then formats the results as a single string: @example @c file eg/prog/indirectcall.awk # do_sort --- sort the data according to `compare' # and return it as a string function do_sort(first, last, compare, data, i, retval) @{ delete data for (i = 1; first <= last; first++) @{ data[i] = $first i++ @} quicksort(data, 1, i-1, compare) retval = data[1] for (i = 2; i in data; i++) retval = retval " " data[i] return retval @} @c endfile @end example Finally, the two sorting functions call @code{do_sort()}, passing in the names of the two comparison functions: @example @c file eg/prog/indirectcall.awk # sort --- sort the data in ascending order and return it as a string function sort(first, last) @{ return do_sort(first, last, "num_lt") @} # rsort --- sort the data in descending order and return it as a string function rsort(first, last) @{ return do_sort(first, last, "num_ge") @} @c endfile @end example Here is an extended version of the data file: @example @c file eg/data/class_data2 Biology_101 sum average sort rsort data: 87.0 92.4 78.5 94.9 Chemistry_305 sum average sort rsort data: 75.2 98.3 94.7 88.2 English_401 sum average sort rsort data: 100.0 95.6 87.1 93.4 @c endfile @end example Finally, here are the results when the enhanced program is run: @example $ @kbd{gawk -f quicksort.awk -f indirectcall.awk class_data2} @print{} Biology 101: @print{} sum: <352.8> @print{} average: <88.2> @print{} sort: <78.5 87.0 92.4 94.9> @print{} rsort: <94.9 92.4 87.0 78.5> @print{} @print{} Chemistry 305: @print{} sum: <356.4> @print{} average: <89.1> @print{} sort: <75.2 88.2 94.7 98.3> @print{} rsort: <98.3 94.7 88.2 75.2> @print{} @print{} English 401: @print{} sum: <376.1> @print{} average: <94.025> @print{} sort: <87.1 93.4 95.6 100.0> @print{} rsort: <100.0 95.6 93.4 87.1> @end example Remember that you must supply a leading @samp{@@} in front of an indirect function call. Unfortunately, indirect function calls cannot be used with the built-in functions. However, you can generally write ``wrapper'' functions which call the built-in ones, and those can be called indirectly. (Other than, perhaps, the mathematical functions, there is not a lot of reason to try to call the built-in functions indirectly.) @command{gawk} does its best to make indirect function calls efficient. For example, in the following case: @example for (i = 1; i <= n; i++) @@the_func() @end example @noindent @code{gawk} will look up the actual function to call only once. @c ENDOFRANGE funcud @node Internationalization @chapter Internationalization with @command{gawk} Once upon a time, computer makers wrote software that worked only in English. Eventually, hardware and software vendors noticed that if their systems worked in the native languages of non-English-speaking countries, they were able to sell more systems. As a result, internationalization and localization of programs and software systems became a common practice. @c STARTOFRANGE inloc @cindex internationalization, localization @cindex @command{gawk}, internationalization and, See internationalization @cindex internationalization, localization, @command{gawk} and For many years, the ability to provide internationalization was largely restricted to programs written in C and C++. This @value{CHAPTER} describes the underlying library @command{gawk} uses for internationalization, as well as how @command{gawk} makes internationalization features available at the @command{awk} program level. Having internationalization available at the @command{awk} level gives software developers additional flexibility---they are no longer forced to write in C or C++ when internationalization is a requirement. @menu * I18N and L10N:: Internationalization and Localization. * Explaining gettext:: How GNU @code{gettext} works. * Programmer i18n:: Features for the programmer. * Translator i18n:: Features for the translator. * I18N Example:: A simple i18n example. * Gawk I18N:: @command{gawk} is also internationalized. @end menu @node I18N and L10N @section Internationalization and Localization @cindex internationalization @cindex localization, See internationalization@comma{} localization @cindex localization @dfn{Internationalization} means writing (or modifying) a program once, in such a way that it can use multiple languages without requiring further source-code changes. @dfn{Localization} means providing the data necessary for an internationalized program to work in a particular language. Most typically, these terms refer to features such as the language used for printing error messages, the language used to read responses, and information related to how numerical and monetary values are printed and read. @node Explaining gettext @section GNU @code{gettext} @cindex internationalizing a program @c STARTOFRANGE gettex @cindex @code{gettext} library The facilities in GNU @code{gettext} focus on messages; strings printed by a program, either directly or via formatting with @code{printf} or @code{sprintf()}.@footnote{For some operating systems, the @command{gawk} port doesn't support GNU @code{gettext}. Therefore, these features are not available if you are using one of those operating systems. Sorry.} @cindex portability, @code{gettext} library and When using GNU @code{gettext}, each application has its own @dfn{text domain}. This is a unique name, such as @samp{kpilot} or @samp{gawk}, that identifies the application. A complete application may have multiple components---programs written in C or C++, as well as scripts written in @command{sh} or @command{awk}. All of the components use the same text domain. To make the discussion concrete, assume we're writing an application named @command{guide}. Internationalization consists of the following steps, in this order: @enumerate @item The programmer goes through the source for all of @command{guide}'s components and marks each string that is a candidate for translation. For example, @code{"`-F': option required"} is a good candidate for translation. A table with strings of option names is not (e.g., @command{gawk}'s @option{--profile} option should remain the same, no matter what the local language). @cindex @code{textdomain()} function (C library) @item The programmer indicates the application's text domain (@code{"guide"}) to the @code{gettext} library, by calling the @code{textdomain()} function. @cindex @code{.pot} files @cindex files, @code{.pot} @cindex portable object template files @cindex files, portable object template @item Messages from the application are extracted from the source code and collected into a portable object template file (@file{guide.pot}), which lists the strings and their translations. The translations are initially empty. The original (usually English) messages serve as the key for lookup of the translations. @cindex @code{.po} files @cindex files, @code{.po} @cindex portable object files @cindex files, portable object @item For each language with a translator, @file{guide.pot} is copied to a portable object file (@code{.po}) and translations are created and shipped with the application. For example, there might be a @file{fr.po} for a French translation. @cindex @code{.mo} files @cindex files, @code{.mo} @cindex message object files @cindex files, message object @item Each language's @file{.po} file is converted into a binary message object (@file{.mo}) file. A message object file contains the original messages and their translations in a binary format that allows fast lookup of translations at runtime. @item When @command{guide} is built and installed, the binary translation files are installed in a standard place. @cindex @code{bindtextdomain()} function (C library) @item For testing and development, it is possible to tell @code{gettext} to use @file{.mo} files in a different directory than the standard one by using the @code{bindtextdomain()} function. @cindex @code{.mo} files, specifying directory of @cindex files, @code{.mo}, specifying directory of @cindex message object files, specifying directory of @cindex files, message object, specifying directory of @item At runtime, @command{guide} looks up each string via a call to @code{gettext()}. The returned string is the translated string if available, or the original string if not. @item If necessary, it is possible to access messages from a different text domain than the one belonging to the application, without having to switch the application's default text domain back and forth. @end enumerate @cindex @code{gettext()} function (C library) In C (or C++), the string marking and dynamic translation lookup are accomplished by wrapping each string in a call to @code{gettext()}: @example printf("%s", gettext("Don't Panic!\n")); @end example The tools that extract messages from source code pull out all strings enclosed in calls to @code{gettext()}. @cindex @code{_} (underscore), @code{_} C macro @cindex underscore (@code{_}), @code{_} C macro The GNU @code{gettext} developers, recognizing that typing @samp{gettext(@dots{})} over and over again is both painful and ugly to look at, use the macro @samp{_} (an underscore) to make things easier: @example /* In the standard header file: */ #define _(str) gettext(str) /* In the program text: */ printf("%s", _("Don't Panic!\n")); @end example @cindex internationalization, localization, locale categories @cindex @code{gettext} library, locale categories @cindex locale categories @noindent This reduces the typing overhead to just three extra characters per string and is considerably easier to read as well. There are locale @dfn{categories} for different types of locale-related information. The defined locale categories that @code{gettext} knows about are: @table @code @cindex @code{LC_MESSAGES} locale category @item LC_MESSAGES Text messages. This is the default category for @code{gettext} operations, but it is possible to supply a different one explicitly, if necessary. (It is almost never necessary to supply a different category.) @cindex sorting characters in different languages @cindex @code{LC_COLLATE} locale category @item LC_COLLATE Text-collation information; i.e., how different characters and/or groups of characters sort in a given language. @cindex @code{LC_CTYPE} locale category @item LC_CTYPE Character-type information (alphabetic, digit, upper- or lowercase, and so on). This information is accessed via the POSIX character classes in regular expressions, such as @code{/[[:alnum:]]/} (@pxref{Regexp Operators}). @cindex monetary information, localization @cindex currency symbols, localization @cindex @code{LC_MONETARY} locale category @item LC_MONETARY Monetary information, such as the currency symbol, and whether the symbol goes before or after a number. @cindex @code{LC_NUMERIC} locale category @item LC_NUMERIC Numeric information, such as which characters to use for the decimal point and the thousands separator.@footnote{Americans use a comma every three decimal places and a period for the decimal point, while many Europeans do exactly the opposite: 1,234.56 versus 1.234,56.} @cindex @code{LC_RESPONSE} locale category @item LC_RESPONSE Response information, such as how ``yes'' and ``no'' appear in the local language, and possibly other information as well. @cindex time, localization and @cindex dates, information related to@comma{} localization @cindex @code{LC_TIME} locale category @item LC_TIME Time- and date-related information, such as 12- or 24-hour clock, month printed before or after the day in a date, local month abbreviations, and so on. @cindex @code{LC_ALL} locale category @item LC_ALL All of the above. (Not too useful in the context of @code{gettext}.) @end table @c ENDOFRANGE gettex @node Programmer i18n @section Internationalizing @command{awk} Programs @c STARTOFRANGE inap @cindex @command{awk} programs, internationalizing @command{gawk} provides the following variables and functions for internationalization: @table @code @cindex @code{TEXTDOMAIN} variable @item TEXTDOMAIN This variable indicates the application's text domain. For compatibility with GNU @code{gettext}, the default value is @code{"messages"}. @cindex internationalization, localization, marked strings @cindex strings, for localization @item _"your message here" String constants marked with a leading underscore are candidates for translation at runtime. String constants without a leading underscore are not translated. @cindex @code{dcgettext()} function (@command{gawk}) @item dcgettext(@var{string} @r{[}, @var{domain} @r{[}, @var{category}@r{]]}) Return the translation of @var{string} in text domain @var{domain} for locale category @var{category}. The default value for @var{domain} is the current value of @code{TEXTDOMAIN}. The default value for @var{category} is @code{"LC_MESSAGES"}. If you supply a value for @var{category}, it must be a string equal to one of the known locale categories described in @ifnotinfo the previous @value{SECTION}. @end ifnotinfo @ifinfo @ref{Explaining gettext}. @end ifinfo You must also supply a text domain. Use @code{TEXTDOMAIN} if you want to use the current domain. @quotation CAUTION The order of arguments to the @command{awk} version of the @code{dcgettext()} function is purposely different from the order for the C version. The @command{awk} version's order was chosen to be simple and to allow for reasonable @command{awk}-style default arguments. @end quotation @cindex @code{dcngettext()} function (@command{gawk}) @item dcngettext(@var{string1}, @var{string2}, @var{number} @r{[}, @var{domain} @r{[}, @var{category}@r{]]}) Return the plural form used for @var{number} of the translation of @var{string1} and @var{string2} in text domain @var{domain} for locale category @var{category}. @var{string1} is the English singular variant of a message, and @var{string2} the English plural variant of the same message. The default value for @var{domain} is the current value of @code{TEXTDOMAIN}. The default value for @var{category} is @code{"LC_MESSAGES"}. The same remarks about argument order as for the @code{dcgettext()} function apply. @cindex @code{.mo} files, specifying directory of @cindex files, @code{.mo}, specifying directory of @cindex message object files, specifying directory of @cindex files, message object, specifying directory of @cindex @code{bindtextdomain()} function (@command{gawk}) @item bindtextdomain(@var{directory} @r{[}, @var{domain}@r{]}) Change the directory in which @code{gettext} looks for @file{.mo} files, in case they will not or cannot be placed in the standard locations (e.g., during testing). Return the directory in which @var{domain} is ``bound.'' The default @var{domain} is the value of @code{TEXTDOMAIN}. If @var{directory} is the null string (@code{""}), then @code{bindtextdomain()} returns the current binding for the given @var{domain}. @end table To use these facilities in your @command{awk} program, follow the steps outlined in @ifnotinfo the previous @value{SECTION}, @end ifnotinfo @ifinfo @ref{Explaining gettext}, @end ifinfo like so: @enumerate @cindex @code{BEGIN} pattern, @code{TEXTDOMAIN} variable and @cindex @code{TEXTDOMAIN} variable, @code{BEGIN} pattern and @item Set the variable @code{TEXTDOMAIN} to the text domain of your program. This is best done in a @code{BEGIN} rule (@pxref{BEGIN/END}), or it can also be done via the @option{-v} command-line option (@pxref{Options}): @example BEGIN @{ TEXTDOMAIN = "guide" @dots{} @} @end example @cindex @code{_} (underscore), translatable string @cindex underscore (@code{_}), translatable string @item Mark all translatable strings with a leading underscore (@samp{_}) character. It @emph{must} be adjacent to the opening quote of the string. For example: @example print _"hello, world" x = _"you goofed" printf(_"Number of users is %d\n", nusers) @end example @item If you are creating strings dynamically, you can still translate them, using the @code{dcgettext()} built-in function: @example message = nusers " users logged in" message = dcgettext(message, "adminprog") print message @end example Here, the call to @code{dcgettext()} supplies a different text domain (@code{"adminprog"}) in which to find the message, but it uses the default @code{"LC_MESSAGES"} category. @cindex @code{LC_MESSAGES} locale category, @code{bindtextdomain()} function (@command{gawk}) @item During development, you might want to put the @file{.mo} file in a private directory for testing. This is done with the @code{bindtextdomain()} built-in function: @example BEGIN @{ TEXTDOMAIN = "guide" # our text domain if (Testing) @{ # where to find our files bindtextdomain("testdir") # joe is in charge of adminprog bindtextdomain("../joe/testdir", "adminprog") @} @dots{} @} @end example @end enumerate @xref{I18N Example}, for an example program showing the steps to create and use translations from @command{awk}. @node Translator i18n @section Translating @command{awk} Programs @cindex @code{.po} files @cindex files, @code{.po} @cindex portable object files @cindex files, portable object Once a program's translatable strings have been marked, they must be extracted to create the initial @file{.po} file. As part of translation, it is often helpful to rearrange the order in which arguments to @code{printf} are output. @command{gawk}'s @option{--gen-pot} command-line option extracts the messages and is discussed next. After that, @code{printf}'s ability to rearrange the order for @code{printf} arguments at runtime is covered. @menu * String Extraction:: Extracting marked strings. * Printf Ordering:: Rearranging @code{printf} arguments. * I18N Portability:: @command{awk}-level portability issues. @end menu @node String Extraction @subsection Extracting Marked Strings @cindex strings, extracting @cindex marked strings@comma{} extracting @cindex @code{--gen-pot} option @cindex command-line options, string extraction @cindex string extraction (internationalization) @cindex marked string extraction (internationalization) @cindex extraction, of marked strings (internationalization) @cindex @code{--gen-pot} option Once your @command{awk} program is working, and all the strings have been marked and you've set (and perhaps bound) the text domain, it is time to produce translations. First, use the @option{--gen-pot} command-line option to create the initial @file{.pot} file: @example $ @kbd{gawk --gen-pot -f guide.awk > guide.pot} @end example @cindex @code{xgettext} utility When run with @option{--gen-pot}, @command{gawk} does not execute your program. Instead, it parses it as usual and prints all marked strings to standard output in the format of a GNU @code{gettext} Portable Object file. Also included in the output are any constant strings that appear as the first argument to @code{dcgettext()} or as the first and second argument to @code{dcngettext()}.@footnote{The @command{xgettext} utility that comes with GNU @code{gettext} can handle @file{.awk} files.} @xref{I18N Example}, for the full list of steps to go through to create and test translations for @command{guide}. @node Printf Ordering @subsection Rearranging @code{printf} Arguments @cindex @code{printf} statement, positional specifiers @cindex positional specifiers, @code{printf} statement Format strings for @code{printf} and @code{sprintf()} (@pxref{Printf}) present a special problem for translation. Consider the following:@footnote{This example is borrowed from the GNU @code{gettext} manual.} @c line broken here only for smallbook format @example printf(_"String `%s' has %d characters\n", string, length(string))) @end example A possible German translation for this might be: @example "%d Zeichen lang ist die Zeichenkette `%s'\n" @end example The problem should be obvious: the order of the format specifications is different from the original! Even though @code{gettext()} can return the translated string at runtime, it cannot change the argument order in the call to @code{printf}. To solve this problem, @code{printf} format specifiers may have an additional optional element, which we call a @dfn{positional specifier}. For example: @example "%2$d Zeichen lang ist die Zeichenkette `%1$s'\n" @end example Here, the positional specifier consists of an integer count, which indicates which argument to use, and a @samp{$}. Counts are one-based, and the format string itself is @emph{not} included. Thus, in the following example, @samp{string} is the first argument and @samp{length(string)} is the second: @example $ @kbd{gawk 'BEGIN @{} > @kbd{string = "Dont Panic"} > @kbd{printf _"%2$d characters live in \"%1$s\"\n",} > @kbd{string, length(string)} > @kbd{@}'} @print{} 10 characters live in "Dont Panic" @end example If present, positional specifiers come first in the format specification, before the flags, the field width, and/or the precision. Positional specifiers can be used with the dynamic field width and precision capability: @example $ @kbd{gawk 'BEGIN @{} > @kbd{printf("%*.*s\n", 10, 20, "hello")} > @kbd{printf("%3$*2$.*1$s\n", 20, 10, "hello")} > @kbd{@}'} @print{} hello @print{} hello @end example @quotation NOTE When using @samp{*} with a positional specifier, the @samp{*} comes first, then the integer position, and then the @samp{$}. This is somewhat counterintuitive. @end quotation @cindex @code{printf} statement, positional specifiers, mixing with regular formats @cindex positional specifiers, @code{printf} statement, mixing with regular formats @cindex format specifiers, mixing regular with positional specifiers @command{gawk} does not allow you to mix regular format specifiers and those with positional specifiers in the same string: @example $ @kbd{gawk 'BEGIN @{ printf _"%d %3$s\n", 1, 2, "hi" @}'} @error{} gawk: cmd. line:1: fatal: must use `count$' on all formats or none @end example @quotation NOTE There are some pathological cases that @command{gawk} may fail to diagnose. In such cases, the output may not be what you expect. It's still a bad idea to try mixing them, even if @command{gawk} doesn't detect it. @end quotation Although positional specifiers can be used directly in @command{awk} programs, their primary purpose is to help in producing correct translations of format strings into languages different from the one in which the program is first written. @node I18N Portability @subsection @command{awk} Portability Issues @cindex portability, internationalization and @cindex internationalization, localization, portability and @command{gawk}'s internationalization features were purposely chosen to have as little impact as possible on the portability of @command{awk} programs that use them to other versions of @command{awk}. Consider this program: @example BEGIN @{ TEXTDOMAIN = "guide" if (Test_Guide) # set with -v bindtextdomain("/test/guide/messages") print _"don't panic!" @} @end example @noindent As written, it won't work on other versions of @command{awk}. However, it is actually almost portable, requiring very little change: @itemize @bullet @cindex @code{TEXTDOMAIN} variable, portability and @item Assignments to @code{TEXTDOMAIN} won't have any effect, since @code{TEXTDOMAIN} is not special in other @command{awk} implementations. @item Non-GNU versions of @command{awk} treat marked strings as the concatenation of a variable named @code{_} with the string following it.@footnote{This is good fodder for an ``Obfuscated @command{awk}'' contest.} Typically, the variable @code{_} has the null string (@code{""}) as its value, leaving the original string constant as the result. @item By defining ``dummy'' functions to replace @code{dcgettext()}, @code{dcngettext()} and @code{bindtextdomain()}, the @command{awk} program can be made to run, but all the messages are output in the original language. For example: @cindex @code{bindtextdomain()} function (@command{gawk}), portability and @cindex @code{dcgettext()} function (@command{gawk}), portability and @cindex @code{dcngettext()} function (@command{gawk}), portability and @example @c file eg/lib/libintl.awk function bindtextdomain(dir, domain) @{ return dir @} function dcgettext(string, domain, category) @{ return string @} function dcngettext(string1, string2, number, domain, category) @{ return (number == 1 ? string1 : string2) @} @c endfile @end example @item The use of positional specifications in @code{printf} or @code{sprintf()} is @emph{not} portable. To support @code{gettext()} at the C level, many systems' C versions of @code{sprintf()} do support positional specifiers. But it works only if enough arguments are supplied in the function call. Many versions of @command{awk} pass @code{printf} formats and arguments unchanged to the underlying C library version of @code{sprintf()}, but only one format and argument at a time. What happens if a positional specification is used is anybody's guess. However, since the positional specifications are primarily for use in @emph{translated} format strings, and since non-GNU @command{awk}s never retrieve the translated string, this should not be a problem in practice. @end itemize @c ENDOFRANGE inap @node I18N Example @section A Simple Internationalization Example Now let's look at a step-by-step example of how to internationalize and localize a simple @command{awk} program, using @file{guide.awk} as our original source: @example @c file eg/prog/guide.awk BEGIN @{ TEXTDOMAIN = "guide" bindtextdomain(".") # for testing print _"Don't Panic" print _"The Answer Is", 42 print "Pardon me, Zaphod who?" @} @c endfile @end example @noindent Run @samp{gawk --gen-pot} to create the @file{.pot} file: @example $ @kbd{gawk --gen-pot -f guide.awk > guide.pot} @end example @noindent This produces: @example @c file eg/data/guide.po #: guide.awk:4 msgid "Don't Panic" msgstr "" #: guide.awk:5 msgid "The Answer Is" msgstr "" @c endfile @end example This original portable object template file is saved and reused for each language into which the application is translated. The @code{msgid} is the original string and the @code{msgstr} is the translation. @quotation NOTE Strings not marked with a leading underscore do not appear in the @file{guide.pot} file. @end quotation Next, the messages must be translated. Here is a translation to a hypothetical dialect of English, called ``Mellow'':@footnote{Perhaps it would be better if it were called ``Hippy.'' Ah, well.} @example @group $ cp guide.pot guide-mellow.po @var{Add translations to} guide-mellow.po @dots{} @end group @end example @noindent Following are the translations: @example @c file eg/data/guide-mellow.po #: guide.awk:4 msgid "Don't Panic" msgstr "Hey man, relax!" #: guide.awk:5 msgid "The Answer Is" msgstr "Like, the scoop is" @c endfile @end example @cindex Linux @cindex GNU/Linux The next step is to make the directory to hold the binary message object file and then to create the @file{guide.mo} file. The directory layout shown here is standard for GNU @code{gettext} on GNU/Linux systems. Other versions of @code{gettext} may use a different layout: @example $ @kbd{mkdir en_US en_US/LC_MESSAGES} @end example @cindex @code{.po} files, converting to @code{.mo} @cindex files, @code{.po}, converting to @code{.mo} @cindex @code{.mo} files, converting from @code{.po} @cindex files, @code{.mo}, converting from @code{.po} @cindex portable object files, converting to message object files @cindex files, portable object, converting to message object files @cindex message object files, converting from portable object files @cindex files, message object, converting from portable object files @cindex @command{msgfmt} utility The @command{msgfmt} utility does the conversion from human-readable @file{.po} file to machine-readable @file{.mo} file. By default, @command{msgfmt} creates a file named @file{messages}. This file must be renamed and placed in the proper directory so that @command{gawk} can find it: @example $ @kbd{msgfmt guide-mellow.po} $ @kbd{mv messages en_US/LC_MESSAGES/guide.mo} @end example Finally, we run the program to test it: @example $ @kbd{gawk -f guide.awk} @print{} Hey man, relax! @print{} Like, the scoop is 42 @print{} Pardon me, Zaphod who? @end example If the three replacement functions for @code{dcgettext()}, @code{dcngettext()} and @code{bindtextdomain()} (@pxref{I18N Portability}) are in a file named @file{libintl.awk}, then we can run @file{guide.awk} unchanged as follows: @example $ @kbd{gawk --posix -f guide.awk -f libintl.awk} @print{} Don't Panic @print{} The Answer Is 42 @print{} Pardon me, Zaphod who? @end example @node Gawk I18N @section @command{gawk} Can Speak Your Language @command{gawk} itself has been internationalized using the GNU @code{gettext} package. (GNU @code{gettext} is described in complete detail in @ifinfo @inforef{Top, , GNU @code{gettext} utilities, gettext, GNU gettext tools}.) @end ifinfo @ifnotinfo @cite{GNU gettext tools}.) @end ifnotinfo As of this writing, the latest version of GNU @code{gettext} is @uref{ftp://ftp.gnu.org/gnu/gettext/gettext-0.18.1.tar.gz, @value{PVERSION} 0.18.1}. If a translation of @command{gawk}'s messages exists, then @command{gawk} produces usage messages, warnings, and fatal errors in the local language. @c ENDOFRANGE inloc @node Advanced Features @chapter Advanced Features of @command{gawk} @cindex advanced features, network connections, See Also networks, connections @c STARTOFRANGE gawadv @cindex @command{gawk}, features, advanced @c STARTOFRANGE advgaw @cindex advanced features, @command{gawk} @ignore Contributed by: Peter Langston Found in Steve English's "signature" line: "Write documentation as if whoever reads it is a violent psychopath who knows where you live." @end ignore @quotation @i{Write documentation as if whoever reads it is a violent psychopath who knows where you live.}@* Steve English, as quoted by Peter Langston @end quotation This @value{CHAPTER} discusses advanced features in @command{gawk}. It's a bit of a ``grab bag'' of items that are otherwise unrelated to each other. First, a command-line option allows @command{gawk} to recognize nondecimal numbers in input data, not just in @command{awk} programs. Then, @command{gawk}'s special features for sorting arrays are presented. Next, two-way I/O, discussed briefly in earlier parts of this @value{DOCUMENT}, is described in full detail, along with the basics of TCP/IP networking. Finally, @command{gawk} can @dfn{profile} an @command{awk} program, making it possible to tune it for performance. @ref{Dynamic Extensions}, discusses the ability to dynamically add new built-in functions to @command{gawk}. As this feature is still immature and likely to change, its description is relegated to an appendix. @menu * Nondecimal Data:: Allowing nondecimal input data. * Array Sorting:: Facilities for controlling array traversal and sorting arrays. * Two-way I/O:: Two-way communications with another process. * TCP/IP Networking:: Using @command{gawk} for network programming. * Profiling:: Profiling your @command{awk} programs. @end menu @node Nondecimal Data @section Allowing Nondecimal Input Data @cindex @code{--non-decimal-data} option @cindex advanced features, @command{gawk}, nondecimal input data @cindex input, data@comma{} nondecimal @cindex constants, nondecimal If you run @command{gawk} with the @option{--non-decimal-data} option, you can have nondecimal constants in your input data: @c line break here for small book format @example $ @kbd{echo 0123 123 0x123 |} > @kbd{gawk --non-decimal-data '@{ printf "%d, %d, %d\n",} > @kbd{$1, $2, $3 @}'} @print{} 83, 123, 291 @end example For this feature to work, write your program so that @command{gawk} treats your data as numeric: @example $ @kbd{echo 0123 123 0x123 | gawk '@{ print $1, $2, $3 @}'} @print{} 0123 123 0x123 @end example @noindent The @code{print} statement treats its expressions as strings. Although the fields can act as numbers when necessary, they are still strings, so @code{print} does not try to treat them numerically. You may need to add zero to a field to force it to be treated as a number. For example: @example $ @kbd{echo 0123 123 0x123 | gawk --non-decimal-data '} > @kbd{@{ print $1, $2, $3} > @kbd{print $1 + 0, $2 + 0, $3 + 0 @}'} @print{} 0123 123 0x123 @print{} 83 123 291 @end example Because it is common to have decimal data with leading zeros, and because using this facility could lead to surprising results, the default is to leave it disabled. If you want it, you must explicitly request it. @cindex programming conventions, @code{--non-decimal-data} option @cindex @code{--non-decimal-data} option, @code{strtonum()} function and @cindex @code{strtonum()} function (@command{gawk}), @code{--non-decimal-data} option and @quotation CAUTION @emph{Use of this option is not recommended.} It can break old programs very badly. Instead, use the @code{strtonum()} function to convert your data (@pxref{Nondecimal-numbers}). This makes your programs easier to write and easier to read, and leads to less surprising results. @end quotation @node Array Sorting @section Controlling Array Traversal and Array Sorting @command{gawk} lets you control the order in which a @samp{for (i in array)} loop traverses an array. In addition, two built-in functions, @code{asort()} and @code{asorti()}, let you sort arrays based on the array values and indices, respectively. These two functions also provide control over the sorting criteria used to order the elements during sorting. @menu * Controlling Array Traversal:: How to use PROCINFO["sorted_in"]. * Array Sorting Functions:: How to use @code{asort()} and @code{asorti()}. @end menu @node Controlling Array Traversal @subsection Controlling Array Traversal By default, the order in which a @samp{for (i in array)} loop scans an array is not defined; it is generally based upon the internal implementation of arrays inside @command{awk}. Often, though, it is desirable to be able to loop over the elements in a particular order that you, the programmer, choose. @command{gawk} lets you do this. @ref{Controlling Scanning}, describes how you can assign special, pre-defined values to @code{PROCINFO["sorted_in"]} in order to control the order in which @command{gawk} will traverse an array during a @code{for} loop. In addition, the value of @code{PROCINFO["sorted_in"]} can be a function name. This lets you traverse an array based on any custom criterion. The array elements are ordered according to the return value of this function. The comparison function should be defined with at least four arguments: @example function comp_func(i1, v1, i2, v2) @{ @var{compare elements 1 and 2 in some fashion} @var{return < 0; 0; or > 0} @} @end example Here, @var{i1} and @var{i2} are the indices, and @var{v1} and @var{v2} are the corresponding values of the two elements being compared. Either @var{v1} or @var{v2}, or both, can be arrays if the array being traversed contains subarrays as values. (@xref{Arrays of Arrays}, for more information about subarrays.) The three possible return values are interpreted as follows: @table @code @item comp_func(i1, v1, i2, v2) < 0 Index @var{i1} comes before index @var{i2} during loop traversal. @item comp_func(i1, v1, i2, v2) == 0 Indices @var{i1} and @var{i2} come together but the relative order with respect to each other is undefined. @item comp_func(i1, v1, i2, v2) > 0 Index @var{i1} comes after index @var{i2} during loop traversal. @end table Our first comparison function can be used to scan an array in numerical order of the indices: @example function cmp_num_idx(i1, v1, i2, v2) @{ # numerical index comparison, ascending order return (i1 - i2) @} @end example Our second function traverses an array based on the string order of the element values rather than by indices: @example function cmp_str_val(i1, v1, i2, v2) @{ # string value comparison, ascending order v1 = v1 "" v2 = v2 "" if (v1 < v2) return -1 return (v1 != v2) @} @end example The third comparison function makes all numbers, and numeric strings without any leading or trailing spaces, come out first during loop traversal: @example function cmp_num_str_val(i1, v1, i2, v2, n1, n2) @{ # numbers before string value comparison, ascending order n1 = v1 + 0 n2 = v2 + 0 if (n1 == v1) return (n2 == v2) ? (n1 - n2) : -1 else if (n2 == v2) return 1 return (v1 < v2) ? -1 : (v1 != v2) @} @end example Here is a main program to demonstrate how @command{gawk} behaves using each of the previous functions: @example BEGIN @{ data["one"] = 10 data["two"] = 20 data[10] = "one" data[100] = 100 data[20] = "two" f[1] = "cmp_num_idx" f[2] = "cmp_str_val" f[3] = "cmp_num_str_val" for (i = 1; i <= 3; i++) @{ printf("Sort function: %s\n", f[i]) PROCINFO["sorted_in"] = f[i] for (j in data) printf("\tdata[%s] = %s\n", j, data[j]) print "" @} @} @end example Here are the results when the program is run: @page @example $ @kbd{gawk -f compdemo.awk} @print{} Sort function: cmp_num_idx @ii{Sort by numeric index} @print{} data[two] = 20 @print{} data[one] = 10 @ii{Both strings are numerically zero} @print{} data[10] = one @print{} data[20] = two @print{} data[100] = 100 @print{} @print{} Sort function: cmp_str_val @ii{Sort by element values as strings} @print{} data[one] = 10 @print{} data[100] = 100 @ii{String 100 is less than string 20} @print{} data[two] = 20 @print{} data[10] = one @print{} data[20] = two @print{} @print{} Sort function: cmp_num_str_val @ii{Sort all numeric values before all strings} @print{} data[one] = 10 @print{} data[two] = 20 @print{} data[100] = 100 @print{} data[10] = one @print{} data[20] = two @end example Consider sorting the entries of a GNU/Linux system password file according to login name. The following program sorts records by a specific field position and can be used for this purpose: @example # sort.awk --- simple program to sort by field position # field position is specified by the global variable POS function cmp_field(i1, v1, i2, v2) @{ # comparison by value, as string, and ascending order return v1[POS] < v2[POS] ? -1 : (v1[POS] != v2[POS]) @} @{ for (i = 1; i <= NF; i++) a[NR][i] = $i @} END @{ PROCINFO["sorted_in"] = "cmp_field" if (POS < 1 || POS > NF) POS = 1 for (i in a) @{ for (j = 1; j <= NF; j++) printf("%s%c", a[i][j], j < NF ? ":" : "") print "" @} @} @end example The first field in each entry of the password file is the user's login name, and the fields are separated by colons. Each record defines a subarray, with each field as an element in the subarray. Running the program produces the following output: @example $ @kbd{gawk -vPOS=1 -F: -f sort.awk /etc/passwd} @print{} adm:x:3:4:adm:/var/adm:/sbin/nologin @print{} apache:x:48:48:Apache:/var/www:/sbin/nologin @print{} avahi:x:70:70:Avahi daemon:/:/sbin/nologin @dots{} @end example The comparison should normally always return the same value when given a specific pair of array elements as its arguments. If inconsistent results are returned then the order is undefined. This behavior can be exploited to introduce random order into otherwise seemingly ordered data: @example function cmp_randomize(i1, v1, i2, v2) @{ # random order return (2 - 4 * rand()) @} @end example As mentioned above, the order of the indices is arbitrary if two elements compare equal. This is usually not a problem, but letting the tied elements come out in arbitrary order can be an issue, especially when comparing item values. The partial ordering of the equal elements may change during the next loop traversal, if other elements are added or removed from the array. One way to resolve ties when comparing elements with otherwise equal values is to include the indices in the comparison rules. Note that doing this may make the loop traversal less efficient, so consider it only if necessary. The following comparison functions force a deterministic order, and are based on the fact that the indices of two elements are never equal: @example function cmp_numeric(i1, v1, i2, v2) @{ # numerical value (and index) comparison, descending order return (v1 != v2) ? (v2 - v1) : (i2 - i1) @} function cmp_string(i1, v1, i2, v2) @{ # string value (and index) comparison, descending order v1 = v1 i1 v2 = v2 i2 return (v1 > v2) ? -1 : (v1 != v2) @} @end example @c Avoid using the term ``stable'' when describing the unpredictable behavior @c if two items compare equal. Usually, the goal of a "stable algorithm" @c is to maintain the original order of the items, which is a meaningless @c concept for a list constructed from a hash. A custom comparison function can often simplify ordered loop traversal, and the sky is really the limit when it comes to designing such a function. When string comparisons are made during a sort, either for element values where one or both aren't numbers, or for element indices handled as strings, the value of @code{IGNORECASE} (@pxref{Built-in Variables}) controls whether the comparisons treat corresponding uppercase and lowercase letters as equivalent or distinct. Another point to keep in mind is that in the case of subarrays the element values can themselves be arrays; a production comparison function should use the @code{isarray()} function (@pxref{Type Functions}), to check for this, and choose a defined sorting order for subarrays. All sorting based on @code{PROCINFO["sorted_in"]} is disabled in POSIX mode, since the @code{PROCINFO} array is not special in that case. As a side note, sorting the array indices before traversing the array has been reported to add 15% to 20% overhead to the execution time of @command{awk} programs. For this reason, sorted array traversal is not the default. @c The @command{gawk} @c maintainers believe that only the people who wish to use a @c feature should have to pay for it. @node Array Sorting Functions @subsection Sorting Array Values and Indices with @command{gawk} @cindex arrays, sorting @cindex @code{asort()} function (@command{gawk}) @cindex @code{asort()} function (@command{gawk}), arrays@comma{} sorting @cindex sort function, arrays, sorting In most @command{awk} implementations, sorting an array requires writing a @code{sort()} function. While this can be educational for exploring different sorting algorithms, usually that's not the point of the program. @command{gawk} provides the built-in @code{asort()} and @code{asorti()} functions (@pxref{String Functions}) for sorting arrays. For example: @example @var{populate the array} data n = asort(data) for (i = 1; i <= n; i++) @var{do something with} data[i] @end example After the call to @code{asort()}, the array @code{data} is indexed from 1 to some number @var{n}, the total number of elements in @code{data}. (This count is @code{asort()}'s return value.) @code{data[1]} @value{LEQ} @code{data[2]} @value{LEQ} @code{data[3]}, and so on. The comparison is based on the type of the elements (@pxref{Typing and Comparison}). All numeric values come before all string values, which in turn come before all subarrays. @cindex side effects, @code{asort()} function An important side effect of calling @code{asort()} is that @emph{the array's original indices are irrevocably lost}. As this isn't always desirable, @code{asort()} accepts a second argument: @example @var{populate the array} source n = asort(source, dest) for (i = 1; i <= n; i++) @var{do something with} dest[i] @end example In this case, @command{gawk} copies the @code{source} array into the @code{dest} array and then sorts @code{dest}, destroying its indices. However, the @code{source} array is not affected. @code{asort()} accepts a third string argument to control comparison of array elements. As with @code{PROCINFO["sorted_in"]}, this argument may be one of the predefined names that @command{gawk} provides (@pxref{Controlling Scanning}), or the name of a user-defined function (@pxref{Controlling Array Traversal}). @quotation NOTE In all cases, the sorted element values consist of the original array's element values. The ability to control comparison merely affects the way in which they are sorted. @end quotation Often, what's needed is to sort on the values of the @emph{indices} instead of the values of the elements. To do that, use the @code{asorti()} function. The interface is identical to that of @code{asort()}, except that the index values are used for sorting, and become the values of the result array: @example @{ source[$0] = some_func($0) @} END @{ n = asorti(source, dest) for (i = 1; i <= n; i++) @{ @ii{Work with sorted indices directly:} @var{do something with} dest[i] @dots{} @ii{Access original array via sorted indices:} @var{do something with} source[dest[i]] @} @} @end example Similar to @code{asort()}, in all cases, the sorted element values consist of the original array's indices. The ability to control comparison merely affects the way in which they are sorted. Sorting the array by replacing the indices provides maximal flexibility. To traverse the elements in decreasing order, use a loop that goes from @var{n} down to 1, either over the elements or over the indices.@footnote{You may also use one of the predefined sorting names that sorts in decreasing order.} @cindex reference counting, sorting arrays Copying array indices and elements isn't expensive in terms of memory. Internally, @command{gawk} maintains @dfn{reference counts} to data. For example, when @code{asort()} copies the first array to the second one, there is only one copy of the original array elements' data, even though both arrays use the values. @c Document It And Call It A Feature. Sigh. @cindex @command{gawk}, @code{IGNORECASE} variable in @cindex @code{IGNORECASE} variable @cindex arrays, sorting, @code{IGNORECASE} variable and @cindex @code{IGNORECASE} variable, array sorting and Because @code{IGNORECASE} affects string comparisons, the value of @code{IGNORECASE} also affects sorting for both @code{asort()} and @code{asorti()}. Note also that the locale's sorting order does @emph{not} come into play; comparisons are based on character values only.@footnote{This is true because locale-based comparison occurs only when in POSIX compatibility mode, and since @code{asort()} and @code{asorti()} are @command{gawk} extensions, they are not available in that case.} Caveat Emptor. @node Two-way I/O @section Two-Way Communications with Another Process @cindex Brennan, Michael @cindex programmers, attractiveness of @smallexample @c Path: cssun.mathcs.emory.edu!gatech!newsxfer3.itd.umich.edu!news-peer.sprintlink.net!news-sea-19.sprintlink.net!news-in-west.sprintlink.net!news.sprintlink.net!Sprint!204.94.52.5!news.whidbey.com!brennan From: brennan@@whidbey.com (Mike Brennan) Newsgroups: comp.lang.awk Subject: Re: Learn the SECRET to Attract Women Easily Date: 4 Aug 1997 17:34:46 GMT @c Organization: WhidbeyNet @c Lines: 12 Message-ID: <5s53rm$eca@@news.whidbey.com> @c References: <5s20dn$2e1@chronicle.concentric.net> @c Reply-To: brennan@whidbey.com @c NNTP-Posting-Host: asn202.whidbey.com @c X-Newsreader: slrn (0.9.4.1 UNIX) @c Xref: cssun.mathcs.emory.edu comp.lang.awk:5403 On 3 Aug 1997 13:17:43 GMT, Want More Dates??? wrote: >Learn the SECRET to Attract Women Easily > >The SCENT(tm) Pheromone Sex Attractant For Men to Attract Women The scent of awk programmers is a lot more attractive to women than the scent of perl programmers. -- Mike Brennan @c brennan@@whidbey.com @end smallexample @cindex advanced features, @command{gawk}, processes@comma{} communicating with @cindex processes, two-way communications with It is often useful to be able to send data to a separate program for processing and then read the result. This can always be done with temporary files: @example # Write the data for processing tempfile = ("mydata." PROCINFO["pid"]) while (@var{not done with data}) print @var{data} | ("subprogram > " tempfile) close("subprogram > " tempfile) # Read the results, remove tempfile when done while ((getline newdata < tempfile) > 0) @var{process} newdata @var{appropriately} close(tempfile) system("rm " tempfile) @end example @noindent This works, but not elegantly. Among other things, it requires that the program be run in a directory that cannot be shared among users; for example, @file{/tmp} will not do, as another user might happen to be using a temporary file with the same name. @cindex coprocesses @cindex input/output, two-way @cindex @code{|} (vertical bar), @code{|&} operator (I/O) @cindex vertical bar (@code{|}), @code{|&} operator (I/O) @cindex @command{csh} utility, @code{|&} operator, comparison with However, with @command{gawk}, it is possible to open a @emph{two-way} pipe to another process. The second process is termed a @dfn{coprocess}, since it runs in parallel with @command{gawk}. The two-way connection is created using the @samp{|&} operator (borrowed from the Korn shell, @command{ksh}):@footnote{This is very different from the same operator in the C shell.} @example do @{ print @var{data} |& "subprogram" "subprogram" |& getline results @} while (@var{data left to process}) close("subprogram") @end example The first time an I/O operation is executed using the @samp{|&} operator, @command{gawk} creates a two-way pipeline to a child process that runs the other program. Output created with @code{print} or @code{printf} is written to the program's standard input, and output from the program's standard output can be read by the @command{gawk} program using @code{getline}. As is the case with processes started by @samp{|}, the subprogram can be any program, or pipeline of programs, that can be started by the shell. There are some cautionary items to be aware of: @itemize @bullet @item As the code inside @command{gawk} currently stands, the coprocess's standard error goes to the same place that the parent @command{gawk}'s standard error goes. It is not possible to read the child's standard error separately. @cindex deadlocks @cindex buffering, input/output @cindex @code{getline} command, deadlock and @item I/O buffering may be a problem. @command{gawk} automatically flushes all output down the pipe to the coprocess. However, if the coprocess does not flush its output, @command{gawk} may hang when doing a @code{getline} in order to read the coprocess's results. This could lead to a situation known as @dfn{deadlock}, where each process is waiting for the other one to do something. @end itemize @cindex @code{close()} function, two-way pipes and It is possible to close just one end of the two-way pipe to a coprocess, by supplying a second argument to the @code{close()} function of either @code{"to"} or @code{"from"} (@pxref{Close Files And Pipes}). These strings tell @command{gawk} to close the end of the pipe that sends data to the coprocess or the end that reads from it, respectively. @cindex @command{sort} utility, coprocesses and This is particularly necessary in order to use the system @command{sort} utility as part of a coprocess; @command{sort} must read @emph{all} of its input data before it can produce any output. The @command{sort} program does not receive an end-of-file indication until @command{gawk} closes the write end of the pipe. When you have finished writing data to the @command{sort} utility, you can close the @code{"to"} end of the pipe, and then start reading sorted data via @code{getline}. For example: @example BEGIN @{ command = "LC_ALL=C sort" n = split("abcdefghijklmnopqrstuvwxyz", a, "") for (i = n; i > 0; i--) print a[i] |& command close(command, "to") while ((command |& getline line) > 0) print "got", line close(command) @} @end example This program writes the letters of the alphabet in reverse order, one per line, down the two-way pipe to @command{sort}. It then closes the write end of the pipe, so that @command{sort} receives an end-of-file indication. This causes @command{sort} to sort the data and write the sorted data back to the @command{gawk} program. Once all of the data has been read, @command{gawk} terminates the coprocess and exits. As a side note, the assignment @samp{LC_ALL=C} in the @command{sort} command ensures traditional Unix (ASCII) sorting from @command{sort}. @cindex @command{gawk}, @code{PROCINFO} array in @cindex @code{PROCINFO} array You may also use pseudo-ttys (ptys) for two-way communication instead of pipes, if your system supports them. This is done on a per-command basis, by setting a special element in the @code{PROCINFO} array (@pxref{Auto-set}), like so: @example command = "sort -nr" # command, save in convenience variable PROCINFO[command, "pty"] = 1 # update PROCINFO print @dots{} |& command # start two-way pipe @dots{} @end example @noindent Using ptys avoids the buffer deadlock issues described earlier, at some loss in performance. If your system does not have ptys, or if all the system's ptys are in use, @command{gawk} automatically falls back to using regular pipes. @node TCP/IP Networking @section Using @command{gawk} for Network Programming @cindex advanced features, @command{gawk}, network programming @cindex networks, programming @c STARTOFRANGE tcpip @cindex TCP/IP @cindex @code{/inet/@dots{}} special files (@command{gawk}) @cindex files, @code{/inet/@dots{}} (@command{gawk}) @cindex @code{/inet4/@dots{}} special files (@command{gawk}) @cindex files, @code{/inet4/@dots{}} (@command{gawk}) @cindex @code{/inet6/@dots{}} special files (@command{gawk}) @cindex files, @code{/inet6/@dots{}} (@command{gawk}) @cindex @code{EMISTERED} @quotation @code{EMISTERED}:@* @ @ @ @ @i{A host is a host from coast to coast,@* @ @ @ @ and no-one can talk to host that's close,@* @ @ @ @ unless the host that isn't close@* @ @ @ @ is busy hung or dead.} @end quotation In addition to being able to open a two-way pipeline to a coprocess on the same system (@pxref{Two-way I/O}), it is possible to make a two-way connection to another process on another system across an IP network connection. You can think of this as just a @emph{very long} two-way pipeline to a coprocess. The way @command{gawk} decides that you want to use TCP/IP networking is by recognizing special @value{FN}s that begin with one of @samp{/inet/}, @samp{/inet4/} or @samp{/inet6}. The full syntax of the special @value{FN} is @file{/@var{net-type}/@var{protocol}/@var{local-port}/@var{remote-host}/@var{remote-port}}. The components are: @table @var @item net-type Specifies the kind of Internet connection to make. Use @samp{/inet4/} to force IPv4, and @samp{/inet6/} to force IPv6. Plain @samp{/inet/} (which used to be the only option) uses the system default, most likely IPv4. @item protocol The protocol to use over IP. This must be either @samp{tcp}, or @samp{udp}, for a TCP or UDP IP connection, respectively. The use of TCP is recommended for most applications. @item local-port @cindex @code{getaddrinfo()} function (C library) The local TCP or UDP port number to use. Use a port number of @samp{0} when you want the system to pick a port. This is what you should do when writing a TCP or UDP client. You may also use a well-known service name, such as @samp{smtp} or @samp{http}, in which case @command{gawk} attempts to determine the predefined port number using the C @code{getaddrinfo()} function. @item remote-host The IP address or fully-qualified domain name of the Internet host to which you want to connect. @item remote-port The TCP or UDP port number to use on the given @var{remote-host}. Again, use @samp{0} if you don't care, or else a well-known service name. @end table @cindex @command{gawk}, @code{ERRNO} variable in @cindex @code{ERRNO} variable @quotation NOTE Failure in opening a two-way socket will result in a non-fatal error being returned to the calling code. The value of @code{ERRNO} indicates the error (@pxref{Auto-set}). @end quotation Consider the following very simple example: @example BEGIN @{ Service = "/inet/tcp/0/localhost/daytime" Service |& getline print $0 close(Service) @} @end example This program reads the current date and time from the local system's TCP @samp{daytime} server. It then prints the results and closes the connection. Because this topic is extensive, the use of @command{gawk} for TCP/IP programming is documented separately. @ifinfo See @inforef{Top, , General Introduction, gawkinet, TCP/IP Internetworking with @command{gawk}}, @end ifinfo @ifnotinfo See @cite{TCP/IP Internetworking with @command{gawk}}, which comes as part of the @command{gawk} distribution, @end ifnotinfo for a much more complete introduction and discussion, as well as extensive examples. @c ENDOFRANGE tcpip @node Profiling @section Profiling Your @command{awk} Programs @c STARTOFRANGE awkp @cindex @command{awk} programs, profiling @c STARTOFRANGE proawk @cindex profiling @command{awk} programs @c STARTOFRANGE pgawk @cindex @command{pgawk} program @cindex profiling @command{gawk}, See @command{pgawk} program You may produce execution traces of your @command{awk} programs. This is done with a specially compiled version of @command{gawk}, called @command{pgawk} (``profiling @command{gawk}''). @cindex @code{awkprof.out} file @cindex files, @code{awkprof.out} @cindex @command{pgawk} program, @code{awkprof.out} file @command{pgawk} is identical in every way to @command{gawk}, except that when it has finished running, it creates a profile of your program in a file named @file{awkprof.out}. Because it is profiling, it also executes up to 45% slower than @command{gawk} normally does. @cindex @code{--profile} option As shown in the following example, the @option{--profile} option can be used to change the name of the file where @command{pgawk} will write the profile: @example pgawk --profile=myprog.prof -f myprog.awk data1 data2 @end example @noindent In the above example, @command{pgawk} places the profile in @file{myprog.prof} instead of in @file{awkprof.out}. Here is a sample session showing a simple @command{awk} program, its input data, and the results from running @command{pgawk}. First, the @command{awk} program: @example BEGIN @{ print "First BEGIN rule" @} END @{ print "First END rule" @} /foo/ @{ print "matched /foo/, gosh" for (i = 1; i <= 3; i++) sing() @} @{ if (/foo/) print "if is true" else print "else is true" @} BEGIN @{ print "Second BEGIN rule" @} END @{ print "Second END rule" @} function sing( dummy) @{ print "I gotta be me!" @} @end example Following is the input data: @example foo bar baz foo junk @end example Here is the @file{awkprof.out} that results from running @command{pgawk} on this program and data (this example also illustrates that @command{awk} programmers sometimes have to work late): @cindex @code{BEGIN} pattern, @command{pgawk} program @cindex @code{END} pattern, @command{pgawk} program @example # gawk profile, created Sun Aug 13 00:00:15 2000 # BEGIN block(s) BEGIN @{ 1 print "First BEGIN rule" 1 print "Second BEGIN rule" @} # Rule(s) 5 /foo/ @{ # 2 2 print "matched /foo/, gosh" 6 for (i = 1; i <= 3; i++) @{ 6 sing() @} @} 5 @{ 5 if (/foo/) @{ # 2 2 print "if is true" 3 @} else @{ 3 print "else is true" @} @} # END block(s) END @{ 1 print "First END rule" 1 print "Second END rule" @} # Functions, listed alphabetically 6 function sing(dummy) @{ 6 print "I gotta be me!" @} @end example This example illustrates many of the basic features of profiling output. They are as follows: @itemize @bullet @item The program is printed in the order @code{BEGIN} rule, @code{BEGINFILE} rule, pattern/action rules, @code{ENDFILE} rule, @code{END} rule and functions, listed alphabetically. Multiple @code{BEGIN} and @code{END} rules are merged together, as are multiple @code{BEGINFILE} and @code{ENDFILE} rules. @cindex patterns, counts @item Pattern-action rules have two counts. The first count, to the left of the rule, shows how many times the rule's pattern was @emph{tested}. The second count, to the right of the rule's opening left brace in a comment, shows how many times the rule's action was @emph{executed}. The difference between the two indicates how many times the rule's pattern evaluated to false. @item Similarly, the count for an @code{if}-@code{else} statement shows how many times the condition was tested. To the right of the opening left brace for the @code{if}'s body is a count showing how many times the condition was true. The count for the @code{else} indicates how many times the test failed. @cindex loops, count for header @item The count for a loop header (such as @code{for} or @code{while}) shows how many times the loop test was executed. (Because of this, you can't just look at the count on the first statement in a rule to determine how many times the rule was executed. If the first statement is a loop, the count is misleading.) @cindex functions, user-defined, counts @cindex user-defined, functions, counts @item For user-defined functions, the count next to the @code{function} keyword indicates how many times the function was called. The counts next to the statements in the body show how many times those statements were executed. @cindex @code{@{@}} (braces), @command{pgawk} program @cindex braces (@code{@{@}}), @command{pgawk} program @item The layout uses ``K&R'' style with TABs. Braces are used everywhere, even when the body of an @code{if}, @code{else}, or loop is only a single statement. @cindex @code{()} (parentheses), @command{pgawk} program @cindex parentheses @code{()}, @command{pgawk} program @item Parentheses are used only where needed, as indicated by the structure of the program and the precedence rules. @c extra verbiage here satisfies the copyeditor. ugh. For example, @samp{(3 + 5) * 4} means add three plus five, then multiply the total by four. However, @samp{3 + 5 * 4} has no parentheses, and means @samp{3 + (5 * 4)}. @ignore @item All string concatenations are parenthesized too. (This could be made a bit smarter.) @end ignore @item Parentheses are used around the arguments to @code{print} and @code{printf} only when the @code{print} or @code{printf} statement is followed by a redirection. Similarly, if the target of a redirection isn't a scalar, it gets parenthesized. @item @command{pgawk} supplies leading comments in front of the @code{BEGIN} and @code{END} rules, the pattern/action rules, and the functions. @end itemize The profiled version of your program may not look exactly like what you typed when you wrote it. This is because @command{pgawk} creates the profiled version by ``pretty printing'' its internal representation of the program. The advantage to this is that @command{pgawk} can produce a standard representation. The disadvantage is that all source-code comments are lost, as are the distinctions among multiple @code{BEGIN}, @code{END}, @code{BEGINFILE}, and @code{ENDFILE} rules. Also, things such as: @example /foo/ @end example @noindent come out as: @example /foo/ @{ print $0 @} @end example @noindent which is correct, but possibly surprising. @cindex profiling @command{awk} programs, dynamically @cindex @command{pgawk} program, dynamic profiling Besides creating profiles when a program has completed, @command{pgawk} can produce a profile while it is running. This is useful if your @command{awk} program goes into an infinite loop and you want to see what has been executed. To use this feature, run @command{pgawk} in the background: @example $ @kbd{pgawk -f myprog &} [1] 13992 @end example @cindex @command{kill} command@comma{} dynamic profiling @cindex @code{USR1} signal @cindex @code{SIGUSR1} signal @cindex signals, @code{USR1}/@code{SIGUSR1} @noindent The shell prints a job number and process ID number; in this case, 13992. Use the @command{kill} command to send the @code{USR1} signal to @command{pgawk}: @example $ @kbd{kill -USR1 13992} @end example @noindent As usual, the profiled version of the program is written to @file{awkprof.out}, or to a different file if you use the @option{--profile} option. Along with the regular profile, as shown earlier, the profile includes a trace of any active functions: @example # Function Call Stack: # 3. baz # 2. bar # 1. foo # -- main -- @end example You may send @command{pgawk} the @code{USR1} signal as many times as you like. Each time, the profile and function call trace are appended to the output profile file. @cindex @code{HUP} signal @cindex @code{SIGHUP} signal @cindex signals, @code{HUP}/@code{SIGHUP} If you use the @code{HUP} signal instead of the @code{USR1} signal, @command{pgawk} produces the profile and the function call trace and then exits. @cindex @code{INT} signal (MS-Windows) @cindex @code{SIGINT} signal (MS-Windows) @cindex signals, @code{INT}/@code{SIGINT} (MS-Windows) @cindex @code{QUIT} signal (MS-Windows) @cindex @code{SIGQUIT} signal (MS-Windows) @cindex signals, @code{QUIT}/@code{SIGQUIT} (MS-Windows) When @command{pgawk} runs on MS-Windows systems, it uses the @code{INT} and @code{QUIT} signals for producing the profile and, in the case of the @code{INT} signal, @command{pgawk} exits. This is because these systems don't support the @command{kill} command, so the only signals you can deliver to a program are those generated by the keyboard. The @code{INT} signal is generated by the @kbd{@value{CTL}-@key{C}} or @kbd{@value{CTL}-@key{BREAK}} key, while the @code{QUIT} signal is generated by the @kbd{@value{CTL}-@key{\}} key. Finally, regular @command{gawk} also accepts the @option{--profile} option. When called this way, @command{gawk} ``pretty prints'' the program into @file{awkprof.out}, without any execution counts. @c ENDOFRANGE advgaw @c ENDOFRANGE gawadv @c ENDOFRANGE pgawk @c ENDOFRANGE awkp @c ENDOFRANGE proawk @node Library Functions @chapter A Library of @command{awk} Functions @c STARTOFRANGE libf @cindex libraries of @command{awk} functions @c STARTOFRANGE flib @cindex functions, library @c STARTOFRANGE fudlib @cindex functions, user-defined, library of @ref{User-defined}, describes how to write your own @command{awk} functions. Writing functions is important, because it allows you to encapsulate algorithms and program tasks in a single place. It simplifies programming, making program development more manageable, and making programs more readable. One valuable way to learn a new programming language is to @emph{read} programs in that language. To that end, this @value{CHAPTER} and @ref{Sample Programs}, provide a good-sized body of code for you to read, and hopefully, to learn from. @c 2e: USE TEXINFO-2 FUNCTION DEFINITION STUFF!!!!!!!!!!!!! This @value{CHAPTER} presents a library of useful @command{awk} functions. Many of the sample programs presented later in this @value{DOCUMENT} use these functions. The functions are presented here in a progression from simple to complex. @cindex Texinfo @ref{Extract Program}, presents a program that you can use to extract the source code for these example library functions and programs from the Texinfo source for this @value{DOCUMENT}. (This has already been done as part of the @command{gawk} distribution.) If you have written one or more useful, general-purpose @command{awk} functions and would like to contribute them to the @command{awk} user community, see @ref{How To Contribute}, for more information. @cindex portability, example programs The programs in this @value{CHAPTER} and in @ref{Sample Programs}, freely use features that are @command{gawk}-specific. Rewriting these programs for different implementations of @command{awk} is pretty straightforward. @itemize @bullet @item Diagnostic error messages are sent to @file{/dev/stderr}. Use @samp{| "cat 1>&2"} instead of @samp{> "/dev/stderr"} if your system does not have a @file{/dev/stderr}, or if you cannot use @command{gawk}. @item A number of programs use @code{nextfile} (@pxref{Nextfile Statement}) to skip any remaining input in the input file. @item @c 12/2000: Thanks to Nelson Beebe for pointing out the output issue. @cindex case sensitivity, example programs @cindex @code{IGNORECASE} variable, in example programs Finally, some of the programs choose to ignore upper- and lowercase distinctions in their input. They do so by assigning one to @code{IGNORECASE}. You can achieve almost the same effect@footnote{The effects are not identical. Output of the transformed record will be in all lowercase, while @code{IGNORECASE} preserves the original contents of the input record.} by adding the following rule to the beginning of the program: @example # ignore case @{ $0 = tolower($0) @} @end example @noindent Also, verify that all regexp and string constants used in comparisons use only lowercase letters. @end itemize @menu * Library Names:: How to best name private global variables in library functions. * General Functions:: Functions that are of general use. * Data File Management:: Functions for managing command-line data files. * Getopt Function:: A function for processing command-line arguments. * Passwd Functions:: Functions for getting user information. * Group Functions:: Functions for getting group information. * Walking Arrays:: A function to walk arrays of arrays. @end menu @node Library Names @section Naming Library Function Global Variables @cindex names, arrays/variables @cindex names, functions @cindex namespace issues @cindex @command{awk} programs, documenting @cindex documentation, of @command{awk} programs Due to the way the @command{awk} language evolved, variables are either @dfn{global} (usable by the entire program) or @dfn{local} (usable just by a specific function). There is no intermediate state analogous to @code{static} variables in C. @cindex variables, global, for library functions @cindex private variables @cindex variables, private Library functions often need to have global variables that they can use to preserve state information between calls to the function---for example, @code{getopt()}'s variable @code{_opti} (@pxref{Getopt Function}). Such variables are called @dfn{private}, since the only functions that need to use them are the ones in the library. When writing a library function, you should try to choose names for your private variables that will not conflict with any variables used by either another library function or a user's main program. For example, a name like @code{i} or @code{j} is not a good choice, because user programs often use variable names like these for their own purposes. @cindex programming conventions, private variable names The example programs shown in this @value{CHAPTER} all start the names of their private variables with an underscore (@samp{_}). Users generally don't use leading underscores in their variable names, so this convention immediately decreases the chances that the variable name will be accidentally shared with the user's program. @cindex @code{_} (underscore), in names of private variables @cindex underscore (@code{_}), in names of private variables In addition, several of the library functions use a prefix that helps indicate what function or set of functions use the variables---for example, @code{_pw_byname} in the user database routines (@pxref{Passwd Functions}). This convention is recommended, since it even further decreases the chance of inadvertent conflict among variable names. Note that this convention is used equally well for variable names and for private function names.@footnote{While all the library routines could have been rewritten to use this convention, this was not done, in order to show how our own @command{awk} programming style has evolved and to provide some basis for this discussion.} As a final note on variable naming, if a function makes global variables available for use by a main program, it is a good convention to start that variable's name with a capital letter---for example, @code{getopt()}'s @code{Opterr} and @code{Optind} variables (@pxref{Getopt Function}). The leading capital letter indicates that it is global, while the fact that the variable name is not all capital letters indicates that the variable is not one of @command{awk}'s built-in variables, such as @code{FS}. @cindex @code{--dump-variables} option It is also important that @emph{all} variables in library functions that do not need to save state are, in fact, declared local.@footnote{@command{gawk}'s @option{--dump-variables} command-line option is useful for verifying this.} If this is not done, the variable could accidentally be used in the user's program, leading to bugs that are very difficult to track down: @example function lib_func(x, y, l1, l2) @{ @dots{} @var{use variable} some_var # some_var should be local @dots{} # but is not by oversight @} @end example @cindex arrays, associative, library functions and @cindex libraries of @command{awk} functions, associative arrays and @cindex functions, library, associative arrays and @cindex Tcl A different convention, common in the Tcl community, is to use a single associative array to hold the values needed by the library function(s), or ``package.'' This significantly decreases the number of actual global names in use. For example, the functions described in @ref{Passwd Functions}, might have used array elements @code{@w{PW_data["inited"]}}, @code{@w{PW_data["total"]}}, @code{@w{PW_data["count"]}}, and @code{@w{PW_data["awklib"]}}, instead of @code{@w{_pw_inited}}, @code{@w{_pw_awklib}}, @code{@w{_pw_total}}, and @code{@w{_pw_count}}. The conventions presented in this @value{SECTION} are exactly that: conventions. You are not required to write your programs this way---we merely recommend that you do so. @node General Functions @section General Programming This @value{SECTION} presents a number of functions that are of general programming use. @menu * Strtonum Function:: A replacement for the built-in @code{strtonum()} function. * Assert Function:: A function for assertions in @command{awk} programs. * Round Function:: A function for rounding if @code{sprintf()} does not do it correctly. * Cliff Random Function:: The Cliff Random Number Generator. * Ordinal Functions:: Functions for using characters as numbers and vice versa. * Join Function:: A function to join an array into a string. * Gettimeofday Function:: A function to get formatted times. @end menu @node Strtonum Function @subsection Converting Strings To Numbers The @code{strtonum()} function (@pxref{String Functions}) is a @command{gawk} extension. The following function provides an implementation for other versions of @command{awk}: @example @c file eg/lib/strtonum.awk # mystrtonum --- convert string to number @c endfile @ignore @c file eg/lib/strtonum.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # February, 2004 @c endfile @end ignore @c file eg/lib/strtonum.awk function mystrtonum(str, ret, chars, n, i, k, c) @{ if (str ~ /^0[0-7]*$/) @{ # octal n = length(str) ret = 0 for (i = 1; i <= n; i++) @{ c = substr(str, i, 1) if ((k = index("01234567", c)) > 0) k-- # adjust for 1-basing in awk ret = ret * 8 + k @} @} else if (str ~ /^0[xX][[:xdigit:]]+/) @{ # hexadecimal str = substr(str, 3) # lop off leading 0x n = length(str) ret = 0 for (i = 1; i <= n; i++) @{ c = substr(str, i, 1) c = tolower(c) if ((k = index("0123456789", c)) > 0) k-- # adjust for 1-basing in awk else if ((k = index("abcdef", c)) > 0) k += 9 ret = ret * 16 + k @} @} else if (str ~ \ /^[-+]?([0-9]+([.][0-9]*([Ee][0-9]+)?)?|([.][0-9]+([Ee][-+]?[0-9]+)?))$/) @{ # decimal number, possibly floating point ret = str + 0 @} else ret = "NOT-A-NUMBER" return ret @} # BEGIN @{ # gawk test harness # a[1] = "25" # a[2] = ".31" # a[3] = "0123" # a[4] = "0xdeadBEEF" # a[5] = "123.45" # a[6] = "1.e3" # a[7] = "1.32" # a[7] = "1.32E2" # # for (i = 1; i in a; i++) # print a[i], strtonum(a[i]), mystrtonum(a[i]) # @} @c endfile @end example The function first looks for C-style octal numbers (base 8). If the input string matches a regular expression describing octal numbers, then @code{mystrtonum()} loops through each character in the string. It sets @code{k} to the index in @code{"01234567"} of the current octal digit. Since the return value is one-based, the @samp{k--} adjusts @code{k} so it can be used in computing the return value. Similar logic applies to the code that checks for and converts a hexadecimal value, which starts with @samp{0x} or @samp{0X}. The use of @code{tolower()} simplifies the computation for finding the correct numeric value for each hexadecimal digit. Finally, if the string matches the (rather complicated) regexp for a regular decimal integer or floating-point number, the computation @samp{ret = str + 0} lets @command{awk} convert the value to a number. A commented-out test program is included, so that the function can be tested with @command{gawk} and the results compared to the built-in @code{strtonum()} function. @node Assert Function @subsection Assertions @c STARTOFRANGE asse @cindex assertions @c STARTOFRANGE assef @cindex @code{assert()} function (C library) @c STARTOFRANGE libfass @cindex libraries of @command{awk} functions, assertions @c STARTOFRANGE flibass @cindex functions, library, assertions @cindex @command{awk} programs, lengthy, assertions When writing large programs, it is often useful to know that a condition or set of conditions is true. Before proceeding with a particular computation, you make a statement about what you believe to be the case. Such a statement is known as an @dfn{assertion}. The C language provides an @code{} header file and corresponding @code{assert()} macro that the programmer can use to make assertions. If an assertion fails, the @code{assert()} macro arranges to print a diagnostic message describing the condition that should have been true but was not, and then it kills the program. In C, using @code{assert()} looks this: @example #include int myfunc(int a, double b) @{ assert(a <= 5 && b >= 17.1); @dots{} @} @end example If the assertion fails, the program prints a message similar to this: @example prog.c:5: assertion failed: a <= 5 && b >= 17.1 @end example @cindex @code{assert()} user-defined function The C language makes it possible to turn the condition into a string for use in printing the diagnostic message. This is not possible in @command{awk}, so this @code{assert()} function also requires a string version of the condition that is being tested. Following is the function: @example @c file eg/lib/assert.awk # assert --- assert that a condition is true. Otherwise exit. @c endfile @ignore @c file eg/lib/assert.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May, 1993 @c endfile @end ignore @c file eg/lib/assert.awk function assert(condition, string) @{ if (! condition) @{ printf("%s:%d: assertion failed: %s\n", FILENAME, FNR, string) > "/dev/stderr" _assert_exit = 1 exit 1 @} @} @group END @{ if (_assert_exit) exit 1 @} @end group @c endfile @end example The @code{assert()} function tests the @code{condition} parameter. If it is false, it prints a message to standard error, using the @code{string} parameter to describe the failed condition. It then sets the variable @code{_assert_exit} to one and executes the @code{exit} statement. The @code{exit} statement jumps to the @code{END} rule. If the @code{END} rules finds @code{_assert_exit} to be true, it exits immediately. The purpose of the test in the @code{END} rule is to keep any other @code{END} rules from running. When an assertion fails, the program should exit immediately. If no assertions fail, then @code{_assert_exit} is still false when the @code{END} rule is run normally, and the rest of the program's @code{END} rules execute. For all of this to work correctly, @file{assert.awk} must be the first source file read by @command{awk}. The function can be used in a program in the following way: @example function myfunc(a, b) @{ assert(a <= 5 && b >= 17.1, "a <= 5 && b >= 17.1") @dots{} @} @end example @noindent If the assertion fails, you see a message similar to the following: @example mydata:1357: assertion failed: a <= 5 && b >= 17.1 @end example @cindex @code{END} pattern, @code{assert()} user-defined function and There is a small problem with this version of @code{assert()}. An @code{END} rule is automatically added to the program calling @code{assert()}. Normally, if a program consists of just a @code{BEGIN} rule, the input files and/or standard input are not read. However, now that the program has an @code{END} rule, @command{awk} attempts to read the input @value{DF}s or standard input (@pxref{Using BEGIN/END}), most likely causing the program to hang as it waits for input. @cindex @code{BEGIN} pattern, @code{assert()} user-defined function and There is a simple workaround to this: make sure that such a @code{BEGIN} rule always ends with an @code{exit} statement. @c ENDOFRANGE asse @c ENDOFRANGE assef @c ENDOFRANGE flibass @c ENDOFRANGE libfass @node Round Function @subsection Rounding Numbers @cindex rounding numbers @cindex numbers, rounding @cindex libraries of @command{awk} functions, rounding numbers @cindex functions, library, rounding numbers @cindex @code{print} statement, @code{sprintf()} function and @cindex @code{printf} statement, @code{sprintf()} function and @cindex @code{sprintf()} function, @code{print}/@code{printf} statements and The way @code{printf} and @code{sprintf()} (@pxref{Printf}) perform rounding often depends upon the system's C @code{sprintf()} subroutine. On many machines, @code{sprintf()} rounding is ``unbiased,'' which means it doesn't always round a trailing @samp{.5} up, contrary to naive expectations. In unbiased rounding, @samp{.5} rounds to even, rather than always up, so 1.5 rounds to 2 but 4.5 rounds to 4. This means that if you are using a format that does rounding (e.g., @code{"%.0f"}), you should check what your system does. The following function does traditional rounding; it might be useful if your @command{awk}'s @code{printf} does unbiased rounding: @cindex @code{round()} user-defined function @example @c file eg/lib/round.awk # round.awk --- do normal rounding @c endfile @ignore @c file eg/lib/round.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # August, 1996 @c endfile @end ignore @c file eg/lib/round.awk function round(x, ival, aval, fraction) @{ ival = int(x) # integer part, int() truncates # see if fractional part if (ival == x) # no fraction return ival # ensure no decimals if (x < 0) @{ aval = -x # absolute value ival = int(aval) fraction = aval - ival if (fraction >= .5) return int(x) - 1 # -2.5 --> -3 else return int(x) # -2.3 --> -2 @} else @{ fraction = x - ival if (fraction >= .5) return ival + 1 else return ival @} @} @c endfile @c don't include test harness in the file that gets installed # test harness @{ print $0, round($0) @} @end example @node Cliff Random Function @subsection The Cliff Random Number Generator @cindex random numbers, Cliff @cindex Cliff random numbers @cindex numbers, Cliff random @cindex functions, library, Cliff random numbers The @uref{http://mathworld.wolfram.com/CliffRandomNumberGenerator.html, Cliff random number generator} is a very simple random number generator that ``passes the noise sphere test for randomness by showing no structure.'' It is easily programmed, in less than 10 lines of @command{awk} code: @cindex @code{cliff_rand()} user-defined function @example @c file eg/lib/cliff_rand.awk # cliff_rand.awk --- generate Cliff random numbers @c endfile @ignore @c file eg/lib/cliff_rand.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # December 2000 @c endfile @end ignore @c file eg/lib/cliff_rand.awk BEGIN @{ _cliff_seed = 0.1 @} function cliff_rand() @{ _cliff_seed = (100 * log(_cliff_seed)) % 1 if (_cliff_seed < 0) _cliff_seed = - _cliff_seed return _cliff_seed @} @c endfile @end example This algorithm requires an initial ``seed'' of 0.1. Each new value uses the current seed as input for the calculation. If the built-in @code{rand()} function (@pxref{Numeric Functions}) isn't random enough, you might try using this function instead. @node Ordinal Functions @subsection Translating Between Characters and Numbers @cindex libraries of @command{awk} functions, character values as numbers @cindex functions, library, character values as numbers @cindex characters, values of as numbers @cindex numbers, as values of characters One commercial implementation of @command{awk} supplies a built-in function, @code{ord()}, which takes a character and returns the numeric value for that character in the machine's character set. If the string passed to @code{ord()} has more than one character, only the first one is used. The inverse of this function is @code{chr()} (from the function of the same name in Pascal), which takes a number and returns the corresponding character. Both functions are written very nicely in @command{awk}; there is no real reason to build them into the @command{awk} interpreter: @cindex @code{ord()} user-defined function @cindex @code{chr()} user-defined function @example @c file eg/lib/ord.awk # ord.awk --- do ord and chr # Global identifiers: # _ord_: numerical values indexed by characters # _ord_init: function to initialize _ord_ @c endfile @ignore @c file eg/lib/ord.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # 16 January, 1992 # 20 July, 1992, revised @c endfile @end ignore @c file eg/lib/ord.awk BEGIN @{ _ord_init() @} function _ord_init( low, high, i, t) @{ low = sprintf("%c", 7) # BEL is ascii 7 if (low == "\a") @{ # regular ascii low = 0 high = 127 @} else if (sprintf("%c", 128 + 7) == "\a") @{ # ascii, mark parity low = 128 high = 255 @} else @{ # ebcdic(!) low = 0 high = 255 @} for (i = low; i <= high; i++) @{ t = sprintf("%c", i) _ord_[t] = i @} @} @c endfile @end example @cindex character sets (machine character encodings) @cindex ASCII @cindex EBCDIC @cindex mark parity Some explanation of the numbers used by @code{chr} is worthwhile. The most prominent character set in use today is ASCII.@footnote{This is changing; many systems use Unicode, a very large character set that includes ASCII as a subset. On systems with full Unicode support, a character can occupy up to 32 bits, making simple tests such as used here prohibitively expensive.} Although an 8-bit byte can hold 256 distinct values (from 0 to 255), ASCII only defines characters that use the values from 0 to 127.@footnote{ASCII has been extended in many countries to use the values from 128 to 255 for country-specific characters. If your system uses these extensions, you can simplify @code{_ord_init} to loop from 0 to 255.} In the now distant past, at least one minicomputer manufacturer @c Pr1me, blech used ASCII, but with mark parity, meaning that the leftmost bit in the byte is always 1. This means that on those systems, characters have numeric values from 128 to 255. Finally, large mainframe systems use the EBCDIC character set, which uses all 256 values. While there are other character sets in use on some older systems, they are not really worth worrying about: @example @c file eg/lib/ord.awk function ord(str, c) @{ # only first character is of interest c = substr(str, 1, 1) return _ord_[c] @} function chr(c) @{ # force c to be numeric by adding 0 return sprintf("%c", c + 0) @} @c endfile #### test code #### # BEGIN \ # @{ # for (;;) @{ # printf("enter a character: ") # if (getline var <= 0) # break # printf("ord(%s) = %d\n", var, ord(var)) # @} # @} @c endfile @end example An obvious improvement to these functions is to move the code for the @code{@w{_ord_init}} function into the body of the @code{BEGIN} rule. It was written this way initially for ease of development. There is a ``test program'' in a @code{BEGIN} rule, to test the function. It is commented out for production use. @node Join Function @subsection Merging an Array into a String @cindex libraries of @command{awk} functions, merging arrays into strings @cindex functions, library, merging arrays into strings @cindex strings, merging arrays into @cindex arrays, merging into strings When doing string processing, it is often useful to be able to join all the strings in an array into one long string. The following function, @code{join()}, accomplishes this task. It is used later in several of the application programs (@pxref{Sample Programs}). Good function design is important; this function needs to be general but it should also have a reasonable default behavior. It is called with an array as well as the beginning and ending indices of the elements in the array to be merged. This assumes that the array indices are numeric---a reasonable assumption since the array was likely created with @code{split()} (@pxref{String Functions}): @cindex @code{join()} user-defined function @example @c file eg/lib/join.awk # join.awk --- join an array into a string @c endfile @ignore @c file eg/lib/join.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 @c endfile @end ignore @c file eg/lib/join.awk function join(array, start, end, sep, result, i) @{ if (sep == "") sep = " " else if (sep == SUBSEP) # magic value sep = "" result = array[start] for (i = start + 1; i <= end; i++) result = result sep array[i] return result @} @c endfile @end example An optional additional argument is the separator to use when joining the strings back together. If the caller supplies a nonempty value, @code{join()} uses it; if it is not supplied, it has a null value. In this case, @code{join()} uses a single space as a default separator for the strings. If the value is equal to @code{SUBSEP}, then @code{join()} joins the strings with no separator between them. @code{SUBSEP} serves as a ``magic'' value to indicate that there should be no separation between the component strings.@footnote{It would be nice if @command{awk} had an assignment operator for concatenation. The lack of an explicit operator for concatenation makes string operations more difficult than they really need to be.} @node Gettimeofday Function @subsection Managing the Time of Day @cindex libraries of @command{awk} functions, managing, time @cindex functions, library, managing time @cindex timestamps, formatted @cindex time, managing The @code{systime()} and @code{strftime()} functions described in @ref{Time Functions}, provide the minimum functionality necessary for dealing with the time of day in human readable form. While @code{strftime()} is extensive, the control formats are not necessarily easy to remember or intuitively obvious when reading a program. The following function, @code{gettimeofday()}, populates a user-supplied array with preformatted time information. It returns a string with the current time formatted in the same way as the @command{date} utility: @cindex @code{gettimeofday()} user-defined function @example @c file eg/lib/gettime.awk # gettimeofday.awk --- get the time of day in a usable format @c endfile @ignore @c file eg/lib/gettime.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain, May 1993 # @c endfile @end ignore @c file eg/lib/gettime.awk # Returns a string in the format of output of date(1) # Populates the array argument time with individual values: # time["second"] -- seconds (0 - 59) # time["minute"] -- minutes (0 - 59) # time["hour"] -- hours (0 - 23) # time["althour"] -- hours (0 - 12) # time["monthday"] -- day of month (1 - 31) # time["month"] -- month of year (1 - 12) # time["monthname"] -- name of the month # time["shortmonth"] -- short name of the month # time["year"] -- year modulo 100 (0 - 99) # time["fullyear"] -- full year # time["weekday"] -- day of week (Sunday = 0) # time["altweekday"] -- day of week (Monday = 0) # time["dayname"] -- name of weekday # time["shortdayname"] -- short name of weekday # time["yearday"] -- day of year (0 - 365) # time["timezone"] -- abbreviation of timezone name # time["ampm"] -- AM or PM designation # time["weeknum"] -- week number, Sunday first day # time["altweeknum"] -- week number, Monday first day function gettimeofday(time, ret, now, i) @{ # get time once, avoids unnecessary system calls now = systime() # return date(1)-style output ret = strftime("%a %b %e %H:%M:%S %Z %Y", now) # clear out target array delete time # fill in values, force numeric values to be # numeric by adding 0 time["second"] = strftime("%S", now) + 0 time["minute"] = strftime("%M", now) + 0 time["hour"] = strftime("%H", now) + 0 time["althour"] = strftime("%I", now) + 0 time["monthday"] = strftime("%d", now) + 0 time["month"] = strftime("%m", now) + 0 time["monthname"] = strftime("%B", now) time["shortmonth"] = strftime("%b", now) time["year"] = strftime("%y", now) + 0 time["fullyear"] = strftime("%Y", now) + 0 time["weekday"] = strftime("%w", now) + 0 time["altweekday"] = strftime("%u", now) + 0 time["dayname"] = strftime("%A", now) time["shortdayname"] = strftime("%a", now) time["yearday"] = strftime("%j", now) + 0 time["timezone"] = strftime("%Z", now) time["ampm"] = strftime("%p", now) time["weeknum"] = strftime("%U", now) + 0 time["altweeknum"] = strftime("%W", now) + 0 return ret @} @c endfile @end example The string indices are easier to use and read than the various formats required by @code{strftime()}. The @code{alarm} program presented in @ref{Alarm Program}, uses this function. A more general design for the @code{gettimeofday()} function would have allowed the user to supply an optional timestamp value to use instead of the current time. @node Data File Management @section @value{DDF} Management @c STARTOFRANGE dataf @cindex files, managing @c STARTOFRANGE libfdataf @cindex libraries of @command{awk} functions, managing, @value{DF}s @c STARTOFRANGE flibdataf @cindex functions, library, managing @value{DF}s This @value{SECTION} presents functions that are useful for managing command-line @value{DF}s. @menu * Filetrans Function:: A function for handling data file transitions. * Rewind Function:: A function for rereading the current file. * File Checking:: Checking that data files are readable. * Empty Files:: Checking for zero-length files. * Ignoring Assigns:: Treating assignments as file names. @end menu @node Filetrans Function @subsection Noting @value{DDF} Boundaries @cindex files, managing, @value{DF} boundaries @cindex files, initialization and cleanup The @code{BEGIN} and @code{END} rules are each executed exactly once at the beginning and end of your @command{awk} program, respectively (@pxref{BEGIN/END}). We (the @command{gawk} authors) once had a user who mistakenly thought that the @code{BEGIN} rule is executed at the beginning of each @value{DF} and the @code{END} rule is executed at the end of each @value{DF}. When informed that this was not the case, the user requested that we add new special patterns to @command{gawk}, named @code{BEGIN_FILE} and @code{END_FILE}, that would have the desired behavior. He even supplied us the code to do so. Adding these special patterns to @command{gawk} wasn't necessary; the job can be done cleanly in @command{awk} itself, as illustrated by the following library program. It arranges to call two user-supplied functions, @code{beginfile()} and @code{endfile()}, at the beginning and end of each @value{DF}. Besides solving the problem in only nine(!) lines of code, it does so @emph{portably}; this works with any implementation of @command{awk}: @example # transfile.awk # # Give the user a hook for filename transitions # # The user must supply functions beginfile() and endfile() # that each take the name of the file being started or # finished, respectively. @c # @c # Arnold Robbins, arnold@@skeeve.com, Public Domain @c # January 1992 FILENAME != _oldfilename \ @{ if (_oldfilename != "") endfile(_oldfilename) _oldfilename = FILENAME beginfile(FILENAME) @} END @{ endfile(FILENAME) @} @end example This file must be loaded before the user's ``main'' program, so that the rule it supplies is executed first. This rule relies on @command{awk}'s @code{FILENAME} variable that automatically changes for each new @value{DF}. The current @value{FN} is saved in a private variable, @code{_oldfilename}. If @code{FILENAME} does not equal @code{_oldfilename}, then a new @value{DF} is being processed and it is necessary to call @code{endfile()} for the old file. Because @code{endfile()} should only be called if a file has been processed, the program first checks to make sure that @code{_oldfilename} is not the null string. The program then assigns the current @value{FN} to @code{_oldfilename} and calls @code{beginfile()} for the file. Because, like all @command{awk} variables, @code{_oldfilename} is initialized to the null string, this rule executes correctly even for the first @value{DF}. The program also supplies an @code{END} rule to do the final processing for the last file. Because this @code{END} rule comes before any @code{END} rules supplied in the ``main'' program, @code{endfile()} is called first. Once again the value of multiple @code{BEGIN} and @code{END} rules should be clear. @cindex @code{beginfile()} user-defined function @cindex @code{endfile()} user-defined function If the same @value{DF} occurs twice in a row on the command line, then @code{endfile()} and @code{beginfile()} are not executed at the end of the first pass and at the beginning of the second pass. The following version solves the problem: @example @c file eg/lib/ftrans.awk # ftrans.awk --- handle data file transitions # # user supplies beginfile() and endfile() functions @c endfile @ignore @c file eg/lib/ftrans.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # November 1992 @c endfile @end ignore @c file eg/lib/ftrans.awk FNR == 1 @{ if (_filename_ != "") endfile(_filename_) _filename_ = FILENAME beginfile(FILENAME) @} END @{ endfile(_filename_) @} @c endfile @end example @ref{Wc Program}, shows how this library function can be used and how it simplifies writing the main program. @c fakenode --- for prepinfo @subheading Advanced Notes: So Why Does @command{gawk} have @code{BEGINFILE} and @code{ENDFILE}? You are probably wondering, if @code{beginfile()} and @code{endfile()} functions can do the job, why does @command{gawk} have @code{BEGINFILE} and @code{ENDFILE} patterns (@pxref{BEGINFILE/ENDFILE})? Good question. Normally, if @command{awk} cannot open a file, this causes an immediate fatal error. In this case, there is no way for a user-defined function to deal with the problem, since the mechanism for calling it relies on the file being open and at the first record. Thus, the main reason for @code{BEGINFILE} is to give you a ``hook'' to catch files that cannot be processed. @code{ENDFILE} exists for symmetry, and because it provides an easy way to do per-file cleanup processing. @node Rewind Function @subsection Rereading the Current File @cindex files, reading Another request for a new built-in function was for a @code{rewind()} function that would make it possible to reread the current file. The requesting user didn't want to have to use @code{getline} (@pxref{Getline}) inside a loop. However, as long as you are not in the @code{END} rule, it is quite easy to arrange to immediately close the current input file and then start over with it from the top. For lack of a better name, we'll call it @code{rewind()}: @cindex @code{rewind()} user-defined function @example @c file eg/lib/rewind.awk # rewind.awk --- rewind the current file and start over @c endfile @ignore @c file eg/lib/rewind.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # September 2000 @c endfile @end ignore @c file eg/lib/rewind.awk function rewind( i) @{ # shift remaining arguments up for (i = ARGC; i > ARGIND; i--) ARGV[i] = ARGV[i-1] # make sure gawk knows to keep going ARGC++ # make current file next to get done ARGV[ARGIND+1] = FILENAME # do it nextfile @} @c endfile @end example This code relies on the @code{ARGIND} variable (@pxref{Auto-set}), which is specific to @command{gawk}. If you are not using @command{gawk}, you can use ideas presented in @ifnotinfo the previous @value{SECTION} @end ifnotinfo @ifinfo @ref{Filetrans Function}, @end ifinfo to either update @code{ARGIND} on your own or modify this code as appropriate. The @code{rewind()} function also relies on the @code{nextfile} keyword (@pxref{Nextfile Statement}). @node File Checking @subsection Checking for Readable @value{DDF}s @cindex troubleshooting, readable @value{DF}s @cindex readable @value{DF}s@comma{} checking @cindex files, skipping Normally, if you give @command{awk} a @value{DF} that isn't readable, it stops with a fatal error. There are times when you might want to just ignore such files and keep going. You can do this by prepending the following program to your @command{awk} program: @cindex @code{readable.awk} program @example @c file eg/lib/readable.awk # readable.awk --- library file to skip over unreadable files @c endfile @ignore @c file eg/lib/readable.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # October 2000 # December 2010 @c endfile @end ignore @c file eg/lib/readable.awk BEGIN @{ for (i = 1; i < ARGC; i++) @{ if (ARGV[i] ~ /^[[:alpha:]_][[:alnum:]_]*=.*/ \ || ARGV[i] == "-" || ARGV[i] == "/dev/stdin") continue # assignment or standard input else if ((getline junk < ARGV[i]) < 0) # unreadable delete ARGV[i] else close(ARGV[i]) @} @} @c endfile @end example @cindex troubleshooting, @code{getline} function This works, because the @code{getline} won't be fatal. Removing the element from @code{ARGV} with @code{delete} skips the file (since it's no longer in the list). See also @ref{ARGC and ARGV}. @node Empty Files @subsection Checking For Zero-length Files All known @command{awk} implementations silently skip over zero-length files. This is a by-product of @command{awk}'s implicit read-a-record-and-match-against-the-rules loop: when @command{awk} tries to read a record from an empty file, it immediately receives an end of file indication, closes the file, and proceeds on to the next command-line @value{DF}, @emph{without} executing any user-level @command{awk} program code. Using @command{gawk}'s @code{ARGIND} variable (@pxref{Built-in Variables}), it is possible to detect when an empty @value{DF} has been skipped. Similar to the library file presented in @ref{Filetrans Function}, the following library file calls a function named @code{zerofile()} that the user must provide. The arguments passed are the @value{FN} and the position in @code{ARGV} where it was found: @cindex @code{zerofile.awk} program @example @c file eg/lib/zerofile.awk # zerofile.awk --- library file to process empty input files @c endfile @ignore @c file eg/lib/zerofile.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # June 2003 @c endfile @end ignore @c file eg/lib/zerofile.awk BEGIN @{ Argind = 0 @} ARGIND > Argind + 1 @{ for (Argind++; Argind < ARGIND; Argind++) zerofile(ARGV[Argind], Argind) @} ARGIND != Argind @{ Argind = ARGIND @} END @{ if (ARGIND > Argind) for (Argind++; Argind <= ARGIND; Argind++) zerofile(ARGV[Argind], Argind) @} @c endfile @end example The user-level variable @code{Argind} allows the @command{awk} program to track its progress through @code{ARGV}. Whenever the program detects that @code{ARGIND} is greater than @samp{Argind + 1}, it means that one or more empty files were skipped. The action then calls @code{zerofile()} for each such file, incrementing @code{Argind} along the way. The @samp{Argind != ARGIND} rule simply keeps @code{Argind} up to date in the normal case. Finally, the @code{END} rule catches the case of any empty files at the end of the command-line arguments. Note that the test in the condition of the @code{for} loop uses the @samp{<=} operator, not @samp{<}. As an exercise, you might consider whether this same problem can be solved without relying on @command{gawk}'s @code{ARGIND} variable. As a second exercise, revise this code to handle the case where an intervening value in @code{ARGV} is a variable assignment. @ignore # zerofile2.awk --- same thing, portably BEGIN @{ ARGIND = Argind = 0 for (i = 1; i < ARGC; i++) Fnames[ARGV[i]]++ @} FNR == 1 @{ while (ARGV[ARGIND] != FILENAME) ARGIND++ Seen[FILENAME]++ if (Seen[FILENAME] == Fnames[FILENAME]) do ARGIND++ while (ARGV[ARGIND] != FILENAME) @} ARGIND > Argind + 1 @{ for (Argind++; Argind < ARGIND; Argind++) zerofile(ARGV[Argind], Argind) @} ARGIND != Argind @{ Argind = ARGIND @} END @{ if (ARGIND < ARGC - 1) ARGIND = ARGC - 1 if (ARGIND > Argind) for (Argind++; Argind <= ARGIND; Argind++) zerofile(ARGV[Argind], Argind) @} @end ignore @node Ignoring Assigns @subsection Treating Assignments as @value{FFN}s @cindex assignments as filenames @cindex filenames, assignments as Occasionally, you might not want @command{awk} to process command-line variable assignments (@pxref{Assignment Options}). In particular, if you have a @value{FN} that contain an @samp{=} character, @command{awk} treats the @value{FN} as an assignment, and does not process it. Some users have suggested an additional command-line option for @command{gawk} to disable command-line assignments. However, some simple programming with a library file does the trick: @cindex @code{noassign.awk} program @example @c file eg/lib/noassign.awk # noassign.awk --- library file to avoid the need for a # special option that disables command-line assignments @c endfile @ignore @c file eg/lib/noassign.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # October 1999 @c endfile @end ignore @c file eg/lib/noassign.awk function disable_assigns(argc, argv, i) @{ for (i = 1; i < argc; i++) if (argv[i] ~ /^[[:alpha:]_][[:alnum:]_]*=.*/) argv[i] = ("./" argv[i]) @} BEGIN @{ if (No_command_assign) disable_assigns(ARGC, ARGV) @} @c endfile @end example You then run your program this way: @example awk -v No_command_assign=1 -f noassign.awk -f yourprog.awk * @end example The function works by looping through the arguments. It prepends @samp{./} to any argument that matches the form of a variable assignment, turning that argument into a @value{FN}. The use of @code{No_command_assign} allows you to disable command-line assignments at invocation time, by giving the variable a true value. When not set, it is initially zero (i.e., false), so the command-line arguments are left alone. @c ENDOFRANGE dataf @c ENDOFRANGE flibdataf @c ENDOFRANGE libfdataf @node Getopt Function @section Processing Command-Line Options @c STARTOFRANGE libfclo @cindex libraries of @command{awk} functions, command-line options @c STARTOFRANGE flibclo @cindex functions, library, command-line options @c STARTOFRANGE clop @cindex command-line options, processing @c STARTOFRANGE oclp @cindex options, command-line, processing @c STARTOFRANGE clibf @cindex functions, library, C library @cindex arguments, processing Most utilities on POSIX compatible systems take options on the command line that can be used to change the way a program behaves. @command{awk} is an example of such a program (@pxref{Options}). Often, options take @dfn{arguments}; i.e., data that the program needs to correctly obey the command-line option. For example, @command{awk}'s @option{-F} option requires a string to use as the field separator. The first occurrence on the command line of either @option{--} or a string that does not begin with @samp{-} ends the options. @cindex @code{getopt()} function (C library) Modern Unix systems provide a C function named @code{getopt()} for processing command-line arguments. The programmer provides a string describing the one-letter options. If an option requires an argument, it is followed in the string with a colon. @code{getopt()} is also passed the count and values of the command-line arguments and is called in a loop. @code{getopt()} processes the command-line arguments for option letters. Each time around the loop, it returns a single character representing the next option letter that it finds, or @samp{?} if it finds an invalid option. When it returns @minus{}1, there are no options left on the command line. When using @code{getopt()}, options that do not take arguments can be grouped together. Furthermore, options that take arguments require that the argument be present. The argument can immediately follow the option letter, or it can be a separate command-line argument. Given a hypothetical program that takes three command-line options, @option{-a}, @option{-b}, and @option{-c}, where @option{-b} requires an argument, all of the following are valid ways of invoking the program: @example prog -a -b foo -c data1 data2 data3 prog -ac -bfoo -- data1 data2 data3 prog -acbfoo data1 data2 data3 @end example Notice that when the argument is grouped with its option, the rest of the argument is considered to be the option's argument. In this example, @option{-acbfoo} indicates that all of the @option{-a}, @option{-b}, and @option{-c} options were supplied, and that @samp{foo} is the argument to the @option{-b} option. @code{getopt()} provides four external variables that the programmer can use: @table @code @item optind The index in the argument value array (@code{argv}) where the first nonoption command-line argument can be found. @item optarg The string value of the argument to an option. @item opterr Usually @code{getopt()} prints an error message when it finds an invalid option. Setting @code{opterr} to zero disables this feature. (An application might want to print its own error message.) @item optopt The letter representing the command-line option. @c While not usually documented, most versions supply this variable. @end table The following C fragment shows how @code{getopt()} might process command-line arguments for @command{awk}: @example int main(int argc, char *argv[]) @{ @dots{} /* print our own message */ opterr = 0; while ((c = getopt(argc, argv, "v:f:F:W:")) != -1) @{ switch (c) @{ case 'f': /* file */ @dots{} break; case 'F': /* field separator */ @dots{} break; case 'v': /* variable assignment */ @dots{} break; case 'W': /* extension */ @dots{} break; case '?': default: usage(); break; @} @} @dots{} @} @end example As a side point, @command{gawk} actually uses the GNU @code{getopt_long()} function to process both normal and GNU-style long options (@pxref{Options}). The abstraction provided by @code{getopt()} is very useful and is quite handy in @command{awk} programs as well. Following is an @command{awk} version of @code{getopt()}. This function highlights one of the greatest weaknesses in @command{awk}, which is that it is very poor at manipulating single characters. Repeated calls to @code{substr()} are necessary for accessing individual characters (@pxref{String Functions}).@footnote{This function was written before @command{gawk} acquired the ability to split strings into single characters using @code{""} as the separator. We have left it alone, since using @code{substr()} is more portable.} @c FIXME: could use split(str, a, "") to do it more easily. The discussion that follows walks through the code a bit at a time: @cindex @code{getopt()} user-defined function @example @c file eg/lib/getopt.awk # getopt.awk --- Do C library getopt(3) function in awk @c endfile @ignore @c file eg/lib/getopt.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # # Initial version: March, 1991 # Revised: May, 1993 @c endfile @end ignore @c file eg/lib/getopt.awk # External variables: # Optind -- index in ARGV of first nonoption argument # Optarg -- string value of argument to current option # Opterr -- if nonzero, print our own diagnostic # Optopt -- current option letter # Returns: # -1 at end of options # "?" for unrecognized option # a character representing the current option # Private Data: # _opti -- index in multi-flag option, e.g., -abc @c endfile @end example The function starts out with comments presenting a list of the global variables it uses, what the return values are, what they mean, and any global variables that are ``private'' to this library function. Such documentation is essential for any program, and particularly for library functions. The @code{getopt()} function first checks that it was indeed called with a string of options (the @code{options} parameter). If @code{options} has a zero length, @code{getopt()} immediately returns @minus{}1: @cindex @code{getopt()} user-defined function @example @c file eg/lib/getopt.awk function getopt(argc, argv, options, thisopt, i) @{ if (length(options) == 0) # no options given return -1 @group if (argv[Optind] == "--") @{ # all done Optind++ _opti = 0 return -1 @end group @} else if (argv[Optind] !~ /^-[^:[:space:]]/) @{ _opti = 0 return -1 @} @c endfile @end example The next thing to check for is the end of the options. A @option{--} ends the command-line options, as does any command-line argument that does not begin with a @samp{-}. @code{Optind} is used to step through the array of command-line arguments; it retains its value across calls to @code{getopt()}, because it is a global variable. The regular expression that is used, @code{@w{/^-[^:[:space:]/}}, checks for a @samp{-} followed by anything that is not whitespace and not a colon. If the current command-line argument does not match this pattern, it is not an option, and it ends option processing. Continuing on: @example @c file eg/lib/getopt.awk if (_opti == 0) _opti = 2 thisopt = substr(argv[Optind], _opti, 1) Optopt = thisopt i = index(options, thisopt) if (i == 0) @{ if (Opterr) printf("%c -- invalid option\n", thisopt) > "/dev/stderr" if (_opti >= length(argv[Optind])) @{ Optind++ _opti = 0 @} else _opti++ return "?" @} @c endfile @end example The @code{_opti} variable tracks the position in the current command-line argument (@code{argv[Optind]}). If multiple options are grouped together with one @samp{-} (e.g., @option{-abx}), it is necessary to return them to the user one at a time. If @code{_opti} is equal to zero, it is set to two, which is the index in the string of the next character to look at (we skip the @samp{-}, which is at position one). The variable @code{thisopt} holds the character, obtained with @code{substr()}. It is saved in @code{Optopt} for the main program to use. If @code{thisopt} is not in the @code{options} string, then it is an invalid option. If @code{Opterr} is nonzero, @code{getopt()} prints an error message on the standard error that is similar to the message from the C version of @code{getopt()}. Because the option is invalid, it is necessary to skip it and move on to the next option character. If @code{_opti} is greater than or equal to the length of the current command-line argument, it is necessary to move on to the next argument, so @code{Optind} is incremented and @code{_opti} is reset to zero. Otherwise, @code{Optind} is left alone and @code{_opti} is merely incremented. In any case, because the option is invalid, @code{getopt()} returns @code{"?"}. The main program can examine @code{Optopt} if it needs to know what the invalid option letter actually is. Continuing on: @example @c file eg/lib/getopt.awk if (substr(options, i + 1, 1) == ":") @{ # get option argument if (length(substr(argv[Optind], _opti + 1)) > 0) Optarg = substr(argv[Optind], _opti + 1) else Optarg = argv[++Optind] _opti = 0 @} else Optarg = "" @c endfile @end example If the option requires an argument, the option letter is followed by a colon in the @code{options} string. If there are remaining characters in the current command-line argument (@code{argv[Optind]}), then the rest of that string is assigned to @code{Optarg}. Otherwise, the next command-line argument is used (@samp{-xFOO} versus @samp{@w{-x FOO}}). In either case, @code{_opti} is reset to zero, because there are no more characters left to examine in the current command-line argument. Continuing: @example @c file eg/lib/getopt.awk if (_opti == 0 || _opti >= length(argv[Optind])) @{ Optind++ _opti = 0 @} else _opti++ return thisopt @} @c endfile @end example Finally, if @code{_opti} is either zero or greater than the length of the current command-line argument, it means this element in @code{argv} is through being processed, so @code{Optind} is incremented to point to the next element in @code{argv}. If neither condition is true, then only @code{_opti} is incremented, so that the next option letter can be processed on the next call to @code{getopt()}. The @code{BEGIN} rule initializes both @code{Opterr} and @code{Optind} to one. @code{Opterr} is set to one, since the default behavior is for @code{getopt()} to print a diagnostic message upon seeing an invalid option. @code{Optind} is set to one, since there's no reason to look at the program name, which is in @code{ARGV[0]}: @example @c file eg/lib/getopt.awk BEGIN @{ Opterr = 1 # default is to diagnose Optind = 1 # skip ARGV[0] # test program if (_getopt_test) @{ while ((_go_c = getopt(ARGC, ARGV, "ab:cd")) != -1) printf("c = <%c>, optarg = <%s>\n", _go_c, Optarg) printf("non-option arguments:\n") for (; Optind < ARGC; Optind++) printf("\tARGV[%d] = <%s>\n", Optind, ARGV[Optind]) @} @} @c endfile @end example The rest of the @code{BEGIN} rule is a simple test program. Here is the result of two sample runs of the test program: @example $ @kbd{awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x} @print{} c =
, optarg = <> @print{} c = , optarg = <> @print{} c = , optarg = @print{} non-option arguments: @print{} ARGV[3] = @print{} ARGV[4] = <-x> $ @kbd{awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc} @print{} c = , optarg = <> @error{} x -- invalid option @print{} c = , optarg = <> @print{} non-option arguments: @print{} ARGV[4] = @print{} ARGV[5] = @end example In both runs, the first @option{--} terminates the arguments to @command{awk}, so that it does not try to interpret the @option{-a}, etc., as its own options. @quotation NOTE After @code{getopt()} is through, it is the responsibility of the user level code to clear out all the elements of @code{ARGV} from 1 to @code{Optind}, so that @command{awk} does not try to process the command-line options as @value{FN}s. @end quotation Several of the sample programs presented in @ref{Sample Programs}, use @code{getopt()} to process their arguments. @c ENDOFRANGE libfclo @c ENDOFRANGE flibclo @c ENDOFRANGE clop @c ENDOFRANGE oclp @node Passwd Functions @section Reading the User Database @c STARTOFRANGE libfudata @cindex libraries of @command{awk} functions, user database, reading @c STARTOFRANGE flibudata @cindex functions, library, user database, reading @c STARTOFRANGE udatar @cindex user database@comma{} reading @c STARTOFRANGE dataur @cindex database, users@comma{} reading @cindex @code{PROCINFO} array The @code{PROCINFO} array (@pxref{Built-in Variables}) provides access to the current user's real and effective user and group ID numbers, and if available, the user's supplementary group set. However, because these are numbers, they do not provide very useful information to the average user. There needs to be some way to find the user information associated with the user and group ID numbers. This @value{SECTION} presents a suite of functions for retrieving information from the user database. @xref{Group Functions}, for a similar suite that retrieves information from the group database. @cindex @code{getpwent()} function (C library) @cindex @code{getpwent()} user-defined function @cindex users, information about, retrieving @cindex login information @cindex account information @cindex password file @cindex files, password The POSIX standard does not define the file where user information is kept. Instead, it provides the @code{} header file and several C language subroutines for obtaining user information. The primary function is @code{getpwent()}, for ``get password entry.'' The ``password'' comes from the original user database file, @file{/etc/passwd}, which stores user information, along with the encrypted passwords (hence the name). @cindex @command{pwcat} program While an @command{awk} program could simply read @file{/etc/passwd} directly, this file may not contain complete information about the system's set of users.@footnote{It is often the case that password information is stored in a network database.} To be sure you are able to produce a readable and complete version of the user database, it is necessary to write a small C program that calls @code{getpwent()}. @code{getpwent()} is defined as returning a pointer to a @code{struct passwd}. Each time it is called, it returns the next entry in the database. When there are no more entries, it returns @code{NULL}, the null pointer. When this happens, the C program should call @code{endpwent()} to close the database. Following is @command{pwcat}, a C program that ``cats'' the password database: @c Use old style function header for portability to old systems (SunOS, HP/UX). @example @c file eg/lib/pwcat.c /* * pwcat.c * * Generate a printable version of the password database */ @c endfile @ignore @c file eg/lib/pwcat.c /* * Arnold Robbins, arnold@@skeeve.com, May 1993 * Public Domain * December 2010, move to ANSI C definition for main(). */ #if HAVE_CONFIG_H #include #endif @c endfile @end ignore @c file eg/lib/pwcat.c #include #include @c endfile @ignore @c file eg/lib/pwcat.c #if defined (STDC_HEADERS) #include #endif @c endfile @end ignore @c file eg/lib/pwcat.c int main(int argc, char **argv) @{ struct passwd *p; while ((p = getpwent()) != NULL) @c endfile @ignore @c file eg/lib/pwcat.c #ifdef ZOS_USS printf("%s:%ld:%ld:%s:%s\n", p->pw_name, (long) p->pw_uid, (long) p->pw_gid, p->pw_dir, p->pw_shell); #else @c endfile @end ignore @c file eg/lib/pwcat.c printf("%s:%s:%ld:%ld:%s:%s:%s\n", p->pw_name, p->pw_passwd, (long) p->pw_uid, (long) p->pw_gid, p->pw_gecos, p->pw_dir, p->pw_shell); @c endfile @ignore @c file eg/lib/pwcat.c #endif @c endfile @end ignore @c file eg/lib/pwcat.c endpwent(); return 0; @} @c endfile @end example If you don't understand C, don't worry about it. The output from @command{pwcat} is the user database, in the traditional @file{/etc/passwd} format of colon-separated fields. The fields are: @table @asis @item Login name The user's login name. @item Encrypted password The user's encrypted password. This may not be available on some systems. @item User-ID The user's numeric user ID number. (On some systems it's a C @code{long}, and not an @code{int}. Thus we cast it to @code{long} for all cases.) @item Group-ID The user's numeric group ID number. (Similar comments about @code{long} vs.@: @code{int} apply here.) @item Full name The user's full name, and perhaps other information associated with the user. @item Home directory The user's login (or ``home'') directory (familiar to shell programmers as @code{$HOME}). @item Login shell The program that is run when the user logs in. This is usually a shell, such as Bash. @end table A few lines representative of @command{pwcat}'s output are as follows: @cindex Jacobs, Andrew @cindex Robbins, Arnold @cindex Robbins, Miriam @example $ @kbd{pwcat} @print{} root:3Ov02d5VaUPB6:0:1:Operator:/:/bin/sh @print{} nobody:*:65534:65534::/: @print{} daemon:*:1:1::/: @print{} sys:*:2:2::/:/bin/csh @print{} bin:*:3:3::/bin: @print{} arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/sh @print{} miriam:yxaay:112:10:Miriam Robbins:/home/miriam:/bin/sh @print{} andy:abcca2:113:10:Andy Jacobs:/home/andy:/bin/sh @dots{} @end example With that introduction, following is a group of functions for getting user information. There are several functions here, corresponding to the C functions of the same names: @cindex @code{_pw_init()} user-defined function @example @c file eg/lib/passwdawk.in # passwd.awk --- access password file information @c endfile @ignore @c file eg/lib/passwdawk.in # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 # Revised October 2000 # Revised December 2010 @c endfile @end ignore @c file eg/lib/passwdawk.in BEGIN @{ # tailor this to suit your system _pw_awklib = "/usr/local/libexec/awk/" @} function _pw_init( oldfs, oldrs, olddol0, pwcat, using_fw, using_fpat) @{ if (_pw_inited) return oldfs = FS oldrs = RS olddol0 = $0 using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") using_fpat = (PROCINFO["FS"] == "FPAT") FS = ":" RS = "\n" pwcat = _pw_awklib "pwcat" while ((pwcat | getline) > 0) @{ _pw_byname[$1] = $0 _pw_byuid[$3] = $0 _pw_bycount[++_pw_total] = $0 @} close(pwcat) _pw_count = 0 _pw_inited = 1 FS = oldfs if (using_fw) FIELDWIDTHS = FIELDWIDTHS else if (using_fpat) FPAT = FPAT RS = oldrs $0 = olddol0 @} @c endfile @end example @cindex @code{BEGIN} pattern, @code{pwcat} program The @code{BEGIN} rule sets a private variable to the directory where @command{pwcat} is stored. Because it is used to help out an @command{awk} library routine, we have chosen to put it in @file{/usr/local/libexec/awk}; however, you might want it to be in a different directory on your system. The function @code{_pw_init()} keeps three copies of the user information in three associative arrays. The arrays are indexed by username (@code{_pw_byname}), by user ID number (@code{_pw_byuid}), and by order of occurrence (@code{_pw_bycount}). The variable @code{_pw_inited} is used for efficiency, since @code{_pw_init()} needs to be called only once. @cindex @code{getline} command, @code{_pw_init()} function Because this function uses @code{getline} to read information from @command{pwcat}, it first saves the values of @code{FS}, @code{RS}, and @code{$0}. It notes in the variable @code{using_fw} whether field splitting with @code{FIELDWIDTHS} is in effect or not. Doing so is necessary, since these functions could be called from anywhere within a user's program, and the user may have his or her own way of splitting records and fields. @cindex @code{PROCINFO} array The @code{using_fw} variable checks @code{PROCINFO["FS"]}, which is @code{"FIELDWIDTHS"} if field splitting is being done with @code{FIELDWIDTHS}. This makes it possible to restore the correct field-splitting mechanism later. The test can only be true for @command{gawk}. It is false if using @code{FS} or @code{FPAT}, or on some other @command{awk} implementation. The code that checks for using @code{FPAT}, using @code{using_fpat} and @code{PROCINFO["FS"]} is similar. The main part of the function uses a loop to read database lines, split the line into fields, and then store the line into each array as necessary. When the loop is done, @code{@w{_pw_init()}} cleans up by closing the pipeline, setting @code{@w{_pw_inited}} to one, and restoring @code{FS} (and @code{FIELDWIDTHS} or @code{FPAT} if necessary), @code{RS}, and @code{$0}. The use of @code{@w{_pw_count}} is explained shortly. @cindex @code{getpwnam()} function (C library) The @code{getpwnam()} function takes a username as a string argument. If that user is in the database, it returns the appropriate line. Otherwise, it relies on the array reference to a nonexistent element to create the element with the null string as its value: @cindex @code{getpwnam()} user-defined function @example @group @c file eg/lib/passwdawk.in function getpwnam(name) @{ _pw_init() return _pw_byname[name] @} @c endfile @end group @end example @cindex @code{getpwuid()} function (C library) Similarly, the @code{getpwuid} function takes a user ID number argument. If that user number is in the database, it returns the appropriate line. Otherwise, it returns the null string: @cindex @code{getpwuid()} user-defined function @example @c file eg/lib/passwdawk.in function getpwuid(uid) @{ _pw_init() return _pw_byuid[uid] @} @c endfile @end example @cindex @code{getpwent()} function (C library) The @code{getpwent()} function simply steps through the database, one entry at a time. It uses @code{_pw_count} to track its current position in the @code{_pw_bycount} array: @cindex @code{getpwent()} user-defined function @example @c file eg/lib/passwdawk.in function getpwent() @{ _pw_init() if (_pw_count < _pw_total) return _pw_bycount[++_pw_count] return "" @} @c endfile @end example @cindex @code{endpwent()} function (C library) The @code{@w{endpwent()}} function resets @code{@w{_pw_count}} to zero, so that subsequent calls to @code{getpwent()} start over again: @cindex @code{endpwent()} user-defined function @example @c file eg/lib/passwdawk.in function endpwent() @{ _pw_count = 0 @} @c endfile @end example A conscious design decision in this suite is that each subroutine calls @code{@w{_pw_init()}} to initialize the database arrays. The overhead of running a separate process to generate the user database, and the I/O to scan it, are only incurred if the user's main program actually calls one of these functions. If this library file is loaded along with a user's program, but none of the routines are ever called, then there is no extra runtime overhead. (The alternative is move the body of @code{@w{_pw_init()}} into a @code{BEGIN} rule, which always runs @command{pwcat}. This simplifies the code but runs an extra process that may never be needed.) In turn, calling @code{_pw_init()} is not too expensive, because the @code{_pw_inited} variable keeps the program from reading the data more than once. If you are worried about squeezing every last cycle out of your @command{awk} program, the check of @code{_pw_inited} could be moved out of @code{_pw_init()} and duplicated in all the other functions. In practice, this is not necessary, since most @command{awk} programs are I/O-bound, and such a change would clutter up the code. The @command{id} program in @ref{Id Program}, uses these functions. @c ENDOFRANGE libfudata @c ENDOFRANGE flibudata @c ENDOFRANGE udatar @c ENDOFRANGE dataur @node Group Functions @section Reading the Group Database @c STARTOFRANGE libfgdata @cindex libraries of @command{awk} functions, group database, reading @c STARTOFRANGE flibgdata @cindex functions, library, group database, reading @c STARTOFRANGE gdatar @cindex group database, reading @c STARTOFRANGE datagr @cindex database, group, reading @cindex @code{PROCINFO} array @cindex @code{getgrent()} function (C library) @cindex @code{getgrent()} user-defined function @cindex groups@comma{} information about @cindex account information @cindex group file @cindex files, group Much of the discussion presented in @ref{Passwd Functions}, applies to the group database as well. Although there has traditionally been a well-known file (@file{/etc/group}) in a well-known format, the POSIX standard only provides a set of C library routines (@code{} and @code{getgrent()}) for accessing the information. Even though this file may exist, it may not have complete information. Therefore, as with the user database, it is necessary to have a small C program that generates the group database as its output. @command{grcat}, a C program that ``cats'' the group database, is as follows: @cindex @command{grcat} program @example @c file eg/lib/grcat.c /* * grcat.c * * Generate a printable version of the group database */ @c endfile @ignore @c file eg/lib/grcat.c /* * Arnold Robbins, arnold@@skeeve.com, May 1993 * Public Domain * December 2010, move to ANSI C definition for main(). */ /* For OS/2, do nothing. */ #if HAVE_CONFIG_H #include #endif #if defined (STDC_HEADERS) #include #endif #ifndef HAVE_GETGRENT int main() { return 0; } #else @c endfile @end ignore @c file eg/lib/grcat.c #include #include int main(int argc, char **argv) @{ struct group *g; int i; while ((g = getgrent()) != NULL) @{ @c endfile @ignore @c file eg/lib/grcat.c #ifdef ZOS_USS printf("%s:%ld:", g->gr_name, (long) g->gr_gid); #else @c endfile @end ignore @c file eg/lib/grcat.c printf("%s:%s:%ld:", g->gr_name, g->gr_passwd, (long) g->gr_gid); @c endfile @ignore @c file eg/lib/grcat.c #endif @c endfile @end ignore @c file eg/lib/grcat.c for (i = 0; g->gr_mem[i] != NULL; i++) @{ printf("%s", g->gr_mem[i]); @group if (g->gr_mem[i+1] != NULL) putchar(','); @} @end group putchar('\n'); @} endgrent(); return 0; @} @c endfile @ignore @c file eg/lib/grcat.c #endif /* HAVE_GETGRENT */ @c endfile @end ignore @end example Each line in the group database represents one group. The fields are separated with colons and represent the following information: @table @asis @item Group Name The group's name. @item Group Password The group's encrypted password. In practice, this field is never used; it is usually empty or set to @samp{*}. @item Group ID Number The group's numeric group ID number; this number must be unique within the file. (On some systems it's a C @code{long}, and not an @code{int}. Thus we cast it to @code{long} for all cases.) @item Group Member List A comma-separated list of user names. These users are members of the group. Modern Unix systems allow users to be members of several groups simultaneously. If your system does, then there are elements @code{"group1"} through @code{"group@var{N}"} in @code{PROCINFO} for those group ID numbers. (Note that @code{PROCINFO} is a @command{gawk} extension; @pxref{Built-in Variables}.) @end table Here is what running @command{grcat} might produce: @example $ @kbd{grcat} @print{} wheel:*:0:arnold @print{} nogroup:*:65534: @print{} daemon:*:1: @print{} kmem:*:2: @print{} staff:*:10:arnold,miriam,andy @print{} other:*:20: @dots{} @end example Here are the functions for obtaining information from the group database. There are several, modeled after the C library functions of the same names: @cindex @code{getline} command, @code{_gr_init()} user-defined function @cindex @code{_gr_init()} user-defined function @example @c file eg/lib/groupawk.in # group.awk --- functions for dealing with the group file @c endfile @ignore @c file eg/lib/groupawk.in # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 # Revised October 2000 # Revised December 2010 @c endfile @end ignore @c line break on _gr_init for smallbook @c file eg/lib/groupawk.in BEGIN \ @{ # Change to suit your system _gr_awklib = "/usr/local/libexec/awk/" @} function _gr_init( oldfs, oldrs, olddol0, grcat, using_fw, using_fpat, n, a, i) @{ if (_gr_inited) return oldfs = FS oldrs = RS olddol0 = $0 using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") using_fpat = (PROCINFO["FS"] == "FPAT") FS = ":" RS = "\n" grcat = _gr_awklib "grcat" while ((grcat | getline) > 0) @{ if ($1 in _gr_byname) _gr_byname[$1] = _gr_byname[$1] "," $4 else _gr_byname[$1] = $0 if ($3 in _gr_bygid) _gr_bygid[$3] = _gr_bygid[$3] "," $4 else _gr_bygid[$3] = $0 n = split($4, a, "[ \t]*,[ \t]*") for (i = 1; i <= n; i++) if (a[i] in _gr_groupsbyuser) _gr_groupsbyuser[a[i]] = \ _gr_groupsbyuser[a[i]] " " $1 else _gr_groupsbyuser[a[i]] = $1 _gr_bycount[++_gr_count] = $0 @} close(grcat) _gr_count = 0 _gr_inited++ FS = oldfs if (using_fw) FIELDWIDTHS = FIELDWIDTHS else if (using_fpat) FPAT = FPAT RS = oldrs $0 = olddol0 @} @c endfile @end example The @code{BEGIN} rule sets a private variable to the directory where @command{grcat} is stored. Because it is used to help out an @command{awk} library routine, we have chosen to put it in @file{/usr/local/libexec/awk}. You might want it to be in a different directory on your system. These routines follow the same general outline as the user database routines (@pxref{Passwd Functions}). The @code{@w{_gr_inited}} variable is used to ensure that the database is scanned no more than once. The @code{@w{_gr_init()}} function first saves @code{FS}, @code{RS}, and @code{$0}, and then sets @code{FS} and @code{RS} to the correct values for scanning the group information. It also takes care to note whether @code{FIELDWIDTHS} or @code{FPAT} is being used, and to restore the appropriate field splitting mechanism. The group information is stored is several associative arrays. The arrays are indexed by group name (@code{@w{_gr_byname}}), by group ID number (@code{@w{_gr_bygid}}), and by position in the database (@code{@w{_gr_bycount}}). There is an additional array indexed by user name (@code{@w{_gr_groupsbyuser}}), which is a space-separated list of groups to which each user belongs. Unlike the user database, it is possible to have multiple records in the database for the same group. This is common when a group has a large number of members. A pair of such entries might look like the following: @example tvpeople:*:101:johnny,jay,arsenio tvpeople:*:101:david,conan,tom,joan @end example For this reason, @code{_gr_init()} looks to see if a group name or group ID number is already seen. If it is, then the user names are simply concatenated onto the previous list of users. (There is actually a subtle problem with the code just presented. Suppose that the first time there were no names. This code adds the names with a leading comma. It also doesn't check that there is a @code{$4}.) Finally, @code{_gr_init()} closes the pipeline to @command{grcat}, restores @code{FS} (and @code{FIELDWIDTHS} or @code{FPAT} if necessary), @code{RS}, and @code{$0}, initializes @code{_gr_count} to zero (it is used later), and makes @code{_gr_inited} nonzero. @cindex @code{getgrnam()} function (C library) The @code{getgrnam()} function takes a group name as its argument, and if that group exists, it is returned. Otherwise, it relies on the array reference to a nonexistent element to create the element with the null string as its value: @cindex @code{getgrnam()} user-defined function @example @c file eg/lib/groupawk.in function getgrnam(group) @{ _gr_init() return _gr_byname[group] @} @c endfile @end example @cindex @code{getgrgid()} function (C library) The @code{getgrgid()} function is similar; it takes a numeric group ID and looks up the information associated with that group ID: @cindex @code{getgrgid()} user-defined function @example @c file eg/lib/groupawk.in function getgrgid(gid) @{ _gr_init() return _gr_bygid[gid] @} @c endfile @end example @cindex @code{getgruser()} function (C library) The @code{getgruser()} function does not have a C counterpart. It takes a user name and returns the list of groups that have the user as a member: @cindex @code{getgruser()} function, user-defined @example @c file eg/lib/groupawk.in function getgruser(user) @{ _gr_init() return _gr_groupsbyuser[user] @} @c endfile @end example @cindex @code{getgrent()} function (C library) The @code{getgrent()} function steps through the database one entry at a time. It uses @code{_gr_count} to track its position in the list: @cindex @code{getgrent()} user-defined function @example @c file eg/lib/groupawk.in function getgrent() @{ _gr_init() if (++_gr_count in _gr_bycount) return _gr_bycount[_gr_count] return "" @} @c endfile @end example @c ENDOFRANGE clibf @cindex @code{endgrent()} function (C library) The @code{endgrent()} function resets @code{_gr_count} to zero so that @code{getgrent()} can start over again: @cindex @code{endgrent()} user-defined function @example @c file eg/lib/groupawk.in function endgrent() @{ _gr_count = 0 @} @c endfile @end example As with the user database routines, each function calls @code{_gr_init()} to initialize the arrays. Doing so only incurs the extra overhead of running @command{grcat} if these functions are used (as opposed to moving the body of @code{_gr_init()} into a @code{BEGIN} rule). Most of the work is in scanning the database and building the various associative arrays. The functions that the user calls are themselves very simple, relying on @command{awk}'s associative arrays to do work. The @command{id} program in @ref{Id Program}, uses these functions. @node Walking Arrays @section Traversing Arrays of Arrays @ref{Arrays of Arrays}, described how @command{gawk} provides arrays of arrays. In particular, any element of an array may be either a scalar, or another array. The @code{isarray()} function (@pxref{Type Functions}) lets you distinguish an array from a scalar. The following function, @code{walk_array()}, recursively traverses an array, printing each element's indices and value. You call it with the array and a string representing the name of the array: @cindex @code{walk_array()} user-defined function @example @c file eg/lib/walkarray.awk function walk_array(arr, name, i) @{ for (i in arr) @{ if (isarray(arr[i])) walk_array(arr[i], (name "[" i "]")) else printf("%s[%s] = %s\n", name, i, arr[i]) @} @} @c endfile @end example @noindent It works by looping over each element of the array. If any given element is itself an array, the function calls itself recursively, passing the subarray and a new string representing the current index. Otherwise, the function simply prints the element's name, index, and value. Here is a main program to demonstrate: @example BEGIN @{ a[1] = 1 a[2][1] = 21 a[2][2] = 22 a[3] = 3 a[4][1][1] = 411 a[4][2] = 42 walk_array(a, "a") @} @end example When run, the program produces the following output: @example $ @kbd{gawk -f walk_array.awk} @print{} a[4][1][1] = 411 @print{} a[4][2] = 42 @print{} a[1] = 1 @print{} a[2][1] = 21 @print{} a[2][2] = 22 @print{} a[3] = 3 @end example @c ENDOFRANGE libfgdata @c ENDOFRANGE flibgdata @c ENDOFRANGE gdatar @c ENDOFRANGE libf @c ENDOFRANGE flib @c ENDOFRANGE fudlib @c ENDOFRANGE datagr @node Sample Programs @chapter Practical @command{awk} Programs @c STARTOFRANGE awkpex @cindex @command{awk} programs, examples of @ref{Library Functions}, presents the idea that reading programs in a language contributes to learning that language. This @value{CHAPTER} continues that theme, presenting a potpourri of @command{awk} programs for your reading enjoyment. @ifnotinfo There are three sections. The first describes how to run the programs presented in this @value{CHAPTER}. The second presents @command{awk} versions of several common POSIX utilities. These are programs that you are hopefully already familiar with, and therefore, whose problems are understood. By reimplementing these programs in @command{awk}, you can focus on the @command{awk}-related aspects of solving the programming problem. The third is a grab bag of interesting programs. These solve a number of different data-manipulation and management problems. Many of the programs are short, which emphasizes @command{awk}'s ability to do a lot in just a few lines of code. @end ifnotinfo Many of these programs use library functions presented in @ref{Library Functions}. @menu * Running Examples:: How to run these examples. * Clones:: Clones of common utilities. * Miscellaneous Programs:: Some interesting @command{awk} programs. @end menu @node Running Examples @section Running the Example Programs To run a given program, you would typically do something like this: @example awk -f @var{program} -- @var{options} @var{files} @end example @noindent Here, @var{program} is the name of the @command{awk} program (such as @file{cut.awk}), @var{options} are any command-line options for the program that start with a @samp{-}, and @var{files} are the actual @value{DF}s. If your system supports the @samp{#!} executable interpreter mechanism (@pxref{Executable Scripts}), you can instead run your program directly: @example cut.awk -c1-8 myfiles > results @end example If your @command{awk} is not @command{gawk}, you may instead need to use this: @example cut.awk -- -c1-8 myfiles > results @end example @node Clones @section Reinventing Wheels for Fun and Profit @c STARTOFRANGE posimawk @cindex POSIX, programs@comma{} implementing in @command{awk} This @value{SECTION} presents a number of POSIX utilities implemented in @command{awk}. Reinventing these programs in @command{awk} is often enjoyable, because the algorithms can be very clearly expressed, and the code is usually very concise and simple. This is true because @command{awk} does so much for you. It should be noted that these programs are not necessarily intended to replace the installed versions on your system. Nor may all of these programs be fully compliant with the most recent POSIX standard. This is not a problem; their purpose is to illustrate @command{awk} language programming for ``real world'' tasks. The programs are presented in alphabetical order. @menu * Cut Program:: The @command{cut} utility. * Egrep Program:: The @command{egrep} utility. * Id Program:: The @command{id} utility. * Split Program:: The @command{split} utility. * Tee Program:: The @command{tee} utility. * Uniq Program:: The @command{uniq} utility. * Wc Program:: The @command{wc} utility. @end menu @node Cut Program @subsection Cutting out Fields and Columns @cindex @command{cut} utility @c STARTOFRANGE cut @cindex @command{cut} utility @c STARTOFRANGE ficut @cindex fields, cutting @c STARTOFRANGE colcut @cindex columns, cutting The @command{cut} utility selects, or ``cuts,'' characters or fields from its standard input and sends them to its standard output. Fields are separated by TABs by default, but you may supply a command-line option to change the field @dfn{delimiter} (i.e., the field-separator character). @command{cut}'s definition of fields is less general than @command{awk}'s. A common use of @command{cut} might be to pull out just the login name of logged-on users from the output of @command{who}. For example, the following pipeline generates a sorted, unique list of the logged-on users: @example who | cut -c1-8 | sort | uniq @end example The options for @command{cut} are: @table @code @item -c @var{list} Use @var{list} as the list of characters to cut out. Items within the list may be separated by commas, and ranges of characters can be separated with dashes. The list @samp{1-8,15,22-35} specifies characters 1 through 8, 15, and 22 through 35. @item -f @var{list} Use @var{list} as the list of fields to cut out. @item -d @var{delim} Use @var{delim} as the field-separator character instead of the TAB character. @item -s Suppress printing of lines that do not contain the field delimiter. @end table The @command{awk} implementation of @command{cut} uses the @code{getopt()} library function (@pxref{Getopt Function}) and the @code{join()} library function (@pxref{Join Function}). The program begins with a comment describing the options, the library functions needed, and a @code{usage()} function that prints out a usage message and exits. @code{usage()} is called if invalid arguments are supplied: @cindex @code{cut.awk} program @example @c file eg/prog/cut.awk # cut.awk --- implement cut in awk @c endfile @ignore @c file eg/prog/cut.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 @c endfile @end ignore @c file eg/prog/cut.awk # Options: # -f list Cut fields # -d c Field delimiter character # -c list Cut characters # # -s Suppress lines without the delimiter # # Requires getopt() and join() library functions @group function usage( e1, e2) @{ e1 = "usage: cut [-f list] [-d c] [-s] [files...]" e2 = "usage: cut [-c list] [files...]" print e1 > "/dev/stderr" print e2 > "/dev/stderr" exit 1 @} @end group @c endfile @end example @noindent The variables @code{e1} and @code{e2} are used so that the function fits nicely on the @ifnotinfo page. @end ifnotinfo @ifnottex screen. @end ifnottex @cindex @code{BEGIN} pattern, running @command{awk} programs and @cindex @code{FS} variable, running @command{awk} programs and Next comes a @code{BEGIN} rule that parses the command-line options. It sets @code{FS} to a single TAB character, because that is @command{cut}'s default field separator. The rule then sets the output field separator to be the same as the input field separator. A loop using @code{getopt()} steps through the command-line options. Exactly one of the variables @code{by_fields} or @code{by_chars} is set to true, to indicate that processing should be done by fields or by characters, respectively. When cutting by characters, the output field separator is set to the null string: @example @c file eg/prog/cut.awk BEGIN \ @{ FS = "\t" # default OFS = FS while ((c = getopt(ARGC, ARGV, "sf:c:d:")) != -1) @{ if (c == "f") @{ by_fields = 1 fieldlist = Optarg @} else if (c == "c") @{ by_chars = 1 fieldlist = Optarg OFS = "" @} else if (c == "d") @{ if (length(Optarg) > 1) @{ printf("Using first character of %s" \ " for delimiter\n", Optarg) > "/dev/stderr" Optarg = substr(Optarg, 1, 1) @} FS = Optarg OFS = FS if (FS == " ") # defeat awk semantics FS = "[ ]" @} else if (c == "s") suppress++ else usage() @} # Clear out options for (i = 1; i < Optind; i++) ARGV[i] = "" @c endfile @end example @cindex field separators, spaces as The code must take special care when the field delimiter is a space. Using a single space (@code{@w{" "}}) for the value of @code{FS} is incorrect---@command{awk} would separate fields with runs of spaces, TABs, and/or newlines, and we want them to be separated with individual spaces. Also remember that after @code{getopt()} is through (as described in @ref{Getopt Function}), we have to clear out all the elements of @code{ARGV} from 1 to @code{Optind}, so that @command{awk} does not try to process the command-line options as @value{FN}s. After dealing with the command-line options, the program verifies that the options make sense. Only one or the other of @option{-c} and @option{-f} should be used, and both require a field list. Then the program calls either @code{set_fieldlist()} or @code{set_charlist()} to pull apart the list of fields or characters: @example @c file eg/prog/cut.awk if (by_fields && by_chars) usage() if (by_fields == 0 && by_chars == 0) by_fields = 1 # default if (fieldlist == "") @{ print "cut: needs list for -c or -f" > "/dev/stderr" exit 1 @} if (by_fields) set_fieldlist() else set_charlist() @} @c endfile @end example @code{set_fieldlist()} splits the field list apart at the commas into an array. Then, for each element of the array, it looks to see if the element is actually a range, and if so, splits it apart. The function checks the range to make sure that the first number is smaller than the second. Each number in the list is added to the @code{flist} array, which simply lists the fields that will be printed. Normal field splitting is used. The program lets @command{awk} handle the job of doing the field splitting: @example @c file eg/prog/cut.awk function set_fieldlist( n, m, i, j, k, f, g) @{ n = split(fieldlist, f, ",") j = 1 # index in flist for (i = 1; i <= n; i++) @{ if (index(f[i], "-") != 0) @{ # a range m = split(f[i], g, "-") @group if (m != 2 || g[1] >= g[2]) @{ printf("bad field list: %s\n", f[i]) > "/dev/stderr" exit 1 @} @end group for (k = g[1]; k <= g[2]; k++) flist[j++] = k @} else flist[j++] = f[i] @} nfields = j - 1 @} @c endfile @end example The @code{set_charlist()} function is more complicated than @code{set_fieldlist()}. The idea here is to use @command{gawk}'s @code{FIELDWIDTHS} variable (@pxref{Constant Size}), which describes constant-width input. When using a character list, that is exactly what we have. Setting up @code{FIELDWIDTHS} is more complicated than simply listing the fields that need to be printed. We have to keep track of the fields to print and also the intervening characters that have to be skipped. For example, suppose you wanted characters 1 through 8, 15, and 22 through 35. You would use @samp{-c 1-8,15,22-35}. The necessary value for @code{FIELDWIDTHS} is @code{@w{"8 6 1 6 14"}}. This yields five fields, and the fields to print are @code{$1}, @code{$3}, and @code{$5}. The intermediate fields are @dfn{filler}, which is stuff in between the desired data. @code{flist} lists the fields to print, and @code{t} tracks the complete field list, including filler fields: @example @c file eg/prog/cut.awk function set_charlist( field, i, j, f, g, t, filler, last, len) @{ field = 1 # count total fields n = split(fieldlist, f, ",") j = 1 # index in flist for (i = 1; i <= n; i++) @{ if (index(f[i], "-") != 0) @{ # range m = split(f[i], g, "-") if (m != 2 || g[1] >= g[2]) @{ printf("bad character list: %s\n", f[i]) > "/dev/stderr" exit 1 @} len = g[2] - g[1] + 1 if (g[1] > 1) # compute length of filler filler = g[1] - last - 1 else filler = 0 @group if (filler) t[field++] = filler @end group t[field++] = len # length of field last = g[2] flist[j++] = field - 1 @} else @{ if (f[i] > 1) filler = f[i] - last - 1 else filler = 0 if (filler) t[field++] = filler t[field++] = 1 last = f[i] flist[j++] = field - 1 @} @} FIELDWIDTHS = join(t, 1, field - 1) nfields = j - 1 @} @c endfile @end example Next is the rule that actually processes the data. If the @option{-s} option is given, then @code{suppress} is true. The first @code{if} statement makes sure that the input record does have the field separator. If @command{cut} is processing fields, @code{suppress} is true, and the field separator character is not in the record, then the record is skipped. If the record is valid, then @command{gawk} has split the data into fields, either using the character in @code{FS} or using fixed-length fields and @code{FIELDWIDTHS}. The loop goes through the list of fields that should be printed. The corresponding field is printed if it contains data. If the next field also has data, then the separator character is written out between the fields: @example @c file eg/prog/cut.awk @{ if (by_fields && suppress && index($0, FS) != 0) next for (i = 1; i <= nfields; i++) @{ if ($flist[i] != "") @{ printf "%s", $flist[i] if (i < nfields && $flist[i+1] != "") printf "%s", OFS @} @} print "" @} @c endfile @end example This version of @command{cut} relies on @command{gawk}'s @code{FIELDWIDTHS} variable to do the character-based cutting. While it is possible in other @command{awk} implementations to use @code{substr()} (@pxref{String Functions}), it is also extremely painful. The @code{FIELDWIDTHS} variable supplies an elegant solution to the problem of picking the input line apart by characters. @c ENDOFRANGE cut @c ENDOFRANGE ficut @c ENDOFRANGE colcut @c Exercise: Rewrite using split with "". @node Egrep Program @subsection Searching for Regular Expressions in Files @c STARTOFRANGE regexps @cindex regular expressions, searching for @c STARTOFRANGE sfregexp @cindex searching, files for regular expressions @c STARTOFRANGE fsregexp @cindex files, searching for regular expressions @cindex @command{egrep} utility The @command{egrep} utility searches files for patterns. It uses regular expressions that are almost identical to those available in @command{awk} (@pxref{Regexp}). You invoke it as follows: @example egrep @r{[} @var{options} @r{]} '@var{pattern}' @var{files} @dots{} @end example The @var{pattern} is a regular expression. In typical usage, the regular expression is quoted to prevent the shell from expanding any of the special characters as @value{FN} wildcards. Normally, @command{egrep} prints the lines that matched. If multiple @value{FN}s are provided on the command line, each output line is preceded by the name of the file and a colon. The options to @command{egrep} are as follows: @table @code @item -c Print out a count of the lines that matched the pattern, instead of the lines themselves. @item -s Be silent. No output is produced and the exit value indicates whether the pattern was matched. @item -v Invert the sense of the test. @command{egrep} prints the lines that do @emph{not} match the pattern and exits successfully if the pattern is not matched. @item -i Ignore case distinctions in both the pattern and the input data. @item -l Only print (list) the names of the files that matched, not the lines that matched. @item -e @var{pattern} Use @var{pattern} as the regexp to match. The purpose of the @option{-e} option is to allow patterns that start with a @samp{-}. @end table This version uses the @code{getopt()} library function (@pxref{Getopt Function}) and the file transition library program (@pxref{Filetrans Function}). The program begins with a descriptive comment and then a @code{BEGIN} rule that processes the command-line arguments with @code{getopt()}. The @option{-i} (ignore case) option is particularly easy with @command{gawk}; we just use the @code{IGNORECASE} built-in variable (@pxref{Built-in Variables}): @cindex @code{egrep.awk} program @example @c file eg/prog/egrep.awk # egrep.awk --- simulate egrep in awk # @c endfile @ignore @c file eg/prog/egrep.awk # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 @c endfile @end ignore @c file eg/prog/egrep.awk # Options: # -c count of lines # -s silent - use exit value # -v invert test, success if no match # -i ignore case # -l print filenames only # -e argument is pattern # # Requires getopt and file transition library functions BEGIN @{ while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) @{ if (c == "c") count_only++ else if (c == "s") no_print++ else if (c == "v") invert++ else if (c == "i") IGNORECASE = 1 else if (c == "l") filenames_only++ else if (c == "e") pattern = Optarg else usage() @} @c endfile @end example Next comes the code that handles the @command{egrep}-specific behavior. If no pattern is supplied with @option{-e}, the first nonoption on the command line is used. The @command{awk} command-line arguments up to @code{ARGV[Optind]} are cleared, so that @command{awk} won't try to process them as files. If no files are specified, the standard input is used, and if multiple files are specified, we make sure to note this so that the @value{FN}s can precede the matched lines in the output: @example @c file eg/prog/egrep.awk if (pattern == "") pattern = ARGV[Optind++] for (i = 1; i < Optind; i++) ARGV[i] = "" if (Optind >= ARGC) @{ ARGV[1] = "-" ARGC = 2 @} else if (ARGC - Optind > 1) do_filenames++ # if (IGNORECASE) # pattern = tolower(pattern) @} @c endfile @end example The last two lines are commented out, since they are not needed in @command{gawk}. They should be uncommented if you have to use another version of @command{awk}. The next set of lines should be uncommented if you are not using @command{gawk}. This rule translates all the characters in the input line into lowercase if the @option{-i} option is specified.@footnote{It also introduces a subtle bug; if a match happens, we output the translated line, not the original.} The rule is commented out since it is not necessary with @command{gawk}: @c Exercise: Fix this, w/array and new line as key to original line @example @c file eg/prog/egrep.awk #@{ # if (IGNORECASE) # $0 = tolower($0) #@} @c endfile @end example The @code{beginfile()} function is called by the rule in @file{ftrans.awk} when each new file is processed. In this case, it is very simple; all it does is initialize a variable @code{fcount} to zero. @code{fcount} tracks how many lines in the current file matched the pattern. Naming the parameter @code{junk} shows we know that @code{beginfile()} is called with a parameter, but that we're not interested in its value: @example @c file eg/prog/egrep.awk function beginfile(junk) @{ fcount = 0 @} @c endfile @end example The @code{endfile()} function is called after each file has been processed. It affects the output only when the user wants a count of the number of lines that matched. @code{no_print} is true only if the exit status is desired. @code{count_only} is true if line counts are desired. @command{egrep} therefore only prints line counts if printing and counting are enabled. The output format must be adjusted depending upon the number of files to process. Finally, @code{fcount} is added to @code{total}, so that we know the total number of lines that matched the pattern: @example @c file eg/prog/egrep.awk function endfile(file) @{ if (! no_print && count_only) @{ if (do_filenames) print file ":" fcount else print fcount @} total += fcount @} @c endfile @end example The following rule does most of the work of matching lines. The variable @code{matches} is true if the line matched the pattern. If the user wants lines that did not match, the sense of @code{matches} is inverted using the @samp{!} operator. @code{fcount} is incremented with the value of @code{matches}, which is either one or zero, depending upon a successful or unsuccessful match. If the line does not match, the @code{next} statement just moves on to the next record. A number of additional tests are made, but they are only done if we are not counting lines. First, if the user only wants exit status (@code{no_print} is true), then it is enough to know that @emph{one} line in this file matched, and we can skip on to the next file with @code{nextfile}. Similarly, if we are only printing @value{FN}s, we can print the @value{FN}, and then skip to the next file with @code{nextfile}. Finally, each line is printed, with a leading @value{FN} and colon if necessary: @cindex @code{!} (exclamation point), @code{!} operator @cindex exclamation point (@code{!}), @code{!} operator @example @c file eg/prog/egrep.awk @{ matches = ($0 ~ pattern) if (invert) matches = ! matches fcount += matches # 1 or 0 if (! matches) next if (! count_only) @{ if (no_print) nextfile if (filenames_only) @{ print FILENAME nextfile @} if (do_filenames) print FILENAME ":" $0 else print @} @} @c endfile @end example The @code{END} rule takes care of producing the correct exit status. If there are no matches, the exit status is one; otherwise it is zero: @example @c file eg/prog/egrep.awk END \ @{ if (total == 0) exit 1 exit 0 @} @c endfile @end example The @code{usage()} function prints a usage message in case of invalid options, and then exits: @example @c file eg/prog/egrep.awk function usage( e) @{ e = "Usage: egrep [-csvil] [-e pat] [files ...]" e = e "\n\tegrep [-csvil] pat [files ...]" print e > "/dev/stderr" exit 1 @} @c endfile @end example The variable @code{e} is used so that the function fits nicely on the printed page. @cindex @code{END} pattern, backslash continuation and @cindex @code{\} (backslash), continuing lines and @cindex backslash (@code{\}), continuing lines and Just a note on programming style: you may have noticed that the @code{END} rule uses backslash continuation, with the open brace on a line by itself. This is so that it more closely resembles the way functions are written. Many of the examples in this @value{CHAPTER} use this style. You can decide for yourself if you like writing your @code{BEGIN} and @code{END} rules this way or not. @c ENDOFRANGE regexps @c ENDOFRANGE sfregexp @c ENDOFRANGE fsregexp @node Id Program @subsection Printing out User Information @cindex printing, user information @cindex users, information about, printing @cindex @command{id} utility The @command{id} utility lists a user's real and effective user ID numbers, real and effective group ID numbers, and the user's group set, if any. @command{id} only prints the effective user ID and group ID if they are different from the real ones. If possible, @command{id} also supplies the corresponding user and group names. The output might look like this: @example $ @kbd{id} @print{} uid=500(arnold) gid=500(arnold) groups=6(disk),7(lp),19(floppy) @end example @cindex @code{PROCINFO} array This information is part of what is provided by @command{gawk}'s @code{PROCINFO} array (@pxref{Built-in Variables}). However, the @command{id} utility provides a more palatable output than just individual numbers. Here is a simple version of @command{id} written in @command{awk}. It uses the user database library functions (@pxref{Passwd Functions}) and the group database library functions (@pxref{Group Functions}): The program is fairly straightforward. All the work is done in the @code{BEGIN} rule. The user and group ID numbers are obtained from @code{PROCINFO}. The code is repetitive. The entry in the user database for the real user ID number is split into parts at the @samp{:}. The name is the first field. Similar code is used for the effective user ID number and the group numbers: @cindex @code{id.awk} program @example @c file eg/prog/id.awk # id.awk --- implement id in awk # # Requires user and group library functions @c endfile @ignore @c file eg/prog/id.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 # Revised February 1996 @c endfile @end ignore @c file eg/prog/id.awk # output is: # uid=12(foo) euid=34(bar) gid=3(baz) \ # egid=5(blat) groups=9(nine),2(two),1(one) @group BEGIN \ @{ uid = PROCINFO["uid"] euid = PROCINFO["euid"] gid = PROCINFO["gid"] egid = PROCINFO["egid"] @end group printf("uid=%d", uid) pw = getpwuid(uid) if (pw != "") @{ split(pw, a, ":") printf("(%s)", a[1]) @} if (euid != uid) @{ printf(" euid=%d", euid) pw = getpwuid(euid) if (pw != "") @{ split(pw, a, ":") printf("(%s)", a[1]) @} @} printf(" gid=%d", gid) pw = getgrgid(gid) if (pw != "") @{ split(pw, a, ":") printf("(%s)", a[1]) @} if (egid != gid) @{ printf(" egid=%d", egid) pw = getgrgid(egid) if (pw != "") @{ split(pw, a, ":") printf("(%s)", a[1]) @} @} for (i = 1; ("group" i) in PROCINFO; i++) @{ if (i == 1) printf(" groups=") group = PROCINFO["group" i] printf("%d", group) pw = getgrgid(group) if (pw != "") @{ split(pw, a, ":") printf("(%s)", a[1]) @} if (("group" (i+1)) in PROCINFO) printf(",") @} print "" @} @c endfile @end example @cindex @code{in} operator The test in the @code{for} loop is worth noting. Any supplementary groups in the @code{PROCINFO} array have the indices @code{"group1"} through @code{"group@var{N}"} for some @var{N}, i.e., the total number of supplementary groups. However, we don't know in advance how many of these groups there are. This loop works by starting at one, concatenating the value with @code{"group"}, and then using @code{in} to see if that value is in the array. Eventually, @code{i} is incremented past the last group in the array and the loop exits. The loop is also correct if there are @emph{no} supplementary groups; then the condition is false the first time it's tested, and the loop body never executes. @c exercise!!! @ignore The POSIX version of @command{id} takes arguments that control which information is printed. Modify this version to accept the same arguments and perform in the same way. @end ignore @node Split Program @subsection Splitting a Large File into Pieces @c FIXME: One day, update to current POSIX version of split @c STARTOFRANGE filspl @cindex files, splitting @cindex @code{split} utility The @command{split} program splits large text files into smaller pieces. Usage is as follows:@footnote{This is the traditional usage. The POSIX usage is different, but not relevant for what the program aims to demonstrate.} @example split @r{[}-@var{count}@r{]} file @r{[} @var{prefix} @r{]} @end example By default, the output files are named @file{xaa}, @file{xab}, and so on. Each file has 1000 lines in it, with the likely exception of the last file. To change the number of lines in each file, supply a number on the command line preceded with a minus; e.g., @samp{-500} for files with 500 lines in them instead of 1000. To change the name of the output files to something like @file{myfileaa}, @file{myfileab}, and so on, supply an additional argument that specifies the @value{FN} prefix. Here is a version of @command{split} in @command{awk}. It uses the @code{ord()} and @code{chr()} functions presented in @ref{Ordinal Functions}. The program first sets its defaults, and then tests to make sure there are not too many arguments. It then looks at each argument in turn. The first argument could be a minus sign followed by a number. If it is, this happens to look like a negative number, so it is made positive, and that is the count of lines. The data @value{FN} is skipped over and the final argument is used as the prefix for the output @value{FN}s: @cindex @code{split.awk} program @example @c file eg/prog/split.awk # split.awk --- do split in awk # # Requires ord() and chr() library functions @c endfile @ignore @c file eg/prog/split.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 @c endfile @end ignore @c file eg/prog/split.awk # usage: split [-num] [file] [outname] BEGIN @{ outfile = "x" # default count = 1000 if (ARGC > 4) usage() i = 1 if (ARGV[i] ~ /^-[[:digit:]]+$/) @{ count = -ARGV[i] ARGV[i] = "" i++ @} # test argv in case reading from stdin instead of file if (i in ARGV) i++ # skip data file name if (i in ARGV) @{ outfile = ARGV[i] ARGV[i] = "" @} s1 = s2 = "a" out = (outfile s1 s2) @} @c endfile @end example The next rule does most of the work. @code{tcount} (temporary count) tracks how many lines have been printed to the output file so far. If it is greater than @code{count}, it is time to close the current file and start a new one. @code{s1} and @code{s2} track the current suffixes for the @value{FN}. If they are both @samp{z}, the file is just too big. Otherwise, @code{s1} moves to the next letter in the alphabet and @code{s2} starts over again at @samp{a}: @c else on separate line here for page breaking @example @c file eg/prog/split.awk @{ if (++tcount > count) @{ close(out) if (s2 == "z") @{ if (s1 == "z") @{ printf("split: %s is too large to split\n", FILENAME) > "/dev/stderr" exit 1 @} s1 = chr(ord(s1) + 1) s2 = "a" @} @group else s2 = chr(ord(s2) + 1) @end group out = (outfile s1 s2) tcount = 1 @} print > out @} @c endfile @end example @c Exercise: do this with just awk builtin functions, index("abc..."), substr, etc. @noindent The @code{usage()} function simply prints an error message and exits: @example @c file eg/prog/split.awk function usage( e) @{ e = "usage: split [-num] [file] [outname]" print e > "/dev/stderr" exit 1 @} @c endfile @end example @noindent The variable @code{e} is used so that the function fits nicely on the @ifinfo screen. @end ifinfo @ifnotinfo page. @end ifnotinfo This program is a bit sloppy; it relies on @command{awk} to automatically close the last file instead of doing it in an @code{END} rule. It also assumes that letters are contiguous in the character set, which isn't true for EBCDIC systems. @c Exercise: Fix these problems. @c BFD... @c ENDOFRANGE filspl @node Tee Program @subsection Duplicating Output into Multiple Files @cindex files, multiple@comma{} duplicating output into @cindex output, duplicating into files @cindex @code{tee} utility The @code{tee} program is known as a ``pipe fitting.'' @code{tee} copies its standard input to its standard output and also duplicates it to the files named on the command line. Its usage is as follows: @example tee @r{[}-a@r{]} file @dots{} @end example The @option{-a} option tells @code{tee} to append to the named files, instead of truncating them and starting over. The @code{BEGIN} rule first makes a copy of all the command-line arguments into an array named @code{copy}. @code{ARGV[0]} is not copied, since it is not needed. @code{tee} cannot use @code{ARGV} directly, since @command{awk} attempts to process each @value{FN} in @code{ARGV} as input data. @cindex flag variables If the first argument is @option{-a}, then the flag variable @code{append} is set to true, and both @code{ARGV[1]} and @code{copy[1]} are deleted. If @code{ARGC} is less than two, then no @value{FN}s were supplied and @code{tee} prints a usage message and exits. Finally, @command{awk} is forced to read the standard input by setting @code{ARGV[1]} to @code{"-"} and @code{ARGC} to two: @cindex @code{tee.awk} program @example @c file eg/prog/tee.awk # tee.awk --- tee in awk # # Copy standard input to all named output files. # Append content if -a option is supplied. # @c endfile @ignore @c file eg/prog/tee.awk # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 # Revised December 1995 @c endfile @end ignore @c file eg/prog/tee.awk BEGIN \ @{ for (i = 1; i < ARGC; i++) copy[i] = ARGV[i] if (ARGV[1] == "-a") @{ append = 1 delete ARGV[1] delete copy[1] ARGC-- @} if (ARGC < 2) @{ print "usage: tee [-a] file ..." > "/dev/stderr" exit 1 @} ARGV[1] = "-" ARGC = 2 @} @c endfile @end example The following single rule does all the work. Since there is no pattern, it is executed for each line of input. The body of the rule simply prints the line into each file on the command line, and then to the standard output: @example @c file eg/prog/tee.awk @{ # moving the if outside the loop makes it run faster if (append) for (i in copy) print >> copy[i] else for (i in copy) print > copy[i] print @} @c endfile @end example @noindent It is also possible to write the loop this way: @example for (i in copy) if (append) print >> copy[i] else print > copy[i] @end example @noindent This is more concise but it is also less efficient. The @samp{if} is tested for each record and for each output file. By duplicating the loop body, the @samp{if} is only tested once for each input record. If there are @var{N} input records and @var{M} output files, the first method only executes @var{N} @samp{if} statements, while the second executes @var{N}@code{*}@var{M} @samp{if} statements. Finally, the @code{END} rule cleans up by closing all the output files: @example @c file eg/prog/tee.awk END \ @{ for (i in copy) close(copy[i]) @} @c endfile @end example @node Uniq Program @subsection Printing Nonduplicated Lines of Text @c FIXME: One day, update to current POSIX version of uniq @c STARTOFRANGE prunt @cindex printing, unduplicated lines of text @c STARTOFRANGE tpul @cindex text@comma{} printing, unduplicated lines of @cindex @command{uniq} utility The @command{uniq} utility reads sorted lines of data on its standard input, and by default removes duplicate lines. In other words, it only prints unique lines---hence the name. @command{uniq} has a number of options. The usage is as follows: @example uniq @r{[}-udc @r{[}-@var{n}@r{]]} @r{[}+@var{n}@r{]} @r{[} @var{input file} @r{[} @var{output file} @r{]]} @end example The options for @command{uniq} are: @table @code @item -d Print only repeated lines. @item -u Print only nonrepeated lines. @item -c Count lines. This option overrides @option{-d} and @option{-u}. Both repeated and nonrepeated lines are counted. @item -@var{n} Skip @var{n} fields before comparing lines. The definition of fields is similar to @command{awk}'s default: nonwhitespace characters separated by runs of spaces and/or TABs. @item +@var{n} Skip @var{n} characters before comparing lines. Any fields specified with @samp{-@var{n}} are skipped first. @item @var{input file} Data is read from the input file named on the command line, instead of from the standard input. @item @var{output file} The generated output is sent to the named output file, instead of to the standard output. @end table Normally @command{uniq} behaves as if both the @option{-d} and @option{-u} options are provided. @command{uniq} uses the @code{getopt()} library function (@pxref{Getopt Function}) and the @code{join()} library function (@pxref{Join Function}). The program begins with a @code{usage()} function and then a brief outline of the options and their meanings in comments. The @code{BEGIN} rule deals with the command-line arguments and options. It uses a trick to get @code{getopt()} to handle options of the form @samp{-25}, treating such an option as the option letter @samp{2} with an argument of @samp{5}. If indeed two or more digits are supplied (@code{Optarg} looks like a number), @code{Optarg} is concatenated with the option digit and then the result is added to zero to make it into a number. If there is only one digit in the option, then @code{Optarg} is not needed. In this case, @code{Optind} must be decremented so that @code{getopt()} processes it next time. This code is admittedly a bit tricky. If no options are supplied, then the default is taken, to print both repeated and nonrepeated lines. The output file, if provided, is assigned to @code{outputfile}. Early on, @code{outputfile} is initialized to the standard output, @file{/dev/stdout}: @cindex @code{uniq.awk} program @example @c file eg/prog/uniq.awk @group # uniq.awk --- do uniq in awk # # Requires getopt() and join() library functions @end group @c endfile @ignore @c file eg/prog/uniq.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 @c endfile @end ignore @c file eg/prog/uniq.awk function usage( e) @{ e = "Usage: uniq [-udc [-n]] [+n] [ in [ out ]]" print e > "/dev/stderr" exit 1 @} # -c count lines. overrides -d and -u # -d only repeated lines # -u only nonrepeated lines # -n skip n fields # +n skip n characters, skip fields first BEGIN \ @{ count = 1 outputfile = "/dev/stdout" opts = "udc0:1:2:3:4:5:6:7:8:9:" while ((c = getopt(ARGC, ARGV, opts)) != -1) @{ if (c == "u") non_repeated_only++ else if (c == "d") repeated_only++ else if (c == "c") do_count++ else if (index("0123456789", c) != 0) @{ # getopt requires args to options # this messes us up for things like -5 if (Optarg ~ /^[[:digit:]]+$/) fcount = (c Optarg) + 0 else @{ fcount = c + 0 Optind-- @} @} else usage() @} if (ARGV[Optind] ~ /^\+[[:digit:]]+$/) @{ charcount = substr(ARGV[Optind], 2) + 0 Optind++ @} for (i = 1; i < Optind; i++) ARGV[i] = "" if (repeated_only == 0 && non_repeated_only == 0) repeated_only = non_repeated_only = 1 if (ARGC - Optind == 2) @{ outputfile = ARGV[ARGC - 1] ARGV[ARGC - 1] = "" @} @} @c endfile @end example The following function, @code{are_equal()}, compares the current line, @code{$0}, to the previous line, @code{last}. It handles skipping fields and characters. If no field count and no character count are specified, @code{are_equal()} simply returns one or zero depending upon the result of a simple string comparison of @code{last} and @code{$0}. Otherwise, things get more complicated. If fields have to be skipped, each line is broken into an array using @code{split()} (@pxref{String Functions}); the desired fields are then joined back into a line using @code{join()}. The joined lines are stored in @code{clast} and @code{cline}. If no fields are skipped, @code{clast} and @code{cline} are set to @code{last} and @code{$0}, respectively. Finally, if characters are skipped, @code{substr()} is used to strip off the leading @code{charcount} characters in @code{clast} and @code{cline}. The two strings are then compared and @code{are_equal()} returns the result: @example @c file eg/prog/uniq.awk function are_equal( n, m, clast, cline, alast, aline) @{ if (fcount == 0 && charcount == 0) return (last == $0) if (fcount > 0) @{ n = split(last, alast) m = split($0, aline) clast = join(alast, fcount+1, n) cline = join(aline, fcount+1, m) @} else @{ clast = last cline = $0 @} if (charcount) @{ clast = substr(clast, charcount + 1) cline = substr(cline, charcount + 1) @} return (clast == cline) @} @c endfile @end example The following two rules are the body of the program. The first one is executed only for the very first line of data. It sets @code{last} equal to @code{$0}, so that subsequent lines of text have something to be compared to. The second rule does the work. The variable @code{equal} is one or zero, depending upon the results of @code{are_equal()}'s comparison. If @command{uniq} is counting repeated lines, and the lines are equal, then it increments the @code{count} variable. Otherwise, it prints the line and resets @code{count}, since the two lines are not equal. If @command{uniq} is not counting, and if the lines are equal, @code{count} is incremented. Nothing is printed, since the point is to remove duplicates. Otherwise, if @command{uniq} is counting repeated lines and more than one line is seen, or if @command{uniq} is counting nonrepeated lines and only one line is seen, then the line is printed, and @code{count} is reset. Finally, similar logic is used in the @code{END} rule to print the final line of input data: @example @c file eg/prog/uniq.awk NR == 1 @{ last = $0 next @} @{ equal = are_equal() if (do_count) @{ # overrides -d and -u if (equal) count++ else @{ printf("%4d %s\n", count, last) > outputfile last = $0 count = 1 # reset @} next @} if (equal) count++ else @{ if ((repeated_only && count > 1) || (non_repeated_only && count == 1)) print last > outputfile last = $0 count = 1 @} @} END @{ if (do_count) printf("%4d %s\n", count, last) > outputfile else if ((repeated_only && count > 1) || (non_repeated_only && count == 1)) print last > outputfile close(outputfile) @} @c endfile @end example @c ENDOFRANGE prunt @c ENDOFRANGE tpul @node Wc Program @subsection Counting Things @c FIXME: One day, update to current POSIX version of wc @c STARTOFRANGE count @cindex counting @c STARTOFRANGE infco @cindex input files, counting elements in @c STARTOFRANGE woco @cindex words, counting @c STARTOFRANGE chco @cindex characters, counting @c STARTOFRANGE lico @cindex lines, counting @cindex @command{wc} utility The @command{wc} (word count) utility counts lines, words, and characters in one or more input files. Its usage is as follows: @example wc @r{[}-lwc@r{]} @r{[} @var{files} @dots{} @r{]} @end example If no files are specified on the command line, @command{wc} reads its standard input. If there are multiple files, it also prints total counts for all the files. The options and their meanings are shown in the following list: @table @code @item -l Count only lines. @item -w Count only words. A ``word'' is a contiguous sequence of nonwhitespace characters, separated by spaces and/or TABs. Luckily, this is the normal way @command{awk} separates fields in its input data. @item -c Count only characters. @end table Implementing @command{wc} in @command{awk} is particularly elegant, since @command{awk} does a lot of the work for us; it splits lines into words (i.e., fields) and counts them, it counts lines (i.e., records), and it can easily tell us how long a line is. This program uses the @code{getopt()} library function (@pxref{Getopt Function}) and the file-transition functions (@pxref{Filetrans Function}). This version has one notable difference from traditional versions of @command{wc}: it always prints the counts in the order lines, words, and characters. Traditional versions note the order of the @option{-l}, @option{-w}, and @option{-c} options on the command line, and print the counts in that order. The @code{BEGIN} rule does the argument processing. The variable @code{print_total} is true if more than one file is named on the command line: @cindex @code{wc.awk} program @example @c file eg/prog/wc.awk # wc.awk --- count lines, words, characters @c endfile @ignore @c file eg/prog/wc.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 @c endfile @end ignore @c file eg/prog/wc.awk # Options: # -l only count lines # -w only count words # -c only count characters # # Default is to count lines, words, characters # # Requires getopt() and file transition library functions BEGIN @{ # let getopt() print a message about # invalid options. we ignore them while ((c = getopt(ARGC, ARGV, "lwc")) != -1) @{ if (c == "l") do_lines = 1 else if (c == "w") do_words = 1 else if (c == "c") do_chars = 1 @} for (i = 1; i < Optind; i++) ARGV[i] = "" # if no options, do all if (! do_lines && ! do_words && ! do_chars) do_lines = do_words = do_chars = 1 print_total = (ARGC - i > 2) @} @c endfile @end example The @code{beginfile()} function is simple; it just resets the counts of lines, words, and characters to zero, and saves the current @value{FN} in @code{fname}: @example @c file eg/prog/wc.awk function beginfile(file) @{ lines = words = chars = 0 fname = FILENAME @} @c endfile @end example The @code{endfile()} function adds the current file's numbers to the running totals of lines, words, and characters.@footnote{@command{wc} can't just use the value of @code{FNR} in @code{endfile()}. If you examine the code in @ref{Filetrans Function}, you will see that @code{FNR} has already been reset by the time @code{endfile()} is called.} It then prints out those numbers for the file that was just read. It relies on @code{beginfile()} to reset the numbers for the following @value{DF}: @c FIXME: ONE DAY: make the above footnote an exercise, @c instead of giving away the answer. @example @c file eg/prog/wc.awk function endfile(file) @{ tlines += lines twords += words tchars += chars if (do_lines) printf "\t%d", lines @group if (do_words) printf "\t%d", words @end group if (do_chars) printf "\t%d", chars printf "\t%s\n", fname @} @c endfile @end example There is one rule that is executed for each line. It adds the length of the record, plus one, to @code{chars}.@footnote{Since @command{gawk} understands multibyte locales, this code counts characters, not bytes.} Adding one plus the record length is needed because the newline character separating records (the value of @code{RS}) is not part of the record itself, and thus not included in its length. Next, @code{lines} is incremented for each line read, and @code{words} is incremented by the value of @code{NF}, which is the number of ``words'' on this line: @example @c file eg/prog/wc.awk # do per line @{ chars += length($0) + 1 # get newline lines++ words += NF @} @c endfile @end example Finally, the @code{END} rule simply prints the totals for all the files: @example @c file eg/prog/wc.awk END @{ if (print_total) @{ if (do_lines) printf "\t%d", tlines if (do_words) printf "\t%d", twords if (do_chars) printf "\t%d", tchars print "\ttotal" @} @} @c endfile @end example @c ENDOFRANGE count @c ENDOFRANGE infco @c ENDOFRANGE lico @c ENDOFRANGE woco @c ENDOFRANGE chco @c ENDOFRANGE posimawk @node Miscellaneous Programs @section A Grab Bag of @command{awk} Programs This @value{SECTION} is a large ``grab bag'' of miscellaneous programs. We hope you find them both interesting and enjoyable. @menu * Dupword Program:: Finding duplicated words in a document. * Alarm Program:: An alarm clock. * Translate Program:: A program similar to the @command{tr} utility. * Labels Program:: Printing mailing labels. * Word Sorting:: A program to produce a word usage count. * History Sorting:: Eliminating duplicate entries from a history file. * Extract Program:: Pulling out programs from Texinfo source files. * Simple Sed:: A Simple Stream Editor. * Igawk Program:: A wrapper for @command{awk} that includes files. * Anagram Program:: Finding anagrams from a dictionary. * Signature Program:: People do amazing things with too much time on their hands. @end menu @node Dupword Program @subsection Finding Duplicated Words in a Document @cindex words, duplicate@comma{} searching for @cindex searching, for words @cindex documents@comma{} searching A common error when writing large amounts of prose is to accidentally duplicate words. Typically you will see this in text as something like ``the the program does the following@dots{}'' When the text is online, often the duplicated words occur at the end of one line and the @iftex the @end iftex beginning of another, making them very difficult to spot. @c as here! This program, @file{dupword.awk}, scans through a file one line at a time and looks for adjacent occurrences of the same word. It also saves the last word on a line (in the variable @code{prev}) for comparison with the first word on the next line. @cindex Texinfo The first two statements make sure that the line is all lowercase, so that, for example, ``The'' and ``the'' compare equal to each other. The next statement replaces nonalphanumeric and nonwhitespace characters with spaces, so that punctuation does not affect the comparison either. The characters are replaced with spaces so that formatting controls don't create nonsense words (e.g., the Texinfo @samp{@@code@{NF@}} becomes @samp{codeNF} if punctuation is simply deleted). The record is then resplit into fields, yielding just the actual words on the line, and ensuring that there are no empty fields. If there are no fields left after removing all the punctuation, the current record is skipped. Otherwise, the program loops through each word, comparing it to the previous one: @cindex @code{dupword.awk} program @example @c file eg/prog/dupword.awk # dupword.awk --- find duplicate words in text @c endfile @ignore @c file eg/prog/dupword.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # December 1991 # Revised October 2000 @c endfile @end ignore @c file eg/prog/dupword.awk @{ $0 = tolower($0) gsub(/[^[:alnum:][:blank:]]/, " "); $0 = $0 # re-split if (NF == 0) next if ($1 == prev) printf("%s:%d: duplicate %s\n", FILENAME, FNR, $1) for (i = 2; i <= NF; i++) if ($i == $(i-1)) printf("%s:%d: duplicate %s\n", FILENAME, FNR, $i) prev = $NF @} @c endfile @end example @node Alarm Program @subsection An Alarm Clock Program @cindex insomnia, cure for @cindex Robbins, Arnold @quotation @i{Nothing cures insomnia like a ringing alarm clock.}@* Arnold Robbins @end quotation @c STARTOFRANGE tialarm @cindex time, alarm clock example program @c STARTOFRANGE alaex @cindex alarm clock example program The following program is a simple ``alarm clock'' program. You give it a time of day and an optional message. At the specified time, it prints the message on the standard output. In addition, you can give it the number of times to repeat the message as well as a delay between repetitions. This program uses the @code{gettimeofday()} function from @ref{Gettimeofday Function}. All the work is done in the @code{BEGIN} rule. The first part is argument checking and setting of defaults: the delay, the count, and the message to print. If the user supplied a message without the ASCII BEL character (known as the ``alert'' character, @code{"\a"}), then it is added to the message. (On many systems, printing the ASCII BEL generates an audible alert. Thus when the alarm goes off, the system calls attention to itself in case the user is not looking at the computer.) Just for a change, this program uses a @code{switch} statement (@pxref{Switch Statement}), but the processing could be done with a series of @code{if}-@code{else} statements instead. Here is the program: @cindex @code{alarm.awk} program @example @c file eg/prog/alarm.awk # alarm.awk --- set an alarm # # Requires gettimeofday() library function @c endfile @ignore @c file eg/prog/alarm.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 # Revised December 2010 @c endfile @end ignore @c file eg/prog/alarm.awk # usage: alarm time [ "message" [ count [ delay ] ] ] BEGIN \ @{ # Initial argument sanity checking usage1 = "usage: alarm time ['message' [count [delay]]]" usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1]) if (ARGC < 2) @{ print usage1 > "/dev/stderr" print usage2 > "/dev/stderr" exit 1 @} switch (ARGC) @{ case 5: delay = ARGV[4] + 0 # fall through case 4: count = ARGV[3] + 0 # fall through case 3: message = ARGV[2] break default: if (ARGV[1] !~ /[[:digit:]]?[[:digit:]]:[[:digit:]]@{2@}/) @{ print usage1 > "/dev/stderr" print usage2 > "/dev/stderr" exit 1 @} break @} # set defaults for once we reach the desired time if (delay == 0) delay = 180 # 3 minutes @group if (count == 0) count = 5 @end group if (message == "") message = sprintf("\aIt is now %s!\a", ARGV[1]) else if (index(message, "\a") == 0) message = "\a" message "\a" @c endfile @end example The next @value{SECTION} of code turns the alarm time into hours and minutes, converts it (if necessary) to a 24-hour clock, and then turns that time into a count of the seconds since midnight. Next it turns the current time into a count of seconds since midnight. The difference between the two is how long to wait before setting off the alarm: @example @c file eg/prog/alarm.awk # split up alarm time split(ARGV[1], atime, ":") hour = atime[1] + 0 # force numeric minute = atime[2] + 0 # force numeric # get current broken down time gettimeofday(now) # if time given is 12-hour hours and it's after that # hour, e.g., `alarm 5:30' at 9 a.m. means 5:30 p.m., # then add 12 to real hour if (hour < 12 && now["hour"] > hour) hour += 12 # set target time in seconds since midnight target = (hour * 60 * 60) + (minute * 60) # get current time in seconds since midnight current = (now["hour"] * 60 * 60) + \ (now["minute"] * 60) + now["second"] # how long to sleep for naptime = target - current if (naptime <= 0) @{ print "time is in the past!" > "/dev/stderr" exit 1 @} @c endfile @end example @cindex @command{sleep} utility Finally, the program uses the @code{system()} function (@pxref{I/O Functions}) to call the @command{sleep} utility. The @command{sleep} utility simply pauses for the given number of seconds. If the exit status is not zero, the program assumes that @command{sleep} was interrupted and exits. If @command{sleep} exited with an OK status (zero), then the program prints the message in a loop, again using @command{sleep} to delay for however many seconds are necessary: @example @c file eg/prog/alarm.awk # zzzzzz..... go away if interrupted if (system(sprintf("sleep %d", naptime)) != 0) exit 1 # time to notify! command = sprintf("sleep %d", delay) for (i = 1; i <= count; i++) @{ print message # if sleep command interrupted, go away if (system(command) != 0) break @} exit 0 @} @c endfile @end example @c ENDOFRANGE tialarm @c ENDOFRANGE alaex @node Translate Program @subsection Transliterating Characters @c STARTOFRANGE chtra @cindex characters, transliterating @cindex @command{tr} utility The system @command{tr} utility transliterates characters. For example, it is often used to map uppercase letters into lowercase for further processing: @example @var{generate data} | tr 'A-Z' 'a-z' | @var{process data} @dots{} @end example @command{tr} requires two lists of characters.@footnote{On some older systems, @ifset ORA including Solaris, @end ifset @command{tr} may require that the lists be written as range expressions enclosed in square brackets (@samp{[a-z]}) and quoted, to prevent the shell from attempting a @value{FN} expansion. This is not a feature.} When processing the input, the first character in the first list is replaced with the first character in the second list, the second character in the first list is replaced with the second character in the second list, and so on. If there are more characters in the ``from'' list than in the ``to'' list, the last character of the ``to'' list is used for the remaining characters in the ``from'' list. Some time ago, @c early or mid-1989! a user proposed that a transliteration function should be added to @command{gawk}. @c Wishing to avoid gratuitous new features, @c at least theoretically The following program was written to prove that character transliteration could be done with a user-level function. This program is not as complete as the system @command{tr} utility but it does most of the job. The @command{translate} program demonstrates one of the few weaknesses of standard @command{awk}: dealing with individual characters is very painful, requiring repeated use of the @code{substr()}, @code{index()}, and @code{gsub()} built-in functions (@pxref{String Functions}).@footnote{This program was written before @command{gawk} acquired the ability to split each character in a string into separate array elements.} @c Exercise: How might you use this new feature to simplify the program? There are two functions. The first, @code{stranslate()}, takes three arguments: @table @code @item from A list of characters from which to translate. @item to A list of characters to which to translate. @item target The string on which to do the translation. @end table Associative arrays make the translation part fairly easy. @code{t_ar} holds the ``to'' characters, indexed by the ``from'' characters. Then a simple loop goes through @code{from}, one character at a time. For each character in @code{from}, if the character appears in @code{target}, it is replaced with the corresponding @code{to} character. The @code{translate()} function simply calls @code{stranslate()} using @code{$0} as the target. The main program sets two global variables, @code{FROM} and @code{TO}, from the command line, and then changes @code{ARGV} so that @command{awk} reads from the standard input. Finally, the processing rule simply calls @code{translate()} for each record: @cindex @code{translate.awk} program @example @c file eg/prog/translate.awk # translate.awk --- do tr-like stuff @c endfile @ignore @c file eg/prog/translate.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # August 1989 # February 2009 - bug fix @c endfile @end ignore @c file eg/prog/translate.awk # Bugs: does not handle things like: tr A-Z a-z, it has # to be spelled out. However, if `to' is shorter than `from', # the last character in `to' is used for the rest of `from'. function stranslate(from, to, target, lf, lt, ltarget, t_ar, i, c, result) @{ lf = length(from) lt = length(to) ltarget = length(target) for (i = 1; i <= lt; i++) t_ar[substr(from, i, 1)] = substr(to, i, 1) if (lt < lf) for (; i <= lf; i++) t_ar[substr(from, i, 1)] = substr(to, lt, 1) for (i = 1; i <= ltarget; i++) @{ c = substr(target, i, 1) if (c in t_ar) c = t_ar[c] result = result c @} return result @} function translate(from, to) @{ return $0 = stranslate(from, to, $0) @} # main program BEGIN @{ @group if (ARGC < 3) @{ print "usage: translate from to" > "/dev/stderr" exit @} @end group FROM = ARGV[1] TO = ARGV[2] ARGC = 2 ARGV[1] = "-" @} @{ translate(FROM, TO) print @} @c endfile @end example While it is possible to do character transliteration in a user-level function, it is not necessarily efficient, and we (the @command{gawk} authors) started to consider adding a built-in function. However, shortly after writing this program, we learned that the System V Release 4 @command{awk} had added the @code{toupper()} and @code{tolower()} functions (@pxref{String Functions}). These functions handle the vast majority of the cases where character transliteration is necessary, and so we chose to simply add those functions to @command{gawk} as well and then leave well enough alone. An obvious improvement to this program would be to set up the @code{t_ar} array only once, in a @code{BEGIN} rule. However, this assumes that the ``from'' and ``to'' lists will never change throughout the lifetime of the program. @c ENDOFRANGE chtra @node Labels Program @subsection Printing Mailing Labels @c STARTOFRANGE prml @cindex printing, mailing labels @c STARTOFRANGE mlprint @cindex mailing labels@comma{} printing Here is a ``real world''@footnote{``Real world'' is defined as ``a program actually used to get something done.''} program. This script reads lists of names and addresses and generates mailing labels. Each page of labels has 20 labels on it, two across and 10 down. The addresses are guaranteed to be no more than five lines of data. Each address is separated from the next by a blank line. The basic idea is to read 20 labels worth of data. Each line of each label is stored in the @code{line} array. The single rule takes care of filling the @code{line} array and printing the page when 20 labels have been read. The @code{BEGIN} rule simply sets @code{RS} to the empty string, so that @command{awk} splits records at blank lines (@pxref{Records}). It sets @code{MAXLINES} to 100, since 100 is the maximum number of lines on the page (20 * 5 = 100). Most of the work is done in the @code{printpage()} function. The label lines are stored sequentially in the @code{line} array. But they have to print horizontally; @code{line[1]} next to @code{line[6]}, @code{line[2]} next to @code{line[7]}, and so on. Two loops are used to accomplish this. The outer loop, controlled by @code{i}, steps through every 10 lines of data; this is each row of labels. The inner loop, controlled by @code{j}, goes through the lines within the row. As @code{j} goes from 0 to 4, @samp{i+j} is the @code{j}-th line in the row, and @samp{i+j+5} is the entry next to it. The output ends up looking something like this: @example line 1 line 6 line 2 line 7 line 3 line 8 line 4 line 9 line 5 line 10 @dots{} @end example @noindent The @code{printf} format string @samp{%-41s} left-aligns the data and prints it within a fixed-width field. As a final note, an extra blank line is printed at lines 21 and 61, to keep the output lined up on the labels. This is dependent on the particular brand of labels in use when the program was written. You will also note that there are two blank lines at the top and two blank lines at the bottom. The @code{END} rule arranges to flush the final page of labels; there may not have been an even multiple of 20 labels in the data: @cindex @code{labels.awk} program @example @c file eg/prog/labels.awk # labels.awk --- print mailing labels @c endfile @ignore @c file eg/prog/labels.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # June 1992 # December 2010, minor edits @c endfile @end ignore @c file eg/prog/labels.awk # Each label is 5 lines of data that may have blank lines. # The label sheets have 2 blank lines at the top and 2 at # the bottom. BEGIN @{ RS = "" ; MAXLINES = 100 @} function printpage( i, j) @{ if (Nlines <= 0) return printf "\n\n" # header for (i = 1; i <= Nlines; i += 10) @{ if (i == 21 || i == 61) print "" for (j = 0; j < 5; j++) @{ if (i + j > MAXLINES) break printf " %-41s %s\n", line[i+j], line[i+j+5] @} print "" @} printf "\n\n" # footer delete line @} # main rule @{ if (Count >= 20) @{ printpage() Count = 0 Nlines = 0 @} n = split($0, a, "\n") for (i = 1; i <= n; i++) line[++Nlines] = a[i] for (; i <= 5; i++) line[++Nlines] = "" Count++ @} END \ @{ printpage() @} @c endfile @end example @c ENDOFRANGE prml @c ENDOFRANGE mlprint @node Word Sorting @subsection Generating Word-Usage Counts @c STARTOFRANGE worus @cindex words, usage counts@comma{} generating When working with large amounts of text, it can be interesting to know how often different words appear. For example, an author may overuse certain words, in which case she might wish to find synonyms to substitute for words that appear too often. This @value{SUBSECTION} develops a program for counting words and presenting the frequency information in a useful format. At first glance, a program like this would seem to do the job: @example # Print list of word frequencies @{ for (i = 1; i <= NF; i++) freq[$i]++ @} END @{ for (word in freq) printf "%s\t%d\n", word, freq[word] @} @end example The program relies on @command{awk}'s default field splitting mechanism to break each line up into ``words,'' and uses an associative array named @code{freq}, indexed by each word, to count the number of times the word occurs. In the @code{END} rule, it prints the counts. This program has several problems that prevent it from being useful on real text files: @itemize @bullet @item The @command{awk} language considers upper- and lowercase characters to be distinct. Therefore, ``bartender'' and ``Bartender'' are not treated as the same word. This is undesirable, since in normal text, words are capitalized if they begin sentences, and a frequency analyzer should not be sensitive to capitalization. @item Words are detected using the @command{awk} convention that fields are separated just by whitespace. Other characters in the input (except newlines) don't have any special meaning to @command{awk}. This means that punctuation characters count as part of words. @item The output does not come out in any useful order. You're more likely to be interested in which words occur most frequently or in having an alphabetized table of how frequently each word occurs. @end itemize @cindex @command{sort} utility The first problem can be solved by using @code{tolower()} to remove case distinctions. The second problem can be solved by using @code{gsub()} to remove punctuation characters. Finally, we solve the third problem by using the system @command{sort} utility to process the output of the @command{awk} script. Here is the new version of the program: @cindex @code{wordfreq.awk} program @example @c file eg/prog/wordfreq.awk # wordfreq.awk --- print list of word frequencies @{ $0 = tolower($0) # remove case distinctions # remove punctuation gsub(/[^[:alnum:]_[:blank:]]/, "", $0) for (i = 1; i <= NF; i++) freq[$i]++ @} @c endfile END @{ for (word in freq) printf "%s\t%d\n", word, freq[word] @} @end example Assuming we have saved this program in a file named @file{wordfreq.awk}, and that the data is in @file{file1}, the following pipeline: @example awk -f wordfreq.awk file1 | sort -k 2nr @end example @noindent produces a table of the words appearing in @file{file1} in order of decreasing frequency. The @command{awk} program suitably massages the data and produces a word frequency table, which is not ordered. The @command{awk} script's output is then sorted by the @command{sort} utility and printed on the screen. The options given to @command{sort} specify a sort that uses the second field of each input line (skipping one field), that the sort keys should be treated as numeric quantities (otherwise @samp{15} would come before @samp{5}), and that the sorting should be done in descending (reverse) order. The @command{sort} could even be done from within the program, by changing the @code{END} action to: @example @c file eg/prog/wordfreq.awk END @{ sort = "sort -k 2nr" for (word in freq) printf "%s\t%d\n", word, freq[word] | sort close(sort) @} @c endfile @end example This way of sorting must be used on systems that do not have true pipes at the command-line (or batch-file) level. See the general operating system documentation for more information on how to use the @command{sort} program. @c ENDOFRANGE worus @node History Sorting @subsection Removing Duplicates from Unsorted Text @c STARTOFRANGE lidu @cindex lines, duplicate@comma{} removing The @command{uniq} program (@pxref{Uniq Program}), removes duplicate lines from @emph{sorted} data. Suppose, however, you need to remove duplicate lines from a @value{DF} but that you want to preserve the order the lines are in. A good example of this might be a shell history file. The history file keeps a copy of all the commands you have entered, and it is not unusual to repeat a command several times in a row. Occasionally you might want to compact the history by removing duplicate entries. Yet it is desirable to maintain the order of the original commands. This simple program does the job. It uses two arrays. The @code{data} array is indexed by the text of each line. For each line, @code{data[$0]} is incremented. If a particular line has not been seen before, then @code{data[$0]} is zero. In this case, the text of the line is stored in @code{lines[count]}. Each element of @code{lines} is a unique command, and the indices of @code{lines} indicate the order in which those lines are encountered. The @code{END} rule simply prints out the lines, in order: @cindex Rakitzis, Byron @cindex @code{histsort.awk} program @example @c file eg/prog/histsort.awk # histsort.awk --- compact a shell history file # Thanks to Byron Rakitzis for the general idea @c endfile @ignore @c file eg/prog/histsort.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 @c endfile @end ignore @c file eg/prog/histsort.awk @group @{ if (data[$0]++ == 0) lines[++count] = $0 @} @end group @group END @{ for (i = 1; i <= count; i++) print lines[i] @} @end group @c endfile @end example This program also provides a foundation for generating other useful information. For example, using the following @code{print} statement in the @code{END} rule indicates how often a particular command is used: @example print data[lines[i]], lines[i] @end example This works because @code{data[$0]} is incremented each time a line is seen. @c ENDOFRANGE lidu @node Extract Program @subsection Extracting Programs from Texinfo Source Files @c STARTOFRANGE texse @cindex Texinfo, extracting programs from source files @c STARTOFRANGE fitex @cindex files, Texinfo@comma{} extracting programs from @ifnotinfo Both this chapter and the previous chapter (@ref{Library Functions}) present a large number of @command{awk} programs. @end ifnotinfo @ifinfo The nodes @ref{Library Functions}, and @ref{Sample Programs}, are the top level nodes for a large number of @command{awk} programs. @end ifinfo If you want to experiment with these programs, it is tedious to have to type them in by hand. Here we present a program that can extract parts of a Texinfo input file into separate files. @cindex Texinfo This @value{DOCUMENT} is written in @uref{http://texinfo.org, Texinfo}, the GNU project's document formatting language. A single Texinfo source file can be used to produce both printed and online documentation. @ifnotinfo Texinfo is fully documented in the book @cite{Texinfo---The GNU Documentation Format}, available from the Free Software Foundation. @end ifnotinfo @ifinfo The Texinfo language is described fully, starting with @inforef{Top, , Texinfo, texinfo,Texinfo---The GNU Documentation Format}. @end ifinfo For our purposes, it is enough to know three things about Texinfo input files: @itemize @bullet @item The ``at'' symbol (@samp{@@}) is special in Texinfo, much as the backslash (@samp{\}) is in C or @command{awk}. Literal @samp{@@} symbols are represented in Texinfo source files as @samp{@@@@}. @item Comments start with either @samp{@@c} or @samp{@@comment}. The file-extraction program works by using special comments that start at the beginning of a line. @item Lines containing @samp{@@group} and @samp{@@end group} commands bracket example text that should not be split across a page boundary. (Unfortunately, @TeX{} isn't always smart enough to do things exactly right, so we have to give it some help.) @end itemize The following program, @file{extract.awk}, reads through a Texinfo source file and does two things, based on the special comments. Upon seeing @samp{@w{@@c system @dots{}}}, it runs a command, by extracting the command text from the control line and passing it on to the @code{system()} function (@pxref{I/O Functions}). Upon seeing @samp{@@c file @var{filename}}, each subsequent line is sent to the file @var{filename}, until @samp{@@c endfile} is encountered. The rules in @file{extract.awk} match either @samp{@@c} or @samp{@@comment} by letting the @samp{omment} part be optional. Lines containing @samp{@@group} and @samp{@@end group} are simply removed. @file{extract.awk} uses the @code{join()} library function (@pxref{Join Function}). The example programs in the online Texinfo source for @cite{@value{TITLE}} (@file{gawk.texi}) have all been bracketed inside @samp{file} and @samp{endfile} lines. The @command{gawk} distribution uses a copy of @file{extract.awk} to extract the sample programs and install many of them in a standard directory where @command{gawk} can find them. The Texinfo file looks something like this: @example @dots{} This program has a @@code@{BEGIN@} rule, that prints a nice message: @@example @@c file examples/messages.awk BEGIN @@@{ print "Don't panic!" @@@} @@c end file @@end example It also prints some final advice: @@example @@c file examples/messages.awk END @@@{ print "Always avoid bored archeologists!" @@@} @@c end file @@end example @dots{} @end example @file{extract.awk} begins by setting @code{IGNORECASE} to one, so that mixed upper- and lowercase letters in the directives won't matter. The first rule handles calling @code{system()}, checking that a command is given (@code{NF} is at least three) and also checking that the command exits with a zero exit status, signifying OK: @cindex @code{extract.awk} program @example @c file eg/prog/extract.awk # extract.awk --- extract files and run programs # from texinfo files @c endfile @ignore @c file eg/prog/extract.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # May 1993 # Revised September 2000 @c endfile @end ignore @c file eg/prog/extract.awk BEGIN @{ IGNORECASE = 1 @} /^@@c(omment)?[ \t]+system/ \ @{ if (NF < 3) @{ e = (FILENAME ":" FNR) e = (e ": badly formed `system' line") print e > "/dev/stderr" next @} $1 = "" $2 = "" stat = system($0) if (stat != 0) @{ e = (FILENAME ":" FNR) e = (e ": warning: system returned " stat) print e > "/dev/stderr" @} @} @c endfile @end example @noindent The variable @code{e} is used so that the rule fits nicely on the @ifnotinfo page. @end ifnotinfo @ifnottex screen. @end ifnottex The second rule handles moving data into files. It verifies that a @value{FN} is given in the directive. If the file named is not the current file, then the current file is closed. Keeping the current file open until a new file is encountered allows the use of the @samp{>} redirection for printing the contents, keeping open file management simple. The @code{for} loop does the work. It reads lines using @code{getline} (@pxref{Getline}). For an unexpected end of file, it calls the @code{@w{unexpected_eof()}} function. If the line is an ``endfile'' line, then it breaks out of the loop. If the line is an @samp{@@group} or @samp{@@end group} line, then it ignores it and goes on to the next line. Similarly, comments within examples are also ignored. Most of the work is in the following few lines. If the line has no @samp{@@} symbols, the program can print it directly. Otherwise, each leading @samp{@@} must be stripped off. To remove the @samp{@@} symbols, the line is split into separate elements of the array @code{a}, using the @code{split()} function (@pxref{String Functions}). The @samp{@@} symbol is used as the separator character. Each element of @code{a} that is empty indicates two successive @samp{@@} symbols in the original line. For each two empty elements (@samp{@@@@} in the original file), we have to add a single @samp{@@} symbol back in.@footnote{This program was written before @command{gawk} had the @code{gensub()} function. Consider how you might use it to simplify the code.} When the processing of the array is finished, @code{join()} is called with the value of @code{SUBSEP}, to rejoin the pieces back into a single line. That line is then printed to the output file: @example @c file eg/prog/extract.awk /^@@c(omment)?[ \t]+file/ \ @{ if (NF != 3) @{ e = (FILENAME ":" FNR ": badly formed `file' line") print e > "/dev/stderr" next @} if ($3 != curfile) @{ if (curfile != "") close(curfile) curfile = $3 @} for (;;) @{ if ((getline line) <= 0) unexpected_eof() if (line ~ /^@@c(omment)?[ \t]+endfile/) break else if (line ~ /^@@(end[ \t]+)?group/) continue else if (line ~ /^@@c(omment+)?[ \t]+/) continue if (index(line, "@@") == 0) @{ print line > curfile continue @} n = split(line, a, "@@") # if a[1] == "", means leading @@, # don't add one back in. for (i = 2; i <= n; i++) @{ if (a[i] == "") @{ # was an @@@@ a[i] = "@@" if (a[i+1] == "") i++ @} @} print join(a, 1, n, SUBSEP) > curfile @} @} @c endfile @end example An important thing to note is the use of the @samp{>} redirection. Output done with @samp{>} only opens the file once; it stays open and subsequent output is appended to the file (@pxref{Redirection}). This makes it easy to mix program text and explanatory prose for the same sample source file (as has been done here!) without any hassle. The file is only closed when a new data @value{FN} is encountered or at the end of the input file. Finally, the function @code{@w{unexpected_eof()}} prints an appropriate error message and then exits. The @code{END} rule handles the final cleanup, closing the open file: @c function lb put on same line for page breaking. sigh @example @c file eg/prog/extract.awk @group function unexpected_eof() @{ printf("%s:%d: unexpected EOF or error\n", FILENAME, FNR) > "/dev/stderr" exit 1 @} @end group END @{ if (curfile) close(curfile) @} @c endfile @end example @c ENDOFRANGE texse @c ENDOFRANGE fitex @node Simple Sed @subsection A Simple Stream Editor @cindex @command{sed} utility @cindex stream editors The @command{sed} utility is a stream editor, a program that reads a stream of data, makes changes to it, and passes it on. It is often used to make global changes to a large file or to a stream of data generated by a pipeline of commands. While @command{sed} is a complicated program in its own right, its most common use is to perform global substitutions in the middle of a pipeline: @example command1 < orig.data | sed 's/old/new/g' | command2 > result @end example Here, @samp{s/old/new/g} tells @command{sed} to look for the regexp @samp{old} on each input line and globally replace it with the text @samp{new}, i.e., all the occurrences on a line. This is similar to @command{awk}'s @code{gsub()} function (@pxref{String Functions}). The following program, @file{awksed.awk}, accepts at least two command-line arguments: the pattern to look for and the text to replace it with. Any additional arguments are treated as data @value{FN}s to process. If none are provided, the standard input is used: @cindex Brennan, Michael @cindex @command{awksed.awk} program @c @cindex simple stream editor @c @cindex stream editor, simple @example @c file eg/prog/awksed.awk # awksed.awk --- do s/foo/bar/g using just print # Thanks to Michael Brennan for the idea @c endfile @ignore @c file eg/prog/awksed.awk # # Arnold Robbins, arnold@@skeeve.com, Public Domain # August 1995 @c endfile @end ignore @c file eg/prog/awksed.awk function usage() @{ print "usage: awksed pat repl [files...]" > "/dev/stderr" exit 1 @} BEGIN @{ # validate arguments if (ARGC < 3) usage() RS = ARGV[1] ORS = ARGV[2] # don't use arguments as files ARGV[1] = ARGV[2] = "" @} @group # look ma, no hands! @{ if (RT == "") printf "%s", $0 else print @} @end group @c endfile @end example The program relies on @command{gawk}'s ability to have @code{RS} be a regexp, as well as on the setting of @code{RT} to the actual text that terminates the record (@pxref{Records}). The idea is to have @code{RS} be the pattern to look for. @command{gawk} automatically sets @code{$0} to the text between matches of the pattern. This is text that we want to keep, unmodified. Then, by setting @code{ORS} to the replacement text, a simple @code{print} statement outputs the text we want to keep, followed by the replacement text. There is one wrinkle to this scheme, which is what to do if the last record doesn't end with text that matches @code{RS}. Using a @code{print} statement unconditionally prints the replacement text, which is not correct. However, if the file did not end in text that matches @code{RS}, @code{RT} is set to the null string. In this case, we can print @code{$0} using @code{printf} (@pxref{Printf}). The @code{BEGIN} rule handles the setup, checking for the right number of arguments and calling @code{usage()} if there is a problem. Then it sets @code{RS} and @code{ORS} from the command-line arguments and sets @code{ARGV[1]} and @code{ARGV[2]} to the null string, so that they are not treated as @value{FN}s (@pxref{ARGC and ARGV}). The @code{usage()} function prints an error message and exits. Finally, the single rule handles the printing scheme outlined above, using @code{print} or @code{printf} as appropriate, depending upon the value of @code{RT}. @ignore Exercise, compare the performance of this version with the more straightforward: BEGIN { pat = ARGV[1] repl = ARGV[2] ARGV[1] = ARGV[2] = "" } { gsub(pat, repl); print } Exercise: what are the advantages and disadvantages of this version versus sed? Advantage: egrep regexps speed (?) Disadvantage: no & in replacement text Others? @end ignore @node Igawk Program @subsection An Easy Way to Use Library Functions @c STARTOFRANGE libfex @cindex libraries of @command{awk} functions, example program for using @c STARTOFRANGE flibex @cindex functions, library, example program for using In @ref{Include Files}, we saw how @command{gawk} provides a built-in file-inclusion capability. However, this is a @command{gawk} extension. This @value{SECTION} provides the motivation for making file inclusion available for standard @command{awk}, and shows how to do it using a combination of shell and @command{awk} programming. Using library functions in @command{awk} can be very beneficial. It encourages code reuse and the writing of general functions. Programs are smaller and therefore clearer. However, using library functions is only easy when writing @command{awk} programs; it is painful when running them, requiring multiple @option{-f} options. If @command{gawk} is unavailable, then so too is the @env{AWKPATH} environment variable and the ability to put @command{awk} functions into a library directory (@pxref{Options}). It would be nice to be able to write programs in the following manner: @example # library functions @@include getopt.awk @@include join.awk @dots{} # main program BEGIN @{ while ((c = getopt(ARGC, ARGV, "a:b:cde")) != -1) @dots{} @dots{} @} @end example The following program, @file{igawk.sh}, provides this service. It simulates @command{gawk}'s searching of the @env{AWKPATH} variable and also allows @dfn{nested} includes; i.e., a file that is included with @samp{@@include} can contain further @samp{@@include} statements. @command{igawk} makes an effort to only include files once, so that nested includes don't accidentally include a library function twice. @command{igawk} should behave just like @command{gawk} externally. This means it should accept all of @command{gawk}'s command-line arguments, including the ability to have multiple source files specified via @option{-f}, and the ability to mix command-line and library source files. The program is written using the POSIX Shell (@command{sh}) command language.@footnote{Fully explaining the @command{sh} language is beyond the scope of this book. We provide some minimal explanations, but see a good shell programming book if you wish to understand things in more depth.} It works as follows: @enumerate @item Loop through the arguments, saving anything that doesn't represent @command{awk} source code for later, when the expanded program is run. @item For any arguments that do represent @command{awk} text, put the arguments into a shell variable that will be expanded. There are two cases: @enumerate a @item Literal text, provided with @option{--source} or @option{--source=}. This text is just appended directly. @item Source @value{FN}s, provided with @option{-f}. We use a neat trick and append @samp{@@include @var{filename}} to the shell variable's contents. Since the file-inclusion program works the way @command{gawk} does, this gets the text of the file included into the program at the correct point. @end enumerate @item Run an @command{awk} program (naturally) over the shell variable's contents to expand @samp{@@include} statements. The expanded program is placed in a second shell variable. @item Run the expanded program with @command{gawk} and any other original command-line arguments that the user supplied (such as the data @value{FN}s). @end enumerate This program uses shell variables extensively: for storing command-line arguments, the text of the @command{awk} program that will expand the user's program, for the user's original program, and for the expanded program. Doing so removes some potential problems that might arise were we to use temporary files instead, at the cost of making the script somewhat more complicated. The initial part of the program turns on shell tracing if the first argument is @samp{debug}. The next part loops through all the command-line arguments. There are several cases of interest: @table @code @item -- This ends the arguments to @command{igawk}. Anything else should be passed on to the user's @command{awk} program without being evaluated. @item -W This indicates that the next option is specific to @command{gawk}. To make argument processing easier, the @option{-W} is appended to the front of the remaining arguments and the loop continues. (This is an @command{sh} programming trick. Don't worry about it if you are not familiar with @command{sh}.) @item -v@r{,} -F These are saved and passed on to @command{gawk}. @item -f@r{,} --file@r{,} --file=@r{,} -Wfile= The @value{FN} is appended to the shell variable @code{program} with an @samp{@@include} statement. The @command{expr} utility is used to remove the leading option part of the argument (e.g., @samp{--file=}). (Typical @command{sh} usage would be to use the @command{echo} and @command{sed} utilities to do this work. Unfortunately, some versions of @command{echo} evaluate escape sequences in their arguments, possibly mangling the program text. Using @command{expr} avoids this problem.) @item --source@r{,} --source=@r{,} -Wsource= The source text is appended to @code{program}. @item --version@r{,} -Wversion @command{igawk} prints its version number, runs @samp{gawk --version} to get the @command{gawk} version information, and then exits. @end table If none of the @option{-f}, @option{--file}, @option{-Wfile}, @option{--source}, or @option{-Wsource} arguments are supplied, then the first nonoption argument should be the @command{awk} program. If there are no command-line arguments left, @command{igawk} prints an error message and exits. Otherwise, the first argument is appended to @code{program}. In any case, after the arguments have been processed, @code{program} contains the complete text of the original @command{awk} program. The program is as follows: @cindex @code{igawk.sh} program @example @c file eg/prog/igawk.sh #! /bin/sh # igawk --- like gawk but do @@include processing @c endfile @ignore @c file eg/prog/igawk.sh # # Arnold Robbins, arnold@@skeeve.com, Public Domain # July 1993 # December 2010, minor edits @c endfile @end ignore @c file eg/prog/igawk.sh if [ "$1" = debug ] then set -x shift fi # A literal newline, so that program text is formatted correctly n=' ' # Initialize variables to empty program= opts= while [ $# -ne 0 ] # loop over arguments do case $1 in --) shift break ;; -W) shift # The $@{x?'message here'@} construct prints a # diagnostic if $x is the null string set -- -W"$@{@@?'missing operand'@}" continue ;; -[vF]) opts="$opts $1 '$@{2?'missing operand'@}'" shift ;; -[vF]*) opts="$opts '$1'" ;; -f) program="$program$n@@include $@{2?'missing operand'@}" shift ;; -f*) f=$(expr "$1" : '-f\(.*\)') program="$program$n@@include $f" ;; -[W-]file=*) f=$(expr "$1" : '-.file=\(.*\)') program="$program$n@@include $f" ;; -[W-]file) program="$program$n@@include $@{2?'missing operand'@}" shift ;; -[W-]source=*) t=$(expr "$1" : '-.source=\(.*\)') program="$program$n$t" ;; -[W-]source) program="$program$n$@{2?'missing operand'@}" shift ;; -[W-]version) echo igawk: version 3.0 1>&2 gawk --version exit 0 ;; -[W-]*) opts="$opts '$1'" ;; *) break ;; esac shift done if [ -z "$program" ] then program=$@{1?'missing program'@} shift fi # At this point, `program' has the program. @c endfile @end example The @command{awk} program to process @samp{@@include} directives is stored in the shell variable @code{expand_prog}. Doing this keeps the shell script readable. The @command{awk} program reads through the user's program, one line at a time, using @code{getline} (@pxref{Getline}). The input @value{FN}s and @samp{@@include} statements are managed using a stack. As each @samp{@@include} is encountered, the current @value{FN} is ``pushed'' onto the stack and the file named in the @samp{@@include} directive becomes the current @value{FN}. As each file is finished, the stack is ``popped,'' and the previous input file becomes the current input file again. The process is started by making the original file the first one on the stack. The @code{pathto()} function does the work of finding the full path to a file. It simulates @command{gawk}'s behavior when searching the @env{AWKPATH} environment variable (@pxref{AWKPATH Variable}). If a @value{FN} has a @samp{/} in it, no path search is done. Similarly, if the @value{FN} is @code{"-"}, then that string is used as-is. Otherwise, the @value{FN} is concatenated with the name of each directory in the path, and an attempt is made to open the generated @value{FN}. The only way to test if a file can be read in @command{awk} is to go ahead and try to read it with @code{getline}; this is what @code{pathto()} does.@footnote{On some very old versions of @command{awk}, the test @samp{getline junk < t} can loop forever if the file exists but is empty. Caveat emptor.} If the file can be read, it is closed and the @value{FN} is returned: @ignore An alternative way to test for the file's existence would be to call @samp{system("test -r " t)}, which uses the @command{test} utility to see if the file exists and is readable. The disadvantage to this method is that it requires creating an extra process and can thus be slightly slower. @end ignore @example @c file eg/prog/igawk.sh expand_prog=' function pathto(file, i, t, junk) @{ if (index(file, "/") != 0) return file if (file == "-") return file for (i = 1; i <= ndirs; i++) @{ t = (pathlist[i] "/" file) @group if ((getline junk < t) > 0) @{ # found it close(t) return t @} @end group @} return "" @} @c endfile @end example The main program is contained inside one @code{BEGIN} rule. The first thing it does is set up the @code{pathlist} array that @code{pathto()} uses. After splitting the path on @samp{:}, null elements are replaced with @code{"."}, which represents the current directory: @example @c file eg/prog/igawk.sh BEGIN @{ path = ENVIRON["AWKPATH"] ndirs = split(path, pathlist, ":") for (i = 1; i <= ndirs; i++) @{ if (pathlist[i] == "") pathlist[i] = "." @} @c endfile @end example The stack is initialized with @code{ARGV[1]}, which will be @file{/dev/stdin}. The main loop comes next. Input lines are read in succession. Lines that do not start with @samp{@@include} are printed verbatim. If the line does start with @samp{@@include}, the @value{FN} is in @code{$2}. @code{pathto()} is called to generate the full path. If it cannot, then the program prints an error message and continues. The next thing to check is if the file is included already. The @code{processed} array is indexed by the full @value{FN} of each included file and it tracks this information for us. If the file is seen again, a warning message is printed. Otherwise, the new @value{FN} is pushed onto the stack and processing continues. Finally, when @code{getline} encounters the end of the input file, the file is closed and the stack is popped. When @code{stackptr} is less than zero, the program is done: @example @c file eg/prog/igawk.sh stackptr = 0 input[stackptr] = ARGV[1] # ARGV[1] is first file for (; stackptr >= 0; stackptr--) @{ while ((getline < input[stackptr]) > 0) @{ if (tolower($1) != "@@include") @{ print continue @} fpath = pathto($2) @group if (fpath == "") @{ printf("igawk:%s:%d: cannot find %s\n", input[stackptr], FNR, $2) > "/dev/stderr" continue @} @end group if (! (fpath in processed)) @{ processed[fpath] = input[stackptr] input[++stackptr] = fpath # push onto stack @} else print $2, "included in", input[stackptr], "already included in", processed[fpath] > "/dev/stderr" @} close(input[stackptr]) @} @}' # close quote ends `expand_prog' variable processed_program=$(gawk -- "$expand_prog" /dev/stdin << EOF $program EOF ) @c endfile @end example The shell construct @samp{@var{command} << @var{marker}} is called a @dfn{here document}. Everything in the shell script up to the @var{marker} is fed to @var{command} as input. The shell processes the contents of the here document for variable and command substitution (and possibly other things as well, depending upon the shell). The shell construct @samp{$(@dots{})} is called @dfn{command substitution}. The output of the command inside the parentheses is substituted into the command line. Because the result is used in a variable assignment, it is saved as a single string, even if the results contain whitespace. The expanded program is saved in the variable @code{processed_program}. It's done in these steps: @enumerate @item Run @command{gawk} with the @samp{@@include}-processing program (the value of the @code{expand_prog} shell variable) on standard input. @item Standard input is the contents of the user's program, from the shell variable @code{program}. Its contents are fed to @command{gawk} via a here document. @item The results of this processing are saved in the shell variable @code{processed_program} by using command substitution. @end enumerate The last step is to call @command{gawk} with the expanded program, along with the original options and command-line arguments that the user supplied. @c this causes more problems than it solves, so leave it out. @ignore The special file @file{/dev/null} is passed as a @value{DF} to @command{gawk} to handle an interesting case. Suppose that the user's program only has a @code{BEGIN} rule and there are no @value{DF}s to read. The program should exit without reading any @value{DF}s. However, suppose that an included library file defines an @code{END} rule of its own. In this case, @command{gawk} will hang, reading standard input. In order to avoid this, @file{/dev/null} is explicitly added to the command-line. Reading from @file{/dev/null} always returns an immediate end of file indication. @c Hmm. Add /dev/null if $# is 0? Still messes up ARGV. Sigh. @end ignore @example @c file eg/prog/igawk.sh eval gawk $opts -- '"$processed_program"' '"$@@"' @c endfile @end example The @command{eval} command is a shell construct that reruns the shell's parsing process. This keeps things properly quoted. This version of @command{igawk} represents my fifth version of this program. There are four key simplifications that make the program work better: @itemize @bullet @item Using @samp{@@include} even for the files named with @option{-f} makes building the initial collected @command{awk} program much simpler; all the @samp{@@include} processing can be done once. @item Not trying to save the line read with @code{getline} in the @code{pathto()} function when testing for the file's accessibility for use with the main program simplifies things considerably. @c what problem does this engender though - exercise @c answer, reading from "-" or /dev/stdin @item Using a @code{getline} loop in the @code{BEGIN} rule does it all in one place. It is not necessary to call out to a separate loop for processing nested @samp{@@include} statements. @item Instead of saving the expanded program in a temporary file, putting it in a shell variable avoids some potential security problems. This has the disadvantage that the script relies upon more features of the @command{sh} language, making it harder to follow for those who aren't familiar with @command{sh}. @end itemize Also, this program illustrates that it is often worthwhile to combine @command{sh} and @command{awk} programming together. You can usually accomplish quite a lot, without having to resort to low-level programming in C or C++, and it is frequently easier to do certain kinds of string and argument manipulation using the shell than it is in @command{awk}. Finally, @command{igawk} shows that it is not always necessary to add new features to a program; they can often be layered on top. @ignore With @command{igawk}, there is no real reason to build @samp{@@include} processing into @command{gawk} itself. @end ignore @cindex search paths @cindex search paths, for source files @cindex source files@comma{} search path for @cindex files, source@comma{} search path for @cindex directories, searching As an additional example of this, consider the idea of having two files in a directory in the search path: @table @file @item default.awk This file contains a set of default library functions, such as @code{getopt()} and @code{assert()}. @item site.awk This file contains library functions that are specific to a site or installation; i.e., locally developed functions. Having a separate file allows @file{default.awk} to change with new @command{gawk} releases, without requiring the system administrator to update it each time by adding the local functions. @end table One user @c Karl Berry, karl@ileaf.com, 10/95 suggested that @command{gawk} be modified to automatically read these files upon startup. Instead, it would be very simple to modify @command{igawk} to do this. Since @command{igawk} can process nested @samp{@@include} directives, @file{default.awk} could simply contain @samp{@@include} statements for the desired library functions. @c Exercise: make this change @c ENDOFRANGE libfex @c ENDOFRANGE flibex @c ENDOFRANGE awkpex @node Anagram Program @subsection Finding Anagrams From A Dictionary An interesting programming challenge is to search for @dfn{anagrams} in a word list (such as @file{/usr/share/dict/words} on many GNU/Linux systems). One word is an anagram of another if both words contain the same letters (for example, ``babbling'' and ``blabbing''). An elegant algorithm is presented in Column 2, Problem C of Jon Bentley's @cite{Programming Pearls}, second edition. The idea is to give words that are anagrams a common signature, sort all the words together by their signature, and then print them. Dr.@: Bentley observes that taking the letters in each word and sorting them produces that common signature. The following program uses arrays of arrays to bring together words with the same signature and array sorting to print the words in sorted order. @cindex @code{anagram.awk} program @example @c file eg/prog/anagram.awk # anagram.awk --- An implementation of the anagram finding algorithm # from Jon Bentley's "Programming Pearls", 2nd edition. # Addison Wesley, 2000, ISBN 0-201-65788-0. # Column 2, Problem C, section 2.8, pp 18-20. @c endfile @ignore @c file eg/prog/anagram.awk # # This program requires gawk 4.0 or newer. # Required gawk-specific features: # - True multidimensional arrays # - split() with "" as separator splits out individual characters # - asort() and asorti() functions # # See http://savannah.gnu.org/projects/gawk. # # Arnold Robbins # arnold@@skeeve.com # Public Domain # January, 2011 @c endfile @end ignore @c file eg/prog/anagram.awk /'s$/ @{ next @} # Skip possessives @c endfile @end example The program starts with a header, and then a rule to skip possessives in the dictionary file. The next rule builds up the data structure. The first dimension of the array is indexed by the signature; the second dimension is the word itself: @example @c file eg/prog/anagram.awk @{ key = word2key($1) # Build signature data[key][$1] = $1 # Store word with signature @} @c endfile @end example The @code{word2key()} function creates the signature. It splits the word apart into individual letters, sorts the letters, and then joins them back together: @example @c file eg/prog/anagram.awk # word2key --- split word apart into letters, sort, joining back together function word2key(word, a, i, n, result) @{ n = split(word, a, "") asort(a) for (i = 1; i <= n; i++) result = result a[i] return result @} @c endfile @end example Finally, the @code{END} rule traverses the array and prints out the anagram lists. It sends the output to the system @command{sort} command, since otherwise the anagrams would appear in arbitrary order: @example @c file eg/prog/anagram.awk END @{ sort = "sort" for (key in data) @{ # Sort words with same key nwords = asorti(data[key], words) if (nwords == 1) continue # And print. Minor glitch: trailing space at end of each line for (j = 1; j <= nwords; j++) printf("%s ", words[j]) | sort print "" | sort @} close(sort) @} @c endfile @end example Here is some partial output when the program is run: @example $ @kbd{gawk -f anagram.awk /usr/share/dict/words | grep '^b'} @dots{} babbled blabbed babbler blabber brabble babblers blabbers brabbles babbling blabbing babbly blabby babel bable babels beslab babery yabber @dots{} @end example @node Signature Program @subsection And Now For Something Completely Different The following program was written by Davide Brini @c (@email{dave_br@@gmx.com}) and is published on @uref{http://backreference.org/2011/02/03/obfuscated-awk/, his website}. It serves as his signature in the Usenet group @code{comp.lang.awk}. He supplies the following copyright terms: @quotation Copyright @copyright{} 2008 Davide Brini Copying and distribution of the code published in this page, with or without modification, are permitted in any medium without royalty provided the copyright notice and this notice are preserved. @end quotation Here is the program: @example awk 'BEGIN@{O="~"~"~";o="=="=="==";o+=+o;x=O""O;while(X++<=x+o+o)c=c"%c"; printf c,(x-O)*(x-O),x*(x-o)-o,x*(x-O)+x-O-o,+x*(x-O)-x+o,X*(o*o+O)+x-O, X*(X-x)-o*o,(x+X)*o*o+o,x*(X-x)-O-O,x-O+(O+o+X+x)*(o+O),X*X-X*(x-O)-x+O, O+X*(o*(o+O)+O),+x+O+X*o,x*(x-o),(o+X+x)*o*o-(x-O-O),O+(X-x)*(X+O),x-O@}' @end example We leave it to you to determine what the program does. @ignore To: "Arnold Robbins" Date: Sat, 20 Aug 2011 13:50:46 -0400 Subject: The GNU Awk User's Guide, Section 13.3.11 From: "Chris Johansen" Message-ID: Arnold, you don't know me, but we have a tenuous connection. My wife is Barbara A. Field, FAIA, GIT '65 (B. Arch.). I have had a couple of paper copies of "Effective Awk Programming" for years, and now I'm going through a Kindle version of "The GNU Awk User's Guide" again. When I got to section 13.3.11, I reformatted and lightly commented Davide Brin's signature script to understand its workings. It occurs to me that this might have pedagogical value as an example (although imperfect) of the value of whitespace and comments, and a starting point for that discussion. It certainly helped _me_ understand what's going on. You are welcome to it, as-is or modified (subject to Davide's constraints, of course, which I think I have met). If I were to include it in a future edition, I would put it at some distance from section 13.3.11, say, as a note or an appendix, so as not to be a "spoiler" to the puzzle. Best regards, -- Chris Johansen {johansen at main dot nc dot us} . . . collapsing the probability wave function, sending ripples of certainty through the space-time continuum. #! /usr/bin/gawk -f # From "13.3.11 And Now For Something Completely Different" # http://www.gnu.org/software/gawk/manual/html_node/Signature-Program.html#Signature-Program # Copyright © 2008 Davide Brini # Copying and distribution of the code published in this page, with # or without modification, are permitted in any medium without # royalty provided the copyright notice and this notice are preserved. BEGIN { O = "~" ~ "~"; # 1 o = "==" == "=="; # 1 o += +o; # 2 x = O "" O; # 11 while ( X++ <= x + o + o ) c = c "%c"; # O is 1 # o is 2 # x is 11 # X is 17 # c is "%c%c%c%c%c%c%c%c%c%c%c%c%c%c%c%c" printf c, ( x - O )*( x - O), # 100 d x*( x - o ) - o, # 97 a x*( x - O ) + x - O - o, # 118 v +x*( x - O ) - x + o, # 101 e X*( o*o + O ) + x - O, # 95 _ X*( X - x ) - o*o, # 98 b ( x + X )*o*o + o, # 114 r x*( X - x ) - O - O, # 64 @ x - O + ( O + o + X + x )*( o + O ), # 103 g X*X - X*( x - O ) - x + O, # 109 m O + X*( o*( o + O ) + O ), # 120 x +x + O + X*o, # 46 . x*( x - o), # 99 c ( o + X + x )*o*o - ( x - O - O ), # 111 0 O + ( X - x )*( X + O ), # 109 m x - O # 10 \n } @end ignore @c The original text for this chapter was contributed by Efraim Yawitz. @c FIXME: Add more indexing. @node Debugger @chapter @command{dgawk}: The @command{awk} Debugger @cindex @command{dgawk} It would be nice if computer programs worked perfectly the first time they were run, but in real life, this rarely happens for programs of any complexity. Thus, most programming languages have facilities available for ``debugging'' programs, and now @command{awk} is no exception. The @command{dgawk} debugger is purposely modeled after @uref{http://www.gnu.org/software/gdb/, the GNU Debugger (GDB)} command-line debugger. If you are familiar with GDB, learning @command{dgawk} is easy. @menu * Debugging:: Introduction to @command{dgawk}. * Sample dgawk session:: Sample @command{dgawk} session. * List of Debugger Commands:: Main @command{dgawk} Commands. * Readline Support:: Readline Support. * Dgawk Limitations:: Limitations and future plans. @end menu @node Debugging @section Introduction to @command{dgawk} This @value{SECTION} introduces debugging in general and begins the discussion of debugging in @command{gawk}. @menu * Debugging Concepts:: Debugging In General. * Debugging Terms:: Additional Debugging Concepts. * Awk Debugging:: Awk Debugging. @end menu @node Debugging Concepts @subsection Debugging In General (If you have used debuggers in other languages, you may want to skip ahead to the next section on the specific features of the @command{awk} debugger.) Of course, a debugging program cannot remove bugs for you, since it has no way of knowing what you or your users consider a ``bug'' and what is a ``feature.'' (Sometimes, we humans have a hard time with this ourselves.) In that case, what can you expect from such a tool? The answer to that depends on the language being debugged, but in general, you can expect at least the following: @itemize @bullet @item The ability to watch a program execute its instructions one by one, giving you, the programmer, the opportunity to think about what is happening on a time scale of seconds, minutes, or hours, rather than the nanosecond time scale at which the code usually runs. @item The opportunity to not only passively observe the operation of your program, but to control it and try different paths of execution, without having to change your source files. @item The chance to see the values of data in the program at any point in execution, and also to change that data on the fly, to see how that affects what happens afterwards. (This often includes the ability to look at internal data structures besides the variables you actually defined in your code.) @item The ability to obtain additional information about your program's state or even its internal structure. @end itemize All of these tools provide a great amount of help in using your own skills and understanding of the goals of your program to find where it is going wrong (or, for that matter, to better comprehend a perfectly functional program that you or someone else wrote). @node Debugging Terms @subsection Additional Debugging Concepts Before diving in to the details, we need to introduce several important concepts that apply to just about all debuggers, including @command{dgawk}. The following list defines terms used throughout the rest of this @value{CHAPTER}. @table @dfn @item Stack Frame Programs generally call functions during the course of their execution. One function can call another, or a function can call itself (recursion). You can view the chain of called functions (main program calls A, which calls B, which calls C), as a stack of executing functions: the currently running function is the topmost one on the stack, and when it finishes (returns), the next one down then becomes the active function. Such a stack is termed a @dfn{call stack}. For each function on the call stack, the system maintains a data area that contains the function's parameters, local variables, and return value, as well as any other ``bookkeeping'' information needed to manage the call stack. This data area is termed a @dfn{stack frame}. @command{gawk} also follows this model, and @command{dgawk} gives you access to the call stack and to each stack frame. You can see the call stack, as well as from where each function on the stack was invoked. Commands that print the call stack print information about each stack frame (as detailed later on). @item Breakpoint During debugging, you often wish to let the program run until it reaches a certain point, and then continue execution from there one statement (or instruction) at a time. The way to do this is to set a @dfn{breakpoint} within the program. A breakpoint is where the execution of the program should break off (stop), so that you can take over control of the program's execution. You can add and remove as many breakpoints as you like. @item Watchpoint A watchpoint is similar to a breakpoint. The difference is that breakpoints are oriented around the code: stop when a certain point in the code is reached. A watchpoint, however, specifies that program execution should stop when a @emph{data value} is changed. This is useful, since sometimes it happens that a variable receives an erroneous value, and it's hard to track down where this happens just by looking at the code. By using a watchpoint, you can stop whenever a variable is assigned to, and usually find the errant code quite quickly. @end table @node Awk Debugging @subsection Awk Debugging Debugging an @command{awk} program has some specific aspects that are not shared with other programming languages. First of all, the fact that @command{awk} programs usually take input line-by-line from a file or files and operate on those lines using specific rules makes it especially useful to organize viewing the execution of the program in terms of these rules. As we will see, each @command{awk} rule is treated almost like a function call, with its own specific block of instructions. In addition, since @command{awk} is by design a very concise language, it is easy to lose sight of everything that is going on ``inside'' each line of @command{awk} code. The debugger provides the opportunity to look at the individual primitive instructions carried out by the higher-level @command{awk} commands. @node Sample dgawk session @section Sample @command{dgawk} session In order to illustrate the use of @command{dgawk}, let's look at a sample debugging session. We will use the @command{awk} implementation of the POSIX @command{uniq} command described earlier (@pxref{Uniq Program}) as our example. @menu * dgawk invocation:: @command{dgawk} Invocation. * Finding The Bug:: Finding The Bug. @end menu @node dgawk invocation @subsection @command{dgawk} Invocation Starting @command{dgawk} is exactly like running @command{awk}. The file(s) containing the program and any supporting code are given on the command line as arguments to one or more @option{-f} options. (@command{dgawk} is not designed to debug command-line programs, only programs contained in files.) In our case, we call @command{dgawk} like this: @example $ @kbd{dgawk -f getopt.awk -f join.awk -f uniq.awk inputfile} @end example @noindent where both @file{getopt.awk} and @file{uniq.awk} are in @env{$AWKPATH}. (Experienced users of GDB or similar debuggers should note that this syntax is slightly different from what they are used to. With @command{dgawk}, the arguments for running the program are given in the command line to the debugger rather than as part of the @code{run} command at the debugger prompt.) Instead of immediately running the program on @file{inputfile}, as @command{gawk} would ordinarily do, @command{dgawk} merely loads all the program source files, compiles them internally, and then gives us a prompt: @example dgawk> @end example @noindent from which we can issue commands to the debugger. At this point, no code has been executed. @node Finding The Bug @subsection Finding The Bug Let's say that we are having a problem using (a faulty version of) @file{uniq.awk} in the ``field-skipping'' mode, and it doesn't seem to be catching lines which should be identical when skipping the first field, such as: @example awk is a wonderful program! gawk is a wonderful program! @end example This could happen if we were thinking (C-like) of the fields in a record as being numbered in a zero-based fashion, so instead of the lines: @example clast = join(alast, fcount+1, n) cline = join(aline, fcount+1, m) @end example @noindent we wrote: @example clast = join(alast, fcount, n) cline = join(aline, fcount, m) @end example The first thing we usually want to do when trying to investigate a problem like this is to put a breakpoint in the program so that we can watch it at work and catch what it is doing wrong. A reasonable spot for a breakpoint in @file{uniq.awk} is at the beginning of the function @code{are_equal()}, which compares the current line with the previous one. To set the breakpoint, use the @code{b} (breakpoint) command: @example dgawk> @kbd{b are_equal} @print{} Breakpoint 1 set at file `awklib/eg/prog/uniq.awk', line 64 @end example The debugger tells us the file and line number where the breakpoint is. Now type @samp{r} or @samp{run} and the program runs until it hits the breakpoint for the first time: @example dgawk> @kbd{r} @print{} Starting program: @print{} Stopping in Rule ... @print{} Breakpoint 1, are_equal(n, m, clast, cline, alast, aline) at `awklib/eg/prog/uniq.awk':64 @print{} 64 if (fcount == 0 && charcount == 0) dgawk> @end example Now we can look at what's going on inside our program. First of all, let's see how we got to where we are. At the prompt, we type @samp{bt} (short for ``backtrace''), and @command{dgawk} responds with a listing of the current stack frames: @example dgawk> @kbd{bt} @print{} #0 are_equal(n, m, clast, cline, alast, aline) at `awklib/eg/prog/uniq.awk':69 @print{} #1 in main() at `awklib/eg/prog/uniq.awk':89 @end example This tells us that @code{are_equal()} was called by the main program at line 89 of @file{uniq.awk}. (This is not a big surprise, since this is the only call to @code{are_equal()} in the program, but in more complex programs, knowing who called a function and with what parameters can be the key to finding the source of the problem.) Now that we're in @code{are_equal()}, we can start looking at the values of some variables. Let's say we type @samp{p n} (@code{p} is short for ``print''). We would expect to see the value of @code{n}, a parameter to @code{are_equal()}. Actually, @command{dgawk} gives us: @example dgawk> @kbd{p n} @print{} n = untyped variable @end example @noindent In this case, @code{n} is an uninitialized local variable, since the function was called without arguments (@pxref{Function Calls}). A more useful variable to display might be the current record: @example dgawk> @kbd{p $0} @print{} $0 = string ("gawk is a wonderful program!") @end example @noindent This might be a bit puzzling at first since this is the second line of our test input above. Let's look at @code{NR}: @example dgawk> @kbd{p NR} @print{} NR = number (2) @end example @noindent So we can see that @code{are_equal()} was only called for the second record of the file. Of course, this is because our program contained a rule for @samp{NR == 1}: @example NR == 1 @{ last = $0 next @} @end example OK, let's just check that that rule worked correctly: @example dgawk> @kbd{p last} @print{} last = string ("awk is a wonderful program!") @end example Everything we have done so far has verified that the program has worked as planned, up to and including the call to @code{are_equal()}, so the problem must be inside this function. To investigate further, we must begin ``stepping through'' the lines of @code{are_equal()}. We start by typing @samp{n} (for ``next''): @example dgawk> @kbd{n} @print{} 67 if (fcount > 0) @{ @end example This tells us that @command{gawk} is now ready to execute line 67, which decides whether to give the lines the special ``field skipping'' treatment indicated by the @option{-f} command-line option. (Notice that we skipped from where we were before at line 64 to here, since the condition in line 64 @example if (fcount == 0 && charcount == 0) @end example @noindent was false.) Continuing to step, we now get to the splitting of the current and last records: @example dgawk> @kbd{n} @print{} 68 n = split(last, alast) dgawk> @kbd{n} @print{} 69 m = split($0, aline) @end example At this point, we should be curious to see what our records were split into, so we try to look: @example dgawk> @kbd{p n m alast aline} @print{} n = number (5) @print{} m = number (5) @print{} alast = array, 5 elements @print{} aline = array, 5 elements @end example @noindent (The @code{p} command can take more than one argument, similar to @command{awk}'s @code{print} statement.) This is kind of disappointing, though. All we found out is that there are five elements in each of our arrays. Useful enough (we now know that none of the words were accidentally left out), but what if we want to see inside the array? The first choice would be to use subscripts: @example dgawk> @kbd{p alast[0]} @print{} "0" not in array `alast' @end example @noindent Oops! @example dgawk> @kbd{p alast[1]} @print{} alast["1"] = string ("awk") @end example This would be kind of slow for a 100-member array, though, so @command{dgawk} provides a shortcut (reminiscent of another language not to be mentioned): @example dgawk> @kbd{p @@alast} @print{} alast["1"] = string ("awk") @print{} alast["2"] = string ("is") @print{} alast["3"] = string ("a") @print{} alast["4"] = string ("wonderful") @print{} alast["5"] = string ("program!") @end example It looks like we got this far OK. Let's take another step or two: @example dgawk> @kbd{n} @print{} 70 clast = join(alast, fcount, n) dgawk> @kbd{n} @print{} 71 cline = join(aline, fcount, m) @end example Well, here we are at our error (sorry to spoil the suspense). What we had in mind was to join the fields starting from the second one to make the virtual record to compare, and if the first field was numbered zero, this would work. Let's look at what we've got: @example dgawk> @kbd{p cline clast} @print{} cline = string ("gawk is a wonderful program!") @print{} clast = string ("awk is a wonderful program!") @end example Hey, those look pretty familiar! They're just our original, unaltered, input records. A little thinking (the human brain is still the best debugging tool), and we realize that we were off by one! We get out of @command{dgawk}: @example dgawk> @kbd{q} @print{} The program is running. Exit anyway (y/n)? @kbd{y} @end example @noindent Then we get into an editor: @example clast = join(alast, fcount+1, n) cline = join(aline, fcount+1, m) @end example @noindent and problem solved! @node List of Debugger Commands @section Main @command{dgawk} Commands The @command{dgawk} command set can be divided into the following categories: @itemize @bullet{} @item Breakpoint control @item Execution control @item Viewing and changing data @item Working with the stack @item Getting information @item Miscellaneous @end itemize Each of these are discussed in the following subsections. In the following descriptions, commands which may be abbreviated show the abbreviation on a second description line. A @command{dgawk} command name may also be truncated if that partial name is unambiguous. @command{dgawk} has the built-in capability to automatically repeat the previous command when just hitting @key{Enter}. This works for the commands @code{list}, @code{next}, @code{nexti}, @code{step}, @code{stepi} and @code{continue} executed without any argument. @menu * Breakpoint Control:: Control of breakpoints. * Dgawk Execution Control:: Control of execution. * Viewing And Changing Data:: Viewing and changing data. * Dgawk Stack:: Dealing with the stack. * Dgawk Info:: Obtaining information about the program and the debugger state. * Miscellaneous Dgawk Commands:: Miscellaneous Commands. @end menu @node Breakpoint Control @subsection Control Of Breakpoints As we saw above, the first thing you probably want to do in a debugging session is to get your breakpoints set up, since otherwise your program will just run as if it was not under the debugger. The commands for controlling breakpoints are: @table @asis @cindex debugger commands, @code{b} (@code{break}) @cindex debugger commands, @code{break} @cindex @code{break} debugger command @cindex @code{b} debugger command (alias for @code{break}) @item @code{break} [[@var{filename}@code{:}]@var{n} | @var{function}] [@code{"@var{expression}"}] @itemx @code{b} [[@var{filename}@code{:}]@var{n} | @var{function}] [@code{"@var{expression}"}] Without any argument, set a breakpoint at the next instruction to be executed in the selected stack frame. Arguments can be one of the following: @c nested table @table @var @item n Set a breakpoint at line number @var{n} in the current source file. @item filename@code{:}n Set a breakpoint at line number @var{n} in source file @var{filename}. @item function Set a breakpoint at entry to (the first instruction of) function @var{function}. @end table Each breakpoint is assigned a number which can be used to delete it from the breakpoint list using the @code{delete} command. With a breakpoint, you may also supply a condition. This is an @command{awk} expression (enclosed in double quotes) that @command{dgawk} evaluates whenever the breakpoint is reached. If the condition is true, then @command{dgawk} stops execution and prompts for a command. Otherwise, @command{dgawk} continues executing the program. @cindex debugger commands, @code{clear} @cindex @code{clear} debugger command @item @code{clear} [[@var{filename}@code{:}]@var{n} | @var{function}] Without any argument, delete any breakpoint at the next instruction to be executed in the selected stack frame. If the program stops at a breakpoint, this deletes that breakpoint so that the program does not stop at that location again. Arguments can be one of the following: @c nested table @table @var @item n Delete breakpoint(s) set at line number @var{n} in the current source file. @item filename@code{:}n Delete breakpoint(s) set at line number @var{n} in source file @var{filename}. @item function Delete breakpoint(s) set at entry to function @var{function}. @end table @cindex debugger commands, @code{condition} @cindex @code{condition} debugger command @item @code{condition} @var{n} @code{"@var{expression}"} Add a condition to existing breakpoint or watchpoint @var{n}. The condition is an @command{awk} expression that @command{dgawk} evaluates whenever the breakpoint or watchpoint is reached. If the condition is true, then @command{dgawk} stops execution and prompts for a command. Otherwise, @command{dgawk} continues executing the program. If the condition expression is not specified, any existing condition is removed; i.e., the breakpoint or watchpoint is made unconditional. @cindex debugger commands, @code{d} (@code{delete}) @cindex debugger commands, @code{delete} @cindex @code{delete} debugger command @cindex @code{d} debugger command (alias for @code{delete}) @item @code{delete} [@var{n1 n2} @dots{}] [@var{n}--@var{m}] @itemx @code{d} [@var{n1 n2} @dots{}] [@var{n}--@var{m}] Delete specified breakpoints or a range of breakpoints. Deletes all defined breakpoints if no argument is supplied. @cindex debugger commands, @code{disable} @cindex @code{disable} debugger command @item @code{disable} [@var{n1 n2} @dots{} | @var{n}--@var{m}] Disable specified breakpoints or a range of breakpoints. Without any argument, disables all breakpoints. @cindex debugger commands, @code{e} (@code{enable}) @cindex debugger commands, @code{enable} @cindex @code{enable} debugger command @cindex @code{e} debugger command (alias for @code{enable}) @item @code{enable} [@code{del} | @code{once}] [@var{n1 n2} @dots{}] [@var{n}--@var{m}] @itemx @code{e} [@code{del} | @code{once}] [@var{n1 n2} @dots{}] [@var{n}--@var{m}] Enable specified breakpoints or a range of breakpoints. Without any argument, enables all breakpoints. Optionally, you can specify how to enable the breakpoint: @c nested table @table @code @item del Enable the breakpoint(s) temporarily, then delete it when the program stops at the breakpoint. @item once Enable the breakpoint(s) temporarily, then disable it when the program stops at the breakpoint. @end table @cindex debugger commands, @code{ignore} @cindex @code{ignore} debugger command @item @code{ignore} @var{n} @var{count} Ignore breakpoint number @var{n} the next @var{count} times it is hit. @cindex debugger commands, @code{t} (@code{tbreak}) @cindex debugger commands, @code{tbreak} @cindex @code{tbreak} debugger command @cindex @code{t} debugger command (alias for @code{tbreak}) @item @code{tbreak} [[@var{filename}@code{:}]@var{n} | @var{function}] @itemx @code{t} [[@var{filename}@code{:}]@var{n} | @var{function}] Set a temporary breakpoint (enabled for only one stop). The arguments are the same as for @code{break}. @end table @node Dgawk Execution Control @subsection Control of Execution Now that your breakpoints are ready, you can start running the program and observing its behavior. There are more commands for controlling execution of the program than we saw in our earlier example: @table @asis @cindex debugger commands, @code{commands} @cindex @code{commands} debugger command @cindex debugger commands, @code{silent} @cindex @code{silent} debugger command @cindex debugger commands, @code{end} @cindex @code{end} debugger command @item @code{commands} [@var{n}] @itemx @code{silent} @itemx @dots{} @itemx @code{end} Set a list of commands to be executed upon stopping at a breakpoint or watchpoint. @var{n} is the breakpoint or watchpoint number. Without a number, the last one set is used. The actual commands follow, starting on the next line, and terminated by the @code{end} command. If the command @code{silent} is in the list, the usual messages about stopping at a breakpoint and the source line are not printed. Any command in the list that resumes execution (e.g., @code{continue}) terminates the list (an implicit @code{end}), and subsequent commands are ignored. For example: @example dgawk> @kbd{commands} > @kbd{silent} > @kbd{printf "A silent breakpoint; i = %d\n", i} > @kbd{info locals} > @kbd{set i = 10} > @kbd{continue} > @kbd{end} dgawk> @end example @cindex debugger commands, @code{c} (@code{continue}) @cindex debugger commands, @code{continue} @item @code{continue} [@var{count}] @itemx @code{c} [@var{count}] Resume program execution. If continued from a breakpoint and @var{count} is specified, ignores the breakpoint at that location the next @var{count} times before stopping. @cindex debugger commands, @code{finish} @cindex @code{finish} debugger command @item @code{finish} Execute until the selected stack frame returns. Print the returned value. @cindex debugger commands, @code{n} (@code{next}) @cindex debugger commands, @code{next} @cindex @code{next} debugger command @cindex @code{n} debugger command (alias for @code{next}) @item @code{next} [@var{count}] @itemx @code{n} [@var{count}] Continue execution to the next source line, stepping over function calls. The argument @var{count} controls how many times to repeat the action, as in @code{step}. @cindex debugger commands, @code{ni} (@code{nexti}) @cindex debugger commands, @code{nexti} @cindex @code{nexti} debugger command @cindex @code{ni} debugger command (alias for @code{nexti}) @item @code{nexti} [@var{count}] @itemx @code{ni} [@var{count}] Execute one (or @var{count}) instruction(s), stepping over function calls. @cindex debugger commands, @code{return} @cindex @code{return} debugger command @item @code{return} [@var{value}] Cancel execution of a function call. If @var{value} (either a string or a number) is specified, it is used as the function's return value. If used in a frame other than the innermost one (the currently executing function, i.e., frame number 0), discard all inner frames in addition to the selected one, and the caller of that frame becomes the innermost frame. @cindex debugger commands, @code{r} (@code{run}) @cindex debugger commands, @code{run} @cindex @code{run} debugger command @cindex @code{r} debugger command (alias for @code{run}) @item @code{run} @itemx @code{r} Start/restart execution of the program. When restarting, @command{dgawk} retains the current breakpoints, watchpoints, command history, automatic display variables, and debugger options. @cindex debugger commands, @code{s} (@code{step}) @cindex debugger commands, @code{step} @cindex @code{step} debugger command @cindex @code{s} debugger command (alias for @code{step}) @item @code{step} [@var{count}] @itemx @code{s} [@var{count}] Continue execution until control reaches a different source line in the current stack frame. @code{step} steps inside any function called within the line. If the argument @var{count} is supplied, steps that many times before stopping, unless it encounters a breakpoint or watchpoint. @cindex debugger commands, @code{si} (@code{stepi}) @cindex debugger commands, @code{stepi} @cindex @code{stepi} debugger command @cindex @code{si} debugger command (alias for @code{stepi}) @item @code{stepi} [@var{count}] @itemx @code{si} [@var{count}] Execute one (or @var{count}) instruction(s), stepping inside function calls. (For illustration of what is meant by an ``instruction'' in @command{gawk}, see the output shown under @code{dump} in @ref{Miscellaneous Dgawk Commands}.) @cindex debugger commands, @code{u} (@code{until}) @cindex debugger commands, @code{until} @cindex @code{until} debugger command @cindex @code{u} debugger command (alias for @code{until}) @item @code{until} [[@var{filename}@code{:}]@var{n} | @var{function}] @itemx @code{u} [[@var{filename}@code{:}]@var{n} | @var{function}] Without any argument, continue execution until a line past the current line in current stack frame is reached. With an argument, continue execution until the specified location is reached, or the current stack frame returns. @end table @node Viewing And Changing Data @subsection Viewing and Changing Data The commands for viewing and changing variables inside of @command{gawk} are: @table @asis @cindex debugger commands, @code{display} @cindex @code{display} debugger command @item @code{display} [@var{var} | @code{$}@var{n}] Add variable @var{var} (or field @code{$@var{n}}) to the display list. The value of the variable or field is displayed each time the program stops. Each variable added to the list is identified by a unique number: @example dgawk> @kbd{display x} @print{} 10: x = 1 @end example @noindent displays the assigned item number, the variable name and its current value. If the display variable refers to a function parameter, it is silently deleted from the list as soon as the execution reaches a context where no such variable of the given name exists. Without argument, @code{display} displays the current values of items on the list. @cindex debugger commands, @code{eval} @cindex @code{eval} debugger command @item @code{eval "@var{awk statements}"} Evaluate @var{awk statements} in the context of the running program. You can do anything that an @command{awk} program would do: assign values to variables, call functions, and so on. @item @code{eval} @var{param}, @dots{} @itemx @var{awk statements} @itemx @code{end} This form of @code{eval} is similar, but it allows you to define ``local variables'' that exist in the context of the @var{awk statements}, instead of using variables or function parameters defined by the program. @cindex debugger commands, @code{p} (@code{print}) @cindex debugger commands, @code{print} @cindex @code{print} debugger command @cindex @code{p} debugger command (alias for @code{print}) @item @code{print} @var{var1}[@code{,} @var{var2} @dots{}] @itemx @code{p} @var{var1}[@code{,} @var{var2} @dots{}] Print the value of a @command{gawk} variable or field. Fields must be referenced by constants: @example dgawk> @kbd{print $3} @end example @noindent This prints the third field in the input record (if the specified field does not exist, it prints @samp{Null field}). A variable can be an array element, with the subscripts being constant values. To print the contents of an array, prefix the name of the array with the @samp{@@} symbol: @example gawk> @kbd{print @@a} @end example @noindent This prints the indices and the corresponding values for all elements in the array @code{a}. @cindex debugger commands, @code{printf} @cindex @code{printf} debugger command @item @code{printf} @var{format} [@code{,} @var{arg} @dots{}] Print formatted text. The @var{format} may include escape sequences, such as @samp{\n} (@pxref{Escape Sequences}). No newline is printed unless one is specified. @cindex debugger commands, @code{set} @cindex @code{set} debugger command @item @code{set} @var{var}@code{=}@var{value} Assign a constant (number or string) value to an @command{awk} variable or field. String values must be enclosed between double quotes (@code{"@dots{}"}). You can also set special @command{awk} variables, such as @code{FS}, @code{NF}, @code{NR}, etc. @cindex debugger commands, @code{w} (@code{watch}) @cindex debugger commands, @code{watch} @cindex @code{watch} debugger command @cindex @code{w} debugger command (alias for @code{watch}) @item @code{watch} @var{var} | @code{$}@var{n} [@code{"@var{expression}"}] @itemx @code{w} @var{var} | @code{$}@var{n} [@code{"@var{expression}"}] Add variable @var{var} (or field @code{$@var{n}}) to the watch list. @command{dgawk} then stops whenever the value of the variable or field changes. Each watched item is assigned a number which can be used to delete it from the watch list using the @code{unwatch} command. With a watchpoint, you may also supply a condition. This is an @command{awk} expression (enclosed in double quotes) that @command{dgawk} evaluates whenever the watchpoint is reached. If the condition is true, then @command{dgawk} stops execution and prompts for a command. Otherwise, @command{dgawk} continues executing the program. @cindex debugger commands, @code{undisplay} @cindex @code{undisplay} debugger command @item @code{undisplay} [@var{n}] Remove item number @var{n} (or all items, if no argument) from the automatic display list. @cindex debugger commands, @code{unwatch} @cindex @code{unwatch} debugger command @item @code{unwatch} [@var{n}] Remove item number @var{n} (or all items, if no argument) from the watch list. @end table @node Dgawk Stack @subsection Dealing With The Stack Whenever you run a program which contains any function calls, @command{gawk} maintains a stack of all of the function calls leading up to where the program is right now. You can see how you got to where you are, and also move around in the stack to see what the state of things was in the functions which called the one you are in. The commands for doing this are: @table @asis @cindex debugger commands, @code{bt} (@code{backtrace}) @cindex debugger commands, @code{backtrace} @cindex @code{backtrace} debugger command @cindex @code{bt} debugger command (alias for @code{backtrace}) @item @code{backtrace} [@var{count}] @itemx @code{bt} [@var{count}] Print a backtrace of all function calls (stack frames), or innermost @var{count} frames if @var{count} > 0. Print the outermost @var{count} frames if @var{count} < 0. The backtrace displays the name and arguments to each function, the source @value{FN}, and the line number. @cindex debugger commands, @code{down} @cindex @code{down} debugger command @item @code{down} [@var{count}] Move @var{count} (default 1) frames down the stack toward the innermost frame. Then select and print the frame. @cindex debugger commands, @code{f} (@code{frame}) @cindex debugger commands, @code{frame} @cindex @code{frame} debugger command @cindex @code{f} debugger command (alias for @code{frame}) @item @code{frame} [@var{n}] @itemx @code{f} [@var{n}] Select and print (frame number, function and argument names, source file, and the source line) stack frame @var{n}. Frame 0 is the currently executing, or @dfn{innermost}, frame (function call), frame 1 is the frame that called the innermost one. The highest numbered frame is the one for the main program. @cindex debugger commands, @code{up} @cindex @code{up} debugger command @item @code{up} [@var{count}] Move @var{count} (default 1) frames up the stack toward the outermost frame. Then select and print the frame. @end table @node Dgawk Info @subsection Obtaining Information About The Program and The Debugger State Besides looking at the values of variables, there is often a need to get other sorts of information about the state of your program and of the debugging environment itself. @command{dgawk} has one command which provides this information, appropriately called @code{info}. @code{info} is used with one of a number of arguments that tell it exactly what you want to know: @table @asis @cindex debugger commands, @code{i} (@code{info}) @cindex debugger commands, @code{info} @cindex @code{info} debugger command @cindex @code{i} debugger command (alias for @code{info}) @item @code{info} @var{what} @itemx @code{i} @var{what} The value for @var{what} should be one of the following: @c nested table @table @code @item args Arguments of the selected frame. @item break List all currently set breakpoints. @item display List all items in the automatic display list. @item frame Description of the selected stack frame. @item functions List all function definitions including source file names and line numbers. @item locals Local variables of the selected frame. @item source The name of the current source file. Each time the program stops, the current source file is the file containing the current instruction. When @command{dgawk} first starts, the current source file is the first file included via the @option{-f} option. The @samp{list @var{filename}:@var{lineno}} command can be used at any time to change the current source. @item sources List all program sources. @item variables List all global variables. @item watch List all items in the watch list. @end table @end table Additional commands give you control over the debugger, the ability to save the debugger's state, and the ability to run debugger commands from a file. The commands are: @table @asis @cindex debugger commands, @code{o} (@code{option}) @cindex debugger commands, @code{option} @cindex @code{option} debugger command @cindex @code{o} debugger command (alias for @code{option}) @item @code{option} [@var{name}[@code{=}@var{value}]] @itemx @code{o} [@var{name}[@code{=}@var{value}]] Without an argument, display the available debugger options and their current values. @samp{option @var{name}} shows the current value of the named option. @samp{option @var{name}=@var{value}} assigns a new value to the named option. The available options are: @c nested table @table @code @item history_size The maximum number of lines to keep in the history file @file{./.dgawk_history}. The default is 100. @item listsize The number of lines that @code{list} prints. The default is 15. @item outfile Send @command{gawk} output to a file; debugger output still goes to standard output. An empty string (@code{""}) resets output to standard output. @item prompt The debugger prompt. The default is @samp{@w{dgawk> }}. @item save_history @r{[}on @r{|} off@r{]} Save command history to file @file{./.dgawk_history}. The default is @code{on}. @item save_options @r{[}on @r{|} off@r{]} Save current options to file @file{./.dgawkrc} upon exit. The default is @code{on}. Options are read back in to the next session upon startup. @item trace @r{[}on @r{|} off@r{]} Turn instruction tracing on or off. The default is @code{off}. @end table @item @code{save} @var{filename} Save the commands from the current session to the given @value{FN}, so that they can be replayed using the @command{source} command. @item @code{source} @var{filename} Run command(s) from a file; an error in any command does not terminate execution of subsequent commands. Comments (lines starting with @samp{#}) are allowed in a command file. Empty lines are ignored; they do @emph{not} repeat the last command. You can't restart the program by having more than one @code{run} command in the file. Also, the list of commands may include additional @code{source} commands; however, @command{dgawk} will not source the same file more than once in order to avoid infinite recursion. In addition to, or instead of the @code{source} command, you can use the @option{-R @var{file}} or @option{--command=@var{file}} command-line options to execute commands from a file non-interactively (@pxref{Options}. @end table @node Miscellaneous Dgawk Commands @subsection Miscellaneous Commands There are a few more commands which do not fit into the previous categories, as follows: @table @asis @cindex debugger commands, @code{dump} @cindex @code{dump} debugger command @item @code{dump} [@var{filename}] Dump bytecode of the program to standard output or to the file named in @var{filename}. This prints a representation of the internal instructions which @command{gawk} executes to implement the @command{awk} commands in a program. This can be very enlightening, as the following partial dump of Davide Brini's obfuscated code (@pxref{Signature Program}) demonstrates: @smallexample dgawk> @kbd{dump} @print{} # BEGIN @print{} @print{} [ 2:0x89faef4] Op_rule : [in_rule = BEGIN] [source_file = brini.awk] @print{} [ 3:0x89fa428] Op_push_i : "~" [PERM|STRING|STRCUR] @print{} [ 3:0x89fa464] Op_push_i : "~" [PERM|STRING|STRCUR] @print{} [ 3:0x89fa450] Op_match : @print{} [ 3:0x89fa3ec] Op_store_var : O [do_reference = FALSE] @print{} [ 4:0x89fa48c] Op_push_i : "==" [PERM|STRING|STRCUR] @print{} [ 4:0x89fa4c8] Op_push_i : "==" [PERM|STRING|STRCUR] @print{} [ 4:0x89fa4b4] Op_equal : @print{} [ 4:0x89fa400] Op_store_var : o [do_reference = FALSE] @print{} [ 5:0x89fa4f0] Op_push : o @print{} [ 5:0x89fa4dc] Op_plus_i : 0 [PERM|NUMCUR|NUMBER] @print{} [ 5:0x89fa414] Op_push_lhs : o [do_reference = TRUE] @print{} [ 5:0x89fa4a0] Op_assign_plus : @print{} [ :0x89fa478] Op_pop : @print{} [ 6:0x89fa540] Op_push : O @print{} [ 6:0x89fa554] Op_push_i : "" [PERM|STRING|STRCUR] @print{} [ :0x89fa5a4] Op_no_op : @print{} [ 6:0x89fa590] Op_push : O @print{} [ :0x89fa5b8] Op_concat : [expr_count = 3] [concat_flag = 0] @print{} [ 6:0x89fa518] Op_store_var : x [do_reference = FALSE] @print{} [ 7:0x89fa504] Op_push_loop : [target_continue = 0x89fa568] [target_break = 0x89fa680] @print{} [ 7:0x89fa568] Op_push_lhs : X [do_reference = TRUE] @print{} [ 7:0x89fa52c] Op_postincrement : @print{} [ 7:0x89fa5e0] Op_push : x @print{} [ 7:0x89fa61c] Op_push : o @print{} [ 7:0x89fa5f4] Op_plus : @print{} [ 7:0x89fa644] Op_push : o @print{} [ 7:0x89fa630] Op_plus : @print{} [ 7:0x89fa5cc] Op_leq : @print{} [ :0x89fa57c] Op_jmp_false : [target_jmp = 0x89fa680] @print{} [ 7:0x89fa694] Op_push_i : "%c" [PERM|STRING|STRCUR] @print{} [ :0x89fa6d0] Op_no_op : @print{} [ 7:0x89fa608] Op_assign_concat : c @print{} [ :0x89fa6a8] Op_jmp : [target_jmp = 0x89fa568] @print{} [ :0x89fa680] Op_pop_loop : @print{} @dots{} @print{} @print{} [ 8:0x89fa658] Op_K_printf : [expr_count = 17] [redir_type = ""] @print{} [ :0x89fa374] Op_no_op : @print{} [ :0x89fa3d8] Op_atexit : @print{} [ :0x89fa6bc] Op_stop : @print{} [ :0x89fa39c] Op_no_op : @print{} [ :0x89fa3b0] Op_after_beginfile : @print{} [ :0x89fa388] Op_no_op : @print{} [ :0x89fa3c4] Op_after_endfile : dgawk> @end smallexample @cindex debugger commands, @code{h} (@code{help}) @cindex debugger commands, @code{help} @cindex @code{help} debugger command @cindex @code{h} debugger command (alias for @code{help}) @item @code{help} @itemx @code{h} Print a list of all of the @command{dgawk} commands with a short summary of their usage. @samp{help @var{command}} prints the information about the command @var{command}. @cindex debugger commands, @code{l} (@code{list}) @cindex debugger commands, @code{list} @cindex @code{list} debugger command @cindex @code{l} debugger command (alias for @code{list}) @item @code{list} [@code{-} | @code{+} | @var{n} | @var{filename@code{:}n} | @var{n}--@var{m} | @var{function}] @itemx @code{l} [@code{-} | @code{+} | @var{n} | @var{filename@code{:}n} | @var{n}--@var{m} | @var{function}] Print the specified lines (default 15) from the current source file or the file named @var{filename}. The possible arguments to @code{list} are as follows: @c nested table @table @asis @item @code{-} Print lines before the lines last printed. @item @code{+} Print lines after the lines last printed. @code{list} without any argument does the same thing. @item @var{n} Print lines centered around line number @var{n}. @item @var{n}--@var{m} Print lines from @var{n} to @var{m}. @item @var{filename@code{:}n} Print lines centered around line number @var{n} in source file @var{filename}. This command may change the current source file. @item @var{function} Print lines centered around beginning of the function @var{function}. This command may change the current source file. @end table @cindex debugger commands, @code{q} (@code{quit}) @cindex debugger commands, @code{quit} @cindex @code{quit} debugger command @cindex @code{q} debugger command (alias for @code{quit}) @item @code{quit} @itemx @code{q} Exit the debugger. Debugging is great fun, but sometimes we all have to tend to other obligations in life, and sometimes we find the bug, and are free to go on to the next one! As we saw above, if you are running a program, @command{dgawk} warns you if you accidentally type @samp{q} or @samp{quit}, to make sure you really want to quit. @cindex debugger commands, @code{trace} @cindex @code{trace} debugger command @item @code{trace} @code{on} @r{|} @code{off} Turn on or off a continuous printing of instructions which are about to be executed, along with printing the @command{awk} line which they implement. The default is @code{off}. It is to be hoped that most of the ``opcodes'' in these instructions are fairly self-explanatory, and using @code{stepi} and @code{nexti} while @code{trace} is on will make them into familiar friends. @end table @node Readline Support @section Readline Support If @command{dgawk} is compiled with the @code{readline} library, you can take advantage of that library's command completion and history expansion features. The following types of completion are available: @table @asis @item Command completion Command names. @item Source @value{FN} completion Source @value{FN}s. Relevant commands are @code{break}, @code{clear}, @code{list}, @code{tbreak}, and @code{until}. @item Argument completion Non-numeric arguments to a command. Relevant commands are @code{enable} and @code{info}. @item Variable name completion Global variable names, and function arguments in the current context if the program is running. Relevant commands are @code{display}, @code{print}, @code{set}, and @code{watch}. @end table @node Dgawk Limitations @section Limitations and Future Plans We hope you find @command{dgawk} useful and enjoyable to work with, but as with any program, especially in its early releases, it still has some limitations. A few which are worth being aware of are: @itemize @bullet{} @item At this point, @command{dgawk} does not give a detailed explanation of what you did wrong when you type in something it doesn't like. Rather, it just responds @samp{syntax error}. When you do figure out what your mistake was, though, you'll feel like a real guru. @item If you perused the dump of opcodes in @ref{Miscellaneous Dgawk Commands}, (or if you are already familiar with @command{gawk} internals), you will realize that much of the internal manipulation of data in @command{gawk}, as in many interpreters, is done on a stack. @code{Op_push}, @code{Op_pop}, etc., are the ``bread and butter'' of most @command{gawk} code. Unfortunately, as of now, @command{dgawk} does not allow you to examine the stack's contents. That is, the intermediate results of expression evaluation are on the stack, but cannot be printed. Rather, only variables which are defined in the program can be printed. Of course, a workaround for this is to use more explicit variables at the debugging stage and then change back to obscure, perhaps more optimal code later. @item There is no way to look ``inside'' the process of compiling regular expressions to see if you got it right. As an @command{awk} programmer, you are expected to know what @code{/[^[:alnum:][:blank:]]/} means. @item @command{dgawk} is designed to be used by running a program (with all its parameters) on the command line, as described in @ref{dgawk invocation}. There is no way (as of now) to attach or ``break in'' to a running program. This seems reasonable for a language which is used mainly for quickly executing, short programs. @item @command{dgawk} only accepts source supplied with the @option{-f} option. @end itemize Look forward to a future release when these and other missing features may be added, and of course feel free to try to add them yourself! @ignore @c Try this @iftex @page @headings off @majorheading III@ @ @ Appendixes Part III provides the appendixes, the Glossary, and two licenses that cover the @command{gawk} source code and this @value{DOCUMENT}, respectively. It contains the following appendixes: @itemize @bullet @item @ref{Language History}. @item @ref{Installation}. @item @ref{Notes}. @item @ref{Basic Concepts}. @item @ref{Glossary}. @item @ref{Copying}. @item @ref{GNU Free Documentation License}. @end itemize @page @evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @| @oddheading @| @| @strong{@thischapter}@ @ @ @thispage @end iftex @end ignore @node Language History @appendix The Evolution of the @command{awk} Language This @value{DOCUMENT} describes the GNU implementation of @command{awk}, which follows the POSIX specification. Many long-time @command{awk} users learned @command{awk} programming with the original @command{awk} implementation in Version 7 Unix. (This implementation was the basis for @command{awk} in Berkeley Unix, through 4.3-Reno. Subsequent versions of Berkeley Unix, and some systems derived from 4.4BSD-Lite, use various versions of @command{gawk} for their @command{awk}.) This @value{CHAPTER} briefly describes the evolution of the @command{awk} language, with cross-references to other parts of the @value{DOCUMENT} where you can find more information. @c FIXME: Try to determine whether it was 3.1 or 3.2 that had new awk. @menu * V7/SVR3.1:: The major changes between V7 and System V Release 3.1. * SVR4:: Minor changes between System V Releases 3.1 and 4. * POSIX:: New features from the POSIX standard. * BTL:: New features from Brian Kernighan's version of @command{awk}. * POSIX/GNU:: The extensions in @command{gawk} not in POSIX @command{awk}. * Common Extensions:: Common Extensions Summary. * Ranges and Locales:: How locales used to affect regexp ranges. * Contributors:: The major contributors to @command{gawk}. @end menu @node V7/SVR3.1 @appendixsec Major Changes Between V7 and SVR3.1 @c STARTOFRANGE gawkv @cindex @command{awk}, versions of @c STARTOFRANGE gawkv1 @cindex @command{awk}, versions of, changes between V7 and SVR3.1 The @command{awk} language evolved considerably between the release of Version 7 Unix (1978) and the new version that was first made generally available in System V Release 3.1 (1987). This @value{SECTION} summarizes the changes, with cross-references to further details: @itemize @bullet @item The requirement for @samp{;} to separate rules on a line (@pxref{Statements/Lines}). @item User-defined functions and the @code{return} statement (@pxref{User-defined}). @item The @code{delete} statement (@pxref{Delete}). @item The @code{do}-@code{while} statement (@pxref{Do Statement}). @item The built-in functions @code{atan2()}, @code{cos()}, @code{sin()}, @code{rand()}, and @code{srand()} (@pxref{Numeric Functions}). @item The built-in functions @code{gsub()}, @code{sub()}, and @code{match()} (@pxref{String Functions}). @item The built-in functions @code{close()} and @code{system()} (@pxref{I/O Functions}). @item The @code{ARGC}, @code{ARGV}, @code{FNR}, @code{RLENGTH}, @code{RSTART}, and @code{SUBSEP} built-in variables (@pxref{Built-in Variables}). @item Assignable @code{$0} (@pxref{Changing Fields}). @item The conditional expression using the ternary operator @samp{?:} (@pxref{Conditional Exp}). @item The expression @samp{@var{index-variable} in @var{array}} outside of @code{for} statements (@pxref{Reference to Elements}). @item The exponentiation operator @samp{^} (@pxref{Arithmetic Ops}) and its assignment operator form @samp{^=} (@pxref{Assignment Ops}). @item C-compatible operator precedence, which breaks some old @command{awk} programs (@pxref{Precedence}). @item Regexps as the value of @code{FS} (@pxref{Field Separators}) and as the third argument to the @code{split()} function (@pxref{String Functions}), rather than using only the first character of @code{FS}. @item Dynamic regexps as operands of the @samp{~} and @samp{!~} operators (@pxref{Regexp Usage}). @item The escape sequences @samp{\b}, @samp{\f}, and @samp{\r} (@pxref{Escape Sequences}). (Some vendors have updated their old versions of @command{awk} to recognize @samp{\b}, @samp{\f}, and @samp{\r}, but this is not something you can rely on.) @item Redirection of input for the @code{getline} function (@pxref{Getline}). @item Multiple @code{BEGIN} and @code{END} rules (@pxref{BEGIN/END}). @item Multidimensional arrays (@pxref{Multi-dimensional}). @end itemize @c ENDOFRANGE gawkv1 @node SVR4 @appendixsec Changes Between SVR3.1 and SVR4 @cindex @command{awk}, versions of, changes between SVR3.1 and SVR4 The System V Release 4 (1989) version of Unix @command{awk} added these features (some of which originated in @command{gawk}): @itemize @bullet @item The @code{ENVIRON} array (@pxref{Built-in Variables}). @c gawk and MKS awk @item Multiple @option{-f} options on the command line (@pxref{Options}). @c MKS awk @item The @option{-v} option for assigning variables before program execution begins (@pxref{Options}). @c GNU, Bell Laboratories & MKS together @item The @option{--} option for terminating command-line options. @item The @samp{\a}, @samp{\v}, and @samp{\x} escape sequences (@pxref{Escape Sequences}). @c GNU, for ANSI C compat @item A defined return value for the @code{srand()} built-in function (@pxref{Numeric Functions}). @item The @code{toupper()} and @code{tolower()} built-in string functions for case translation (@pxref{String Functions}). @item A cleaner specification for the @samp{%c} format-control letter in the @code{printf} function (@pxref{Control Letters}). @item The ability to dynamically pass the field width and precision (@code{"%*.*d"}) in the argument list of the @code{printf} function (@pxref{Control Letters}). @item The use of regexp constants, such as @code{/foo/}, as expressions, where they are equivalent to using the matching operator, as in @samp{$0 ~ /foo/} (@pxref{Using Constant Regexps}). @item Processing of escape sequences inside command-line variable assignments (@pxref{Assignment Options}). @end itemize @node POSIX @appendixsec Changes Between SVR4 and POSIX @command{awk} @cindex @command{awk}, versions of, changes between SVR4 and POSIX @command{awk} @cindex POSIX @command{awk}, changes in @command{awk} versions The POSIX Command Language and Utilities standard for @command{awk} (1992) introduced the following changes into the language: @itemize @bullet @item The use of @option{-W} for implementation-specific options (@pxref{Options}). @item The use of @code{CONVFMT} for controlling the conversion of numbers to strings (@pxref{Conversion}). @item The concept of a numeric string and tighter comparison rules to go with it (@pxref{Typing and Comparison}). @item The use of built-in variables as function parameter names is forbidden (@pxref{Definition Syntax}. @item More complete documentation of many of the previously undocumented features of the language. @end itemize @xref{Common Extensions}, for a list of common extensions not permitted by the POSIX standard. The 2008 POSIX standard can be found online at @url{http://www.opengroup.org/onlinepubs/9699919799/}. @c ENDOFRANGE gawkv @node BTL @appendixsec Extensions in Brian Kernighan's @command{awk} @cindex @command{awk}, versions of, See Also Brian Kernighan's @command{awk} @cindex extensions, Brian Kernighan's @command{awk} @cindex Brian Kernighan's @command{awk}, extensions @cindex Kernighan, Brian Brian Kernighan has made his version available via his home page (@pxref{Other Versions}). This @value{SECTION} describes common extensions that originally appeared in his version of @command{awk}. @itemize @bullet @item The @samp{**} and @samp{**=} operators (@pxref{Arithmetic Ops} and @ref{Assignment Ops}). @item The use of @code{func} as an abbreviation for @code{function} (@pxref{Definition Syntax}). @item The @code{fflush()} built-in function for flushing buffered output (@pxref{I/O Functions}). @ignore @item The @code{SYMTAB} array, that allows access to @command{awk}'s internal symbol table. This feature is not documented, largely because it is somewhat shakily implemented. For instance, you cannot access arrays or array elements through it. @end ignore @end itemize @xref{Common Extensions}, for a full list of the extensions available in his @command{awk}. @node POSIX/GNU @appendixsec Extensions in @command{gawk} Not in POSIX @command{awk} @c STARTOFRANGE fripls @cindex compatibility mode (@command{gawk}), extensions @c STARTOFRANGE exgnot @cindex extensions, in @command{gawk}, not in POSIX @command{awk} @c STARTOFRANGE posnot @cindex POSIX, @command{gawk} extensions not included in The GNU implementation, @command{gawk}, adds a large number of features. They can all be disabled with either the @option{--traditional} or @option{--posix} options (@pxref{Options}). A number of features have come and gone over the years. This @value{SECTION} summarizes the additional features over POSIX @command{awk} that are in the current version of @command{gawk}. @itemize @bullet @item Additional built-in variables: @itemize @minus @item The @code{ARGIND} @code{BINMODE}, @code{ERRNO}, @code{FIELDWIDTHS}, @code{FPAT}, @code{IGNORECASE}, @code{LINT}, @code{PROCINFO}, @code{RT}, and @code{TEXTDOMAIN} variables (@pxref{Built-in Variables}). @end itemize @item Special files in I/O redirections: @itemize @minus{} @item The @file{/dev/stdin}, @file{/dev/stdout}, @file{/dev/stderr} and @file{/dev/fd/@var{N}} special @value{FN}s (@pxref{Special Files}). @item The @file{/inet}, @file{/inet4}, and @samp{/inet6} special files for TCP/IP networking using @samp{|&} to specify which version of the IP protocol to use. (@pxref{TCP/IP Networking}). @end itemize @item Changes and/or additions to the language: @itemize @minus{} @item The @samp{\x} escape sequence (@pxref{Escape Sequences}). @item Full support for both POSIX and GNU regexps (@pxref{Regexp}). @item The ability for @code{FS} and for the third argument to @code{split()} to be null strings (@pxref{Single Character Fields}). @item The ability for @code{RS} to be a regexp (@pxref{Records}). @item The ability to use octal and hexadecimal constants in @command{awk} program source code (@pxref{Nondecimal-numbers}). @item The @samp{|&} operator for two-way I/O to a coprocess (@pxref{Two-way I/O}). @item Indirect function calls (@pxref{Indirect Calls}). @item Directories on the command line produce a warning and are skipped (@pxref{Command line directories}). @end itemize @item New keywords: @itemize @minus{} @item The @code{BEGINFILE} and @code{ENDFILE} special patterns. (@pxref{BEGINFILE/ENDFILE}). @item The ability to delete all of an array at once with @samp{delete @var{array}} (@pxref{Delete}). @item The @code{nextfile} statement (@pxref{Nextfile Statement}). @item The @code{switch} statement (@pxref{Switch Statement}). @end itemize @item Changes to standard @command{awk} functions: @itemize @minus @item The optional second argument to @code{close()} that allows closing one end of a two-way pipe to a coprocess (@pxref{Two-way I/O}). @item POSIX compliance for @code{gsub()} and @code{sub()}. @item The @code{length()} function accepts an array argument and returns the number of elements in the array (@pxref{String Functions}). @item The optional third argument to the @code{match()} function for capturing text-matching subexpressions within a regexp (@pxref{String Functions}). @item Positional specifiers in @code{printf} formats for making translations easier (@pxref{Printf Ordering}). @item The @code{split()} function's additional optional fourth argument which is an array to hold the text of the field separators. (@pxref{String Functions}). @end itemize @item Additional functions only in @command{gawk}: @itemize @minus @item The @code{and()}, @code{compl()}, @code{lshift()}, @code{or()}, @code{rshift()}, and @code{xor()} functions for bit manipulation (@pxref{Bitwise Functions}). @item The @code{asort()} and @code{asorti()} functions for sorting arrays (@pxref{Array Sorting}). @item The @code{bindtextdomain()}, @code{dcgettext()} and @code{dcngettext()} functions for internationalization (@pxref{Programmer i18n}). @item The @code{extension()} built-in function and the ability to add new functions dynamically (@pxref{Dynamic Extensions}). @item The @code{fflush()} function from Brian Kernighan's version of @command{awk} (@pxref{I/O Functions}). @item The @code{gensub()}, @code{patsplit()}, and @code{strtonum()} functions for more powerful text manipulation (@pxref{String Functions}). @item The @code{mktime()}, @code{systime()}, and @code{strftime()} functions for working with timestamps (@pxref{Time Functions}). @end itemize @item Changes and/or additions in the command-line options: @itemize @minus @item The @env{AWKPATH} environment variable for specifying a path search for the @option{-f} command-line option (@pxref{Options}). @item The ability to use GNU-style long-named options that start with @option{--} and the @option{--characters-as-bytes}, @option{--compat}, @option{--dump-variables}, @option{--exec}, @option{--gen-pot}, @option{--lint}, @option{--lint-old}, @option{--non-decimal-data}, @option{--posix}, @option{--profile}, @option{--re-interval}, @option{--sandbox}, @option{--source}, @option{--traditional}, and @option{--use-lc-numeric} options (@pxref{Options}). @end itemize @c new ports @item Support for the following obsolete systems was removed from the code and the documentation for @command{gawk} @value{PVERSION} 4.0: @c nested table @itemize @minus @item Amiga @item Atari @item BeOS @item Cray @item MIPS RiscOS @item MS-DOS with the Microsoft Compiler @item MS-Windows with the Microsoft Compiler @item NeXT @item SunOS 3.x, Sun 386 (Road Runner) @item Tandem (non-POSIX) @item Prestandard VAX C compiler for VAX/VMS @end itemize @end itemize @c XXX ADD MORE STUFF HERE @c ENDOFRANGE fripls @c ENDOFRANGE exgnot @c ENDOFRANGE posnot @node Common Extensions @appendixsec Common Extensions Summary This @value{SECTION} summarizes the common extensions supported by @command{gawk}, Brian Kernighan's @command{awk}, and @command{mawk}, the three most widely-used freely available versions of @command{awk} (@pxref{Other Versions}). @multitable {@file{/dev/stderr} special file} {BWK Awk} {Mawk} {GNU Awk} @headitem Feature @tab BWK Awk @tab Mawk @tab GNU Awk @item @samp{\x} Escape sequence @tab X @tab X @tab X @item @code{RS} as regexp @tab @tab X @tab X @item @code{FS} as null string @tab X @tab X @tab X @item @file{/dev/stdin} special file @tab X @tab @tab X @item @file{/dev/stdout} special file @tab X @tab X @tab X @item @file{/dev/stderr} special file @tab X @tab X @tab X @item @code{**} and @code{**=} operators @tab X @tab @tab X @item @code{func} keyword @tab X @tab @tab X @item @code{nextfile} statement @tab X @tab X @tab X @item @code{delete} without subscript @tab X @tab X @tab X @item @code{length()} of an array @tab X @tab @tab X @item @code{fflush()} function @tab X @tab X @tab X @item @code{BINMODE} variable @tab @tab X @tab X @end multitable @node Ranges and Locales @appendixsec Regexp Ranges and Locales: A Long Sad Story This @value{SECTION} describes the confusing history of ranges within regular expressions and their interactions with locales, and how this affected different versions of @command{gawk}. The original Unix tools that worked with regular expressions defined character ranges (such as @samp{[a-z]}) to match any character between the first character in the range and the last character in the range, inclusive. Ordering was based on the numeric value of each character in the machine's native character set. Thus, on ASCII-based systems, @code{[a-z]} matched all the lowercase letters, and only the lowercase letters, since the numeric values for the letters from @samp{a} through @samp{z} were contiguous. (On an EBCDIC system, the range @samp{[a-z]} includes additional, non-alphabetic characters as well.) Almost all introductory Unix literature explained range expressions as working in this fashion, and in particular, would teach that the ``correct'' way to match lowercase letters was with @samp{[a-z]}, and that @samp{[A-Z]} was the ``correct'' way to match uppercase letters. And indeed, this was true. The 1993 POSIX standard introduced the idea of locales (@pxref{Locales}). Since many locales include other letters besides the plain twenty-six letters of the American English alphabet, the POSIX standard added character classes (@pxref{Bracket Expressions}) as a way to match different kinds of characters besides the traditional ones in the ASCII character set. However, the standard @emph{changed} the interpretation of range expressions. In the @code{"C"} and @code{"POSIX"} locales, a range expression like @samp{[a-dx-z]} is still equivalent to @samp{[abcdxyz]}, as in ASCII. But outside those locales, the ordering was defined to be based on @dfn{collation order}. In many locales, @samp{A} and @samp{a} are both less than @samp{B}. In other words, these locales sort characters in dictionary order, and @samp{[a-dx-z]} is typically not equivalent to @samp{[abcdxyz]}; instead it might be equivalent to @samp{[aBbCcdXxYyz]}, for example. This point needs to be emphasized: Much literature teaches that you should use @samp{[a-z]} to match a lowercase character. But on systems with non-ASCII locales, this also matched all of the uppercase characters except @samp{Z}! This was a continuous cause of confusion, even well into the twenty-first century. To demonstrate these issues, the following example uses the @code{sub()} function, which does text replacement (@pxref{String Functions}). Here, the intent is to remove trailing uppercase characters: @example $ @kbd{echo something1234abc | gawk-3.1.8 '@{ sub("[A-Z]*$", ""); print @}'} @print{} something1234a @end example @noindent This output is unexpected, since the @samp{bc} at the end of @samp{something1234abc} should not normally match @samp{[A-Z]*}. This result is due to the locale setting (and thus you may not see it on your system). Similar considerations apply to other ranges. For example, @samp{["-/]} is perfectly valid in ASCII, but is not valid in many Unicode locales, such as @samp{en_US.UTF-8}. Early versions of @command{gawk} used regexp matching code that was not locale aware, so ranges had their traditional interpretation. When @command{gawk} switched to using locale-aware regexp matchers, the problems began; especially as both GNU/Linux and commercial Unix vendors started implementing non-ASCII locales, @emph{and making them the default}. Perhaps the most frequently asked question became something like ``why does @code{[A-Z]} match lowercase letters?!?'' This situation existed for close to 10 years, if not more, and the @command{gawk} maintainer grew weary of trying to explain that @command{gawk} was being nicely standards-compliant, and that the issue was in the user's locale. During the development of version 4.0, he modified @command{gawk} to always treat ranges in the original, pre-POSIX fashion, unless @option{--posix} was used (@pxref{Options}). Fortunately, shortly before the final release of @command{gawk} 4.0, the maintainer learned that the 2008 standard had changed the definition of ranges, such that outside the @code{"C"} and @code{"POSIX"} locales, the meaning of range expressions was @emph{undefined}.@footnote{See @uref{http://pubs.opengroup.org/onlinepubs/9699919799/basedefs/V1_chap09.html#tag_09_03_05, the standard} and @uref{http://pubs.opengroup.org/onlinepubs/9699919799/xrat/V4_xbd_chap09.html#tag_21_09_03_05, its rationale}.} By using this lovely technical term, the standard gives license to implementors to implement ranges in whatever way they choose. The @command{gawk} maintainer chose to apply the pre-POSIX meaning in all cases: the default regexp matching; with @option{--traditional}, and with @option{--posix}; in all cases, @command{gawk} remains POSIX compliant. @node Contributors @appendixsec Major Contributors to @command{gawk} @cindex @command{gawk}, list of contributors to @quotation @i{Always give credit where credit is due.}@* Anonymous @end quotation This @value{SECTION} names the major contributors to @command{gawk} and/or this @value{DOCUMENT}, in approximate chronological order: @itemize @bullet @item @cindex Aho, Alfred @cindex Weinberger, Peter @cindex Kernighan, Brian Dr.@: Alfred V.@: Aho, Dr.@: Peter J.@: Weinberger, and Dr.@: Brian W.@: Kernighan, all of Bell Laboratories, designed and implemented Unix @command{awk}, from which @command{gawk} gets the majority of its feature set. @item @cindex Rubin, Paul Paul Rubin did the initial design and implementation in 1986, and wrote the first draft (around 40 pages) of this @value{DOCUMENT}. @item @cindex Fenlason, Jay Jay Fenlason finished the initial implementation. @item @cindex Close, Diane Diane Close revised the first draft of this @value{DOCUMENT}, bringing it to around 90 pages. @item @cindex Stallman, Richard Richard Stallman helped finish the implementation and the initial draft of this @value{DOCUMENT}. He is also the founder of the FSF and the GNU project. @item @cindex Woods, John John Woods contributed parts of the code (mostly fixes) in the initial version of @command{gawk}. @item @cindex Trueman, David In 1988, David Trueman took over primary maintenance of @command{gawk}, making it compatible with ``new'' @command{awk}, and greatly improving its performance. @item @cindex Kwok, Conrad @cindex Garfinkle, Scott @cindex Williams, Kent Conrad Kwok, Scott Garfinkle, and Kent Williams did the initial ports to MS-DOS with various versions of MSC. @item @cindex Rankin, Pat Pat Rankin provided the VMS port and its documentation. @item @cindex Peterson, Hal Hal Peterson provided help in porting @command{gawk} to Cray systems. (This is no longer supported.) @item @cindex Rommel, Kai Uwe Kai Uwe Rommel provided the initial port to OS/2 and its documentation. @item @cindex Jaegermann, Michal Michal Jaegermann provided the port to Atari systems and its documentation. (This port is no longer supported.) He continues to provide portability checking with DEC Alpha systems, and has done a lot of work to make sure @command{gawk} works on non-32-bit systems. @item @cindex Fish, Fred Fred Fish provided the port to Amiga systems and its documentation. (With Fred's sad passing, this is no longer supported.) @item @cindex Deifik, Scott Scott Deifik currently maintains the MS-DOS port using DJGPP. @item @cindex Zaretskii, Eli Eli Zaretskii currently maintains the MS-Windows port using MinGW. @item @cindex Grigera, Juan Juan Grigera provided a port to Windows32 systems. (This is no longer supported.) @item @cindex Hankerson, Darrel For many years, Dr.@: Darrel Hankerson acted as coordinator for the various ports to different PC platforms and created binary distributions for various PC operating systems. He was also instrumental in keeping the documentation up to date for the various PC platforms. @item @cindex Zoulas, Christos Christos Zoulas provided the @code{extension()} built-in function for dynamically adding new modules. @item @cindex Kahrs, J@"urgen J@"urgen Kahrs contributed the initial version of the TCP/IP networking code and documentation, and motivated the inclusion of the @samp{|&} operator. @item @cindex Davies, Stephen Stephen Davies provided the initial port to Tandem systems and its documentation. (However, this is no longer supported.) He was also instrumental in the initial work to integrate the byte-code internals into the @command{gawk} code base. @item @cindex Woehlke, Matthew Matthew Woehlke provided improvements for Tandem's POSIX-compliant systems. @item @cindex Brown, Martin Martin Brown provided the port to BeOS and its documentation. (This is no longer supported.) @item @cindex Peters, Arno Arno Peters did the initial work to convert @command{gawk} to use GNU Automake and GNU @code{gettext}. @item @cindex Broder, Alan J.@: Alan J.@: Broder provided the initial version of the @code{asort()} function as well as the code for the optional third argument to the @code{match()} function. @item @cindex Buening, Andreas Andreas Buening updated the @command{gawk} port for OS/2. @item @cindex Hasegawa, Isamu Isamu Hasegawa, of IBM in Japan, contributed support for multibyte characters. @item @cindex Benzinger, Michael Michael Benzinger contributed the initial code for @code{switch} statements. @item @cindex McPhee, Patrick Patrick T.J.@: McPhee contributed the code for dynamic loading in Windows32 environments. (This is no longer supported) @item @cindex Haque, John John Haque reworked the @command{gawk} internals to use a byte-code engine, providing the @command{dgawk} debugger for @command{awk} programs. @item @cindex Yawitz, Efraim Efraim Yawitz contributed the original text for @ref{Debugger}. @item @cindex Robbins, Arnold Arnold Robbins has been working on @command{gawk} since 1988, at first helping David Trueman, and as the primary maintainer since around 1994. @end itemize @node Installation @appendix Installing @command{gawk} @c last two commas are part of see also @cindex operating systems, See Also GNU/Linux, PC operating systems, Unix @c STARTOFRANGE gligawk @cindex @command{gawk}, installing @c STARTOFRANGE ingawk @cindex installing @command{gawk} This appendix provides instructions for installing @command{gawk} on the various platforms that are supported by the developers. The primary developer supports GNU/Linux (and Unix), whereas the other ports are contributed. @xref{Bugs}, for the electronic mail addresses of the people who did the respective ports. @menu * Gawk Distribution:: What is in the @command{gawk} distribution. * Unix Installation:: Installing @command{gawk} under various versions of Unix. * Non-Unix Installation:: Installation on Other Operating Systems. * Bugs:: Reporting Problems and Bugs. * Other Versions:: Other freely available @command{awk} implementations. @end menu @node Gawk Distribution @appendixsec The @command{gawk} Distribution @cindex source code, @command{gawk} This @value{SECTION} describes how to get the @command{gawk} distribution, how to extract it, and then what is in the various files and subdirectories. @menu * Getting:: How to get the distribution. * Extracting:: How to extract the distribution. * Distribution contents:: What is in the distribution. @end menu @node Getting @appendixsubsec Getting the @command{gawk} Distribution @cindex @command{gawk}, source code@comma{} obtaining There are three ways to get GNU software: @itemize @bullet @item Copy it from someone else who already has it. @cindex FSF (Free Software Foundation) @cindex Free Software Foundation (FSF) @item Retrieve @command{gawk} from the Internet host @code{ftp.gnu.org}, in the directory @file{/gnu/gawk}. Both anonymous @command{ftp} and @code{http} access are supported. If you have the @command{wget} program, you can use a command like the following: @example wget http://ftp.gnu.org/gnu/gawk/gawk-@value{VERSION}.@value{PATCHLEVEL}.tar.gz @end example @end itemize The GNU software archive is mirrored around the world. The up-to-date list of mirror sites is available from @uref{http://www.gnu.org/order/ftp.html, the main FSF web site}. Try to use one of the mirrors; they will be less busy, and you can usually find one closer to your site. @node Extracting @appendixsubsec Extracting the Distribution @command{gawk} is distributed as several @code{tar} files compressed with different compression programs: @command{gzip}, @command{bzip2}, and @command{xz}. For simplicity, the rest of these instructions assume you are using the one compressed with the GNU Zip program, @code{gzip}. Once you have the distribution (for example, @file{gawk-@value{VERSION}.@value{PATCHLEVEL}.tar.gz}), use @code{gzip} to expand the file and then use @code{tar} to extract it. You can use the following pipeline to produce the @command{gawk} distribution: @example # Under System V, add 'o' to the tar options gzip -d -c gawk-@value{VERSION}.@value{PATCHLEVEL}.tar.gz | tar -xvpf - @end example On a system with GNU @command{tar}, you can let @command{tar} do the decompression for you: @example tar -xvpzf gawk-@value{VERSION}.@value{PATCHLEVEL}.tar.gz @end example @noindent Extracting the archive creates a directory named @file{gawk-@value{VERSION}.@value{PATCHLEVEL}} in the current directory. The distribution @value{FN} is of the form @file{gawk-@var{V}.@var{R}.@var{P}.tar.gz}. The @var{V} represents the major version of @command{gawk}, the @var{R} represents the current release of version @var{V}, and the @var{P} represents a @dfn{patch level}, meaning that minor bugs have been fixed in the release. The current patch level is @value{PATCHLEVEL}, but when retrieving distributions, you should get the version with the highest version, release, and patch level. (Note, however, that patch levels greater than or equal to 70 denote ``beta'' or nonproduction software; you might not want to retrieve such a version unless you don't mind experimenting.) If you are not on a Unix or GNU/Linux system, you need to make other arrangements for getting and extracting the @command{gawk} distribution. You should consult a local expert. @node Distribution contents @appendixsubsec Contents of the @command{gawk} Distribution @c STARTOFRANGE gawdis @cindex @command{gawk}, distribution The @command{gawk} distribution has a number of C source files, documentation files, subdirectories, and files related to the configuration process (@pxref{Unix Installation}), as well as several subdirectories related to different non-Unix operating systems: @table @asis @item Various @samp{.c}, @samp{.y}, and @samp{.h} files The actual @command{gawk} source code. @end table @table @file @item README @itemx README_d/README.* Descriptive files: @file{README} for @command{gawk} under Unix and the rest for the various hardware and software combinations. @item INSTALL A file providing an overview of the configuration and installation process. @item ChangeLog A detailed list of source code changes as bugs are fixed or improvements made. @item ChangeLog.0 An older list of source code changes. @item NEWS A list of changes to @command{gawk} since the last release or patch. @item NEWS.0 An older list of changes to @command{gawk}. @item COPYING The GNU General Public License. @item FUTURES A brief list of features and changes being contemplated for future releases, with some indication of the time frame for the feature, based on its difficulty. @item LIMITATIONS A list of those factors that limit @command{gawk}'s performance. Most of these depend on the hardware or operating system software and are not limits in @command{gawk} itself. @item POSIX.STD A description of behaviors in the POSIX standard for @command{awk} which are left undefined, or where @command{gawk} may not comply fully, as well as a list of things that the POSIX standard should describe but does not. @cindex artificial intelligence@comma{} @command{gawk} and @item doc/awkforai.txt A short article describing why @command{gawk} is a good language for Artificial Intelligence (AI) programming. @item doc/bc_notes A brief description of @command{gawk}'s ``byte code'' internals. @item doc/README.card @itemx doc/ad.block @itemx doc/awkcard.in @itemx doc/cardfonts @itemx doc/colors @itemx doc/macros @itemx doc/no.colors @itemx doc/setter.outline The @command{troff} source for a five-color @command{awk} reference card. A modern version of @command{troff} such as GNU @command{troff} (@command{groff}) is needed to produce the color version. See the file @file{README.card} for instructions if you have an older @command{troff}. @item doc/gawk.1 The @command{troff} source for a manual page describing @command{gawk}. This is distributed for the convenience of Unix users. @cindex Texinfo @item doc/gawk.texi The Texinfo source file for this @value{DOCUMENT}. It should be processed with @TeX{} (via @command{texi2dvi} or @command{texi2pdf}) to produce a printed document, and with @command{makeinfo} to produce an Info or HTML file. @item doc/gawk.info The generated Info file for this @value{DOCUMENT}. @item doc/gawkinet.texi The Texinfo source file for @ifinfo @inforef{Top, , General Introduction, gawkinet, TCP/IP Internetworking with @command{gawk}}. @end ifinfo @ifnotinfo @cite{TCP/IP Internetworking with @command{gawk}}. @end ifnotinfo It should be processed with @TeX{} (via @command{texi2dvi} or @command{texi2pdf}) to produce a printed document and with @command{makeinfo} to produce an Info or HTML file. @item doc/gawkinet.info The generated Info file for @cite{TCP/IP Internetworking with @command{gawk}}. @item doc/igawk.1 The @command{troff} source for a manual page describing the @command{igawk} program presented in @ref{Igawk Program}. @item doc/Makefile.in The input file used during the configuration process to generate the actual @file{Makefile} for creating the documentation. @item Makefile.am @itemx */Makefile.am Files used by the GNU @command{automake} software for generating the @file{Makefile.in} files used by @command{autoconf} and @command{configure}. @item Makefile.in @itemx aclocal.m4 @itemx configh.in @itemx configure.ac @itemx configure @itemx custom.h @itemx missing_d/* @itemx m4/* These files and subdirectories are used when configuring @command{gawk} for various Unix systems. They are explained in @ref{Unix Installation}. @item po/* The @file{po} library contains message translations. @item awklib/extract.awk @itemx awklib/Makefile.am @itemx awklib/Makefile.in @itemx awklib/eg/* The @file{awklib} directory contains a copy of @file{extract.awk} (@pxref{Extract Program}), which can be used to extract the sample programs from the Texinfo source file for this @value{DOCUMENT}. It also contains a @file{Makefile.in} file, which @command{configure} uses to generate a @file{Makefile}. @file{Makefile.am} is used by GNU Automake to create @file{Makefile.in}. The library functions from @ref{Library Functions}, and the @command{igawk} program from @ref{Igawk Program}, are included as ready-to-use files in the @command{gawk} distribution. They are installed as part of the installation process. The rest of the programs in this @value{DOCUMENT} are available in appropriate subdirectories of @file{awklib/eg}. @item posix/* Files needed for building @command{gawk} on POSIX-compliant systems. @item pc/* Files needed for building @command{gawk} under MS-Windows and OS/2 (@pxref{PC Installation}, for details). @item vms/* Files needed for building @command{gawk} under VMS (@pxref{VMS Installation}, for details). @item test/* A test suite for @command{gawk}. You can use @samp{make check} from the top-level @command{gawk} directory to run your version of @command{gawk} against the test suite. If @command{gawk} successfully passes @samp{make check}, then you can be confident of a successful port. @end table @c ENDOFRANGE gawdis @node Unix Installation @appendixsec Compiling and Installing @command{gawk} on Unix-like Systems Usually, you can compile and install @command{gawk} by typing only two commands. However, if you use an unusual system, you may need to configure @command{gawk} for your system yourself. @menu * Quick Installation:: Compiling @command{gawk} under Unix. * Additional Configuration Options:: Other compile-time options. * Configuration Philosophy:: How it's all supposed to work. @end menu @node Quick Installation @appendixsubsec Compiling @command{gawk} for Unix-like Systems The normal installation steps should work on all modern commercial Unix-derived systems, GNU/Linux, BSD-based systems, and the Cygwin environment for MS-Windows. After you have extracted the @command{gawk} distribution, @command{cd} to @file{gawk-@value{VERSION}.@value{PATCHLEVEL}}. Like most GNU software, @command{gawk} is configured automatically for your system by running the @command{configure} program. This program is a Bourne shell script that is generated automatically using GNU @command{autoconf}. @ifnotinfo (The @command{autoconf} software is described fully in @cite{Autoconf---Generating Automatic Configuration Scripts}, which can be found online at @uref{http://www.gnu.org/software/autoconf/manual/index.html, the Free Software Foundation's web site}.) @end ifnotinfo @ifinfo (The @command{autoconf} software is described fully starting with @inforef{Top, , Autoconf, autoconf,Autoconf---Generating Automatic Configuration Scripts}.) @end ifinfo To configure @command{gawk}, simply run @command{configure}: @example sh ./configure @end example This produces a @file{Makefile} and @file{config.h} tailored to your system. The @file{config.h} file describes various facts about your system. You might want to edit the @file{Makefile} to change the @code{CFLAGS} variable, which controls the command-line options that are passed to the C compiler (such as optimization levels or compiling for debugging). Alternatively, you can add your own values for most @command{make} variables on the command line, such as @code{CC} and @code{CFLAGS}, when running @command{configure}: @example CC=cc CFLAGS=-g sh ./configure @end example @noindent See the file @file{INSTALL} in the @command{gawk} distribution for all the details. After you have run @command{configure} and possibly edited the @file{Makefile}, type: @example make @end example @noindent Shortly thereafter, you should have an executable version of @command{gawk}. That's all there is to it! To verify that @command{gawk} is working properly, run @samp{make check}. All of the tests should succeed. If these steps do not work, or if any of the tests fail, check the files in the @file{README_d} directory to see if you've found a known problem. If the failure is not described there, please send in a bug report (@pxref{Bugs}). @node Additional Configuration Options @appendixsubsec Additional Configuration Options @cindex @command{gawk}, configuring, options @cindex configuration options@comma{} @command{gawk} There are several additional options you may use on the @command{configure} command line when compiling @command{gawk} from scratch, including: @table @code @cindex @code{--disable-lint} configuration option @cindex configuration option, @code{--disable-lint} @item --disable-lint Disable all lint checking within @code{gawk}. The @option{--lint} and @option{--lint-old} options (@pxref{Options}) are accepted, but silently do nothing. Similarly, setting the @code{LINT} variable (@pxref{User-modified}) has no effect on the running @command{awk} program. When used with GCC's automatic dead-code-elimination, this option cuts almost 200K bytes off the size of the @command{gawk} executable on GNU/Linux x86 systems. Results on other systems and with other compilers are likely to vary. Using this option may bring you some slight performance improvement. Using this option will cause some of the tests in the test suite to fail. This option may be removed at a later date. @cindex @code{--disable-nls} configuration option @cindex configuration option, @code{--disable-nls} @item --disable-nls Disable all message-translation facilities. This is usually not desirable, but it may bring you some slight performance improvement. @cindex @code{--with-whiny-user-strftime} configuration option @cindex configuration option, @code{--with-whiny-user-strftime} @item --with-whiny-user-strftime Force use of the included version of the @code{strftime()} function for deficient systems. @end table Use the command @samp{./configure --help} to see the full list of options that @command{configure} supplies. @node Configuration Philosophy @appendixsubsec The Configuration Process @cindex @command{gawk}, configuring This @value{SECTION} is of interest only if you know something about using the C language and Unix-like operating systems. The source code for @command{gawk} generally attempts to adhere to formal standards wherever possible. This means that @command{gawk} uses library routines that are specified by the ISO C standard and by the POSIX operating system interface standard. The @command{gawk} source code requires using an ISO C compiler (the 1990 standard). Many Unix systems do not support all of either the ISO or the POSIX standards. The @file{missing_d} subdirectory in the @command{gawk} distribution contains replacement versions of those functions that are most likely to be missing. The @file{config.h} file that @command{configure} creates contains definitions that describe features of the particular operating system where you are attempting to compile @command{gawk}. The three things described by this file are: what header files are available, so that they can be correctly included, what (supposedly) standard functions are actually available in your C libraries, and various miscellaneous facts about your operating system. For example, there may not be an @code{st_blksize} element in the @code{stat} structure. In this case, @samp{HAVE_ST_BLKSIZE} is undefined. @cindex @code{custom.h} file It is possible for your C compiler to lie to @command{configure}. It may do so by not exiting with an error when a library function is not available. To get around this, edit the file @file{custom.h}. Use an @samp{#ifdef} that is appropriate for your system, and either @code{#define} any constants that @command{configure} should have defined but didn't, or @code{#undef} any constants that @command{configure} defined and should not have. @file{custom.h} is automatically included by @file{config.h}. It is also possible that the @command{configure} program generated by @command{autoconf} will not work on your system in some other fashion. If you do have a problem, the file @file{configure.ac} is the input for @command{autoconf}. You may be able to change this file and generate a new version of @command{configure} that works on your system (@pxref{Bugs}, for information on how to report problems in configuring @command{gawk}). The same mechanism may be used to send in updates to @file{configure.ac} and/or @file{custom.h}. @node Non-Unix Installation @appendixsec Installation on Other Operating Systems This @value{SECTION} describes how to install @command{gawk} on various non-Unix systems. @menu * PC Installation:: Installing and Compiling @command{gawk} on MS-DOS and OS/2. * VMS Installation:: Installing @command{gawk} on VMS. @end menu @c Rewritten by Scott Deifik @c and Darrel Hankerson @node PC Installation @appendixsubsec Installation on PC Operating Systems @cindex PC operating systems@comma{} @command{gawk} on, installing @cindex operating systems, PC@comma{} @command{gawk} on, installing This @value{SECTION} covers installation and usage of @command{gawk} on x86 machines running MS-DOS, any version of MS-Windows, or OS/2. In this @value{SECTION}, the term ``Windows32'' refers to any of Microsoft Windows-95/98/ME/NT/2000/XP/Vista/7. The limitations of MS-DOS (and MS-DOS shells under Windows32 or OS/2) has meant that various ``DOS extenders'' are often used with programs such as @command{gawk}. The varying capabilities of Microsoft Windows 3.1 and Windows32 can add to the confusion. For an overview of the considerations, please refer to @file{README_d/README.pc} in the distribution. @menu * PC Binary Installation:: Installing a prepared distribution. * PC Compiling:: Compiling @command{gawk} for MS-DOS, Windows32, and OS/2. * PC Testing:: Testing @command{gawk} on PC systems. * PC Using:: Running @command{gawk} on MS-DOS, Windows32 and OS/2. * Cygwin:: Building and running @command{gawk} for Cygwin. * MSYS:: Using @command{gawk} In The MSYS Environment. @end menu @node PC Binary Installation @appendixsubsubsec Installing a Prepared Distribution for PC Systems If you have received a binary distribution prepared by the MS-DOS maintainers, then @command{gawk} and the necessary support files appear under the @file{gnu} directory, with executables in @file{gnu/bin}, libraries in @file{gnu/lib/awk}, and manual pages under @file{gnu/man}. This is designed for easy installation to a @file{/gnu} directory on your drive---however, the files can be installed anywhere provided @env{AWKPATH} is set properly. Regardless of the installation directory, the first line of @file{igawk.cmd} and @file{igawk.bat} (in @file{gnu/bin}) may need to be edited. The binary distribution contains a separate file describing the contents. In particular, it may include more than one version of the @command{gawk} executable. OS/2 (32 bit, EMX) binary distributions are prepared for the @file{/usr} directory of your preferred drive. Set @env{UNIXROOT} to your installation drive (e.g., @samp{e:}) if you want to install @command{gawk} onto another drive than the hardcoded default @samp{c:}. Executables appear in @file{/usr/bin}, libraries under @file{/usr/share/awk}, manual pages under @file{/usr/man}, Texinfo documentation under @file{/usr/info}, and NLS files under @file{/usr/share/locale}. Note that the files can be installed anywhere provided @env{AWKPATH} is set properly. If you already have a file @file{/usr/info/dir} from another package @emph{do not overwrite it!} Instead enter the following commands at your prompt (replace @samp{x:} by your installation drive): @example install-info --info-dir=x:/usr/info x:/usr/info/gawk.info install-info --info-dir=x:/usr/info x:/usr/info/gawkinet.info @end example The binary distribution may contain a separate file containing additional or more detailed installation instructions. @node PC Compiling @appendixsubsubsec Compiling @command{gawk} for PC Operating Systems @command{gawk} can be compiled for MS-DOS, Windows32, and OS/2 using the GNU development tools from DJ Delorie (DJGPP: MS-DOS only) or Eberhard Mattes (EMX: MS-DOS, Windows32 and OS/2). The file @file{README_d/README.pc} in the @command{gawk} distribution contains additional notes, and @file{pc/Makefile} contains important information on compilation options. @cindex compiling @command{gawk} for MS-DOS and MS-Windows To build @command{gawk} for MS-DOS and Windows32, copy the files in the @file{pc} directory (@emph{except} for @file{ChangeLog}) to the directory with the rest of the @command{gawk} sources, then invoke @command{make} with the appropriate target name as an argument to build @command{gawk}. The @file{Makefile} copied from the @file{pc} directory contains a configuration section with comments and may need to be edited in order to work with your @command{make} utility. The @file{Makefile} supports a number of targets for building various MS-DOS and Windows32 versions. A list of targets is printed if the @command{make} command is given without a target. As an example, to build @command{gawk} using the DJGPP tools, enter @samp{make djgpp}. (The DJGPP tools needed for the build may be found at @uref{ftp://ftp.delorie.com/pub/djgpp/current/v2gnu/}.) To build a native MS-Windows binary of @command{gawk}, type @samp{make mingw32}. @cindex compiling @command{gawk} with EMX for OS/2 The 32 bit EMX version of @command{gawk} works ``out of the box'' under OS/2. However, it is highly recommended to use GCC 2.95.3 for the compilation. In principle, it is possible to compile @command{gawk} the following way: @example $ @kbd{./configure} $ @kbd{make} @end example This is not recommended, though. To get an OMF executable you should use the following commands at your @command{sh} prompt: @example $ @kbd{CFLAGS="-O2 -Zomf -Zmt"} $ @kbd{export CFLAGS} $ @kbd{LDFLAGS="-s -Zcrtdll -Zlinker /exepack:2 -Zlinker /pm:vio -Zstack 0x6000"} $ @kbd{export LDFLAGS} $ @kbd{RANLIB="echo"} $ @kbd{export RANLIB} $ @kbd{./configure --prefix=c:/usr} $ @kbd{make AR=emxomfar} @end example These are just suggestions for use with GCC 2.x. You may use any other set of (self-consistent) environment variables and compiler flags. @ignore To get an FHS-compliant file hierarchy it is recommended to use the additional @command{configure} options @option{--infodir=c:/usr/share/info}, @option{--mandir=c:/usr/share/man} and @option{--libexecdir=c:/usr/lib}. @end ignore @ignore The internal @code{gettext} library tends to be problematic. It is therefore recommended to use either an external one (@option{--without-included-gettext}) or to disable NLS entirely (@option{--disable-nls}). @end ignore If you use GCC 2.95 it is recommended to use also: @example $ @kbd{LIBS="-lgcc"} $ @kbd{export LIBS} @end example You can also get an @code{a.out} executable if you prefer: @example $ @kbd{CFLAGS="-O2 -Zmt"} $ @kbd{export CFLAGS} $ @kbd{LDFLAGS="-s -Zstack 0x6000"} $ @kbd{LIBS="-lgcc"} $ @kbd{unset RANLIB} @c $ ./configure --prefix=c:/usr --without-included-gettext $ @kbd{./configure --prefix=c:/usr} $ @kbd{make} @end example @quotation NOTE Compilation of @code{a.out} executables also works with GCC 3.2. Versions later than GCC 3.2 have not been tested successfully. @end quotation @samp{make install} works as expected with the EMX build. @quotation NOTE Ancient OS/2 ports of GNU @command{make} are not able to handle the Makefiles of this package. If you encounter any problems with @command{make}, try GNU Make 3.79.1 or later versions. You should find the latest version on @uref{ftp://hobbes.nmsu.edu/pub/os2/}. @end quotation @node PC Testing @appendixsubsubsec Testing @command{gawk} on PC Operating Systems Using @command{make} to run the standard tests and to install @command{gawk} requires additional Unix-like tools, including @command{sh}, @command{sed}, and @command{cp}. In order to run the tests, the @file{test/*.ok} files may need to be converted so that they have the usual MS-DOS-style end-of-line markers. Alternatively, run @command{make check CMP="diff -a"} to use GNU @command{diff} in text mode instead of @command{cmp} to compare the resulting files. Most of the tests work properly with Stewartson's shell along with the companion utilities or appropriate GNU utilities. However, some editing of @file{test/Makefile} is required. It is recommended that you copy the file @file{pc/Makefile.tst} over the file @file{test/Makefile} as a replacement. Details can be found in @file{README_d/README.pc} and in the file @file{pc/Makefile.tst}. On OS/2 the @code{pid} test fails because @code{spawnl()} is used instead of @code{fork()}/@code{execl()} to start child processes. Also the @code{mbfw1} and @code{mbprintf1} tests fail because the needed multibyte functionality is not available. @node PC Using @appendixsubsubsec Using @command{gawk} on PC Operating Systems @c STARTOFRANGE opgawx @cindex operating systems, PC, @command{gawk} on @c STARTOFRANGE pcgawon @cindex PC operating systems, @command{gawk} on With the exception of the Cygwin environment, the @samp{|&} operator and TCP/IP networking (@pxref{TCP/IP Networking}) are not supported for MS-DOS or MS-Windows. EMX (OS/2 only) does support at least the @samp{|&} operator. @cindex search paths @cindex search paths, for source files @cindex @command{gawk}, OS/2 version of @cindex @command{gawk}, MS-DOS version of @cindex @command{gawk}, MS-Windows version of @cindex @code{;} (semicolon), @code{AWKPATH} variable and @cindex semicolon (@code{;}), @code{AWKPATH} variable and @cindex @code{AWKPATH} environment variable The MS-DOS and MS-Windows versions of @command{gawk} search for program files as described in @ref{AWKPATH Variable}. However, semicolons (rather than colons) separate elements in the @env{AWKPATH} variable. If @env{AWKPATH} is not set or is empty, then the default search path for MS-Windows and MS-DOS versions is @code{@w{".;c:/lib/awk;c:/gnu/lib/awk"}}. @cindex @code{UNIXROOT} variable, on OS/2 systems The search path for OS/2 (32 bit, EMX) is determined by the prefix directory (most likely @file{/usr} or @file{c:/usr}) that has been specified as an option of the @command{configure} script like it is the case for the Unix versions. If @file{c:/usr} is the prefix directory then the default search path contains @file{.} and @file{c:/usr/share/awk}. Additionally, to support binary distributions of @command{gawk} for OS/2 systems whose drive @samp{c:} might not support long file names or might not exist at all, there is a special environment variable. If @env{UNIXROOT} specifies a drive then this specific drive is also searched for program files. E.g., if @env{UNIXROOT} is set to @file{e:} the complete default search path is @code{@w{".;c:/usr/share/awk;e:/usr/share/awk"}}. An @command{sh}-like shell (as opposed to @command{command.com} under MS-DOS or @command{cmd.exe} under MS-Windows or OS/2) may be useful for @command{awk} programming. The DJGPP collection of tools includes an MS-DOS port of Bash, and several shells are available for OS/2, including @command{ksh}. @cindex common extensions, @code{BINMODE} variable @cindex extensions, common@comma{} @code{BINMODE} variable @cindex differences in @command{awk} and @command{gawk}, @code{BINMODE} variable @cindex @code{BINMODE} variable Under MS-Windows, OS/2 and MS-DOS, @command{gawk} (and many other text programs) silently translate end-of-line @code{"\r\n"} to @code{"\n"} on input and @code{"\n"} to @code{"\r\n"} on output. A special @code{BINMODE} variable @value{COMMONEXT} allows control over these translations and is interpreted as follows: @itemize @bullet @item If @code{BINMODE} is @code{"r"}, or one, then binary mode is set on read (i.e., no translations on reads). @item If @code{BINMODE} is @code{"w"}, or two, then binary mode is set on write (i.e., no translations on writes). @item If @code{BINMODE} is @code{"rw"} or @code{"wr"} or three, binary mode is set for both read and write. @item @code{BINMODE=@var{non-null-string}} is the same as @samp{BINMODE=3} (i.e., no translations on reads or writes). However, @command{gawk} issues a warning message if the string is not one of @code{"rw"} or @code{"wr"}. @end itemize @noindent The modes for standard input and standard output are set one time only (after the command line is read, but before processing any of the @command{awk} program). Setting @code{BINMODE} for standard input or standard output is accomplished by using an appropriate @samp{-v BINMODE=@var{N}} option on the command line. @code{BINMODE} is set at the time a file or pipe is opened and cannot be changed mid-stream. The name @code{BINMODE} was chosen to match @command{mawk} (@pxref{Other Versions}). @command{mawk} and @command{gawk} handle @code{BINMODE} similarly; however, @command{mawk} adds a @samp{-W BINMODE=@var{N}} option and an environment variable that can set @code{BINMODE}, @code{RS}, and @code{ORS}. The files @file{binmode[1-3].awk} (under @file{gnu/lib/awk} in some of the prepared distributions) have been chosen to match @command{mawk}'s @samp{-W BINMODE=@var{N}} option. These can be changed or discarded; in particular, the setting of @code{RS} giving the fewest ``surprises'' is open to debate. @command{mawk} uses @samp{RS = "\r\n"} if binary mode is set on read, which is appropriate for files with the MS-DOS-style end-of-line. To illustrate, the following examples set binary mode on writes for standard output and other files, and set @code{ORS} as the ``usual'' MS-DOS-style end-of-line: @example gawk -v BINMODE=2 -v ORS="\r\n" @dots{} @end example @noindent or: @example gawk -v BINMODE=w -f binmode2.awk @dots{} @end example @noindent These give the same result as the @samp{-W BINMODE=2} option in @command{mawk}. The following changes the record separator to @code{"\r\n"} and sets binary mode on reads, but does not affect the mode on standard input: @example gawk -v RS="\r\n" --source "BEGIN @{ BINMODE = 1 @}" @dots{} @end example @noindent or: @example gawk -f binmode1.awk @dots{} @end example @noindent With proper quoting, in the first example the setting of @code{RS} can be moved into the @code{BEGIN} rule. @node Cygwin @appendixsubsubsec Using @command{gawk} In The Cygwin Environment @cindex compiling @command{gawk} for Cygwin @command{gawk} can be built and used ``out of the box'' under MS-Windows if you are using the @uref{http://www.cygwin.com, Cygwin environment}. This environment provides an excellent simulation of Unix, using the GNU tools, such as Bash, the GNU Compiler Collection (GCC), GNU Make, and other GNU programs. Compilation and installation for Cygwin is the same as for a Unix system: @example tar -xvpzf gawk-@value{VERSION}.@value{PATCHLEVEL}.tar.gz cd gawk-@value{VERSION}.@value{PATCHLEVEL} ./configure make @end example When compared to GNU/Linux on the same system, the @samp{configure} step on Cygwin takes considerably longer. However, it does finish, and then the @samp{make} proceeds as usual. @quotation NOTE The @samp{|&} operator and TCP/IP networking (@pxref{TCP/IP Networking}) are fully supported in the Cygwin environment. This is not true for any other environment on MS-Windows. @end quotation @node MSYS @appendixsubsubsec Using @command{gawk} In The MSYS Environment In the MSYS environment under MS-Windows, @command{gawk} automatically uses binary mode for reading and writing files. Thus there is no need to use the @code{BINMODE} variable. This can cause problems with other Unix-like components that have been ported to MS-Windows that expect @command{gawk} to do automatic translation of @code{"\r\n"}, since it won't. Caveat Emptor! @node VMS Installation @appendixsubsec How to Compile and Install @command{gawk} on VMS @c based on material from Pat Rankin @c now rankin@pactechdata.com @c now r.pat.rankin@gmail.com @cindex @command{gawk}, VMS version of @cindex installation, VMS This @value{SUBSECTION} describes how to compile and install @command{gawk} under VMS. The older designation ``VMS'' is used throughout to refer to OpenVMS. @menu * VMS Compilation:: How to compile @command{gawk} under VMS. * VMS Installation Details:: How to install @command{gawk} under VMS. * VMS Running:: How to run @command{gawk} under VMS. * VMS Old Gawk:: An old version comes with some VMS systems. @end menu @node VMS Compilation @appendixsubsubsec Compiling @command{gawk} on VMS @cindex compiling @command{gawk} for VMS To compile @command{gawk} under VMS, there is a @code{DCL} command procedure that issues all the necessary @code{CC} and @code{LINK} commands. There is also a @file{Makefile} for use with the @code{MMS} utility. From the source directory, use either: @example $ @kbd{@@[.VMS]VMSBUILD.COM} @end example @noindent or: @example $ @kbd{MMS/DESCRIPTION=[.VMS]DESCRIP.MMS GAWK} @end example Older versions of @command{gawk} could be built with VAX C or GNU C on VAX/VMS, as well as with DEC C, but that is no longer supported. DEC C (also briefly known as ``Compaq C'' and now known as ``HP C,'' but referred to here as ``DEC C'') is required. Both @code{VMSBUILD.COM} and @code{DESCRIP.MMS} contain some obsolete support for the older compilers but are set up to use DEC C by default. @command{gawk} has been tested under Alpha/VMS 7.3-1 using Compaq C V6.4, and on Alpha/VMS 7.3, Alpha/VMS 7.3-2, and IA64/VMS 8.3.@footnote{The IA64 architecture is also known as ``Itanium.''} @node VMS Installation Details @appendixsubsubsec Installing @command{gawk} on VMS To install @command{gawk}, all you need is a ``foreign'' command, which is a @code{DCL} symbol whose value begins with a dollar sign. For example: @example $ @kbd{GAWK :== $disk1:[gnubin]GAWK} @end example @noindent Substitute the actual location of @command{gawk.exe} for @samp{$disk1:[gnubin]}. The symbol should be placed in the @file{login.com} of any user who wants to run @command{gawk}, so that it is defined every time the user logs on. Alternatively, the symbol may be placed in the system-wide @file{sylogin.com} procedure, which allows all users to run @command{gawk}. Optionally, the help entry can be loaded into a VMS help library: @example $ @kbd{LIBRARY/HELP SYS$HELP:HELPLIB [.VMS]GAWK.HLP} @end example @noindent (You may want to substitute a site-specific help library rather than the standard VMS library @samp{HELPLIB}.) After loading the help text, the command: @example $ @kbd{HELP GAWK} @end example @noindent provides information about both the @command{gawk} implementation and the @command{awk} programming language. The logical name @samp{AWK_LIBRARY} can designate a default location for @command{awk} program files. For the @option{-f} option, if the specified @value{FN} has no device or directory path information in it, @command{gawk} looks in the current directory first, then in the directory specified by the translation of @samp{AWK_LIBRARY} if the file is not found. If, after searching in both directories, the file still is not found, @command{gawk} appends the suffix @samp{.awk} to the filename and retries the file search. If @samp{AWK_LIBRARY} has no definition, a default value of @samp{SYS$LIBRARY:} is used for it. @node VMS Running @appendixsubsubsec Running @command{gawk} on VMS Command-line parsing and quoting conventions are significantly different on VMS, so examples in this @value{DOCUMENT} or from other sources often need minor changes. They @emph{are} minor though, and all @command{awk} programs should run correctly. Here are a couple of trivial tests: @example $ @kbd{gawk -- "BEGIN @{print ""Hello, World!""@}"} $ @kbd{gawk -"W" version} ! could also be -"W version" or "-W version" @end example @noindent Note that uppercase and mixed-case text must be quoted. The VMS port of @command{gawk} includes a @code{DCL}-style interface in addition to the original shell-style interface (see the help entry for details). One side effect of dual command-line parsing is that if there is only a single parameter (as in the quoted string program above), the command becomes ambiguous. To work around this, the normally optional @option{--} flag is required to force Unix-style parsing rather than @code{DCL} parsing. If any other dash-type options (or multiple parameters such as @value{DF}s to process) are present, there is no ambiguity and @option{--} can be omitted. @c @cindex directory search @c @cindex path, search @cindex search paths @cindex search paths, for source files The default search path, when looking for @command{awk} program files specified by the @option{-f} option, is @code{"SYS$DISK:[],AWK_LIBRARY:"}. The logical name @env{AWKPATH} can be used to override this default. The format of @env{AWKPATH} is a comma-separated list of directory specifications. When defining it, the value should be quoted so that it retains a single translation and not a multitranslation @code{RMS} searchlist. @ignore @c The VMS POSIX product, also known as POSIX for OpenVMS, is long defunct @c and building gawk for it has not been tested in many years, but these @c old instructions might still work if anyone is still using it. @node VMS POSIX @appendixsubsubsec Building and Using @command{gawk} on VMS POSIX Ignore the instructions above, although @file{vms/gawk.hlp} should still be made available in a help library. The source tree should be unpacked into a container file subsystem rather than into the ordinary VMS filesystem. Make sure that the two scripts, @file{configure} and @file{vms/posix-cc.sh}, are executable; use @samp{chmod +x} on them if necessary. Then execute the following two commands: @example psx> @kbd{CC=vms/posix-cc.sh configure} psx> @kbd{make CC=c89 gawk} @end example @noindent The first command constructs files @file{config.h} and @file{Makefile} out of templates, using a script to make the C compiler fit @command{configure}'s expectations. The second command compiles and links @command{gawk} using the C compiler directly; ignore any warnings from @command{make} about being unable to redefine @code{CC}. @command{configure} takes a very long time to execute, but at least it provides incremental feedback as it runs. This has been tested with VAX/VMS V6.2, VMS POSIX V2.0, and DEC C V5.2. Once built, @command{gawk} works like any other shell utility. Unlike the normal VMS port of @command{gawk}, no special command-line manipulation is needed in the VMS POSIX environment. @end ignore @node VMS Old Gawk @appendixsubsubsec Some VMS Systems Have An Old Version of @command{gawk} @c Thanks to "gerard labadie" Some versions of VMS have an old version of @command{gawk}. To access it, define a symbol, as follows: @example $ @kbd{gawk :== $sys$common:[syshlp.examples.tcpip.snmp]gawk.exe} @end example This is apparently @value{PVERSION} 2.15.6, which is extremely old. We recommend compiling and using the current version. @c ENDOFRANGE opgawx @c ENDOFRANGE pcgawon @node Bugs @appendixsec Reporting Problems and Bugs @cindex archeologists @quotation @i{There is nothing more dangerous than a bored archeologist.}@* The Hitchhiker's Guide to the Galaxy @end quotation @c the radio show, not the book. :-) @c STARTOFRANGE dbugg @cindex debugging @command{gawk}, bug reports @c STARTOFRANGE tblgawb @cindex troubleshooting, @command{gawk}, bug reports If you have problems with @command{gawk} or think that you have found a bug, please report it to the developers; we cannot promise to do anything but we might well want to fix it. Before reporting a bug, make sure you have actually found a real bug. Carefully reread the documentation and see if it really says you can do what you're trying to do. If it's not clear whether you should be able to do something or not, report that too; it's a bug in the documentation! Before reporting a bug or trying to fix it yourself, try to isolate it to the smallest possible @command{awk} program and input @value{DF} that reproduces the problem. Then send us the program and @value{DF}, some idea of what kind of Unix system you're using, the compiler you used to compile @command{gawk}, and the exact results @command{gawk} gave you. Also say what you expected to occur; this helps us decide whether the problem is really in the documentation. Please include the version number of @command{gawk} you are using. You can get this information with the command @samp{gawk --version}. @cindex @code{bug-gawk@@gnu.org} bug reporting address @cindex email address for bug reports, @code{bug-gawk@@gnu.org} @cindex bug reports, email address, @code{bug-gawk@@gnu.org} Once you have a precise problem, send email to @EMAIL{bug-gawk@@gnu.org,bug-gawk at gnu dot org}. @cindex Robbins, Arnold Using this address automatically sends a copy of your mail to me. If necessary, I can be reached directly at @EMAIL{arnold@@skeeve.com,arnold at skeeve dot com}. The bug reporting address is preferred since the email list is archived at the GNU Project. @emph{All email should be in English, since that is my native language.} @cindex @code{comp.lang.awk} newsgroup @quotation CAUTION Do @emph{not} try to report bugs in @command{gawk} by posting to the Usenet/Internet newsgroup @code{comp.lang.awk}. While the @command{gawk} developers do occasionally read this newsgroup, there is no guarantee that we will see your posting. The steps described above are the official recognized ways for reporting bugs. Really. @end quotation @quotation NOTE Many distributions of GNU/Linux and the various BSD-based operating systems have their own bug reporting systems. If you report a bug using your distribution's bug reporting system, @emph{please} also send a copy to @EMAIL{bug-gawk@@gnu.org,bug-gawk at gnu dot org}. This is for two reasons. First, while some distributions forward bug reports ``upstream'' to the GNU mailing list, many don't, so there is a good chance that the @command{gawk} maintainer won't even see the bug report! Second, mail to the GNU list is archived, and having everything at the GNU project keeps things self-contained and not dependant on other web sites. @end quotation Non-bug suggestions are always welcome as well. If you have questions about things that are unclear in the documentation or are just obscure features, ask me; I will try to help you out, although I may not have the time to fix the problem. You can send me electronic mail at the Internet address noted previously. If you find bugs in one of the non-Unix ports of @command{gawk}, please send an electronic mail message to the person who maintains that port. They are named in the following list, as well as in the @file{README} file in the @command{gawk} distribution. Information in the @file{README} file should be considered authoritative if it conflicts with this @value{DOCUMENT}. The people maintaining the non-Unix ports of @command{gawk} are as follows: @multitable {MS-Windows with MINGW} {123456789012345678901234567890123456789001234567890} @cindex Deifik, Scott @item MS-DOS with DJGPP @tab Scott Deifik, @EMAIL{scottd.mail@@sbcglobal.net,scottd dot mail at sbcglobal dot net}. @cindex Zaretskii, Eli @item MS-Windows with MINGW @tab Eli Zaretskii, @EMAIL{eliz@@gnu.org,eliz at gnu dot org}. @cindex Buening, Andreas @item OS/2 @tab Andreas Buening, @EMAIL{andreas.buening@@nexgo.de,andreas dot buening at nexgo dot de}. @cindex Rankin, Pat @item VMS @tab Pat Rankin, @EMAIL{r.pat.rankin@@gmail.com,r.pat.rankin at gmail.com} @cindex Pitts, Dave @item z/OS (OS/390) @tab Dave Pitts, @EMAIL{dpitts@@cozx.com,dpitts at cozx dot com}. @end multitable If your bug is also reproducible under Unix, please send a copy of your report to the @EMAIL{bug-gawk@@gnu.org,bug-gawk at gnu dot org} email list as well. @c ENDOFRANGE dbugg @c ENDOFRANGE tblgawb @node Other Versions @appendixsec Other Freely Available @command{awk} Implementations @c STARTOFRANGE awkim @cindex @command{awk}, implementations @ignore From: emory!amc.com!brennan (Michael Brennan) Subject: C++ comments in awk programs To: arnold@gnu.ai.mit.edu (Arnold Robbins) Date: Wed, 4 Sep 1996 08:11:48 -0700 (PDT) @end ignore @cindex Brennan, Michael @quotation @i{It's kind of fun to put comments like this in your awk code.}@* @ @ @ @ @ @ @code{// Do C++ comments work? answer: yes! of course}@* Michael Brennan @end quotation There are a number of other freely available @command{awk} implementations. This @value{SECTION} briefly describes where to get them: @table @asis @cindex Kernighan, Brian @cindex source code, Brian Kernighan's @command{awk} @cindex @command{awk}, versions of, See Also Brian Kernighan's @command{awk} @cindex extensions, Brian Kernighan's @command{awk} @cindex Brian Kernighan's @command{awk}, extensions @item Unix @command{awk} Brian Kernighan, one of the original designers of Unix @command{awk}, has made his implementation of @command{awk} freely available. You can retrieve this version via the World Wide Web from @uref{http://www.cs.princeton.edu/~bwk, his home page}. It is available in several archive formats: @table @asis @item Shell archive @uref{http://www.cs.princeton.edu/~bwk/btl.mirror/awk.shar} @item Compressed @command{tar} file @uref{http://www.cs.princeton.edu/~bwk/btl.mirror/awk.tar.gz} @item Zip file @uref{http://www.cs.princeton.edu/~bwk/btl.mirror/awk.zip} @end table This version requires an ISO C (1990 standard) compiler; the C compiler from GCC (the GNU Compiler Collection) works quite nicely. @xref{Common Extensions}, for a list of extensions in this @command{awk} that are not in POSIX @command{awk}. @cindex Brennan, Michael @cindex @command{mawk} program @cindex source code, @command{mawk} @item @command{mawk} Michael Brennan wrote an independent implementation of @command{awk}, called @command{mawk}. It is available under the GPL (@pxref{Copying}), just as @command{gawk} is. The original distribution site for the @command{mawk} source code no longer has it. A copy is available at @uref{http://www.skeeve.com/gawk/mawk1.3.3.tar.gz}. In 2009, Thomas Dickey took on @command{mawk} maintenance. Basic information is available on @uref{http://www.invisible-island.net/mawk/mawk.html, the project's web page}. The download URL is @url{http://invisible-island.net/datafiles/release/mawk.tar.gz}. Once you have it, @command{gunzip} may be used to decompress this file. Installation is similar to @command{gawk}'s (@pxref{Unix Installation}). @xref{Common Extensions}, for a list of extensions in @command{mawk} that are not in POSIX @command{awk}. @cindex Sumner, Andrew @cindex @command{awka} compiler for @command{awk} @cindex source code, @command{awka} @item @command{awka} Written by Andrew Sumner, @command{awka} translates @command{awk} programs into C, compiles them, and links them with a library of functions that provides the core @command{awk} functionality. It also has a number of extensions. The @command{awk} translator is released under the GPL, and the library is under the LGPL. To get @command{awka}, go to @url{http://sourceforge.net/projects/awka}. @c You can reach Andrew Sumner at @email{andrew@@zbcom.net}. @c andrewsumner@@yahoo.net The project seems to be frozen; no new code changes have been made since approximately 2003. @cindex Beebe, Nelson @cindex @command{pawk} (profiling version of Brian Kernighan's @command{awk}) @cindex source code, @command{pawk} @item @command{pawk} Nelson H.F.@: Beebe at the University of Utah has modified Brian Kernighan's @command{awk} to provide timing and profiling information. It is different from @command{pgawk} (@pxref{Profiling}), in that it uses CPU-based profiling, not line-count profiling. You may find it at either @uref{ftp://ftp.math.utah.edu/pub/pawk/pawk-20030606.tar.gz} or @uref{http://www.math.utah.edu/pub/pawk/pawk-20030606.tar.gz}. @item Busybox Awk @cindex Busybox Awk @cindex source code, Busybox Awk Busybox is a GPL-licensed program providing small versions of many applications within a single executable. It is aimed at embedded systems. It includes a full implementation of POSIX @command{awk}. When building it, be careful not to do @samp{make install} as it will overwrite copies of other applications in your @file{/usr/local/bin}. For more information, see the @uref{http://busybox.net, project's home page}. @cindex OpenSolaris @cindex Solaris, POSIX-compliant @command{awk} @cindex source code, Solaris @command{awk} @item The OpenSolaris POSIX @command{awk} The version of @command{awk} in @file{/usr/xpg4/bin} on Solaris is more-or-less POSIX-compliant. It is based on the @command{awk} from Mortice Kern Systems for PCs. The source code can be downloaded from the @uref{http://www.opensolaris.org, OpenSolaris web site}. This author was able to make it compile and work under GNU/Linux with 1--2 hours of work. Making it more generally portable (using GNU Autoconf and/or Automake) would take more work, and this has not been done, at least to our knowledge. @cindex @command{jawk} @cindex Java implementation of @command{awk} @cindex source code, @command{jawk} @item @command{jawk} This is an interpreter for @command{awk} written in Java. It claims to be a full interpreter, although because it uses Java facilities for I/O and for regexp matching, the language it supports is different from POSIX @command{awk}. More information is available on the @uref{http://jawk.sourceforge.net, project's home page}. @item Libmawk @cindex libmawk @cindex source code, libmawk This is an embeddable @command{awk} interpreter derived from @command{mawk}. For more information see @uref{http://repo.hu/projects/libmawk/}. @item @w{QSE Awk} @cindex QSE Awk @cindex source code, QSE Awk This is an embeddable @command{awk} interpreter. For more information see @uref{http://code.google.com/p/qse/} and @uref{http://awk.info/?tools/qse}. @item @command{QTawk} @cindex QuikTrim Awk @cindex source code, QuikTrim Awk This is an independent implementation of @command{awk} distributed under the GPL. It has a large number of extensions over standard @command{awk} and may not be 100% syntactically compatible with it. See @uref{http://www.quiktrim.org/QTawk.html} for more information, including the manual and a download link. @item @command{xgawk} @cindex @command{xgawk} @cindex source code, @command{xgawk} XML @command{gawk}. This is a fork of the @command{gawk} 3.1.6 source base to support processing XML files. It has a number of interesting extensions which should one day be integrated into the main @command{gawk} code base. For more information, see @uref{http://xmlgawk.sourceforge.net, the XMLgawk project web site}. @end table @c ENDOFRANGE gligawk @c ENDOFRANGE ingawk @c ENDOFRANGE awkim @node Notes @appendix Implementation Notes @c STARTOFRANGE gawii @cindex @command{gawk}, implementation issues @c STARTOFRANGE impis @cindex implementation issues, @command{gawk} This appendix contains information mainly of interest to implementers and maintainers of @command{gawk}. Everything in it applies specifically to @command{gawk} and not to other implementations. @menu * Compatibility Mode:: How to disable certain @command{gawk} extensions. * Additions:: Making Additions To @command{gawk}. * Dynamic Extensions:: Adding new built-in functions to @command{gawk}. * Future Extensions:: New features that may be implemented one day. @end menu @node Compatibility Mode @appendixsec Downward Compatibility and Debugging @cindex @command{gawk}, implementation issues, downward compatibility @cindex @command{gawk}, implementation issues, debugging @cindex troubleshooting, @command{gawk} @cindex implementation issues@comma{} @command{gawk}, debugging @xref{POSIX/GNU}, for a summary of the GNU extensions to the @command{awk} language and program. All of these features can be turned off by invoking @command{gawk} with the @option{--traditional} option or with the @option{--posix} option. If @command{gawk} is compiled for debugging with @samp{-DDEBUG}, then there is one more option available on the command line: @table @code @item -Y @itemx --parsedebug Prints out the parse stack information as the program is being parsed. @end table This option is intended only for serious @command{gawk} developers and not for the casual user. It probably has not even been compiled into your version of @command{gawk}, since it slows down execution. @node Additions @appendixsec Making Additions to @command{gawk} If you find that you want to enhance @command{gawk} in a significant fashion, you are perfectly free to do so. That is the point of having free software; the source code is available and you are free to change it as you want (@pxref{Copying}). This @value{SECTION} discusses the ways you might want to change @command{gawk} as well as any considerations you should bear in mind. @menu * Accessing The Source:: Accessing the Git repository. * Adding Code:: Adding code to the main body of @command{gawk}. * New Ports:: Porting @command{gawk} to a new operating system. @end menu @node Accessing The Source @appendixsubsec Accessing The @command{gawk} Git Repository As @command{gawk} is Free Software, the source code is always available. @ref{Gawk Distribution}, describes how to get and build the formal, released versions of @command{gawk}. However, if you want to modify @command{gawk} and contribute back your changes, you will probably wish to work with the development version. To do so, you will need to access the @command{gawk} source code repository. The code is maintained using the @uref{http://git-scm.com/, Git distributed version control system}. You will need to install it if your system doesn't have it. Once you have done so, use the command: @example git clone git://git.savannah.gnu.org/gawk.git @end example @noindent This will clone the @command{gawk} repository. If you are behind a firewall that will not allow you to use the Git native protocol, you can still access the repository using: @example git clone http://git.savannah.gnu.org/r/gawk.git @end example Once you have made changes, you can use @samp{git diff} to produce a patch, and send that to the @command{gawk} maintainer; see @ref{Bugs} for how to do that. Finally, if you cannot install Git (e.g., if it hasn't been ported yet to your operating system), you can use the Git--CVS gateway to check out a copy using CVS, as follows: @example cvs -d:pserver:anonymous@@pserver.git.sv.gnu.org:/gawk.git co -d gawk master @end example @node Adding Code @appendixsubsec Adding New Features @c STARTOFRANGE adfgaw @cindex adding, features to @command{gawk} @c STARTOFRANGE fadgaw @cindex features, adding to @command{gawk} @c STARTOFRANGE gawadf @cindex @command{gawk}, features, adding You are free to add any new features you like to @command{gawk}. However, if you want your changes to be incorporated into the @command{gawk} distribution, there are several steps that you need to take in order to make it possible to include your changes: @enumerate 1 @item Before building the new feature into @command{gawk} itself, consider writing it as an extension module (@pxref{Dynamic Extensions}). If that's not possible, continue with the rest of the steps in this list. @item Be prepared to sign the appropriate paperwork. In order for the FSF to distribute your changes, you must either place those changes in the public domain and submit a signed statement to that effect, or assign the copyright in your changes to the FSF. Both of these actions are easy to do and @emph{many} people have done so already. If you have questions, please contact me (@pxref{Bugs}), or @EMAIL{assign@@gnu.org,assign at gnu dot org}. @item Get the latest version. It is much easier for me to integrate changes if they are relative to the most recent distributed version of @command{gawk}. If your version of @command{gawk} is very old, I may not be able to integrate them at all. (@xref{Getting}, for information on getting the latest version of @command{gawk}.) @item @ifnotinfo Follow the @cite{GNU Coding Standards}. @end ifnotinfo @ifinfo See @inforef{Top, , Version, standards, GNU Coding Standards}. @end ifinfo This document describes how GNU software should be written. If you haven't read it, please do so, preferably @emph{before} starting to modify @command{gawk}. (The @cite{GNU Coding Standards} are available from the GNU Project's @uref{http://www.gnu.org/prep/standards_toc.html, web site}. Texinfo, Info, and DVI versions are also available.) @cindex @command{gawk}, coding style in @item Use the @command{gawk} coding style. The C code for @command{gawk} follows the instructions in the @cite{GNU Coding Standards}, with minor exceptions. The code is formatted using the traditional ``K&R'' style, particularly as regards to the placement of braces and the use of TABs. In brief, the coding rules for @command{gawk} are as follows: @itemize @bullet @item Use ANSI/ISO style (prototype) function headers when defining functions. @item Put the name of the function at the beginning of its own line. @item Put the return type of the function, even if it is @code{int}, on the line above the line with the name and arguments of the function. @item Put spaces around parentheses used in control structures (@code{if}, @code{while}, @code{for}, @code{do}, @code{switch}, and @code{return}). @item Do not put spaces in front of parentheses used in function calls. @item Put spaces around all C operators and after commas in function calls. @item Do not use the comma operator to produce multiple side effects, except in @code{for} loop initialization and increment parts, and in macro bodies. @item Use real TABs for indenting, not spaces. @item Use the ``K&R'' brace layout style. @item Use comparisons against @code{NULL} and @code{'\0'} in the conditions of @code{if}, @code{while}, and @code{for} statements, as well as in the @code{case}s of @code{switch} statements, instead of just the plain pointer or character value. @item Use the @code{TRUE}, @code{FALSE} and @code{NULL} symbolic constants and the character constant @code{'\0'} where appropriate, instead of @code{1} and @code{0}. @item Provide one-line descriptive comments for each function. @item Do not use the @code{alloca()} function for allocating memory off the stack. Its use causes more portability trouble than is worth the minor benefit of not having to free the storage. Instead, use @code{malloc()} and @code{free()}. @item Do not use comparisons of the form @samp{! strcmp(a, b)} or similar. As Henry Spencer once said, ``@code{strcmp()} is not a boolean!'' Instead, use @samp{strcmp(a, b) == 0}. @item If adding new bit flag values, use explicit hexadecimal constants (@code{0x001}, @code{0x002}, @code{0x004}, and son on) instead of shifting one left by successive amounts (@samp{(1<<0)}, @samp{(1<<1)}, and so on). @end itemize @quotation NOTE If I have to reformat your code to follow the coding style used in @command{gawk}, I may not bother to integrate your changes at all. @end quotation @cindex Texinfo @item Update the documentation. Along with your new code, please supply new sections and/or chapters for this @value{DOCUMENT}. If at all possible, please use real Texinfo, instead of just supplying unformatted ASCII text (although even that is better than no documentation at all). Conventions to be followed in @cite{@value{TITLE}} are provided after the @samp{@@bye} at the end of the Texinfo source file. If possible, please update the @command{man} page as well. You will also have to sign paperwork for your documentation changes. @item Submit changes as unified diffs. Use @samp{diff -u -r -N} to compare the original @command{gawk} source tree with your version. I recommend using the GNU version of @command{diff}. Send the output produced by either run of @command{diff} to me when you submit your changes. (@xref{Bugs}, for the electronic mail information.) Using this format makes it easy for me to apply your changes to the master version of the @command{gawk} source code (using @code{patch}). If I have to apply the changes manually, using a text editor, I may not do so, particularly if there are lots of changes. @item Include an entry for the @file{ChangeLog} file with your submission. This helps further minimize the amount of work I have to do, making it easier for me to accept patches. @end enumerate Although this sounds like a lot of work, please remember that while you may write the new code, I have to maintain it and support it. If it isn't possible for me to do that with a minimum of extra work, then I probably will not. @c ENDOFRANGE adfgaw @c ENDOFRANGE gawadf @c ENDOFRANGE fadgaw @node New Ports @appendixsubsec Porting @command{gawk} to a New Operating System @cindex portability, @command{gawk} @cindex operating systems, porting @command{gawk} to @cindex porting @command{gawk} If you want to port @command{gawk} to a new operating system, there are several steps: @enumerate 1 @item Follow the guidelines in @ifinfo @ref{Adding Code}, @end ifinfo @ifnotinfo the previous @value{SECTION} @end ifnotinfo concerning coding style, submission of diffs, and so on. @item Be prepared to sign the appropriate paperwork. In order for the FSF to distribute your code, you must either place your code in the public domain and submit a signed statement to that effect, or assign the copyright in your code to the FSF. @ifinfo Both of these actions are easy to do and @emph{many} people have done so already. If you have questions, please contact me, or @email{gnu@@gnu.org}. @end ifinfo @item When doing a port, bear in mind that your code must coexist peacefully with the rest of @command{gawk} and the other ports. Avoid gratuitous changes to the system-independent parts of the code. If at all possible, avoid sprinkling @samp{#ifdef}s just for your port throughout the code. If the changes needed for a particular system affect too much of the code, I probably will not accept them. In such a case, you can, of course, distribute your changes on your own, as long as you comply with the GPL (@pxref{Copying}). @item A number of the files that come with @command{gawk} are maintained by other people. Thus, you should not change them unless it is for a very good reason; i.e., changes are not out of the question, but changes to these files are scrutinized extra carefully. The files are @file{dfa.c}, @file{dfa.h}, @file{getopt1.c}, @file{getopt.c}, @file{getopt.h}, @file{install-sh}, @file{mkinstalldirs}, @file{regcomp.c}, @file{regex.c}, @file{regexec.c}, @file{regexex.c}, @file{regex.h}, @file{regex_internal.c}, and @file{regex_internal.h}. @item Be willing to continue to maintain the port. Non-Unix operating systems are supported by volunteers who maintain the code needed to compile and run @command{gawk} on their systems. If noone volunteers to maintain a port, it becomes unsupported and it may be necessary to remove it from the distribution. @item Supply an appropriate @file{gawkmisc.???} file. Each port has its own @file{gawkmisc.???} that implements certain operating system specific functions. This is cleaner than a plethora of @samp{#ifdef}s scattered throughout the code. The @file{gawkmisc.c} in the main source directory includes the appropriate @file{gawkmisc.???} file from each subdirectory. Be sure to update it as well. Each port's @file{gawkmisc.???} file has a suffix reminiscent of the machine or operating system for the port---for example, @file{pc/gawkmisc.pc} and @file{vms/gawkmisc.vms}. The use of separate suffixes, instead of plain @file{gawkmisc.c}, makes it possible to move files from a port's subdirectory into the main subdirectory, without accidentally destroying the real @file{gawkmisc.c} file. (Currently, this is only an issue for the PC operating system ports.) @item Supply a @file{Makefile} as well as any other C source and header files that are necessary for your operating system. All your code should be in a separate subdirectory, with a name that is the same as, or reminiscent of, either your operating system or the computer system. If possible, try to structure things so that it is not necessary to move files out of the subdirectory into the main source directory. If that is not possible, then be sure to avoid using names for your files that duplicate the names of files in the main source directory. @item Update the documentation. Please write a section (or sections) for this @value{DOCUMENT} describing the installation and compilation steps needed to compile and/or install @command{gawk} for your system. @end enumerate Following these steps makes it much easier to integrate your changes into @command{gawk} and have them coexist happily with other operating systems' code that is already there. In the code that you supply and maintain, feel free to use a coding style and brace layout that suits your taste. @node Dynamic Extensions @appendixsec Adding New Built-in Functions to @command{gawk} @cindex Robinson, Will @cindex robot, the @cindex Lost In Space @quotation @i{Danger Will Robinson! Danger!!@* Warning! Warning!}@* The Robot @end quotation @c STARTOFRANGE gladfgaw @cindex @command{gawk}, functions, adding @c STARTOFRANGE adfugaw @cindex adding, functions to @command{gawk} @c STARTOFRANGE fubadgaw @cindex functions, built-in, adding to @command{gawk} It is possible to add new built-in functions to @command{gawk} using dynamically loaded libraries. This facility is available on systems (such as GNU/Linux) that support the C @code{dlopen()} and @code{dlsym()} functions. This @value{SECTION} describes how to write and use dynamically loaded extensions for @command{gawk}. Experience with programming in C or C++ is necessary when reading this @value{SECTION}. @quotation CAUTION The facilities described in this @value{SECTION} are very much subject to change in a future @command{gawk} release. Be aware that you may have to re-do everything, at some future time. If you have written your own dynamic extensions, be sure to recompile them for each new @command{gawk} release. There is no guarantee of binary compatibility between different releases, nor will there ever be such a guarantee. @end quotation @quotation NOTE When @option{--sandbox} is specified, extensions are disabled (@pxref{Options}. @end quotation @menu * Internals:: A brief look at some @command{gawk} internals. * Plugin License:: A note about licensing. * Sample Library:: A example of new functions. @end menu @node Internals @appendixsubsec A Minimal Introduction to @command{gawk} Internals @c STARTOFRANGE gawint @cindex @command{gawk}, internals The truth is that @command{gawk} was not designed for simple extensibility. The facilities for adding functions using shared libraries work, but are something of a ``bag on the side.'' Thus, this tour is brief and simplistic; would-be @command{gawk} hackers are encouraged to spend some time reading the source code before trying to write extensions based on the material presented here. Of particular note are the files @file{awk.h}, @file{builtin.c}, and @file{eval.c}. Reading @file{awkgram.y} in order to see how the parse tree is built would also be of use. @cindex @code{awk.h} file (internal) With the disclaimers out of the way, the following types, structure members, functions, and macros are declared in @file{awk.h} and are of use when writing extensions. The next @value{SECTION} shows how they are used: @table @code @cindex floating-point, numbers, @code{AWKNUM} internal type @cindex numbers, floating-point, @code{AWKNUM} internal type @cindex @code{AWKNUM} internal type @cindex internal type, @code{AWKNUM} @item AWKNUM An @code{AWKNUM} is the internal type of @command{awk} floating-point numbers. Typically, it is a C @code{double}. @cindex @code{NODE} internal type @cindex internal type, @code{NODE} @cindex strings, @code{NODE} internal type @cindex numbers, @code{NODE} internal type @item NODE Just about everything is done using objects of type @code{NODE}. These contain both strings and numbers, as well as variables and arrays. @cindex @code{force_number()} internal function @cindex internal function, @code{force_number()} @cindex numeric, values @item AWKNUM force_number(NODE *n) This macro forces a value to be numeric. It returns the actual numeric value contained in the node. It may end up calling an internal @command{gawk} function. @cindex @code{force_string()} internal function @cindex internal function, @code{force_string()} @item void force_string(NODE *n) This macro guarantees that a @code{NODE}'s string value is current. It may end up calling an internal @command{gawk} function. It also guarantees that the string is zero-terminated. @cindex @code{force_wstring()} internal function @cindex internal function, @code{force_wstring()} @item void force_wstring(NODE *n) Similarly, this macro guarantees that a @code{NODE}'s wide-string value is current. It may end up calling an internal @command{gawk} function. It also guarantees that the wide string is zero-terminated. @cindex @code{get_curfunc_arg_count()} internal function @cindex internal function, @code{get_curfunc_arg_count()} @item size_t get_curfunc_arg_count(void) This function returns the actual number of parameters passed to the current function. Inside the code of an extension this can be used to determine the maximum index which is safe to use with @code{get_actual_argument}. If this value is greater than @code{nargs}, the function was called incorrectly from the @command{awk} program. @cindex parameters@comma{} number of @cindex @code{nargs} internal variable @cindex internal variable, @code{nargs} @item nargs Inside an extension function, this is the maximum number of expected parameters, as set by the @code{make_builtin()} function. @cindex @code{stptr} internal variable @cindex internal variable, @code{stptr} @cindex @code{stlen} internal variable @cindex internal variable, @code{stlen} @item n->stptr @itemx n->stlen The data and length of a @code{NODE}'s string value, respectively. The string is @emph{not} guaranteed to be zero-terminated. If you need to pass the string value to a C library function, save the value in @code{n->stptr[n->stlen]}, assign @code{'\0'} to it, call the routine, and then restore the value. @cindex @code{wstptr} internal variable @cindex internal variable, @code{wstptr} @cindex @code{wstlen} internal variable @cindex internal variable, @code{wstlen} @item n->wstptr @itemx n->wstlen The data and length of a @code{NODE}'s wide-string value, respectively. Use @code{force_wstring()} to make sure these values are current. @cindex @code{type} internal variable @cindex internal variable, @code{type} @item n->type The type of the @code{NODE}. This is a C @code{enum}. Values should be one of @code{Node_var}, @code{Node_var_new}, or @code{Node_var_array} for function parameters. @cindex @code{vname} internal variable @cindex internal variable, @code{vname} @item n->vname The ``variable name'' of a node. This is not of much use inside externally written extensions. @cindex arrays, associative, clearing @cindex @code{assoc_clear()} internal function @cindex internal function, @code{assoc_clear()} @item void assoc_clear(NODE *n) Clears the associative array pointed to by @code{n}. Make sure that @samp{n->type == Node_var_array} first. @cindex arrays, elements, installing @cindex @code{assoc_lookup()} internal function @cindex internal function, @code{assoc_lookup()} @item NODE **assoc_lookup(NODE *symbol, NODE *subs, int reference) Finds, and installs if necessary, array elements. @code{symbol} is the array, @code{subs} is the subscript. This is usually a value created with @code{make_string()} (see below). @code{reference} should be @code{TRUE} if it is an error to use the value before it is created. Typically, @code{FALSE} is the correct value to use from extension functions. @cindex strings @cindex @code{make_string()} internal function @cindex internal function, @code{make_string()} @item NODE *make_string(char *s, size_t len) Take a C string and turn it into a pointer to a @code{NODE} that can be stored appropriately. This is permanent storage; understanding of @command{gawk} memory management is helpful. @cindex numbers @cindex @code{make_number()} internal function @cindex internal function, @code{make_number()} @item NODE *make_number(AWKNUM val) Take an @code{AWKNUM} and turn it into a pointer to a @code{NODE} that can be stored appropriately. This is permanent storage; understanding of @command{gawk} memory management is helpful. @cindex nodes@comma{} duplicating @cindex @code{dupnode()} internal function @cindex internal function, @code{dupnode()} @item NODE *dupnode(NODE *n) Duplicate a node. In most cases, this increments an internal reference count instead of actually duplicating the entire @code{NODE}; understanding of @command{gawk} memory management is helpful. @cindex memory, releasing @cindex @code{unref()} internal function @cindex internal function, @code{unref()} @item void unref(NODE *n) This macro releases the memory associated with a @code{NODE} allocated with @code{make_string()} or @code{make_number()}. Understanding of @command{gawk} memory management is helpful. @cindex @code{make_builtin()} internal function @cindex internal function, @code{make_builtin()} @item void make_builtin(const char *name, NODE *(*func)(NODE *), int count) Register a C function pointed to by @code{func} as new built-in function @code{name}. @code{name} is a regular C string. @code{count} is the maximum number of arguments that the function takes. The function should be written in the following manner: @example /* do_xxx --- do xxx function for gawk */ NODE * do_xxx(int nargs) @{ @dots{} @} @end example @cindex arguments, retrieving @cindex @code{get_argument()} internal function @cindex internal function, @code{get_argument()} @item NODE *get_argument(int i) This function is called from within a C extension function to get the @code{i}-th argument from the function call. The first argument is argument zero. @cindex @code{get_actual_argument()} internal function @cindex internal function, @code{get_actual_argument()} @item NODE *get_actual_argument(int i, @itemx @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ int@ optional,@ int@ wantarray); This function retrieves a particular argument @code{i}. @code{wantarray} is @code{TRUE} if the argument should be an array, @code{FALSE} otherwise. If @code{optional} is @code{TRUE}, the argument need not have been supplied. If it wasn't, the return value is @code{NULL}. It is a fatal error if @code{optional} is @code{TRUE} but the argument was not provided. @cindex @code{get_scalar_argument()} internal macro @cindex internal macro, @code{get_scalar_argument()} @item get_scalar_argument(i, opt) This is a convenience macro that calls @code{get_actual_argument()}. @cindex @code{get_array_argument()} internal macro @cindex internal macro, @code{get_array_argument()} @item get_array_argument(i, opt) This is a convenience macro that calls @code{get_actual_argument()}. @cindex functions, return values@comma{} setting @cindex @code{ERRNO} variable @cindex @code{update_ERRNO()} internal function @cindex internal function, @code{update_ERRNO()} @item void update_ERRNO(void) This function is called from within a C extension function to set the value of @command{gawk}'s @code{ERRNO} variable, based on the current value of the C @code{errno} global variable. It is provided as a convenience. @cindex @code{ERRNO} variable @cindex @code{update_ERRNO_saved()} internal function @cindex internal function, @code{update_ERRNO_saved()} @item void update_ERRNO_saved(int errno_saved) This function is called from within a C extension function to set the value of @command{gawk}'s @code{ERRNO} variable, based on the error value provided as the argument. It is provided as a convenience. @cindex @code{ENVIRON} array @cindex @code{PROCINFO} array @cindex @code{register_deferred_variable()} internal function @cindex internal function, @code{register_deferred_variable()} @item void register_deferred_variable(const char *name, NODE *(*load_func)(void)) This function is called to register a function to be called when a reference to an undefined variable with the given name is encountered. The callback function will never be called if the variable exists already, so, unless the calling code is running at program startup, it should first check whether a variable of the given name already exists. The argument function must return a pointer to a @code{NODE} containing the newly created variable. This function is used to implement the builtin @code{ENVIRON} and @code{PROCINFO} arrays, so you can refer to them for examples. @cindex @code{IOBUF} internal structure @cindex internal structure, @code{IOBUF} @cindex @code{iop_alloc()} internal function @cindex internal function, @code{iop_alloc()} @cindex @code{get_record()} input method @cindex @code{close_func}() input method @cindex @code{INVALID_HANDLE} internal constant @cindex internal constant, @code{INVALID_HANDLE} @cindex XML (eXtensible Markup Language) @cindex eXtensible Markup Language (XML) @cindex @code{register_open_hook()} internal function @cindex internal function, @code{register_open_hook()} @item void register_open_hook(void *(*open_func)(IOBUF *)) This function is called to register a function to be called whenever a new data file is opened, leading to the creation of an @code{IOBUF} structure in @code{iop_alloc()}. After creating the new @code{IOBUF}, @code{iop_alloc()} will call (in reverse order of registration, so the last function registered is called first) each open hook until one returns non-@code{NULL}. If any hook returns a non-@code{NULL} value, that value is assigned to the @code{IOBUF}'s @code{opaque} field (which will presumably point to a structure containing additional state associated with the input processing), and no further open hooks are called. The function called will most likely want to set the @code{IOBUF}'s @code{get_record} method to indicate that future input records should be retrieved by calling that method instead of using the standard @command{gawk} input processing. And the function will also probably want to set the @code{IOBUF}'s @code{close_func} method to be called when the file is closed to clean up any state associated with the input. Finally, hook functions should be prepared to receive an @code{IOBUF} structure where the @code{fd} field is set to @code{INVALID_HANDLE}, meaning that @command{gawk} was not able to open the file itself. In this case, the hook function must be able to successfully open the file and place a valid file descriptor there. Currently, for example, the hook function facility is used to implement the XML parser shared library extension. For more info, please look in @file{awk.h} and in @file{io.c}. @end table An argument that is supposed to be an array needs to be handled with some extra code, in case the array being passed in is actually from a function parameter. The following boilerplate code shows how to do this: @example NODE *the_arg; /* assume need 3rd arg, 0-based */ the_arg = get_array_argument(2, FALSE); @end example Again, you should spend time studying the @command{gawk} internals; don't just blindly copy this code. @c ENDOFRANGE gawint @node Plugin License @appendixsubsec Extension Licensing Every dynamic extension should define the global symbol @code{plugin_is_GPL_compatible} to assert that it has been licensed under a GPL-compatible license. If this symbol does not exist, @command{gawk} will emit a fatal error and exit. The declared type of the symbol should be @code{int}. It does not need to be in any allocated section, though. The code merely asserts that the symbol exists in the global scope. Something like this is enough: @example int plugin_is_GPL_compatible; @end example @node Sample Library @appendixsubsec Example: Directory and File Operation Built-ins @c STARTOFRANGE chdirg @cindex @code{chdir()} function@comma{} implementing in @command{gawk} @c STARTOFRANGE statg @cindex @code{stat()} function@comma{} implementing in @command{gawk} @c STARTOFRANGE filre @cindex files, information about@comma{} retrieving @c STARTOFRANGE dirch @cindex directories, changing Two useful functions that are not in @command{awk} are @code{chdir()} (so that an @command{awk} program can change its directory) and @code{stat()} (so that an @command{awk} program can gather information about a file). This @value{SECTION} implements these functions for @command{gawk} in an external extension library. @menu * Internal File Description:: What the new functions will do. * Internal File Ops:: The code for internal file operations. * Using Internal File Ops:: How to use an external extension. @end menu @node Internal File Description @appendixsubsubsec Using @code{chdir()} and @code{stat()} This @value{SECTION} shows how to use the new functions at the @command{awk} level once they've been integrated into the running @command{gawk} interpreter. Using @code{chdir()} is very straightforward. It takes one argument, the new directory to change to: @example @dots{} newdir = "/home/arnold/funstuff" ret = chdir(newdir) if (ret < 0) @{ printf("could not change to %s: %s\n", newdir, ERRNO) > "/dev/stderr" exit 1 @} @dots{} @end example The return value is negative if the @code{chdir} failed, and @code{ERRNO} (@pxref{Built-in Variables}) is set to a string indicating the error. Using @code{stat()} is a bit more complicated. The C @code{stat()} function fills in a structure that has a fair amount of information. The right way to model this in @command{awk} is to fill in an associative array with the appropriate information: @c broke printf for page breaking @example file = "/home/arnold/.profile" fdata[1] = "x" # force `fdata' to be an array ret = stat(file, fdata) if (ret < 0) @{ printf("could not stat %s: %s\n", file, ERRNO) > "/dev/stderr" exit 1 @} printf("size of %s is %d bytes\n", file, fdata["size"]) @end example The @code{stat()} function always clears the data array, even if the @code{stat()} fails. It fills in the following elements: @table @code @item "name" The name of the file that was @code{stat()}'ed. @item "dev" @itemx "ino" The file's device and inode numbers, respectively. @item "mode" The file's mode, as a numeric value. This includes both the file's type and its permissions. @item "nlink" The number of hard links (directory entries) the file has. @item "uid" @itemx "gid" The numeric user and group ID numbers of the file's owner. @item "size" The size in bytes of the file. @item "blocks" The number of disk blocks the file actually occupies. This may not be a function of the file's size if the file has holes. @item "atime" @itemx "mtime" @itemx "ctime" The file's last access, modification, and inode update times, respectively. These are numeric timestamps, suitable for formatting with @code{strftime()} (@pxref{Built-in}). @item "pmode" The file's ``printable mode.'' This is a string representation of the file's type and permissions, such as what is produced by @samp{ls -l}---for example, @code{"drwxr-xr-x"}. @item "type" A printable string representation of the file's type. The value is one of the following: @table @code @item "blockdev" @itemx "chardev" The file is a block or character device (``special file''). @ignore @item "door" The file is a Solaris ``door'' (special file used for interprocess communications). @end ignore @item "directory" The file is a directory. @item "fifo" The file is a named-pipe (also known as a FIFO). @item "file" The file is just a regular file. @item "socket" The file is an @code{AF_UNIX} (``Unix domain'') socket in the filesystem. @item "symlink" The file is a symbolic link. @end table @end table Several additional elements may be present depending upon the operating system and the type of the file. You can test for them in your @command{awk} program by using the @code{in} operator (@pxref{Reference to Elements}): @table @code @item "blksize" The preferred block size for I/O to the file. This field is not present on all POSIX-like systems in the C @code{stat} structure. @item "linkval" If the file is a symbolic link, this element is the name of the file the link points to (i.e., the value of the link). @item "rdev" @itemx "major" @itemx "minor" If the file is a block or character device file, then these values represent the numeric device number and the major and minor components of that number, respectively. @end table @node Internal File Ops @appendixsubsubsec C Code for @code{chdir()} and @code{stat()} Here is the C code for these extensions. They were written for GNU/Linux. The code needs some more work for complete portability to other POSIX-compliant systems:@footnote{This version is edited slightly for presentation. See @file{extension/filefuncs.c} in the @command{gawk} distribution for the complete version.} @c break line for page breaking @example #include "awk.h" #include int plugin_is_GPL_compatible; /* do_chdir --- provide dynamically loaded chdir() builtin for gawk */ static NODE * do_chdir(int nargs) @{ NODE *newdir; int ret = -1; if (do_lint && get_curfunc_arg_count() != 1) lintwarn("chdir: called with incorrect number of arguments"); newdir = get_scalar_argument(0, FALSE); @end example The file includes the @code{"awk.h"} header file for definitions for the @command{gawk} internals. It includes @code{} for access to the @code{major()} and @code{minor}() macros. @cindex programming conventions, @command{gawk} internals By convention, for an @command{awk} function @code{foo}, the function that implements it is called @samp{do_foo}. The function should take a @samp{int} argument, usually called @code{nargs}, that represents the number of defined arguments for the function. The @code{newdir} variable represents the new directory to change to, retrieved with @code{get_scalar_argument()}. Note that the first argument is numbered zero. This code actually accomplishes the @code{chdir()}. It first forces the argument to be a string and passes the string value to the @code{chdir()} system call. If the @code{chdir()} fails, @code{ERRNO} is updated. @example (void) force_string(newdir); ret = chdir(newdir->stptr); if (ret < 0) update_ERRNO(); @end example Finally, the function returns the return value to the @command{awk} level: @example return make_number((AWKNUM) ret); @} @end example The @code{stat()} built-in is more involved. First comes a function that turns a numeric mode into a printable representation (e.g., 644 becomes @samp{-rw-r--r--}). This is omitted here for brevity: @c break line for page breaking @example /* format_mode --- turn a stat mode field into something readable */ static char * format_mode(unsigned long fmode) @{ @dots{} @} @end example Next comes the @code{do_stat()} function. It starts with variable declarations and argument checking: @ignore Changed message for page breaking. Used to be: "stat: called with incorrect number of arguments (%d), should be 2", @end ignore @example /* do_stat --- provide a stat() function for gawk */ static NODE * do_stat(int nargs) @{ NODE *file, *array, *tmp; struct stat sbuf; int ret; NODE **aptr; char *pmode; /* printable mode */ char *type = "unknown"; if (do_lint && get_curfunc_arg_count() > 2) lintwarn("stat: called with too many arguments"); @end example Then comes the actual work. First, the function gets the arguments. Then, it always clears the array. The code use @code{lstat()} (instead of @code{stat()}) to get the file information, in case the file is a symbolic link. If there's an error, it sets @code{ERRNO} and returns: @c comment made multiline for page breaking @example /* file is first arg, array to hold results is second */ file = get_scalar_argument(0, FALSE); array = get_array_argument(1, FALSE); /* empty out the array */ assoc_clear(array); /* lstat the file, if error, set ERRNO and return */ (void) force_string(file); ret = lstat(file->stptr, & sbuf); if (ret < 0) @{ update_ERRNO(); return make_number((AWKNUM) ret); @} @end example Now comes the tedious part: filling in the array. Only a few of the calls are shown here, since they all follow the same pattern: @example /* fill in the array */ aptr = assoc_lookup(array, tmp = make_string("name", 4), FALSE); *aptr = dupnode(file); unref(tmp); aptr = assoc_lookup(array, tmp = make_string("mode", 4), FALSE); *aptr = make_number((AWKNUM) sbuf.st_mode); unref(tmp); aptr = assoc_lookup(array, tmp = make_string("pmode", 5), FALSE); pmode = format_mode(sbuf.st_mode); *aptr = make_string(pmode, strlen(pmode)); unref(tmp); @end example When done, return the @code{lstat()} return value: @example return make_number((AWKNUM) ret); @} @end example @cindex programming conventions, @command{gawk} internals Finally, it's necessary to provide the ``glue'' that loads the new function(s) into @command{gawk}. By convention, each library has a routine named @code{dlload()} that does the job: @example /* dlload --- load new builtins in this library */ NODE * dlload(NODE *tree, void *dl) @{ make_builtin("chdir", do_chdir, 1); make_builtin("stat", do_stat, 2); return make_number((AWKNUM) 0); @} @end example And that's it! As an exercise, consider adding functions to implement system calls such as @code{chown()}, @code{chmod()}, and @code{umask()}. @node Using Internal File Ops @appendixsubsubsec Integrating the Extensions @cindex @command{gawk}, interpreter@comma{} adding code to Now that the code is written, it must be possible to add it at runtime to the running @command{gawk} interpreter. First, the code must be compiled. Assuming that the functions are in a file named @file{filefuncs.c}, and @var{idir} is the location of the @command{gawk} include files, the following steps create a GNU/Linux shared library: @example $ @kbd{gcc -fPIC -shared -DHAVE_CONFIG_H -c -O -g -I@var{idir} filefuncs.c} $ @kbd{ld -o filefuncs.so -shared filefuncs.o} @end example @cindex @code{extension()} function (@command{gawk}) Once the library exists, it is loaded by calling the @code{extension()} built-in function. This function takes two arguments: the name of the library to load and the name of a function to call when the library is first loaded. This function adds the new functions to @command{gawk}. It returns the value returned by the initialization function within the shared library: @example # file testff.awk BEGIN @{ extension("./filefuncs.so", "dlload") chdir(".") # no-op data[1] = 1 # force `data' to be an array print "Info for testff.awk" ret = stat("testff.awk", data) print "ret =", ret for (i in data) printf "data[\"%s\"] = %s\n", i, data[i] print "testff.awk modified:", strftime("%m %d %y %H:%M:%S", data["mtime"]) print "\nInfo for JUNK" ret = stat("JUNK", data) print "ret =", ret for (i in data) printf "data[\"%s\"] = %s\n", i, data[i] print "JUNK modified:", strftime("%m %d %y %H:%M:%S", data["mtime"]) @} @end example Here are the results of running the program: @example $ @kbd{gawk -f testff.awk} @print{} Info for testff.awk @print{} ret = 0 @print{} data["size"] = 607 @print{} data["ino"] = 14945891 @print{} data["name"] = testff.awk @print{} data["pmode"] = -rw-rw-r-- @print{} data["nlink"] = 1 @print{} data["atime"] = 1293993369 @print{} data["mtime"] = 1288520752 @print{} data["mode"] = 33204 @print{} data["blksize"] = 4096 @print{} data["dev"] = 2054 @print{} data["type"] = file @print{} data["gid"] = 500 @print{} data["uid"] = 500 @print{} data["blocks"] = 8 @print{} data["ctime"] = 1290113572 @print{} testff.awk modified: 10 31 10 12:25:52 @print{} @print{} Info for JUNK @print{} ret = -1 @print{} JUNK modified: 01 01 70 02:00:00 @end example @c ENDOFRANGE filre @c ENDOFRANGE dirch @c ENDOFRANGE statg @c ENDOFRANGE chdirg @c ENDOFRANGE gladfgaw @c ENDOFRANGE adfugaw @c ENDOFRANGE fubadgaw @node Future Extensions @appendixsec Probable Future Extensions @ignore From emory!scalpel.netlabs.com!lwall Tue Oct 31 12:43:17 1995 Return-Path: Message-Id: <9510311732.AA28472@scalpel.netlabs.com> To: arnold@skeeve.atl.ga.us (Arnold D. Robbins) Subject: Re: May I quote you? In-Reply-To: Your message of "Tue, 31 Oct 95 09:11:00 EST." Date: Tue, 31 Oct 95 09:32:46 -0800 From: Larry Wall : Greetings. I am working on the release of gawk 3.0. Part of it will be a : thoroughly updated manual. One of the sections deals with planned future : extensions and enhancements. I have the following at the beginning : of it: : : @cindex PERL : @cindex Wall, Larry : @display : @i{AWK is a language similar to PERL, only considerably more elegant.} @* : Arnold Robbins : @sp 1 : @i{Hey!} @* : Larry Wall : @end display : : Before I actually release this for publication, I wanted to get your : permission to quote you. (Hopefully, in the spirit of much of GNU, the : implied humor is visible... :-) I think that would be fine. Larry @end ignore @cindex Perl @cindex Wall, Larry @cindex Robbins, Arnold @quotation @i{AWK is a language similar to PERL, only considerably more elegant.}@* Arnold Robbins @i{Hey!}@* Larry Wall @end quotation This @value{SECTION} briefly lists extensions and possible improvements that indicate the directions we are currently considering for @command{gawk}. The file @file{FUTURES} in the @command{gawk} distribution lists these extensions as well. Following is a list of probable future changes visible at the @command{awk} language level: @c these are ordered by likelihood @table @asis @item Loadable module interface It is not clear that the @command{awk}-level interface to the modules facility is as good as it should be. The interface needs to be redesigned, particularly taking namespace issues into account, as well as possibly including issues such as library search path order and versioning. @item @code{RECLEN} variable for fixed-length records Along with @code{FIELDWIDTHS}, this would speed up the processing of fixed-length records. @code{PROCINFO["RS"]} would be @code{"RS"} or @code{"RECLEN"}, depending upon which kind of record processing is in effect. @item Databases It may be possible to map a GDBM/NDBM/SDBM file into an @command{awk} array. @item More @code{lint} warnings There are more things that could be checked for portability. @end table Following is a list of probable improvements that will make @command{gawk}'s source code easier to work with: @table @asis @item Loadable module mechanics The current extension mechanism works (@pxref{Dynamic Extensions}), but is rather primitive. It requires a fair amount of manual work to create and integrate a loadable module. Nor is the current mechanism as portable as might be desired. The GNU @command{libtool} package provides a number of features that would make using loadable modules much easier. @command{gawk} should be changed to use @command{libtool}. @item Loadable module internals The API to its internals that @command{gawk} ``exports'' should be revised. Too many things are needlessly exposed. A new API should be designed and implemented to make module writing easier. @item Better array subscript management @command{gawk}'s management of array subscript storage could use revamping, so that using the same value to index multiple arrays only stores one copy of the index value. @end table Finally, the programs in the test suite could use documenting in this @value{DOCUMENT}. @xref{Additions}, if you are interested in tackling any of these projects. @c ENDOFRANGE impis @c ENDOFRANGE gawii @node Basic Concepts @appendix Basic Programming Concepts @cindex programming, concepts @c STARTOFRANGE procon @cindex programming, concepts This @value{APPENDIX} attempts to define some of the basic concepts and terms that are used throughout the rest of this @value{DOCUMENT}. As this @value{DOCUMENT} is specifically about @command{awk}, and not about computer programming in general, the coverage here is by necessity fairly cursory and simplistic. (If you need more background, there are many other introductory texts that you should refer to instead.) @menu * Basic High Level:: The high level view. * Basic Data Typing:: A very quick intro to data types. * Floating Point Issues:: Stuff to know about floating-point numbers. @end menu @node Basic High Level @appendixsec What a Program Does @cindex processing data At the most basic level, the job of a program is to process some input data and produce results. @iftex @image{general-program} @end iftex @ifnottex @example _______ +------+ / \ +---------+ | Data | -----> < Program > -----> | Results | +------+ \_______/ +---------+ @end example @end ifnottex @cindex compiled programs @cindex interpreted programs The ``program'' in the figure can be either a compiled program@footnote{Compiled programs are typically written in lower-level languages such as C, C++, or Ada, and then translated, or @dfn{compiled}, into a form that the computer can execute directly.} (such as @command{ls}), or it may be @dfn{interpreted}. In the latter case, a machine-executable program such as @command{awk} reads your program, and then uses the instructions in your program to process the data. @cindex programming, basic steps When you write a program, it usually consists of the following, very basic set of steps: @iftex @image{process-flow} @end iftex @ifnottex @example ______ +----------------+ / More \ No +----------+ | Initialization | -------> < Data > -------> | Clean Up | +----------------+ ^ \ ? / +----------+ | +--+-+ | | Yes | | | V | +---------+ +-----+ Process | +---------+ @end example @end ifnottex @table @asis @item Initialization These are the things you do before actually starting to process data, such as checking arguments, initializing any data you need to work with, and so on. This step corresponds to @command{awk}'s @code{BEGIN} rule (@pxref{BEGIN/END}). If you were baking a cake, this might consist of laying out all the mixing bowls and the baking pan, and making sure you have all the ingredients that you need. @item Processing This is where the actual work is done. Your program reads data, one logical chunk at a time, and processes it as appropriate. In most programming languages, you have to manually manage the reading of data, checking to see if there is more each time you read a chunk. @command{awk}'s pattern-action paradigm (@pxref{Getting Started}) handles the mechanics of this for you. In baking a cake, the processing corresponds to the actual labor: breaking eggs, mixing the flour, water, and other ingredients, and then putting the cake into the oven. @item Clean Up Once you've processed all the data, you may have things you need to do before exiting. This step corresponds to @command{awk}'s @code{END} rule (@pxref{BEGIN/END}). After the cake comes out of the oven, you still have to wrap it in plastic wrap to keep anyone from tasting it, as well as wash the mixing bowls and utensils. @end table @cindex algorithms An @dfn{algorithm} is a detailed set of instructions necessary to accomplish a task, or process data. It is much the same as a recipe for baking a cake. Programs implement algorithms. Often, it is up to you to design the algorithm and implement it, simultaneously. @cindex records @cindex fields The ``logical chunks'' we talked about previously are called @dfn{records}, similar to the records a company keeps on employees, a school keeps for students, or a doctor keeps for patients. Each record has many component parts, such as first and last names, date of birth, address, and so on. The component parts are referred to as the @dfn{fields} of the record. The act of reading data is termed @dfn{input}, and that of generating results, not too surprisingly, is termed @dfn{output}. They are often referred to together as ``input/output,'' and even more often, as ``I/O'' for short. (You will also see ``input'' and ``output'' used as verbs.) @cindex data-driven languages @cindex languages@comma{} data-driven @command{awk} manages the reading of data for you, as well as the breaking it up into records and fields. Your program's job is to tell @command{awk} what to do with the data. You do this by describing @dfn{patterns} in the data to look for, and @dfn{actions} to execute when those patterns are seen. This @dfn{data-driven} nature of @command{awk} programs usually makes them both easier to write and easier to read. @node Basic Data Typing @appendixsec Data Values in a Computer @cindex variables In a program, you keep track of information and values in things called @dfn{variables}. A variable is just a name for a given value, such as @code{first_name}, @code{last_name}, @code{address}, and so on. @command{awk} has several predefined variables, and it has special names to refer to the current input record and the fields of the record. You may also group multiple associated values under one name, as an array. @cindex values, numeric @cindex values, string @cindex scalar values Data, particularly in @command{awk}, consists of either numeric values, such as 42 or 3.1415927, or string values. String values are essentially anything that's not a number, such as a name. Strings are sometimes referred to as @dfn{character data}, since they store the individual characters that comprise them. Individual variables, as well as numeric and string variables, are referred to as @dfn{scalar} values. Groups of values, such as arrays, are not scalars. @cindex integers @cindex floating-point, numbers @cindex numbers, floating-point Within computers, there are two kinds of numeric values: @dfn{integers} and @dfn{floating-point}. In school, integer values were referred to as ``whole'' numbers---that is, numbers without any fractional part, such as 1, 42, or @minus{}17. The advantage to integer numbers is that they represent values exactly. The disadvantage is that their range is limited. On most systems, this range is @minus{}2,147,483,648 to 2,147,483,647. However, many systems now support a range from @minus{}9,223,372,036,854,775,808 to 9,223,372,036,854,775,807. @cindex unsigned integers @cindex integers, unsigned Integer values come in two flavors: @dfn{signed} and @dfn{unsigned}. Signed values may be negative or positive, with the range of values just described. Unsigned values are always positive. On most systems, the range is from 0 to 4,294,967,295. However, many systems now support a range from 0 to 18,446,744,073,709,551,615. @cindex double precision floating-point @cindex single precision floating-point Floating-point numbers represent what are called ``real'' numbers; i.e., those that do have a fractional part, such as 3.1415927. The advantage to floating-point numbers is that they can represent a much larger range of values. The disadvantage is that there are numbers that they cannot represent exactly. @command{awk} uses @dfn{double precision} floating-point numbers, which can hold more digits than @dfn{single precision} floating-point numbers. Floating-point issues are discussed more fully in @ref{Floating Point Issues}. At the very lowest level, computers store values as groups of binary digits, or @dfn{bits}. Modern computers group bits into groups of eight, called @dfn{bytes}. Advanced applications sometimes have to manipulate bits directly, and @command{gawk} provides functions for doing so. @cindex null strings While you are probably used to the idea of a number without a value (i.e., zero), it takes a bit more getting used to the idea of zero-length character data. Nevertheless, such a thing exists. It is called the @dfn{null string}. The null string is character data that has no value. In other words, it is empty. It is written in @command{awk} programs like this: @code{""}. Humans are used to working in decimal; i.e., base 10. In base 10, numbers go from 0 to 9, and then ``roll over'' into the next column. (Remember grade school? 42 is 4 times 10 plus 2.) There are other number bases though. Computers commonly use base 2 or @dfn{binary}, base 8 or @dfn{octal}, and base 16 or @dfn{hexadecimal}. In binary, each column represents two times the value in the column to its right. Each column may contain either a 0 or a 1. Thus, binary 1010 represents 1 times 8, plus 0 times 4, plus 1 times 2, plus 0 times 1, or decimal 10. Octal and hexadecimal are discussed more in @ref{Nondecimal-numbers}. Programs are written in programming languages. Hundreds, if not thousands, of programming languages exist. One of the most popular is the C programming language. The C language had a very strong influence on the design of the @command{awk} language. @cindex Kernighan, Brian @cindex Ritchie, Dennis There have been several versions of C. The first is often referred to as ``K&R'' C, after the initials of Brian Kernighan and Dennis Ritchie, the authors of the first book on C. (Dennis Ritchie created the language, and Brian Kernighan was one of the creators of @command{awk}.) In the mid-1980s, an effort began to produce an international standard for C. This work culminated in 1989, with the production of the ANSI standard for C. This standard became an ISO standard in 1990. In 1999, a revised ISO C standard was approved and released. Where it makes sense, POSIX @command{awk} is compatible with 1999 ISO C. @node Floating Point Issues @appendixsec Floating-Point Number Caveats As mentioned earlier, floating-point numbers represent what are called ``real'' numbers, i.e., those that have a fractional part. @command{awk} uses double precision floating-point numbers to represent all numeric values. This @value{SECTION} describes some of the issues involved in using floating-point numbers. There is a very nice @uref{http://www.validlab.com/goldberg/paper.pdf, paper on floating-point arithmetic} by David Goldberg, ``What Every Computer Scientist Should Know About Floating-point Arithmetic,'' @cite{ACM Computing Surveys} @strong{23}, 1 (1991-03), 5-48. This is worth reading if you are interested in the details, but it does require a background in computer science. @menu * String Conversion Precision:: The String Value Can Lie. * Unexpected Results:: Floating Point Numbers Are Not Abstract Numbers. * POSIX Floating Point Problems:: Standards Versus Existing Practice. @end menu @node String Conversion Precision @appendixsubsec The String Value Can Lie Internally, @command{awk} keeps both the numeric value (double precision floating-point) and the string value for a variable. Separately, @command{awk} keeps track of what type the variable has (@pxref{Typing and Comparison}), which plays a role in how variables are used in comparisons. It is important to note that the string value for a number may not reflect the full value (all the digits) that the numeric value actually contains. The following program (@file{values.awk}) illustrates this: @example @{ sum = $1 + $2 # see it for what it is printf("sum = %.12g\n", sum) # use CONVFMT a = "<" sum ">" print "a =", a # use OFMT print "sum =", sum @} @end example @noindent This program shows the full value of the sum of @code{$1} and @code{$2} using @code{printf}, and then prints the string values obtained from both automatic conversion (via @code{CONVFMT}) and from printing (via @code{OFMT}). Here is what happens when the program is run: @example $ @kbd{echo 3.654321 1.2345678 | awk -f values.awk} @print{} sum = 4.8888888 @print{} a = <4.88889> @print{} sum = 4.88889 @end example This makes it clear that the full numeric value is different from what the default string representations show. @code{CONVFMT}'s default value is @code{"%.6g"}, which yields a value with at least six significant digits. For some applications, you might want to change it to specify more precision. On most modern machines, most of the time, 17 digits is enough to capture a floating-point number's value exactly.@footnote{Pathological cases can require up to 752 digits (!), but we doubt that you need to worry about this.} @node Unexpected Results @appendixsubsec Floating Point Numbers Are Not Abstract Numbers @cindex floating-point, numbers Unlike numbers in the abstract sense (such as what you studied in high school or college math), numbers stored in computers are limited in certain ways. They cannot represent an infinite number of digits, nor can they always represent things exactly. In particular, floating-point numbers cannot always represent values exactly. Here is an example: @example $ @kbd{awk '@{ printf("%010d\n", $1 * 100) @}'} 515.79 @print{} 0000051579 515.80 @print{} 0000051579 515.81 @print{} 0000051580 515.82 @print{} 0000051582 @kbd{@value{CTL}-d} @end example @noindent This shows that some values can be represented exactly, whereas others are only approximated. This is not a ``bug'' in @command{awk}, but simply an artifact of how computers represent numbers. @cindex negative zero @cindex positive zero @cindex zero@comma{} negative vs.@: positive Another peculiarity of floating-point numbers on modern systems is that they often have more than one representation for the number zero! In particular, it is possible to represent ``minus zero'' as well as regular, or ``positive'' zero. This example shows that negative and positive zero are distinct values when stored internally, but that they are in fact equal to each other, as well as to ``regular'' zero: @example $ @kbd{gawk 'BEGIN @{ mz = -0 ; pz = 0} > @kbd{printf "-0 = %g, +0 = %g, (-0 == +0) -> %d\n", mz, pz, mz == pz} > @kbd{printf "mz == 0 -> %d, pz == 0 -> %d\n", mz == 0, pz == 0} > @kbd{@}'} @print{} -0 = -0, +0 = 0, (-0 == +0) -> 1 @print{} mz == 0 -> 1, pz == 0 -> 1 @end example It helps to keep this in mind should you process numeric data that contains negative zero values; the fact that the zero is negative is noted and can affect comparisons. @node POSIX Floating Point Problems @appendixsubsec Standards Versus Existing Practice Historically, @command{awk} has converted any non-numeric looking string to the numeric value zero, when required. Furthermore, the original definition of the language and the original POSIX standards specified that @command{awk} only understands decimal numbers (base 10), and not octal (base 8) or hexadecimal numbers (base 16). Changes in the language of the 2001 and 2004 POSIX standard can be interpreted to imply that @command{awk} should support additional features. These features are: @itemize @bullet @item Interpretation of floating point data values specified in hexadecimal notation (@samp{0xDEADBEEF}). (Note: data values, @emph{not} source code constants.) @item Support for the special IEEE 754 floating point values ``Not A Number'' (NaN), positive Infinity (``inf'') and negative Infinity (``@minus{}inf''). In particular, the format for these values is as specified by the ISO 1999 C standard, which ignores case and can allow machine-dependent additional characters after the @samp{nan} and allow either @samp{inf} or @samp{infinity}. @end itemize The first problem is that both of these are clear changes to historical practice: @itemize @bullet @item The @command{gawk} maintainer feels that supporting hexadecimal floating point values, in particular, is ugly, and was never intended by the original designers to be part of the language. @item Allowing completely alphabetic strings to have valid numeric values is also a very severe departure from historical practice. @end itemize The second problem is that the @code{gawk} maintainer feels that this interpretation of the standard, which requires a certain amount of ``language lawyering'' to arrive at in the first place, was not even intended by the standard developers. In other words, ``we see how you got where you are, but we don't think that that's where you want to be.'' The 2008 POSIX standard added explicit wording to allow, but not require, that @command{awk} support hexadecimal floating point values and special values for ``Not A Number'' and infinity. Although the @command{gawk} maintainer continues to feel that providing those features is inadvisable, nevertheless, on systems that support IEEE floating point, it seems reasonable to provide @emph{some} way to support NaN and Infinity values. The solution implemented in @command{gawk} is as follows: @itemize @bullet @item With the @option{--posix} command-line option, @command{gawk} becomes ``hands off.'' String values are passed directly to the system library's @code{strtod()} function, and if it successfully returns a numeric value, that is what's used.@footnote{You asked for it, you got it.} By definition, the results are not portable across different systems. They are also a little surprising: @example $ @kbd{echo nanny | gawk --posix '@{ print $1 + 0 @}'} @print{} nan $ @kbd{echo 0xDeadBeef | gawk --posix '@{ print $1 + 0 @}'} @print{} 3735928559 @end example @item Without @option{--posix}, @command{gawk} interprets the four strings @samp{+inf}, @samp{-inf}, @samp{+nan}, and @samp{-nan} specially, producing the corresponding special numeric values. The leading sign acts a signal to @command{gawk} (and the user) that the value is really numeric. Hexadecimal floating point is not supported (unless you also use @option{--non-decimal-data}, which is @emph{not} recommended). For example: @example $ @kbd{echo nanny | gawk '@{ print $1 + 0 @}'} @print{} 0 $ @kbd{echo +nan | gawk '@{ print $1 + 0 @}'} @print{} nan $ @kbd{echo 0xDeadBeef | gawk '@{ print $1 + 0 @}'} @print{} 0 @end example @command{gawk} does ignore case in the four special values. Thus @samp{+nan} and @samp{+NaN} are the same. @end itemize @c ENDOFRANGE procon @node Glossary @unnumbered Glossary @table @asis @item Action A series of @command{awk} statements attached to a rule. If the rule's pattern matches an input record, @command{awk} executes the rule's action. Actions are always enclosed in curly braces. (@xref{Action Overview}.) @cindex Spencer, Henry @cindex @command{sed} utility @cindex amazing @command{awk} assembler (@command{aaa}) @item Amazing @command{awk} Assembler Henry Spencer at the University of Toronto wrote a retargetable assembler completely as @command{sed} and @command{awk} scripts. It is thousands of lines long, including machine descriptions for several eight-bit microcomputers. It is a good example of a program that would have been better written in another language. You can get it from @uref{http://awk.info/?awk100/aaa}. @cindex Ada programming language @cindex Programming languages, Ada @item Ada A programming language originally defined by the U.S.@: Department of Defense for embedded programming. It was designed to enforce good Software Engineering practices. @cindex amazingly workable formatter (@command{awf}) @cindex @command{awf} (amazingly workable formatter) program @item Amazingly Workable Formatter (@command{awf}) Henry Spencer at the University of Toronto wrote a formatter that accepts a large subset of the @samp{nroff -ms} and @samp{nroff -man} formatting commands, using @command{awk} and @command{sh}. It is available from @uref{http://awk.info/?tools/awf}. @item Anchor The regexp metacharacters @samp{^} and @samp{$}, which force the match to the beginning or end of the string, respectively. @cindex ANSI @item ANSI The American National Standards Institute. This organization produces many standards, among them the standards for the C and C++ programming languages. These standards often become international standards as well. See also ``ISO.'' @item Array A grouping of multiple values under the same name. Most languages just provide sequential arrays. @command{awk} provides associative arrays. @item Assertion A statement in a program that a condition is true at this point in the program. Useful for reasoning about how a program is supposed to behave. @item Assignment An @command{awk} expression that changes the value of some @command{awk} variable or data object. An object that you can assign to is called an @dfn{lvalue}. The assigned values are called @dfn{rvalues}. @xref{Assignment Ops}. @item Associative Array Arrays in which the indices may be numbers or strings, not just sequential integers in a fixed range. @item @command{awk} Language The language in which @command{awk} programs are written. @item @command{awk} Program An @command{awk} program consists of a series of @dfn{patterns} and @dfn{actions}, collectively known as @dfn{rules}. For each input record given to the program, the program's rules are all processed in turn. @command{awk} programs may also contain function definitions. @item @command{awk} Script Another name for an @command{awk} program. @item Bash The GNU version of the standard shell @ifnotinfo (the @b{B}ourne-@b{A}gain @b{SH}ell). @end ifnotinfo @ifinfo (the Bourne-Again SHell). @end ifinfo See also ``Bourne Shell.'' @item BBS See ``Bulletin Board System.'' @item Bit Short for ``Binary Digit.'' All values in computer memory ultimately reduce to binary digits: values that are either zero or one. Groups of bits may be interpreted differently---as integers, floating-point numbers, character data, addresses of other memory objects, or other data. @command{awk} lets you work with floating-point numbers and strings. @command{gawk} lets you manipulate bit values with the built-in functions described in @ref{Bitwise Functions}. Computers are often defined by how many bits they use to represent integer values. Typical systems are 32-bit systems, but 64-bit systems are becoming increasingly popular, and 16-bit systems have essentially disappeared. @item Boolean Expression Named after the English mathematician Boole. See also ``Logical Expression.'' @item Bourne Shell The standard shell (@file{/bin/sh}) on Unix and Unix-like systems, originally written by Steven R.@: Bourne. Many shells (Bash, @command{ksh}, @command{pdksh}, @command{zsh}) are generally upwardly compatible with the Bourne shell. @item Built-in Function The @command{awk} language provides built-in functions that perform various numerical, I/O-related, and string computations. Examples are @code{sqrt()} (for the square root of a number) and @code{substr()} (for a substring of a string). @command{gawk} provides functions for timestamp management, bit manipulation, array sorting, type checking, and runtime string translation. (@xref{Built-in}.) @item Built-in Variable @code{ARGC}, @code{ARGV}, @code{CONVFMT}, @code{ENVIRON}, @code{FILENAME}, @code{FNR}, @code{FS}, @code{NF}, @code{NR}, @code{OFMT}, @code{OFS}, @code{ORS}, @code{RLENGTH}, @code{RSTART}, @code{RS}, and @code{SUBSEP} are the variables that have special meaning to @command{awk}. In addition, @code{ARGIND}, @code{BINMODE}, @code{ERRNO}, @code{FIELDWIDTHS}, @code{FPAT}, @code{IGNORECASE}, @code{LINT}, @code{PROCINFO}, @code{RT}, and @code{TEXTDOMAIN} are the variables that have special meaning to @command{gawk}. Changing some of them affects @command{awk}'s running environment. (@xref{Built-in Variables}.) @item Braces See ``Curly Braces.'' @item Bulletin Board System A computer system allowing users to log in and read and/or leave messages for other users of the system, much like leaving paper notes on a bulletin board. @item C The system programming language that most GNU software is written in. The @command{awk} programming language has C-like syntax, and this @value{DOCUMENT} points out similarities between @command{awk} and C when appropriate. In general, @command{gawk} attempts to be as similar to the 1990 version of ISO C as makes sense. @item C++ A popular object-oriented programming language derived from C. @cindex ASCII @cindex ISO 8859-1 @cindex ISO Latin-1 @cindex character sets (machine character encodings) @cindex Unicode @item Character Set The set of numeric codes used by a computer system to represent the characters (letters, numbers, punctuation, etc.) of a particular country or place. The most common character set in use today is ASCII (American Standard Code for Information Interchange). Many European countries use an extension of ASCII known as ISO-8859-1 (ISO Latin-1). The @uref{http://www.unicode.org, Unicode character set} is becoming increasingly popular and standard, and is particularly widely used on GNU/Linux systems. @cindex @command{chem} utility @item CHEM A preprocessor for @command{pic} that reads descriptions of molecules and produces @command{pic} input for drawing them. It was written in @command{awk} by Brian Kernighan and Jon Bentley, and is available from @uref{http://netlib.sandia.gov/netlib/typesetting/chem.gz}. @item Coprocess A subordinate program with which two-way communications is possible. @cindex compiled programs @item Compiler A program that translates human-readable source code into machine-executable object code. The object code is then executed directly by the computer. See also ``Interpreter.'' @item Compound Statement A series of @command{awk} statements, enclosed in curly braces. Compound statements may be nested. (@xref{Statements}.) @item Concatenation Concatenating two strings means sticking them together, one after another, producing a new string. For example, the string @samp{foo} concatenated with the string @samp{bar} gives the string @samp{foobar}. (@xref{Concatenation}.) @item Conditional Expression An expression using the @samp{?:} ternary operator, such as @samp{@var{expr1} ? @var{expr2} : @var{expr3}}. The expression @var{expr1} is evaluated; if the result is true, the value of the whole expression is the value of @var{expr2}; otherwise the value is @var{expr3}. In either case, only one of @var{expr2} and @var{expr3} is evaluated. (@xref{Conditional Exp}.) @item Comparison Expression A relation that is either true or false, such as @samp{a < b}. Comparison expressions are used in @code{if}, @code{while}, @code{do}, and @code{for} statements, and in patterns to select which input records to process. (@xref{Typing and Comparison}.) @item Curly Braces The characters @samp{@{} and @samp{@}}. Curly braces are used in @command{awk} for delimiting actions, compound statements, and function bodies. @cindex dark corner @item Dark Corner An area in the language where specifications often were (or still are) not clear, leading to unexpected or undesirable behavior. Such areas are marked in this @value{DOCUMENT} with @iftex the picture of a flashlight in the margin @end iftex @ifnottex ``(d.c.)'' in the text @end ifnottex and are indexed under the heading ``dark corner.'' @item Data Driven A description of @command{awk} programs, where you specify the data you are interested in processing, and what to do when that data is seen. @item Data Objects These are numbers and strings of characters. Numbers are converted into strings and vice versa, as needed. (@xref{Conversion}.) @item Deadlock The situation in which two communicating processes are each waiting for the other to perform an action. @item Debugger A program used to help developers remove ``bugs'' from (de-bug) their programs. @item Double Precision An internal representation of numbers that can have fractional parts. Double precision numbers keep track of more digits than do single precision numbers, but operations on them are sometimes more expensive. This is the way @command{awk} stores numeric values. It is the C type @code{double}. @item Dynamic Regular Expression A dynamic regular expression is a regular expression written as an ordinary expression. It could be a string constant, such as @code{"foo"}, but it may also be an expression whose value can vary. (@xref{Computed Regexps}.) @item Environment A collection of strings, of the form @var{name@code{=}val}, that each program has available to it. Users generally place values into the environment in order to provide information to various programs. Typical examples are the environment variables @env{HOME} and @env{PATH}. @item Empty String See ``Null String.'' @cindex epoch, definition of @item Epoch The date used as the ``beginning of time'' for timestamps. Time values in most systems are represented as seconds since the epoch, with library functions available for converting these values into standard date and time formats. The epoch on Unix and POSIX systems is 1970-01-01 00:00:00 UTC. See also ``GMT'' and ``UTC.'' @item Escape Sequences A special sequence of characters used for describing nonprinting characters, such as @samp{\n} for newline or @samp{\033} for the ASCII ESC (Escape) character. (@xref{Escape Sequences}.) @item Extension An additional feature or change to a programming language or utility not defined by that language's or utility's standard. @command{gawk} has (too) many extensions over POSIX @command{awk}. @item FDL See ``Free Documentation License.'' @item Field When @command{awk} reads an input record, it splits the record into pieces separated by whitespace (or by a separator regexp that you can change by setting the built-in variable @code{FS}). Such pieces are called fields. If the pieces are of fixed length, you can use the built-in variable @code{FIELDWIDTHS} to describe their lengths. If you wish to specify the contents of fields instead of the field separator, you can use the built-in variable @code{FPAT} to do so. (@xref{Field Separators}, @ref{Constant Size}, and @ref{Splitting By Content}.) @item Flag A variable whose truth value indicates the existence or nonexistence of some condition. @item Floating-Point Number Often referred to in mathematical terms as a ``rational'' or real number, this is just a number that can have a fractional part. See also ``Double Precision'' and ``Single Precision.'' @item Format Format strings are used to control the appearance of output in the @code{strftime()} and @code{sprintf()} functions, and are used in the @code{printf} statement as well. Also, data conversions from numbers to strings are controlled by the format strings contained in the built-in variables @code{CONVFMT} and @code{OFMT}. (@xref{Control Letters}.) @item Free Documentation License This document describes the terms under which this @value{DOCUMENT} is published and may be copied. (@xref{GNU Free Documentation License}.) @item Function A specialized group of statements used to encapsulate general or program-specific tasks. @command{awk} has a number of built-in functions, and also allows you to define your own. (@xref{Functions}.) @item FSF See ``Free Software Foundation.'' @cindex FSF (Free Software Foundation) @cindex Free Software Foundation (FSF) @cindex Stallman, Richard @item Free Software Foundation A nonprofit organization dedicated to the production and distribution of freely distributable software. It was founded by Richard M.@: Stallman, the author of the original Emacs editor. GNU Emacs is the most widely used version of Emacs today. @item @command{gawk} The GNU implementation of @command{awk}. @cindex GPL (General Public License) @cindex General Public License (GPL) @cindex GNU General Public License @item General Public License This document describes the terms under which @command{gawk} and its source code may be distributed. (@xref{Copying}.) @item GMT ``Greenwich Mean Time.'' This is the old term for UTC. It is the time of day used internally for Unix and POSIX systems. See also ``Epoch'' and ``UTC.'' @cindex FSF (Free Software Foundation) @cindex Free Software Foundation (FSF) @cindex GNU Project @item GNU ``GNU's not Unix''. An on-going project of the Free Software Foundation to create a complete, freely distributable, POSIX-compliant computing environment. @item GNU/Linux A variant of the GNU system using the Linux kernel, instead of the Free Software Foundation's Hurd kernel. The Linux kernel is a stable, efficient, full-featured clone of Unix that has been ported to a variety of architectures. It is most popular on PC-class systems, but runs well on a variety of other systems too. The Linux kernel source code is available under the terms of the GNU General Public License, which is perhaps its most important aspect. @item GPL See ``General Public License.'' @item Hexadecimal Base 16 notation, where the digits are @code{0}--@code{9} and @code{A}--@code{F}, with @samp{A} representing 10, @samp{B} representing 11, and so on, up to @samp{F} for 15. Hexadecimal numbers are written in C using a leading @samp{0x}, to indicate their base. Thus, @code{0x12} is 18 (1 times 16 plus 2). @xref{Nondecimal-numbers}. @item I/O Abbreviation for ``Input/Output,'' the act of moving data into and/or out of a running program. @item Input Record A single chunk of data that is read in by @command{awk}. Usually, an @command{awk} input record consists of one line of text. (@xref{Records}.) @item Integer A whole number, i.e., a number that does not have a fractional part. @item Internationalization The process of writing or modifying a program so that it can use multiple languages without requiring further source code changes. @cindex interpreted programs @item Interpreter A program that reads human-readable source code directly, and uses the instructions in it to process data and produce results. @command{awk} is typically (but not always) implemented as an interpreter. See also ``Compiler.'' @item Interval Expression A component of a regular expression that lets you specify repeated matches of some part of the regexp. Interval expressions were not originally available in @command{awk} programs. @cindex ISO @item ISO The International Standards Organization. This organization produces international standards for many things, including programming languages, such as C and C++. In the computer arena, important standards like those for C, C++, and POSIX become both American national and ISO international standards simultaneously. This @value{DOCUMENT} refers to Standard C as ``ISO C'' throughout. @cindex Java programming language @cindex Programming languages, Java @item Java A modern programming language originally developed by Sun Microsystems (now Oracle) supporting Object-Oriented programming. Although usually implemented by compiling to the instructions for a standard virtual machine (the JVM), the language can be compiled to native code. @item Keyword In the @command{awk} language, a keyword is a word that has special meaning. Keywords are reserved and may not be used as variable names. @command{gawk}'s keywords are: @code{BEGIN}, @code{BEGINFILE}, @code{END}, @code{ENDFILE}, @code{break}, @code{case}, @code{continue}, @code{default} @code{delete}, @code{do@dots{}while}, @code{else}, @code{exit}, @code{for@dots{}in}, @code{for}, @code{function}, @code{func}, @code{if}, @code{nextfile}, @code{next}, @code{switch}, and @code{while}. @cindex LGPL (Lesser General Public License) @cindex Lesser General Public License (LGPL) @cindex GNU Lesser General Public License @item Lesser General Public License This document describes the terms under which binary library archives or shared objects, and their source code may be distributed. @item Linux See ``GNU/Linux.'' @item LGPL See ``Lesser General Public License.'' @item Localization The process of providing the data necessary for an internationalized program to work in a particular language. @item Logical Expression An expression using the operators for logic, AND, OR, and NOT, written @samp{&&}, @samp{||}, and @samp{!} in @command{awk}. Often called Boolean expressions, after the mathematician who pioneered this kind of mathematical logic. @item Lvalue An expression that can appear on the left side of an assignment operator. In most languages, lvalues can be variables or array elements. In @command{awk}, a field designator can also be used as an lvalue. @item Matching The act of testing a string against a regular expression. If the regexp describes the contents of the string, it is said to @dfn{match} it. @item Metacharacters Characters used within a regexp that do not stand for themselves. Instead, they denote regular expression operations, such as repetition, grouping, or alternation. @item No-op An operation that does nothing. @item Null String A string with no characters in it. It is represented explicitly in @command{awk} programs by placing two double quote characters next to each other (@code{""}). It can appear in input data by having two successive occurrences of the field separator appear next to each other. @item Number A numeric-valued data object. Modern @command{awk} implementations use double precision floating-point to represent numbers. Ancient @command{awk} implementations used single precision floating-point. @item Octal Base-eight notation, where the digits are @code{0}--@code{7}. Octal numbers are written in C using a leading @samp{0}, to indicate their base. Thus, @code{013} is 11 (one times 8 plus 3). @xref{Nondecimal-numbers}. @cindex P1003.1 POSIX standard @cindex P1003.2 POSIX standard @item P1003.1, P1003.2 See ``POSIX.'' @item Pattern Patterns tell @command{awk} which input records are interesting to which rules. A pattern is an arbitrary conditional expression against which input is tested. If the condition is satisfied, the pattern is said to @dfn{match} the input record. A typical pattern might compare the input record against a regular expression. (@xref{Pattern Overview}.) @item POSIX The name for a series of standards @c being developed by the IEEE that specify a Portable Operating System interface. The ``IX'' denotes the Unix heritage of these standards. The main standard of interest for @command{awk} users is @cite{IEEE Standard for Information Technology, Standard 1003.1-2008}. The 2008 POSIX standard can be found online at @url{http://www.opengroup.org/onlinepubs/9699919799/}. @item Precedence The order in which operations are performed when operators are used without explicit parentheses. @item Private Variables and/or functions that are meant for use exclusively by library functions and not for the main @command{awk} program. Special care must be taken when naming such variables and functions. (@xref{Library Names}.) @item Range (of input lines) A sequence of consecutive lines from the input file(s). A pattern can specify ranges of input lines for @command{awk} to process or it can specify single lines. (@xref{Pattern Overview}.) @item Recursion When a function calls itself, either directly or indirectly. As long as this is not clear, refer to the entry for ``recursion.'' If this is clear, stop, and proceed to the next entry. @item Redirection Redirection means performing input from something other than the standard input stream, or performing output to something other than the standard output stream. You can redirect input to the @code{getline} statement using the @samp{<}, @samp{|}, and @samp{|&} operators. You can redirect the output of the @code{print} and @code{printf} statements to a file or a system command, using the @samp{>}, @samp{>>}, @samp{|}, and @samp{|&} operators. (@xref{Getline}, and @ref{Redirection}.) @item Regexp See ``Regular Expression.'' @item Regular Expression A regular expression (``regexp'' for short) is a pattern that denotes a set of strings, possibly an infinite set. For example, the regular expression @samp{R.*xp} matches any string starting with the letter @samp{R} and ending with the letters @samp{xp}. In @command{awk}, regular expressions are used in patterns and in conditional expressions. Regular expressions may contain escape sequences. (@xref{Regexp}.) @item Regular Expression Constant A regular expression constant is a regular expression written within slashes, such as @code{/foo/}. This regular expression is chosen when you write the @command{awk} program and cannot be changed during its execution. (@xref{Regexp Usage}.) @item Rule A segment of an @command{awk} program that specifies how to process single input records. A rule consists of a @dfn{pattern} and an @dfn{action}. @command{awk} reads an input record; then, for each rule, if the input record satisfies the rule's pattern, @command{awk} executes the rule's action. Otherwise, the rule does nothing for that input record. @item Rvalue A value that can appear on the right side of an assignment operator. In @command{awk}, essentially every expression has a value. These values are rvalues. @item Scalar A single value, be it a number or a string. Regular variables are scalars; arrays and functions are not. @item Search Path In @command{gawk}, a list of directories to search for @command{awk} program source files. In the shell, a list of directories to search for executable programs. @item Seed The initial value, or starting point, for a sequence of random numbers. @item @command{sed} See ``Stream Editor.'' @item Shell The command interpreter for Unix and POSIX-compliant systems. The shell works both interactively, and as a programming language for batch files, or shell scripts. @item Short-Circuit The nature of the @command{awk} logical operators @samp{&&} and @samp{||}. If the value of the entire expression is determinable from evaluating just the lefthand side of these operators, the righthand side is not evaluated. (@xref{Boolean Ops}.) @item Side Effect A side effect occurs when an expression has an effect aside from merely producing a value. Assignment expressions, increment and decrement expressions, and function calls have side effects. (@xref{Assignment Ops}.) @item Single Precision An internal representation of numbers that can have fractional parts. Single precision numbers keep track of fewer digits than do double precision numbers, but operations on them are sometimes less expensive in terms of CPU time. This is the type used by some very old versions of @command{awk} to store numeric values. It is the C type @code{float}. @item Space The character generated by hitting the space bar on the keyboard. @item Special File A @value{FN} interpreted internally by @command{gawk}, instead of being handed directly to the underlying operating system---for example, @file{/dev/stderr}. (@xref{Special Files}.) @item Stream Editor A program that reads records from an input stream and processes them one or more at a time. This is in contrast with batch programs, which may expect to read their input files in entirety before starting to do anything, as well as with interactive programs which require input from the user. @item String A datum consisting of a sequence of characters, such as @samp{I am a string}. Constant strings are written with double quotes in the @command{awk} language and may contain escape sequences. (@xref{Escape Sequences}.) @item Tab The character generated by hitting the @kbd{TAB} key on the keyboard. It usually expands to up to eight spaces upon output. @item Text Domain A unique name that identifies an application. Used for grouping messages that are translated at runtime into the local language. @item Timestamp A value in the ``seconds since the epoch'' format used by Unix and POSIX systems. Used for the @command{gawk} functions @code{mktime()}, @code{strftime()}, and @code{systime()}. See also ``Epoch'' and ``UTC.'' @cindex Linux @cindex GNU/Linux @cindex Unix @cindex BSD-based operating systems @cindex NetBSD @cindex FreeBSD @cindex OpenBSD @item Unix A computer operating system originally developed in the early 1970's at AT&T Bell Laboratories. It initially became popular in universities around the world and later moved into commercial environments as a software development system and network server system. There are many commercial versions of Unix, as well as several work-alike systems whose source code is freely available (such as GNU/Linux, @uref{http://www.netbsd.org, NetBSD}, @uref{http://www.freebsd.org, FreeBSD}, and @uref{http://www.openbsd.org, OpenBSD}). @item UTC The accepted abbreviation for ``Universal Coordinated Time.'' This is standard time in Greenwich, England, which is used as a reference time for day and date calculations. See also ``Epoch'' and ``GMT.'' @item Whitespace A sequence of space, TAB, or newline characters occurring inside an input record or a string. @end table @c The GNU General Public License. @node Copying @unnumbered GNU General Public License @center Version 3, 29 June 2007 @c This file is intended to be included within another document, @c hence no sectioning command or @node. @display Copyright @copyright{} 2007 Free Software Foundation, Inc. @url{http://fsf.org/} Everyone is permitted to copy and distribute verbatim copies of this license document, but changing it is not allowed. @end display @c fakenode --- for prepinfo @heading Preamble The GNU General Public License is a free, copyleft license for software and other kinds of works. The licenses for most software and other practical works are designed to take away your freedom to share and change the works. By contrast, the GNU General Public License is intended to guarantee your freedom to share and change all versions of a program---to make sure it remains free software for all its users. We, the Free Software Foundation, use the GNU General Public License for most of our software; it applies also to any other work released this way by its authors. You can apply it to your programs, too. When we speak of free software, we are referring to freedom, not price. Our General Public Licenses are designed to make sure that you have the freedom to distribute copies of free software (and charge for them if you wish), that you receive source code or can get it if you want it, that you can change the software or use pieces of it in new free programs, and that you know you can do these things. To protect your rights, we need to prevent others from denying you these rights or asking you to surrender the rights. Therefore, you have certain responsibilities if you distribute copies of the software, or if you modify it: responsibilities to respect the freedom of others. For example, if you distribute copies of such a program, whether gratis or for a fee, you must pass on to the recipients the same freedoms that you received. You must make sure that they, too, receive or can get the source code. And you must show them these terms so they know their rights. Developers that use the GNU GPL protect your rights with two steps: (1) assert copyright on the software, and (2) offer you this License giving you legal permission to copy, distribute and/or modify it. For the developers' and authors' protection, the GPL clearly explains that there is no warranty for this free software. For both users' and authors' sake, the GPL requires that modified versions be marked as changed, so that their problems will not be attributed erroneously to authors of previous versions. Some devices are designed to deny users access to install or run modified versions of the software inside them, although the manufacturer can do so. This is fundamentally incompatible with the aim of protecting users' freedom to change the software. The systematic pattern of such abuse occurs in the area of products for individuals to use, which is precisely where it is most unacceptable. Therefore, we have designed this version of the GPL to prohibit the practice for those products. If such problems arise substantially in other domains, we stand ready to extend this provision to those domains in future versions of the GPL, as needed to protect the freedom of users. Finally, every program is threatened constantly by software patents. States should not allow patents to restrict development and use of software on general-purpose computers, but in those that do, we wish to avoid the special danger that patents applied to a free program could make it effectively proprietary. To prevent this, the GPL assures that patents cannot be used to render the program non-free. The precise terms and conditions for copying, distribution and modification follow. @c fakenode --- for prepinfo @heading TERMS AND CONDITIONS @enumerate 0 @item Definitions. ``This License'' refers to version 3 of the GNU General Public License. ``Copyright'' also means copyright-like laws that apply to other kinds of works, such as semiconductor masks. ``The Program'' refers to any copyrightable work licensed under this License. Each licensee is addressed as ``you''. ``Licensees'' and ``recipients'' may be individuals or organizations. To ``modify'' a work means to copy from or adapt all or part of the work in a fashion requiring copyright permission, other than the making of an exact copy. The resulting work is called a ``modified version'' of the earlier work or a work ``based on'' the earlier work. A ``covered work'' means either the unmodified Program or a work based on the Program. To ``propagate'' a work means to do anything with it that, without permission, would make you directly or secondarily liable for infringement under applicable copyright law, except executing it on a computer or modifying a private copy. Propagation includes copying, distribution (with or without modification), making available to the public, and in some countries other activities as well. To ``convey'' a work means any kind of propagation that enables other parties to make or receive copies. Mere interaction with a user through a computer network, with no transfer of a copy, is not conveying. An interactive user interface displays ``Appropriate Legal Notices'' to the extent that it includes a convenient and prominently visible feature that (1) displays an appropriate copyright notice, and (2) tells the user that there is no warranty for the work (except to the extent that warranties are provided), that licensees may convey the work under this License, and how to view a copy of this License. If the interface presents a list of user commands or options, such as a menu, a prominent item in the list meets this criterion. @item Source Code. The ``source code'' for a work means the preferred form of the work for making modifications to it. ``Object code'' means any non-source form of a work. A ``Standard Interface'' means an interface that either is an official standard defined by a recognized standards body, or, in the case of interfaces specified for a particular programming language, one that is widely used among developers working in that language. The ``System Libraries'' of an executable work include anything, other than the work as a whole, that (a) is included in the normal form of packaging a Major Component, but which is not part of that Major Component, and (b) serves only to enable use of the work with that Major Component, or to implement a Standard Interface for which an implementation is available to the public in source code form. A ``Major Component'', in this context, means a major essential component (kernel, window system, and so on) of the specific operating system (if any) on which the executable work runs, or a compiler used to produce the work, or an object code interpreter used to run it. The ``Corresponding Source'' for a work in object code form means all the source code needed to generate, install, and (for an executable work) run the object code and to modify the work, including scripts to control those activities. However, it does not include the work's System Libraries, or general-purpose tools or generally available free programs which are used unmodified in performing those activities but which are not part of the work. For example, Corresponding Source includes interface definition files associated with source files for the work, and the source code for shared libraries and dynamically linked subprograms that the work is specifically designed to require, such as by intimate data communication or control flow between those subprograms and other parts of the work. The Corresponding Source need not include anything that users can regenerate automatically from other parts of the Corresponding Source. The Corresponding Source for a work in source code form is that same work. @item Basic Permissions. All rights granted under this License are granted for the term of copyright on the Program, and are irrevocable provided the stated conditions are met. This License explicitly affirms your unlimited permission to run the unmodified Program. The output from running a covered work is covered by this License only if the output, given its content, constitutes a covered work. This License acknowledges your rights of fair use or other equivalent, as provided by copyright law. You may make, run and propagate covered works that you do not convey, without conditions so long as your license otherwise remains in force. You may convey covered works to others for the sole purpose of having them make modifications exclusively for you, or provide you with facilities for running those works, provided that you comply with the terms of this License in conveying all material for which you do not control copyright. Those thus making or running the covered works for you must do so exclusively on your behalf, under your direction and control, on terms that prohibit them from making any copies of your copyrighted material outside their relationship with you. Conveying under any other circumstances is permitted solely under the conditions stated below. Sublicensing is not allowed; section 10 makes it unnecessary. @item Protecting Users' Legal Rights From Anti-Circumvention Law. No covered work shall be deemed part of an effective technological measure under any applicable law fulfilling obligations under article 11 of the WIPO copyright treaty adopted on 20 December 1996, or similar laws prohibiting or restricting circumvention of such measures. When you convey a covered work, you waive any legal power to forbid circumvention of technological measures to the extent such circumvention is effected by exercising rights under this License with respect to the covered work, and you disclaim any intention to limit operation or modification of the work as a means of enforcing, against the work's users, your or third parties' legal rights to forbid circumvention of technological measures. @item Conveying Verbatim Copies. You may convey verbatim copies of the Program's source code as you receive it, in any medium, provided that you conspicuously and appropriately publish on each copy an appropriate copyright notice; keep intact all notices stating that this License and any non-permissive terms added in accord with section 7 apply to the code; keep intact all notices of the absence of any warranty; and give all recipients a copy of this License along with the Program. You may charge any price or no price for each copy that you convey, and you may offer support or warranty protection for a fee. @item Conveying Modified Source Versions. You may convey a work based on the Program, or the modifications to produce it from the Program, in the form of source code under the terms of section 4, provided that you also meet all of these conditions: @enumerate a @item The work must carry prominent notices stating that you modified it, and giving a relevant date. @item The work must carry prominent notices stating that it is released under this License and any conditions added under section 7. This requirement modifies the requirement in section 4 to ``keep intact all notices''. @item You must license the entire work, as a whole, under this License to anyone who comes into possession of a copy. This License will therefore apply, along with any applicable section 7 additional terms, to the whole of the work, and all its parts, regardless of how they are packaged. This License gives no permission to license the work in any other way, but it does not invalidate such permission if you have separately received it. @item If the work has interactive user interfaces, each must display Appropriate Legal Notices; however, if the Program has interactive interfaces that do not display Appropriate Legal Notices, your work need not make them do so. @end enumerate A compilation of a covered work with other separate and independent works, which are not by their nature extensions of the covered work, and which are not combined with it such as to form a larger program, in or on a volume of a storage or distribution medium, is called an ``aggregate'' if the compilation and its resulting copyright are not used to limit the access or legal rights of the compilation's users beyond what the individual works permit. Inclusion of a covered work in an aggregate does not cause this License to apply to the other parts of the aggregate. @item Conveying Non-Source Forms. You may convey a covered work in object code form under the terms of sections 4 and 5, provided that you also convey the machine-readable Corresponding Source under the terms of this License, in one of these ways: @enumerate a @item Convey the object code in, or embodied in, a physical product (including a physical distribution medium), accompanied by the Corresponding Source fixed on a durable physical medium customarily used for software interchange. @item Convey the object code in, or embodied in, a physical product (including a physical distribution medium), accompanied by a written offer, valid for at least three years and valid for as long as you offer spare parts or customer support for that product model, to give anyone who possesses the object code either (1) a copy of the Corresponding Source for all the software in the product that is covered by this License, on a durable physical medium customarily used for software interchange, for a price no more than your reasonable cost of physically performing this conveying of source, or (2) access to copy the Corresponding Source from a network server at no charge. @item Convey individual copies of the object code with a copy of the written offer to provide the Corresponding Source. This alternative is allowed only occasionally and noncommercially, and only if you received the object code with such an offer, in accord with subsection 6b. @item Convey the object code by offering access from a designated place (gratis or for a charge), and offer equivalent access to the Corresponding Source in the same way through the same place at no further charge. You need not require recipients to copy the Corresponding Source along with the object code. If the place to copy the object code is a network server, the Corresponding Source may be on a different server (operated by you or a third party) that supports equivalent copying facilities, provided you maintain clear directions next to the object code saying where to find the Corresponding Source. Regardless of what server hosts the Corresponding Source, you remain obligated to ensure that it is available for as long as needed to satisfy these requirements. @item Convey the object code using peer-to-peer transmission, provided you inform other peers where the object code and Corresponding Source of the work are being offered to the general public at no charge under subsection 6d. @end enumerate A separable portion of the object code, whose source code is excluded from the Corresponding Source as a System Library, need not be included in conveying the object code work. A ``User Product'' is either (1) a ``consumer product'', which means any tangible personal property which is normally used for personal, family, or household purposes, or (2) anything designed or sold for incorporation into a dwelling. In determining whether a product is a consumer product, doubtful cases shall be resolved in favor of coverage. For a particular product received by a particular user, ``normally used'' refers to a typical or common use of that class of product, regardless of the status of the particular user or of the way in which the particular user actually uses, or expects or is expected to use, the product. A product is a consumer product regardless of whether the product has substantial commercial, industrial or non-consumer uses, unless such uses represent the only significant mode of use of the product. ``Installation Information'' for a User Product means any methods, procedures, authorization keys, or other information required to install and execute modified versions of a covered work in that User Product from a modified version of its Corresponding Source. The information must suffice to ensure that the continued functioning of the modified object code is in no case prevented or interfered with solely because modification has been made. If you convey an object code work under this section in, or with, or specifically for use in, a User Product, and the conveying occurs as part of a transaction in which the right of possession and use of the User Product is transferred to the recipient in perpetuity or for a fixed term (regardless of how the transaction is characterized), the Corresponding Source conveyed under this section must be accompanied by the Installation Information. But this requirement does not apply if neither you nor any third party retains the ability to install modified object code on the User Product (for example, the work has been installed in ROM). The requirement to provide Installation Information does not include a requirement to continue to provide support service, warranty, or updates for a work that has been modified or installed by the recipient, or for the User Product in which it has been modified or installed. Access to a network may be denied when the modification itself materially and adversely affects the operation of the network or violates the rules and protocols for communication across the network. Corresponding Source conveyed, and Installation Information provided, in accord with this section must be in a format that is publicly documented (and with an implementation available to the public in source code form), and must require no special password or key for unpacking, reading or copying. @item Additional Terms. ``Additional permissions'' are terms that supplement the terms of this License by making exceptions from one or more of its conditions. Additional permissions that are applicable to the entire Program shall be treated as though they were included in this License, to the extent that they are valid under applicable law. If additional permissions apply only to part of the Program, that part may be used separately under those permissions, but the entire Program remains governed by this License without regard to the additional permissions. When you convey a copy of a covered work, you may at your option remove any additional permissions from that copy, or from any part of it. (Additional permissions may be written to require their own removal in certain cases when you modify the work.) You may place additional permissions on material, added by you to a covered work, for which you have or can give appropriate copyright permission. Notwithstanding any other provision of this License, for material you add to a covered work, you may (if authorized by the copyright holders of that material) supplement the terms of this License with terms: @enumerate a @item Disclaiming warranty or limiting liability differently from the terms of sections 15 and 16 of this License; or @item Requiring preservation of specified reasonable legal notices or author attributions in that material or in the Appropriate Legal Notices displayed by works containing it; or @item Prohibiting misrepresentation of the origin of that material, or requiring that modified versions of such material be marked in reasonable ways as different from the original version; or @item Limiting the use for publicity purposes of names of licensors or authors of the material; or @item Declining to grant rights under trademark law for use of some trade names, trademarks, or service marks; or @item Requiring indemnification of licensors and authors of that material by anyone who conveys the material (or modified versions of it) with contractual assumptions of liability to the recipient, for any liability that these contractual assumptions directly impose on those licensors and authors. @end enumerate All other non-permissive additional terms are considered ``further restrictions'' within the meaning of section 10. If the Program as you received it, or any part of it, contains a notice stating that it is governed by this License along with a term that is a further restriction, you may remove that term. If a license document contains a further restriction but permits relicensing or conveying under this License, you may add to a covered work material governed by the terms of that license document, provided that the further restriction does not survive such relicensing or conveying. If you add terms to a covered work in accord with this section, you must place, in the relevant source files, a statement of the additional terms that apply to those files, or a notice indicating where to find the applicable terms. Additional terms, permissive or non-permissive, may be stated in the form of a separately written license, or stated as exceptions; the above requirements apply either way. @item Termination. You may not propagate or modify a covered work except as expressly provided under this License. Any attempt otherwise to propagate or modify it is void, and will automatically terminate your rights under this License (including any patent licenses granted under the third paragraph of section 11). However, if you cease all violation of this License, then your license from a particular copyright holder is reinstated (a) provisionally, unless and until the copyright holder explicitly and finally terminates your license, and (b) permanently, if the copyright holder fails to notify you of the violation by some reasonable means prior to 60 days after the cessation. Moreover, your license from a particular copyright holder is reinstated permanently if the copyright holder notifies you of the violation by some reasonable means, this is the first time you have received notice of violation of this License (for any work) from that copyright holder, and you cure the violation prior to 30 days after your receipt of the notice. Termination of your rights under this section does not terminate the licenses of parties who have received copies or rights from you under this License. If your rights have been terminated and not permanently reinstated, you do not qualify to receive new licenses for the same material under section 10. @item Acceptance Not Required for Having Copies. You are not required to accept this License in order to receive or run a copy of the Program. Ancillary propagation of a covered work occurring solely as a consequence of using peer-to-peer transmission to receive a copy likewise does not require acceptance. However, nothing other than this License grants you permission to propagate or modify any covered work. These actions infringe copyright if you do not accept this License. Therefore, by modifying or propagating a covered work, you indicate your acceptance of this License to do so. @item Automatic Licensing of Downstream Recipients. Each time you convey a covered work, the recipient automatically receives a license from the original licensors, to run, modify and propagate that work, subject to this License. You are not responsible for enforcing compliance by third parties with this License. An ``entity transaction'' is a transaction transferring control of an organization, or substantially all assets of one, or subdividing an organization, or merging organizations. If propagation of a covered work results from an entity transaction, each party to that transaction who receives a copy of the work also receives whatever licenses to the work the party's predecessor in interest had or could give under the previous paragraph, plus a right to possession of the Corresponding Source of the work from the predecessor in interest, if the predecessor has it or can get it with reasonable efforts. You may not impose any further restrictions on the exercise of the rights granted or affirmed under this License. For example, you may not impose a license fee, royalty, or other charge for exercise of rights granted under this License, and you may not initiate litigation (including a cross-claim or counterclaim in a lawsuit) alleging that any patent claim is infringed by making, using, selling, offering for sale, or importing the Program or any portion of it. @item Patents. A ``contributor'' is a copyright holder who authorizes use under this License of the Program or a work on which the Program is based. The work thus licensed is called the contributor's ``contributor version''. A contributor's ``essential patent claims'' are all patent claims owned or controlled by the contributor, whether already acquired or hereafter acquired, that would be infringed by some manner, permitted by this License, of making, using, or selling its contributor version, but do not include claims that would be infringed only as a consequence of further modification of the contributor version. For purposes of this definition, ``control'' includes the right to grant patent sublicenses in a manner consistent with the requirements of this License. Each contributor grants you a non-exclusive, worldwide, royalty-free patent license under the contributor's essential patent claims, to make, use, sell, offer for sale, import and otherwise run, modify and propagate the contents of its contributor version. In the following three paragraphs, a ``patent license'' is any express agreement or commitment, however denominated, not to enforce a patent (such as an express permission to practice a patent or covenant not to sue for patent infringement). To ``grant'' such a patent license to a party means to make such an agreement or commitment not to enforce a patent against the party. If you convey a covered work, knowingly relying on a patent license, and the Corresponding Source of the work is not available for anyone to copy, free of charge and under the terms of this License, through a publicly available network server or other readily accessible means, then you must either (1) cause the Corresponding Source to be so available, or (2) arrange to deprive yourself of the benefit of the patent license for this particular work, or (3) arrange, in a manner consistent with the requirements of this License, to extend the patent license to downstream recipients. ``Knowingly relying'' means you have actual knowledge that, but for the patent license, your conveying the covered work in a country, or your recipient's use of the covered work in a country, would infringe one or more identifiable patents in that country that you have reason to believe are valid. If, pursuant to or in connection with a single transaction or arrangement, you convey, or propagate by procuring conveyance of, a covered work, and grant a patent license to some of the parties receiving the covered work authorizing them to use, propagate, modify or convey a specific copy of the covered work, then the patent license you grant is automatically extended to all recipients of the covered work and works based on it. A patent license is ``discriminatory'' if it does not include within the scope of its coverage, prohibits the exercise of, or is conditioned on the non-exercise of one or more of the rights that are specifically granted under this License. You may not convey a covered work if you are a party to an arrangement with a third party that is in the business of distributing software, under which you make payment to the third party based on the extent of your activity of conveying the work, and under which the third party grants, to any of the parties who would receive the covered work from you, a discriminatory patent license (a) in connection with copies of the covered work conveyed by you (or copies made from those copies), or (b) primarily for and in connection with specific products or compilations that contain the covered work, unless you entered into that arrangement, or that patent license was granted, prior to 28 March 2007. Nothing in this License shall be construed as excluding or limiting any implied license or other defenses to infringement that may otherwise be available to you under applicable patent law. @item No Surrender of Others' Freedom. If conditions are imposed on you (whether by court order, agreement or otherwise) that contradict the conditions of this License, they do not excuse you from the conditions of this License. If you cannot convey a covered work so as to satisfy simultaneously your obligations under this License and any other pertinent obligations, then as a consequence you may not convey it at all. For example, if you agree to terms that obligate you to collect a royalty for further conveying from those to whom you convey the Program, the only way you could satisfy both those terms and this License would be to refrain entirely from conveying the Program. @item Use with the GNU Affero General Public License. Notwithstanding any other provision of this License, you have permission to link or combine any covered work with a work licensed under version 3 of the GNU Affero General Public License into a single combined work, and to convey the resulting work. The terms of this License will continue to apply to the part which is the covered work, but the special requirements of the GNU Affero General Public License, section 13, concerning interaction through a network will apply to the combination as such. @item Revised Versions of this License. The Free Software Foundation may publish revised and/or new versions of the GNU General Public License from time to time. Such new versions will be similar in spirit to the present version, but may differ in detail to address new problems or concerns. Each version is given a distinguishing version number. If the Program specifies that a certain numbered version of the GNU General Public License ``or any later version'' applies to it, you have the option of following the terms and conditions either of that numbered version or of any later version published by the Free Software Foundation. If the Program does not specify a version number of the GNU General Public License, you may choose any version ever published by the Free Software Foundation. If the Program specifies that a proxy can decide which future versions of the GNU General Public License can be used, that proxy's public statement of acceptance of a version permanently authorizes you to choose that version for the Program. Later license versions may give you additional or different permissions. However, no additional obligations are imposed on any author or copyright holder as a result of your choosing to follow a later version. @item Disclaimer of Warranty. THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM ``AS IS'' WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION. @item Limitation of Liability. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. @item Interpretation of Sections 15 and 16. If the disclaimer of warranty and limitation of liability provided above cannot be given local legal effect according to their terms, reviewing courts shall apply local law that most closely approximates an absolute waiver of all civil liability in connection with the Program, unless a warranty or assumption of liability accompanies a copy of the Program in return for a fee. @end enumerate @c fakenode --- for prepinfo @heading END OF TERMS AND CONDITIONS @c fakenode --- for prepinfo @heading How to Apply These Terms to Your New Programs If you develop a new program, and you want it to be of the greatest possible use to the public, the best way to achieve this is to make it free software which everyone can redistribute and change under these terms. To do so, attach the following notices to the program. It is safest to attach them to the start of each source file to most effectively state the exclusion of warranty; and each file should have at least the ``copyright'' line and a pointer to where the full notice is found. @smallexample @var{one line to give the program's name and a brief idea of what it does.} Copyright (C) @var{year} @var{name of author} This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see @url{http://www.gnu.org/licenses/}. @end smallexample Also add information on how to contact you by electronic and paper mail. If the program does terminal interaction, make it output a short notice like this when it starts in an interactive mode: @smallexample @var{program} Copyright (C) @var{year} @var{name of author} This program comes with ABSOLUTELY NO WARRANTY; for details type @samp{show w}. This is free software, and you are welcome to redistribute it under certain conditions; type @samp{show c} for details. @end smallexample The hypothetical commands @samp{show w} and @samp{show c} should show the appropriate parts of the General Public License. Of course, your program's commands might be different; for a GUI interface, you would use an ``about box''. You should also get your employer (if you work as a programmer) or school, if any, to sign a ``copyright disclaimer'' for the program, if necessary. For more information on this, and how to apply and follow the GNU GPL, see @url{http://www.gnu.org/licenses/}. The GNU General Public License does not permit incorporating your program into proprietary programs. If your program is a subroutine library, you may consider it more useful to permit linking proprietary applications with the library. If this is what you want to do, use the GNU Lesser General Public License instead of this License. But first, please read @url{http://www.gnu.org/philosophy/why-not-lgpl.html}. @c The GNU Free Documentation License. @node GNU Free Documentation License @unnumbered GNU Free Documentation License @cindex FDL (Free Documentation License) @cindex Free Documentation License (FDL) @cindex GNU Free Documentation License @center Version 1.3, 3 November 2008 @c This file is intended to be included within another document, @c hence no sectioning command or @node. @display Copyright @copyright{} 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc. @uref{http://fsf.org/} Everyone is permitted to copy and distribute verbatim copies of this license document, but changing it is not allowed. @end display @enumerate 0 @item PREAMBLE The purpose of this License is to make a manual, textbook, or other functional and useful document @dfn{free} in the sense of freedom: to assure everyone the effective freedom to copy and redistribute it, with or without modifying it, either commercially or noncommercially. Secondarily, this License preserves for the author and publisher a way to get credit for their work, while not being considered responsible for modifications made by others. This License is a kind of ``copyleft'', which means that derivative works of the document must themselves be free in the same sense. It complements the GNU General Public License, which is a copyleft license designed for free software. We have designed this License in order to use it for manuals for free software, because free software needs free documentation: a free program should come with manuals providing the same freedoms that the software does. But this License is not limited to software manuals; it can be used for any textual work, regardless of subject matter or whether it is published as a printed book. We recommend this License principally for works whose purpose is instruction or reference. @item APPLICABILITY AND DEFINITIONS This License applies to any manual or other work, in any medium, that contains a notice placed by the copyright holder saying it can be distributed under the terms of this License. Such a notice grants a world-wide, royalty-free license, unlimited in duration, to use that work under the conditions stated herein. The ``Document'', below, refers to any such manual or work. Any member of the public is a licensee, and is addressed as ``you''. You accept the license if you copy, modify or distribute the work in a way requiring permission under copyright law. A ``Modified Version'' of the Document means any work containing the Document or a portion of it, either copied verbatim, or with modifications and/or translated into another language. A ``Secondary Section'' is a named appendix or a front-matter section of the Document that deals exclusively with the relationship of the publishers or authors of the Document to the Document's overall subject (or to related matters) and contains nothing that could fall directly within that overall subject. (Thus, if the Document is in part a textbook of mathematics, a Secondary Section may not explain any mathematics.) The relationship could be a matter of historical connection with the subject or with related matters, or of legal, commercial, philosophical, ethical or political position regarding them. The ``Invariant Sections'' are certain Secondary Sections whose titles are designated, as being those of Invariant Sections, in the notice that says that the Document is released under this License. If a section does not fit the above definition of Secondary then it is not allowed to be designated as Invariant. The Document may contain zero Invariant Sections. If the Document does not identify any Invariant Sections then there are none. The ``Cover Texts'' are certain short passages of text that are listed, as Front-Cover Texts or Back-Cover Texts, in the notice that says that the Document is released under this License. A Front-Cover Text may be at most 5 words, and a Back-Cover Text may be at most 25 words. A ``Transparent'' copy of the Document means a machine-readable copy, represented in a format whose specification is available to the general public, that is suitable for revising the document straightforwardly with generic text editors or (for images composed of pixels) generic paint programs or (for drawings) some widely available drawing editor, and that is suitable for input to text formatters or for automatic translation to a variety of formats suitable for input to text formatters. A copy made in an otherwise Transparent file format whose markup, or absence of markup, has been arranged to thwart or discourage subsequent modification by readers is not Transparent. An image format is not Transparent if used for any substantial amount of text. A copy that is not ``Transparent'' is called ``Opaque''. Examples of suitable formats for Transparent copies include plain @sc{ascii} without markup, Texinfo input format, La@TeX{} input format, @acronym{SGML} or @acronym{XML} using a publicly available @acronym{DTD}, and standard-conforming simple @acronym{HTML}, PostScript or @acronym{PDF} designed for human modification. Examples of transparent image formats include @acronym{PNG}, @acronym{XCF} and @acronym{JPG}. Opaque formats include proprietary formats that can be read and edited only by proprietary word processors, @acronym{SGML} or @acronym{XML} for which the @acronym{DTD} and/or processing tools are not generally available, and the machine-generated @acronym{HTML}, PostScript or @acronym{PDF} produced by some word processors for output purposes only. The ``Title Page'' means, for a printed book, the title page itself, plus such following pages as are needed to hold, legibly, the material this License requires to appear in the title page. For works in formats which do not have any title page as such, ``Title Page'' means the text near the most prominent appearance of the work's title, preceding the beginning of the body of the text. The ``publisher'' means any person or entity that distributes copies of the Document to the public. A section ``Entitled XYZ'' means a named subunit of the Document whose title either is precisely XYZ or contains XYZ in parentheses following text that translates XYZ in another language. (Here XYZ stands for a specific section name mentioned below, such as ``Acknowledgements'', ``Dedications'', ``Endorsements'', or ``History''.) To ``Preserve the Title'' of such a section when you modify the Document means that it remains a section ``Entitled XYZ'' according to this definition. The Document may include Warranty Disclaimers next to the notice which states that this License applies to the Document. These Warranty Disclaimers are considered to be included by reference in this License, but only as regards disclaiming warranties: any other implication that these Warranty Disclaimers may have is void and has no effect on the meaning of this License. @item VERBATIM COPYING You may copy and distribute the Document in any medium, either commercially or noncommercially, provided that this License, the copyright notices, and the license notice saying this License applies to the Document are reproduced in all copies, and that you add no other conditions whatsoever to those of this License. You may not use technical measures to obstruct or control the reading or further copying of the copies you make or distribute. However, you may accept compensation in exchange for copies. If you distribute a large enough number of copies you must also follow the conditions in section 3. You may also lend copies, under the same conditions stated above, and you may publicly display copies. @item COPYING IN QUANTITY If you publish printed copies (or copies in media that commonly have printed covers) of the Document, numbering more than 100, and the Document's license notice requires Cover Texts, you must enclose the copies in covers that carry, clearly and legibly, all these Cover Texts: Front-Cover Texts on the front cover, and Back-Cover Texts on the back cover. Both covers must also clearly and legibly identify you as the publisher of these copies. The front cover must present the full title with all words of the title equally prominent and visible. You may add other material on the covers in addition. Copying with changes limited to the covers, as long as they preserve the title of the Document and satisfy these conditions, can be treated as verbatim copying in other respects. If the required texts for either cover are too voluminous to fit legibly, you should put the first ones listed (as many as fit reasonably) on the actual cover, and continue the rest onto adjacent pages. If you publish or distribute Opaque copies of the Document numbering more than 100, you must either include a machine-readable Transparent copy along with each Opaque copy, or state in or with each Opaque copy a computer-network location from which the general network-using public has access to download using public-standard network protocols a complete Transparent copy of the Document, free of added material. If you use the latter option, you must take reasonably prudent steps, when you begin distribution of Opaque copies in quantity, to ensure that this Transparent copy will remain thus accessible at the stated location until at least one year after the last time you distribute an Opaque copy (directly or through your agents or retailers) of that edition to the public. It is requested, but not required, that you contact the authors of the Document well before redistributing any large number of copies, to give them a chance to provide you with an updated version of the Document. @item MODIFICATIONS You may copy and distribute a Modified Version of the Document under the conditions of sections 2 and 3 above, provided that you release the Modified Version under precisely this License, with the Modified Version filling the role of the Document, thus licensing distribution and modification of the Modified Version to whoever possesses a copy of it. In addition, you must do these things in the Modified Version: @enumerate A @item Use in the Title Page (and on the covers, if any) a title distinct from that of the Document, and from those of previous versions (which should, if there were any, be listed in the History section of the Document). You may use the same title as a previous version if the original publisher of that version gives permission. @item List on the Title Page, as authors, one or more persons or entities responsible for authorship of the modifications in the Modified Version, together with at least five of the principal authors of the Document (all of its principal authors, if it has fewer than five), unless they release you from this requirement. @item State on the Title page the name of the publisher of the Modified Version, as the publisher. @item Preserve all the copyright notices of the Document. @item Add an appropriate copyright notice for your modifications adjacent to the other copyright notices. @item Include, immediately after the copyright notices, a license notice giving the public permission to use the Modified Version under the terms of this License, in the form shown in the Addendum below. @item Preserve in that license notice the full lists of Invariant Sections and required Cover Texts given in the Document's license notice. @item Include an unaltered copy of this License. @item Preserve the section Entitled ``History'', Preserve its Title, and add to it an item stating at least the title, year, new authors, and publisher of the Modified Version as given on the Title Page. If there is no section Entitled ``History'' in the Document, create one stating the title, year, authors, and publisher of the Document as given on its Title Page, then add an item describing the Modified Version as stated in the previous sentence. @item Preserve the network location, if any, given in the Document for public access to a Transparent copy of the Document, and likewise the network locations given in the Document for previous versions it was based on. These may be placed in the ``History'' section. You may omit a network location for a work that was published at least four years before the Document itself, or if the original publisher of the version it refers to gives permission. @item For any section Entitled ``Acknowledgements'' or ``Dedications'', Preserve the Title of the section, and preserve in the section all the substance and tone of each of the contributor acknowledgements and/or dedications given therein. @item Preserve all the Invariant Sections of the Document, unaltered in their text and in their titles. Section numbers or the equivalent are not considered part of the section titles. @item Delete any section Entitled ``Endorsements''. Such a section may not be included in the Modified Version. @item Do not retitle any existing section to be Entitled ``Endorsements'' or to conflict in title with any Invariant Section. @item Preserve any Warranty Disclaimers. @end enumerate If the Modified Version includes new front-matter sections or appendices that qualify as Secondary Sections and contain no material copied from the Document, you may at your option designate some or all of these sections as invariant. To do this, add their titles to the list of Invariant Sections in the Modified Version's license notice. These titles must be distinct from any other section titles. You may add a section Entitled ``Endorsements'', provided it contains nothing but endorsements of your Modified Version by various parties---for example, statements of peer review or that the text has been approved by an organization as the authoritative definition of a standard. You may add a passage of up to five words as a Front-Cover Text, and a passage of up to 25 words as a Back-Cover Text, to the end of the list of Cover Texts in the Modified Version. Only one passage of Front-Cover Text and one of Back-Cover Text may be added by (or through arrangements made by) any one entity. If the Document already includes a cover text for the same cover, previously added by you or by arrangement made by the same entity you are acting on behalf of, you may not add another; but you may replace the old one, on explicit permission from the previous publisher that added the old one. The author(s) and publisher(s) of the Document do not by this License give permission to use their names for publicity for or to assert or imply endorsement of any Modified Version. @item COMBINING DOCUMENTS You may combine the Document with other documents released under this License, under the terms defined in section 4 above for modified versions, provided that you include in the combination all of the Invariant Sections of all of the original documents, unmodified, and list them all as Invariant Sections of your combined work in its license notice, and that you preserve all their Warranty Disclaimers. The combined work need only contain one copy of this License, and multiple identical Invariant Sections may be replaced with a single copy. If there are multiple Invariant Sections with the same name but different contents, make the title of each such section unique by adding at the end of it, in parentheses, the name of the original author or publisher of that section if known, or else a unique number. Make the same adjustment to the section titles in the list of Invariant Sections in the license notice of the combined work. In the combination, you must combine any sections Entitled ``History'' in the various original documents, forming one section Entitled ``History''; likewise combine any sections Entitled ``Acknowledgements'', and any sections Entitled ``Dedications''. You must delete all sections Entitled ``Endorsements.'' @item COLLECTIONS OF DOCUMENTS You may make a collection consisting of the Document and other documents released under this License, and replace the individual copies of this License in the various documents with a single copy that is included in the collection, provided that you follow the rules of this License for verbatim copying of each of the documents in all other respects. You may extract a single document from such a collection, and distribute it individually under this License, provided you insert a copy of this License into the extracted document, and follow this License in all other respects regarding verbatim copying of that document. @item AGGREGATION WITH INDEPENDENT WORKS A compilation of the Document or its derivatives with other separate and independent documents or works, in or on a volume of a storage or distribution medium, is called an ``aggregate'' if the copyright resulting from the compilation is not used to limit the legal rights of the compilation's users beyond what the individual works permit. When the Document is included in an aggregate, this License does not apply to the other works in the aggregate which are not themselves derivative works of the Document. If the Cover Text requirement of section 3 is applicable to these copies of the Document, then if the Document is less than one half of the entire aggregate, the Document's Cover Texts may be placed on covers that bracket the Document within the aggregate, or the electronic equivalent of covers if the Document is in electronic form. Otherwise they must appear on printed covers that bracket the whole aggregate. @item TRANSLATION Translation is considered a kind of modification, so you may distribute translations of the Document under the terms of section 4. Replacing Invariant Sections with translations requires special permission from their copyright holders, but you may include translations of some or all Invariant Sections in addition to the original versions of these Invariant Sections. You may include a translation of this License, and all the license notices in the Document, and any Warranty Disclaimers, provided that you also include the original English version of this License and the original versions of those notices and disclaimers. In case of a disagreement between the translation and the original version of this License or a notice or disclaimer, the original version will prevail. If a section in the Document is Entitled ``Acknowledgements'', ``Dedications'', or ``History'', the requirement (section 4) to Preserve its Title (section 1) will typically require changing the actual title. @item TERMINATION You may not copy, modify, sublicense, or distribute the Document except as expressly provided under this License. Any attempt otherwise to copy, modify, sublicense, or distribute it is void, and will automatically terminate your rights under this License. However, if you cease all violation of this License, then your license from a particular copyright holder is reinstated (a) provisionally, unless and until the copyright holder explicitly and finally terminates your license, and (b) permanently, if the copyright holder fails to notify you of the violation by some reasonable means prior to 60 days after the cessation. Moreover, your license from a particular copyright holder is reinstated permanently if the copyright holder notifies you of the violation by some reasonable means, this is the first time you have received notice of violation of this License (for any work) from that copyright holder, and you cure the violation prior to 30 days after your receipt of the notice. Termination of your rights under this section does not terminate the licenses of parties who have received copies or rights from you under this License. If your rights have been terminated and not permanently reinstated, receipt of a copy of some or all of the same material does not give you any rights to use it. @item FUTURE REVISIONS OF THIS LICENSE The Free Software Foundation may publish new, revised versions of the GNU Free Documentation License from time to time. Such new versions will be similar in spirit to the present version, but may differ in detail to address new problems or concerns. See @uref{http://www.gnu.org/copyleft/}. Each version of the License is given a distinguishing version number. If the Document specifies that a particular numbered version of this License ``or any later version'' applies to it, you have the option of following the terms and conditions either of that specified version or of any later version that has been published (not as a draft) by the Free Software Foundation. If the Document does not specify a version number of this License, you may choose any version ever published (not as a draft) by the Free Software Foundation. If the Document specifies that a proxy can decide which future versions of this License can be used, that proxy's public statement of acceptance of a version permanently authorizes you to choose that version for the Document. @item RELICENSING ``Massive Multiauthor Collaboration Site'' (or ``MMC Site'') means any World Wide Web server that publishes copyrightable works and also provides prominent facilities for anybody to edit those works. A public wiki that anybody can edit is an example of such a server. A ``Massive Multiauthor Collaboration'' (or ``MMC'') contained in the site means any set of copyrightable works thus published on the MMC site. ``CC-BY-SA'' means the Creative Commons Attribution-Share Alike 3.0 license published by Creative Commons Corporation, a not-for-profit corporation with a principal place of business in San Francisco, California, as well as future copyleft versions of that license published by that same organization. ``Incorporate'' means to publish or republish a Document, in whole or in part, as part of another Document. An MMC is ``eligible for relicensing'' if it is licensed under this License, and if all works that were first published under this License somewhere other than this MMC, and subsequently incorporated in whole or in part into the MMC, (1) had no cover texts or invariant sections, and (2) were thus incorporated prior to November 1, 2008. The operator of an MMC Site may republish an MMC contained in the site under CC-BY-SA on the same site at any time before August 1, 2009, provided the MMC is eligible for relicensing. @end enumerate @c fakenode --- for prepinfo @unnumberedsec ADDENDUM: How to use this License for your documents To use this License in a document you have written, include a copy of the License in the document and put the following copyright and license notices just after the title page: @smallexample @group Copyright (C) @var{year} @var{your name}. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.3 or any later version published by the Free Software Foundation; with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. A copy of the license is included in the section entitled ``GNU Free Documentation License''. @end group @end smallexample If you have Invariant Sections, Front-Cover Texts and Back-Cover Texts, replace the ``with@dots{}Texts.'' line with this: @smallexample @group with the Invariant Sections being @var{list their titles}, with the Front-Cover Texts being @var{list}, and with the Back-Cover Texts being @var{list}. @end group @end smallexample If you have Invariant Sections without Cover Texts, or some other combination of the three, merge those two alternatives to suit the situation. If your document contains nontrivial examples of program code, we recommend releasing these examples in parallel under your choice of free software license, such as the GNU General Public License, to permit their use in free software. @c Local Variables: @c ispell-local-pdict: "ispell-dict" @c End: @node Index @unnumbered Index @printindex cp @bye Unresolved Issues: ------------------ 1. From ADR. Robert J. Chassell points out that awk programs should have some indication of how to use them. It would be useful to perhaps have a "programming style" section of the manual that would include this and other tips. 2. The default AWKPATH search path should be configurable via `configure' The default and how this changes needs to be documented. Consistency issues: /.../ regexps are in @code, not @samp ".." strings are in @code, not @samp no @print before @dots values of expressions in the text (@code{x} has the value 15), should be in roman, not @code Use TAB and not tab Use ESC and not ESCAPE Use space and not blank to describe the space bar's character The term "blank" is thus basically reserved for "blank lines" etc. To make dark corners work, the @value{DARKCORNER} has to be outside closing `.' of a sentence and after (pxref{...}). " " should have an @w{} around it Use "non-" only with language names or acronyms, or the words bug and option and null Use @command{ftp} when talking about anonymous ftp Use uppercase and lowercase, not "upper-case" and "lower-case" or "upper case" and "lower case" Use "single precision" and "double precision", not "single-precision" or "double-precision" Use alphanumeric, not alpha-numeric Use POSIX-compliant, not POSIX compliant Use --foo, not -Wfoo when describing long options Use "Bell Laboratories", but not "Bell Labs". Use "behavior" instead of "behaviour". Use "zeros" instead of "zeroes". Use "nonzero" not "non-zero". Use "runtime" not "run time" or "run-time". Use "command-line" not "command line". Use "online" not "on-line". Use "whitespace" not "white space". Use "Input/Output", not "input/output". Also "I/O", not "i/o". Use "lefthand"/"righthand", not "left-hand"/"right-hand". Use "workaround", not "work-around". Use "startup"/"cleanup", not "start-up"/"clean-up" Use @code{do}, and not @code{do}-@code{while}, except where actually discussing the do-while. Use "versus" in text and "vs." in index entries Use @code{"C"} for the C locale, not ``C'' or @samp{C}. The words "a", "and", "as", "between", "for", "from", "in", "of", "on", "that", "the", "to", "with", and "without", should not be capitalized in @chapter, @section etc. "Into" and "How" should. Search for @dfn; make sure important items are also indexed. "e.g." should always be followed by a comma. "i.e." should always be followed by a comma. The numbers zero through ten should be spelled out, except when talking about file descriptor numbers. > 10 and < 0, it's ok to use numbers. In tables, put command-line options in @code, while in the text, put them in @option. For most cases, do NOT put a comma before "and", "or" or "but". But exercise taste with this rule. Don't show the awk command with a program in quotes when it's just the program. I.e. { .... } not awk '{ ... }' Do show it when showing command-line arguments, data files, etc, even if there is no output shown. Use numbered lists only to show a sequential series of steps. Use @code{xxx} for the xxx operator in indexing statements, not @samp. Use MS-Windows not MS Windows Use MS-DOS not MS-DOS Use an empty set of parentheses after built-in and awk function names. Date: Wed, 13 Apr 94 15:20:52 -0400 From: rms@gnu.org (Richard Stallman) To: gnu-prog@gnu.org Subject: A reminder: no pathnames in GNU It's a GNU convention to use the term "file name" for the name of a file, never "pathname". We use the term "path" for search paths, which are lists of file names. Using it for a single file name as well is potentially confusing to users. So please check any documentation you maintain, if you think you might have used "pathname". Note that "file name" should be two words when it appears as ordinary text. It's ok as one word when it's a metasyntactic variable, though. ------------------------ ORA uses filename, thus the macro. Suggestions: ------------ Enhance FIELDWIDTHS with some way to indicate "the rest of the record". E.g., a length of 0 or -1 or something. May be "n"? Make FIELDWIDTHS be an array? % Next edition: % 1. Talk about common extensions, those in nawk, gawk, mawk % 2. Use @code{foo} for variables and @code{foo()} for functions % 3. Standardize the error messages from the functions and programs % in Chapters 12 and 13. % 4. Nuke the BBS stuff and use something that won't be obsolete gawk-doc-4.0.1+ds.orig/doc/rflashlight.eps0000644000175000017500000001003511463242060017355 0ustar schotschot%! %%Creator: arnold@skeeve (Aharon Robbins) %%Title: flashlight.small.xpic (xpic) %%CreationDate: Tue Oct 24 14:41:28 2000 %%Pages: 1 %%BoundingBox: 0 0 72 28.8 % (in inches) at 0 0, width 1, height 0.4 %%EndComments % Prolog for xpic to PostScript converter % Author: Mark Moraes % $Header: x2ps.pro,v 1.2 88/03/19 16:50:09 moraes Exp % %d D - change style SOLID, DOTTED, SHORT-DASH, LONG-DASH, DOT-DASH % %s F - change font to fontname % %d S - change size (font size in points) % (%s) rj %d t - text right just. (%d is TOPLINE, MIDLINE, BOTLINE) % (%s) lj %d t - text left just. (%d is TOPLINE, MIDLINE, BOTLINE) % (%s) ce %d t - text centered (%d is TOPLINE, MIDLINE, BOTLINE) % %d %d l - lineto % %d %d m - moveto % %d %d s - spline segment % x - flush line, spline % b - box % e - ellipse % %d ss - setscale % %d W - change linewidth % getpagesize - gets the values of PAGEHEIGHT and PAGEWIDTH % %d %d flip - translate by %d, PAGEHEIGHT - %d (this % transforms to X windows coordinates) save 50 dict begin /xpic exch def /StartXpic {newpath 0 0 moveto [] 0 setdash 0 setgray 1 setlinecap} def % Set defaults /fontname /Times-Roman def /ptsize 12 def % halign has the values for MIDLINE, TOPLINE, BOTLINE /halign 3 array def /s {rcurveto} def /x {stroke} def /l {lineto} def /m {moveto} def /b { /ury exch def /urx exch def /lly exch def /llx exch def llx lly moveto urx lly lineto urx ury lineto llx ury lineto llx lly lineto stroke } def /mtrx matrix def /e { /yc exch def /xc exch def /yrad exch def /xrad exch def xc xrad add yc moveto /savematrix mtrx currentmatrix def xc yc translate xrad yrad scale 0 0 1 0 360 arc savematrix setmatrix stroke } def % The next three take the text string, and moveto the right horiz. position % leaving the string on the stack. /lj {} def /rj {dup stringwidth pop neg 0 rmoveto} def /ce {dup stringwidth pop 2 div neg 0 rmoveto} def % And this is invoked after one of the three above, and % computes the vert. pos, and then displays the string. /t {halign exch get 0 exch rmoveto show newpath} def % Store an array of patterns in /styles - a pattern is an array consisting % of an array and an offset. Corresp to xpic patterns % solid, dotted, short-dashed, long-dashed, dot-dashed /styles [ [] 0 ] [ [1 3] 0 ] [ [4 4] 0 ] [ [8 4] 0 ] [ [1 4 4 4] 0 ] 5 array astore def % change style to arg. /D {stroke styles exch get aload pop setdash newpath} def /W {stroke 0.5 mul setlinewidth newpath} def % fontbox takes a fontname off the stack, and returns an array % containing the values of the bottom line of the bounding box, the % mid line of the bounding box, and the top line of the bounding box % of that font, taken from the baseline, scaled to a font of size 1 /fontbox { findfont dup /FontMatrix get /fm exch def /FontBBox get aload pop /ytop exch def pop /ybot exch def pop /ymid ytop ybot sub 2 div def 0 ybot fm dtransform exch pop % botline dup neg exch % midline - this works better than (ytop-ybot)/2! 0 ytop fm dtransform exch pop exch %topline % now in the order midline, topline, botline. 3 array astore } def % select font /F { dup /fontname exch def fontbox /thisfontbox exch def SF } def % set point size /S {/ptsize exch def SF} def % actually set font /SF { fontname findfont ptsize curscale div scalefont setfont thisfontbox aload pop 1 1 3 { pop ptsize mul curscale div neg 3 1 roll } for halign astore pop } def % sets the scale to 72 / n, where n is on the stack, and stores the value % in curscale for font scaling /curscale 1 def /getpagesize{newpath clippath pathbbox /pageheight exch def /pagewidth exch def pop pop newpath} def /flip{pageheight exch sub translate} def /ss {/curscale exch 72 exch div dup dup scale def} def /land {90 rotate} def StartXpic %%EndProlog 80 ss 0.5 W 0 D 8 16 24 16 e 24 32 m 48 24 l x 24 0 m 48 8 l x 48 24 m 0 0 0 -5.33333 0 -16 s x 48 24 80 8 b 0 8 m 0 8 l x 0 0 m 16 8 l x 0 16 m 16 16 l x 16 24 m 0 32 l x %%Trailer showpage % Trailer for xpic to PostScript converter % $Header: x2ps.tra,v 1.2 89/07/02 15:59:53 moraes Exp $ xpic end restore gawk-doc-4.0.1+ds.orig/doc/statist.eps0000644000175000017500000003112011463242060016537 0ustar schotschot%!PS-Adobe-2.0 %%Creator: gnuplot 3.7 patchlevel 0.1 %%CreationDate: Sun Jan 7 14:23:12 2001 %%DocumentFonts: (atend) %%BoundingBox: 50 50 554 770 %%Orientation: Portrait %%Pages: (atend) %%EndComments /gnudict 256 dict def gnudict begin /Color true def /Solid false def /gnulinewidth 5.000 def /userlinewidth gnulinewidth def /vshift -46 def /dl {10 mul} def /hpt_ 31.5 def /vpt_ 31.5 def /hpt hpt_ def /vpt vpt_ def /M {moveto} bind def /L {lineto} bind def /R {rmoveto} bind def /V {rlineto} bind def /vpt2 vpt 2 mul def /hpt2 hpt 2 mul def /Lshow { currentpoint stroke M 0 vshift R show } def /Rshow { currentpoint stroke M dup stringwidth pop neg vshift R show } def /Cshow { currentpoint stroke M dup stringwidth pop -2 div vshift R show } def /UP { dup vpt_ mul /vpt exch def hpt_ mul /hpt exch def /hpt2 hpt 2 mul def /vpt2 vpt 2 mul def } def /DL { Color {setrgbcolor Solid {pop []} if 0 setdash } {pop pop pop Solid {pop []} if 0 setdash} ifelse } def /BL { stroke gnulinewidth 2 mul setlinewidth } def /AL { stroke gnulinewidth 2 div setlinewidth } def /UL { gnulinewidth mul /userlinewidth exch def } def /PL { stroke userlinewidth setlinewidth } def /LTb { BL [] 0 0 0 DL } def /LTa { AL [1 dl 2 dl] 0 setdash 0 0 0 setrgbcolor } def /LT0 { PL [] 1 0 0 DL } def /LT1 { PL [4 dl 2 dl] 0 1 0 DL } def /LT2 { PL [2 dl 3 dl] 0 0 1 DL } def /LT3 { PL [1 dl 1.5 dl] 1 0 1 DL } def /LT4 { PL [5 dl 2 dl 1 dl 2 dl] 0 1 1 DL } def /LT5 { PL [4 dl 3 dl 1 dl 3 dl] 1 1 0 DL } def /LT6 { PL [2 dl 2 dl 2 dl 4 dl] 0 0 0 DL } def /LT7 { PL [2 dl 2 dl 2 dl 2 dl 2 dl 4 dl] 1 0.3 0 DL } def /LT8 { PL [2 dl 2 dl 2 dl 2 dl 2 dl 2 dl 2 dl 4 dl] 0.5 0.5 0.5 DL } def /Pnt { stroke [] 0 setdash gsave 1 setlinecap M 0 0 V stroke grestore } def /Dia { stroke [] 0 setdash 2 copy vpt add M hpt neg vpt neg V hpt vpt neg V hpt vpt V hpt neg vpt V closepath stroke Pnt } def /Pls { stroke [] 0 setdash vpt sub M 0 vpt2 V currentpoint stroke M hpt neg vpt neg R hpt2 0 V stroke } def /Box { stroke [] 0 setdash 2 copy exch hpt sub exch vpt add M 0 vpt2 neg V hpt2 0 V 0 vpt2 V hpt2 neg 0 V closepath stroke Pnt } def /Crs { stroke [] 0 setdash exch hpt sub exch vpt add M hpt2 vpt2 neg V currentpoint stroke M hpt2 neg 0 R hpt2 vpt2 V stroke } def /TriU { stroke [] 0 setdash 2 copy vpt 1.12 mul add M hpt neg vpt -1.62 mul V hpt 2 mul 0 V hpt neg vpt 1.62 mul V closepath stroke Pnt } def /Star { 2 copy Pls Crs } def /BoxF { stroke [] 0 setdash exch hpt sub exch vpt add M 0 vpt2 neg V hpt2 0 V 0 vpt2 V hpt2 neg 0 V closepath fill } def /TriUF { stroke [] 0 setdash vpt 1.12 mul add M hpt neg vpt -1.62 mul V hpt 2 mul 0 V hpt neg vpt 1.62 mul V closepath fill } def /TriD { stroke [] 0 setdash 2 copy vpt 1.12 mul sub M hpt neg vpt 1.62 mul V hpt 2 mul 0 V hpt neg vpt -1.62 mul V closepath stroke Pnt } def /TriDF { stroke [] 0 setdash vpt 1.12 mul sub M hpt neg vpt 1.62 mul V hpt 2 mul 0 V hpt neg vpt -1.62 mul V closepath fill} def /DiaF { stroke [] 0 setdash vpt add M hpt neg vpt neg V hpt vpt neg V hpt vpt V hpt neg vpt V closepath fill } def /Pent { stroke [] 0 setdash 2 copy gsave translate 0 hpt M 4 {72 rotate 0 hpt L} repeat closepath stroke grestore Pnt } def /PentF { stroke [] 0 setdash gsave translate 0 hpt M 4 {72 rotate 0 hpt L} repeat closepath fill grestore } def /Circle { stroke [] 0 setdash 2 copy hpt 0 360 arc stroke Pnt } def /CircleF { stroke [] 0 setdash hpt 0 360 arc fill } def /C0 { BL [] 0 setdash 2 copy moveto vpt 90 450 arc } bind def /C1 { BL [] 0 setdash 2 copy moveto 2 copy vpt 0 90 arc closepath fill vpt 0 360 arc closepath } bind def /C2 { BL [] 0 setdash 2 copy moveto 2 copy vpt 90 180 arc closepath fill vpt 0 360 arc closepath } bind def /C3 { BL [] 0 setdash 2 copy moveto 2 copy vpt 0 180 arc closepath fill vpt 0 360 arc closepath } bind def /C4 { BL [] 0 setdash 2 copy moveto 2 copy vpt 180 270 arc closepath fill vpt 0 360 arc closepath } bind def /C5 { BL [] 0 setdash 2 copy moveto 2 copy vpt 0 90 arc 2 copy moveto 2 copy vpt 180 270 arc closepath fill vpt 0 360 arc } bind def /C6 { BL [] 0 setdash 2 copy moveto 2 copy vpt 90 270 arc closepath fill vpt 0 360 arc closepath } bind def /C7 { BL [] 0 setdash 2 copy moveto 2 copy vpt 0 270 arc closepath fill vpt 0 360 arc closepath } bind def /C8 { BL [] 0 setdash 2 copy moveto 2 copy vpt 270 360 arc closepath fill vpt 0 360 arc closepath } bind def /C9 { BL [] 0 setdash 2 copy moveto 2 copy vpt 270 450 arc closepath fill vpt 0 360 arc closepath } bind def /C10 { BL [] 0 setdash 2 copy 2 copy moveto vpt 270 360 arc closepath fill 2 copy moveto 2 copy vpt 90 180 arc closepath fill vpt 0 360 arc closepath } bind def /C11 { BL [] 0 setdash 2 copy moveto 2 copy vpt 0 180 arc closepath fill 2 copy moveto 2 copy vpt 270 360 arc closepath fill vpt 0 360 arc closepath } bind def /C12 { BL [] 0 setdash 2 copy moveto 2 copy vpt 180 360 arc closepath fill vpt 0 360 arc closepath } bind def /C13 { BL [] 0 setdash 2 copy moveto 2 copy vpt 0 90 arc closepath fill 2 copy moveto 2 copy vpt 180 360 arc closepath fill vpt 0 360 arc closepath } bind def /C14 { BL [] 0 setdash 2 copy moveto 2 copy vpt 90 360 arc closepath fill vpt 0 360 arc } bind def /C15 { BL [] 0 setdash 2 copy vpt 0 360 arc closepath fill vpt 0 360 arc closepath } bind def /Rec { newpath 4 2 roll moveto 1 index 0 rlineto 0 exch rlineto neg 0 rlineto closepath } bind def /Square { dup Rec } bind def /Bsquare { vpt sub exch vpt sub exch vpt2 Square } bind def /S0 { BL [] 0 setdash 2 copy moveto 0 vpt rlineto BL Bsquare } bind def /S1 { BL [] 0 setdash 2 copy vpt Square fill Bsquare } bind def /S2 { BL [] 0 setdash 2 copy exch vpt sub exch vpt Square fill Bsquare } bind def /S3 { BL [] 0 setdash 2 copy exch vpt sub exch vpt2 vpt Rec fill Bsquare } bind def /S4 { BL [] 0 setdash 2 copy exch vpt sub exch vpt sub vpt Square fill Bsquare } bind def /S5 { BL [] 0 setdash 2 copy 2 copy vpt Square fill exch vpt sub exch vpt sub vpt Square fill Bsquare } bind def /S6 { BL [] 0 setdash 2 copy exch vpt sub exch vpt sub vpt vpt2 Rec fill Bsquare } bind def /S7 { BL [] 0 setdash 2 copy exch vpt sub exch vpt sub vpt vpt2 Rec fill 2 copy vpt Square fill Bsquare } bind def /S8 { BL [] 0 setdash 2 copy vpt sub vpt Square fill Bsquare } bind def /S9 { BL [] 0 setdash 2 copy vpt sub vpt vpt2 Rec fill Bsquare } bind def /S10 { BL [] 0 setdash 2 copy vpt sub vpt Square fill 2 copy exch vpt sub exch vpt Square fill Bsquare } bind def /S11 { BL [] 0 setdash 2 copy vpt sub vpt Square fill 2 copy exch vpt sub exch vpt2 vpt Rec fill Bsquare } bind def /S12 { BL [] 0 setdash 2 copy exch vpt sub exch vpt sub vpt2 vpt Rec fill Bsquare } bind def /S13 { BL [] 0 setdash 2 copy exch vpt sub exch vpt sub vpt2 vpt Rec fill 2 copy vpt Square fill Bsquare } bind def /S14 { BL [] 0 setdash 2 copy exch vpt sub exch vpt sub vpt2 vpt Rec fill 2 copy exch vpt sub exch vpt Square fill Bsquare } bind def /S15 { BL [] 0 setdash 2 copy Bsquare fill Bsquare } bind def /D0 { gsave translate 45 rotate 0 0 S0 stroke grestore } bind def /D1 { gsave translate 45 rotate 0 0 S1 stroke grestore } bind def /D2 { gsave translate 45 rotate 0 0 S2 stroke grestore } bind def /D3 { gsave translate 45 rotate 0 0 S3 stroke grestore } bind def /D4 { gsave translate 45 rotate 0 0 S4 stroke grestore } bind def /D5 { gsave translate 45 rotate 0 0 S5 stroke grestore } bind def /D6 { gsave translate 45 rotate 0 0 S6 stroke grestore } bind def /D7 { gsave translate 45 rotate 0 0 S7 stroke grestore } bind def /D8 { gsave translate 45 rotate 0 0 S8 stroke grestore } bind def /D9 { gsave translate 45 rotate 0 0 S9 stroke grestore } bind def /D10 { gsave translate 45 rotate 0 0 S10 stroke grestore } bind def /D11 { gsave translate 45 rotate 0 0 S11 stroke grestore } bind def /D12 { gsave translate 45 rotate 0 0 S12 stroke grestore } bind def /D13 { gsave translate 45 rotate 0 0 S13 stroke grestore } bind def /D14 { gsave translate 45 rotate 0 0 S14 stroke grestore } bind def /D15 { gsave translate 45 rotate 0 0 S15 stroke grestore } bind def /DiaE { stroke [] 0 setdash vpt add M hpt neg vpt neg V hpt vpt neg V hpt vpt V hpt neg vpt V closepath stroke } def /BoxE { stroke [] 0 setdash exch hpt sub exch vpt add M 0 vpt2 neg V hpt2 0 V 0 vpt2 V hpt2 neg 0 V closepath stroke } def /TriUE { stroke [] 0 setdash vpt 1.12 mul add M hpt neg vpt -1.62 mul V hpt 2 mul 0 V hpt neg vpt 1.62 mul V closepath stroke } def /TriDE { stroke [] 0 setdash vpt 1.12 mul sub M hpt neg vpt 1.62 mul V hpt 2 mul 0 V hpt neg vpt -1.62 mul V closepath stroke } def /PentE { stroke [] 0 setdash gsave translate 0 hpt M 4 {72 rotate 0 hpt L} repeat closepath stroke grestore } def /CircE { stroke [] 0 setdash hpt 0 360 arc stroke } def /Opaque { gsave closepath 1 setgray fill grestore 0 setgray closepath } def /DiaW { stroke [] 0 setdash vpt add M hpt neg vpt neg V hpt vpt neg V hpt vpt V hpt neg vpt V Opaque stroke } def /BoxW { stroke [] 0 setdash exch hpt sub exch vpt add M 0 vpt2 neg V hpt2 0 V 0 vpt2 V hpt2 neg 0 V Opaque stroke } def /TriUW { stroke [] 0 setdash vpt 1.12 mul add M hpt neg vpt -1.62 mul V hpt 2 mul 0 V hpt neg vpt 1.62 mul V Opaque stroke } def /TriDW { stroke [] 0 setdash vpt 1.12 mul sub M hpt neg vpt 1.62 mul V hpt 2 mul 0 V hpt neg vpt -1.62 mul V Opaque stroke } def /PentW { stroke [] 0 setdash gsave translate 0 hpt M 4 {72 rotate 0 hpt L} repeat Opaque stroke grestore } def /CircW { stroke [] 0 setdash hpt 0 360 arc Opaque stroke } def /BoxFill { gsave Rec 1 setgray fill grestore } def end %%EndProlog %%Page: 1 1 gnudict begin gsave 50 50 translate 0.100 0.100 scale 0 setgray newpath (Helvetica) findfont 140 scalefont setfont 1.000 UL LTb 574 280 M 63 0 V 4165 0 R -63 0 V 490 280 M (-0.3) Rshow 574 1245 M 63 0 V 4165 0 R -63 0 V -4249 0 R (-0.2) Rshow 574 2209 M 63 0 V 4165 0 R -63 0 V -4249 0 R (-0.1) Rshow 574 3174 M 63 0 V 4165 0 R -63 0 V -4249 0 R (0) Rshow 574 4138 M 63 0 V 4165 0 R -63 0 V -4249 0 R (0.1) Rshow 574 5103 M 63 0 V 4165 0 R -63 0 V -4249 0 R (0.2) Rshow 574 6067 M 63 0 V 4165 0 R -63 0 V -4249 0 R (0.3) Rshow 574 7032 M 63 0 V 4165 0 R -63 0 V -4249 0 R (0.4) Rshow 574 280 M 0 63 V 0 6689 R 0 -63 V 574 140 M (-10) Cshow 1631 280 M 0 63 V 0 6689 R 0 -63 V 0 -6829 R (-5) Cshow 2688 280 M 0 63 V 0 6689 R 0 -63 V 0 -6829 R (0) Cshow 3745 280 M 0 63 V 0 6689 R 0 -63 V 0 -6829 R (5) Cshow 4802 280 M 0 63 V 0 6689 R 0 -63 V 0 -6829 R (10) Cshow 1.000 UL LTb 574 280 M 4228 0 V 0 6752 V -4228 0 V 574 280 L 2688 2209 M (p\(m1=m2\) =0.0863798346775753) Lshow 2688 1245 M (p\(v1=v2\) =0.31647637745891) Lshow 1.000 UL LT0 4151 6899 M (sample 1) Rshow 4235 6899 M 399 0 V 574 3174 M 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 1 V 43 2 V 43 4 V 42 8 V 43 13 V 43 24 V 42 41 V 43 65 V 43 101 V 43 146 V 42 205 V 43 271 V 43 340 V 42 404 V 43 450 V 43 470 V 43 452 V 42 390 V 43 288 V 43 153 V 42 0 V 43 -153 V 43 -288 V 42 -390 V 43 -452 V 43 -470 V 43 -450 V 42 -404 V 43 -340 V 43 -271 V 42 -205 V 43 -146 V 43 -101 V 43 -65 V 42 -41 V 43 -24 V 43 -13 V 42 -8 V 43 -4 V 43 -2 V 42 -1 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 1.000 UL LT1 4151 6759 M (sample 2) Rshow 4235 6759 M 399 0 V 574 3174 M 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 1 V 43 1 V 43 1 V 42 3 V 43 4 V 43 6 V 42 9 V 43 13 V 43 19 V 42 27 V 43 37 V 43 51 V 43 66 V 42 85 V 43 106 V 43 130 V 42 155 V 43 179 V 43 201 V 43 219 V 42 231 V 43 236 V 43 229 V 42 214 V 43 187 V 43 149 V 42 104 V 43 52 V 43 -3 V 43 -57 V 42 -109 V 43 -154 V 43 -189 V 42 -216 V 43 -231 V 43 -235 V 43 -231 V 42 -217 V 43 -199 V 43 -177 V 42 -152 V 43 -127 V 43 -104 V 42 -83 V 43 -65 V 43 -49 V 43 -36 V 42 -26 V 43 -19 V 43 -12 V 42 -9 V 43 -6 V 43 -3 V 43 -3 V 42 -1 V 43 -1 V 43 -1 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 42 0 V 43 0 V 43 0 V 43 0 V 42 0 V 43 0 V stroke grestore end showpage %%Trailer %%DocumentFonts: Helvetica %%Pages: 1