debian/0000775000000000000000000000000012313344336007172 5ustar debian/copyright0000664000000000000000000001471712116110454011130 0ustar Format: http://www.debian.org/doc/packaging-manuals/copyright-format/1.0/ Upstream-Name: genometools Source: http://genometools.org Files: * Copyright: 2001-2013 Stefan Kurtz 2003-2013 Gordon Gremme 2007-2013 Sascha Steinbiss 2004-2012 Stefan Bienert 2010-2011 Joachim Bonnet 2007 David Ellinghaus 2008 Johannes Fischer 2009-2013 Giorgio Gonnella 2007-2008 Thomas Jahns 2007 Malte Mader 2009 Brent Pedersen 2007 Christin Schaerfer 2007 David Schmitz-Huebsch 2003-2005 Michael E Sparks 2009 Zhihao Tang 2010-2013 Dirk Willrodt 2004-2013 Center for Bioinformatics, University of Hamburg License: Permission to use, copy, modify, and distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. . THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. Files: src/core/yarandom.* Copyright: 1997,1998,2003 Jamie Zawinski License: Permission to use, copy, modify, distribute, and sell this software and its documentation for any purpose is hereby granted without fee, provided that the above copyright notice appear in all copies and that both that copyright notice and this permission notice appear in supporting documentation. No representations are made about the suitability of this software for any purpose. It is provided "as is" without express or implied warranty. Files: src/external/libtecla-1.6.1/* Copyright: 2000, 2001, 2002, 2003, 2004 Martin C. Shepherd. License: Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, provided that the above copyright notice(s) and this permission notice appear in all copies of the Software and that both the above copyright notice(s) and this permission notice appear in supporting documentation. . THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT OF THIRD PARTY RIGHTS. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR HOLDERS INCLUDED IN THIS NOTICE BE LIABLE FOR ANY CLAIM, OR ANY SPECIAL INDIRECT OR CONSEQUENTIAL DAMAGES, OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. . Except as contained in this notice, the name of a copyright holder shall not be used in advertising or otherwise to promote the sale, use or other dealings in this Software without prior written authorization of the copyright holder. Files: src/core/msort.[ch] Copyright: 1992, 1993 The Regents of the University of California This code is derived from software contributed to Berkeley by Peter McIlroy. License: Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: 1. Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. 2. Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. 3. Neither the name of the University nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. . THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. Files: src/extended/rbtree.[ch] Copyright: Copyright (c) 2009 Charles Wilson License: Derived from code released into the public domain by Julienne Walker: http://eternallyconfuzzled.com/tuts/datastructures/jsw_tut_rbtree.aspx > Created (Julienne Walker): August 23, 2003 > Modified (Julienne Walker): March 14, 2008 . Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: . The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. . THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. debian/man/0000775000000000000000000000000012116110454007736 5ustar debian/man/gt-encseq-bitextract.10000664000000000000000000000362412116110454014062 0ustar '\" t .\" Title: gt-encseq-bitextract .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ\-BITEXTRA" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq-bitextract \- Extracts internal data from encoded sequences\&. .SH "SYNOPSIS" .sp gt encseq bitextract [option \&...] [indexname] .SH "OPTIONS" .PP \fB\-mirrored\fR .RS 4 mirror sequence (default: no) .RE .PP \fB\-stoppos\fR .RS 4 output stop positions (default: undefined) .RE .PP \fB\-specialranges\fR .RS 4 output special ranges (default: no) .RE .PP \fB\-bitpos\fR .RS 4 extract and display two bit encoding for position (default: undefined) .RE .PP \fB\-dir\fR .RS 4 specify reading direction (fwd, cpl, rev, rcl) (default: fwd) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-csa.10000664000000000000000000001172212116110454011201 0ustar '\" t .\" Title: gt-csa .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/10/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-CSA" "1" "10/10/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-csa \- Transform spliced alignments from GFF3 file into consensus spliced alignments\&. .SH "SYNOPSIS" .sp gt csa [option \&...] [GFF3_file] .SH "OPTIONS" .PP \fB\-join\-length\fR .RS 4 set join length for the spliced alignment clustering (default: 300) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Let\(cqs assume we have a GFF3 file \fIcsa_example_spliced_alignments\&.gff3\fR containing the following four overlapping spliced alignments (represented as genes with exons as children): .sp .if n \{\ .RS 4 .\} .nf ##gff\-version 3 ##sequence\-region seq 1 290 seq \&. gene 1 209 \&. + \&. ID=gene1 seq \&. exon 1 90 \&. + \&. Parent=gene1 seq \&. exon 110 190 \&. + \&. Parent=gene1 seq \&. exon 201 209 \&. + \&. Parent=gene1 ### seq \&. gene 1 290 \&. + \&. ID=gene2 seq \&. exon 1 90 \&. + \&. Parent=gene2 seq \&. exon 101 190 \&. + \&. Parent=gene2 seq \&. exon 201 290 \&. + \&. Parent=gene2 ### seq \&. gene 10 290 \&. + \&. ID=gene3 seq \&. exon 10 90 \&. + \&. Parent=gene3 seq \&. exon 110 190 \&. + \&. Parent=gene3 seq \&. exon 201 290 \&. + \&. Parent=gene3 ### seq \&. gene 181 290 \&. + \&. ID=gene4 seq \&. exon 181 190 \&. + \&. Parent=gene4 seq \&. exon 201 290 \&. + \&. Parent=gene4 ### .fi .if n \{\ .RE .\} .sp To compute the consensus spliced alignments we call: .sp $ gt csa csa_example_spliced_alignments\&.gff3 .sp Which returns: .sp .if n \{\ .RS 4 .\} .nf ##gff\-version 3 ##sequence\-region seq 1 290 seq gt csa gene 1 290 \&. + \&. ID=gene1 seq gt csa mRNA 1 290 \&. + \&. ID=mRNA1;Parent=gene1 seq gt csa exon 1 90 \&. + \&. Parent=mRNA1 seq gt csa exon 110 190 \&. + \&. Parent=mRNA1 seq gt csa exon 201 290 \&. + \&. Parent=mRNA1 seq gt csa mRNA 1 290 \&. + \&. ID=mRNA2;Parent=gene1 seq gt csa exon 1 90 \&. + \&. Parent=mRNA2 seq gt csa exon 101 190 \&. + \&. Parent=mRNA2 seq gt csa exon 201 290 \&. + \&. Parent=mRNA2 ### .fi .if n \{\ .RE .\} .sp As one can see, they have been combined into a consensus spliced alignment (represented as genes with mRNAs as children which in turn have exons as children) with two alternative splice forms\&. The first and the third spliced alignment have been combined into the first alternative splice form (mRNA1) and the the second and the fourth spliced alignment into the second alternative splice form (mRNA2)\&. .sp As one can see, the second exon from the first alternative splice form ist shorter than the corresponding exon from the second alternative splice form\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-hop.10000664000000000000000000001143112116110454011216 0ustar '\" t .\" Title: gt-hop .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/10/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-HOP" "1" "10/10/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-hop \- Reference\-based homopolymer error correction\&. .SH "SYNOPSIS" .sp gt hop \- \-ref \-map \-reads [options\&...] .SH "OPTIONS" .PP \fB\-ref\fR .RS 4 reference sequence in GtEncseq format (can be prepared using gt encseq encode) .RE .PP \fB\-map\fR .RS 4 mapping of reads to reference it must be in SAM/BAM format, and sorted by coordinate (can be prepared e\&.g\&. using: samtools sort) .RE .PP \fB\-sam\fR .RS 4 mapping file is SAM (default: BAM) .RE .PP \fB\-aggressive\fR .RS 4 correct as much as possible .RE .PP \fB\-moderate\fR .RS 4 mediate between sensitivity and precision .RE .PP \fB\-conservative\fR .RS 4 correct only most likely errors .RE .PP \fB\-expert\fR .RS 4 manually select correction criteria .RE .PP \fB\-reads\fR .RS 4 uncorrected read file(s) in FastQ format; the corrected reads are output in the currect working directory in files which are named as the input files, each prepended by a prefix (see \-outprefix option) \-reads allows one to output the reads in the same order as in the input and is mandatory if the SAM contains more than a single primary alignment for each read (e\&.g\&. output of bwasw) see also \-o option as an alternative .RE .PP \fB\-outprefix\fR .RS 4 prefix for output filenames (corrected reads)when \-reads is specified the prefix is prepended to each input filename (default: hop_) .RE .PP \fB\-o\fR .RS 4 output file for corrected reads (see also \-reads/\-outprefix) if \-o is used, reads are output in a single file in the order they are found in the SAM file (which usually differ from the original order) this will only work if the reads were aligned with a software which only includes 1 alignment for each read (e\&.g\&. bwa) (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Correction mode: .sp One of the options \-aggressive, \-moderate, \-conservative or \-expert must be selected\&. .sp The \-aggressive, \-moderate and \-conservative modes are presets of the criteria by which it is decided if an observed discrepancy in homopolymer length between reference and a read shall be corrected or not\&. A description of the single criteria is provided by using the \-help+ option\&. The presets are equivalent to the following settings: .sp .if n \{\ .RS 4 .\} .nf \-aggressive \-moderate \-conservative \-hmin 3 3 3 \-read\-hmin 1 1 2 \-altmax 1\&.00 0\&.99 0\&.80 \-refmin 0\&.00 0\&.00 0\&.10 \-mapqmin 0 10 21 \-covmin 1 1 1 \-clenmax unlimited unlimited unlimited \-allow\-multiple yes yes no .fi .if n \{\ .RE .\} .sp The aggressive mode tries to maximize the sensitivity, the conservative mode to minimize the false positives\&. An even more conservative set of corrections can be achieved using the \-ann option (see \-help+)\&. .sp The \-expert mode allows one to manually set each parameter; the default values are the same as in the \-conservative mode\&. .sp (Finally, for evaluation purposes only, the \-state\-of\-truth mode can be used: this mode assumes that the target sequence of the sequencing has been specified as reference sequence and outputs an ideal list of corrections\&.) .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-readjoiner.10000664000000000000000000000306512116110454012556 0ustar '\" t .\" Title: gt-readjoiner .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-READJOINER" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-readjoiner \- String graph based sequencing reads assembler\&. .SH "SYNOPSIS" .sp gt readjoiner [option \&...] tool [argument \&...] .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Tools: .sp assembly overlap prefilter .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-compreads-decompress.10000664000000000000000000000421512116110454014551 0ustar '\" t .\" Title: gt-compreads-decompress .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-COMPREADS\-DECOM" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-compreads-decompress \- Decodes a file of compressed reads\&. .SH "SYNOPSIS" .sp gt compreads decompress [option \&...] (\-file file) .SH "OPTIONS" .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-descs\fR .RS 4 enable description decoding (default: no) .RE .PP \fB\-file\fR .RS 4 specify base name of files containing HCR\&. (default: undefined) .RE .PP \fB\-name\fR .RS 4 specify base name for decoded hcr (suffix will be "\&.fastq") (default: undefined) .RE .PP \fB\-smap\fR .RS 4 specify file containing alphabetdescription (file must be an \&.al1 file)\&. If "\-smap" is not set, dna alphabet is used\&. (default: undefined) .RE .PP \fB\-range\fR .RS 4 decode multiple consecutive reads\&. If range is not specified, the entire file will be decoded\&. (default: undefined) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-convertseq.10000664000000000000000000000446612116110454012633 0ustar '\" t .\" Title: gt-convertseq .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-CONVERTSEQ" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-convertseq \- Parse and convert sequence file formats\&. .SH "SYNOPSIS" .sp gt convertseq [options] file [\&...] .SH "OPTIONS" .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-r\fR .RS 4 reverse complement sequences (default: no) .RE .PP \fB\-showfilelengthvalues\fR .RS 4 show filelengths (default: no) .RE .PP \fB\-noseq\fR .RS 4 do not show sequences (default: no) .RE .PP \fB\-fastawidth\fR .RS 4 FASTA output line width (default: 60) .RE .PP \fB\-contractdnawc\fR .RS 4 replace stretches of DNA wildcards with a single \fIN\fR (default: no) .RE .PP \fB\-contractproteinwc\fR .RS 4 replace stretches of protein wildcards with a single \fIX\fR (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-shredder.10000664000000000000000000000643612116110454012241 0ustar '\" t .\" Title: gt-shredder .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SHREDDER" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-shredder \- Shredder sequence file(s) into consecutive pieces of random length\&. .SH "SYNOPSIS" .sp gt shredder [option \&...] [sequence_file \&...] .SH "OPTIONS" .PP \fB\-coverage\fR .RS 4 set the number of times the sequence_file is shreddered (default: 1) .RE .PP \fB\-minlength\fR .RS 4 set the minimum length of the shreddered fragments (default: 300) .RE .PP \fB\-maxlength\fR .RS 4 set the maximum length of the shreddered fragments (default: 700) .RE .PP \fB\-overlap\fR .RS 4 set the overlap between consecutive pieces (default: 0) .RE .PP \fB\-sample\fR .RS 4 take samples of the generated sequences pieces with the given probability (default: 1\&.00) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Each sequence given in sequence_file is shreddered into consecutive pieces of random length (between \-minlength and \-maxlength) until it is consumed\&. By this means the last shreddered fragment of a given sequence can be shorter than the argument to option \-minlength\&. To get rid of such fragments use gt seqfilter (see example below)\&. .SH "EXAMPLES:" .sp Shredder a given BAC .sp $ gt shredder U89959_genomic\&.fas > fragments\&.fas .sp Shredder an EST collection into pieces between 50 and 100 bp and get rid of all (terminal) fragments shorter than 50 bp .sp $ gt shredder \-minlength 50 \-maxlength 100 U89959_ests\&.fas \e | gt seqfilter \-minlength 50 \- > fragments\&.fas # 130 out of 1260 sequences have been removed (10\&.317%) .sp Shredder an EST collection and show only random 10% of the resulting fragments .sp $ gt shredder \-sample 0\&.1 U89959_ests\&.fas .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-compreads-compress.10000664000000000000000000000456712116110454014252 0ustar '\" t .\" Title: gt-compreads-compress .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-COMPREADS\-COMPR" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-compreads-compress \- Generates compact encoding for fastq data\&. .SH "SYNOPSIS" .sp gt compreads compress [option \&...] (\-files file [\&...]) .SH "OPTIONS" .PP \fB\-descs\fR .RS 4 encode descriptions (default: no) .RE .PP \fB\-files\fR .RS 4 File(s) containing reads\&. .RE .PP \fB\-name\fR .RS 4 specify base name for HCR to be generated\&. Only mandatory, if more than one file was given\&. (default: undefined) .RE .PP \fB\-smap\fR .RS 4 file containing alphabet description\&. If "\-smap" is not set, dna alphabet is used\&. (default: undefined) .RE .PP \fB\-qrange\fR .RS 4 specify range of quality values\&. All values smaller or equal to the lower bound will be converted to the lower bound\&. All values equal or larger than the upper bound will be converted to the upper bound\&. (default: undefined) .RE .PP \fB\-srate\fR .RS 4 sampling rate, set to sensible default depending on sampling method (default: undefined) .RE .PP \fB\-stype\fR .RS 4 type of sampling one of regular \- page \- none (default: page) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-encseq-md5.10000664000000000000000000000354512116110454012400 0ustar '\" t .\" Title: gt-encseq-md5 .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ\-MD5" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq-md5 \- Display MD5 sums for an encoded sequence\&. .SH "SYNOPSIS" .sp gt encseq md5 [option \&...] indexname .SH "OPTIONS" .PP \fB\-fromindex\fR .RS 4 use MD5 table from \&.md5 file (default: yes) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-sequniq.10000664000000000000000000000412212116110454012114 0ustar '\" t .\" Title: gt-sequniq .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQUNIQ" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-sequniq \- Filter out repeated sequences in given in given sequence_file(s)\&. .SH "SYNOPSIS" .sp gt sequniq [option \&...] sequence_file [\&...] .SH "OPTIONS" .PP \fB\-rev\fR .RS 4 filter out also sequences whose reverse complement is identical to a sequence already output (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-packedindex.10000664000000000000000000000327112116110454012712 0ustar '\" t .\" Title: gt-packedindex .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-PACKEDINDEX" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-packedindex \- Call packed index tool with name index_tool and pass argument(s) to it\&. .SH "SYNOPSIS" .sp gt packedindex [option \&...] index_tool [argument \&...] .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Tools: .sp chkintegrity chksearch mkctxmap mkindex trsuftab .sp For detailed information, please refer to the manual of packedindex\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-tallymer-mkindex.10000664000000000000000000000473412116110454013726 0ustar '\" t .\" Title: gt-tallymer-mkindex .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-TALLYMER\-MKINDE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-tallymer-mkindex \- Count and index k\-mers in the given enhanced suffix array for a fixed value of k\&. .SH "SYNOPSIS" .sp gt tallymer mkindex [options] \-esa suffixerator\-index [options] .SH "OPTIONS" .PP \fB\-esa\fR .RS 4 specify suffixerator\-index (mandatory option) (default: undefined) .RE .PP \fB\-mersize\fR .RS 4 Specify the mer size\&. (default: 20) .RE .PP \fB\-minocc\fR .RS 4 Specify the minimum occurrence number for the mers to output/index (default: 0) .RE .PP \fB\-maxocc\fR .RS 4 Specify the maximum occurrence number for the mers to output/index (default: 0) .RE .PP \fB\-pl\fR .RS 4 specify prefix length for bucket boundary construction recommendation: use without argument; then a reasonable prefix length is automatically determined (default: 0) .RE .PP \fB\-indexname\fR .RS 4 store the mers specified by options \-maxocc and \-minocc in an index (default: undefined) .RE .PP \fB\-counts\fR .RS 4 store counts of the mers (default: no) .RE .PP \fB\-scan\fR .RS 4 read enhanced suffix array sequentially instead of mapping it to memory (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-gtf_to_gff3.10000664000000000000000000000354212116110454012623 0ustar '\" t .\" Title: gt-gtf_to_gff3 .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-GTF_TO_GFF3" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-gtf_to_gff3 \- Parse GTF2\&.2 file and convert it to GFF3\&. .SH "SYNOPSIS" .sp gt gtf_to_gff3 [GTF_file] .SH "OPTIONS" .PP \fB\-tidy\fR .RS 4 try to tidy the GTF file up during parsing (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-seqorder.10000664000000000000000000000346512116110454012264 0ustar '\" t .\" Title: gt-seqorder .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQORDER" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-seqorder \- Output sequences as MultiFasta in specified order\&. .SH "SYNOPSIS" .sp gt seqorder (\-invert|\-sort|\-revsort|\-shuffle) encseq .SH "OPTIONS" .PP \fB\-invert\fR .RS 4 invert order of sequences (default: no) .RE .PP \fB\-sort\fR .RS 4 sort sequences lexicographically (default: no) .RE .PP \fB\-revsort\fR .RS 4 sort sequences in reverse lexicographic order (default: no) .RE .PP \fB\-shuffle\fR .RS 4 shuffle sequences pseudo\-randomly (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-encseq-info.10000664000000000000000000000404412116110454012641 0ustar '\" t .\" Title: gt-encseq-info .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ\-INFO" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq-info \- Display meta\-information about an encoded sequence\&. .SH "SYNOPSIS" .sp gt encseq info [option \&...] indexname .SH "OPTIONS" .PP \fB\-nomap\fR .RS 4 do not map encoded sequence (gives less information) (default: no) .RE .PP \fB\-mirrored\fR .RS 4 use mirrored encoded sequence (DNA only) (default: no) .RE .PP \fB\-noindexname\fR .RS 4 do not output index name (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-eval.10000664000000000000000000000547412116110454011371 0ustar '\" t .\" Title: gt-eval .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-EVAL" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-eval \- Compare annotation files and show accuracy measures (prediction vs\&. reference)\&. .SH "SYNOPSIS" .sp gt eval reference_file prediction_file .SH "OPTIONS" .PP \fB\-nuc\fR .RS 4 evaluate nucleotide level (memory consumption is proportional to the input file sizes) (default: yes) .RE .PP \fB\-ltr\fR .RS 4 evaluate a LTR retrotransposon prediction instead of a gene prediction (all LTR_retrotransposon elements are considered to have an undetermined strand) (default: no) .RE .PP \fB\-ltrdelta\fR .RS 4 set allowed delta for LTR borders to be considered equal (default: 20) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp The program shows sensitivity and specificity values for certain feature types (e\&.g\&., gene, mRNA, and exon)\&. For some feature types the number of missing and wrong features of that type is also shown\&. Thereby, \(lqmissing\(rq means the numbe r of features of that type from the \(lqreference\(rq without overlap to a feature of that type from the \(lqprediction\(rq\&. Vice versa, \(lqwrong\(rq denotes the number of features of that type from the \(lqprediction\(rq without overlap to a feature of that type from the \(lqreference\(rq\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-uniquesub.10000664000000000000000000000406712116110454012457 0ustar '\" t .\" Title: gt-uniquesub .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-UNIQUESUB" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-uniquesub \- Compute length of minumum unique prefixes\&. .SH "SYNOPSIS" .sp gt uniquesub [options \&...] \-query queryfile [\&...] .SH "OPTIONS" .PP \fB\-fmi\fR .RS 4 specify fmindex (default: undefined) .RE .PP \fB\-esa\fR .RS 4 specify suffix array (default: undefined) .RE .PP \fB\-pck\fR .RS 4 specify packed index (default: undefined) .RE .PP \fB\-query\fR .RS 4 specify queryfiles .RE .PP \fB\-min\fR .RS 4 only output length if >= given minimum length (default: 0) .RE .PP \fB\-max\fR .RS 4 only output length if ⇐ given maximum length (default: 0) .RE .PP \fB\-output\fR .RS 4 set output flags (sequence, querypos) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp For detailed information, please refer to the manual of uniquesub\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt.10000664000000000000000000000542012116110454010433 0ustar '\" t .\" Title: gt .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt \- The GenomeTools (gt) genome analysis system (http://genometools\&.org)\&. .SH "SYNOPSIS" .sp gt [option \&...] [tool | script] [argument \&...] .SH "OPTIONS" .PP \fB\-i\fR .RS 4 enter interactive mode after executing \fItool\fR or \fIscript\fR .RE .PP \fB\-test\fR .RS 4 perform unit tests and exit .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Tools: .sp bed_to_gff3 cds chain2dim chseqids clean compreads congruence convertseq csa dupfeat encseq encseq2spm eval extractfeat extractseq featureindex fingerprint genomediff gff3 gff3_to_gtf gff3validator gtf_to_gff3 hop id_to_md5 interfeat ltrclustering ltrdigest ltrharvest matchtool matstat md5_to_id merge mergefeat mgth mkfeatureindex mkfmindex mmapandread orffinder packedindex prebwt readjoiner repfind scriptfilter select seq seqfilter seqids seqmutate seqorder seqstat seqtransform seqtranslate sequniq shredder shulengthdist simreads sketch sketch_page splicesiteinfo splitfasta stat suffixerator tagerator tallymer uniq uniquesub .sp Set the environment variable GT_MEM_BOOKKEEPING=on to enable memory bookkeeping (e\&.g\&., like this: env GT_MEM_BOOKKEEPING=on gt)\&. .sp Set the environment variable GT_ENV_OPTIONS=\-spacepeak to show a spacepeak afte r program run\&. Set the environment variable GT_ENV_OPTIONS=\-showtime to show processing times for some program parts if implemented\&. .sp Combinations are possible\&. Running the \(oqgt\(cq binary with GT_ENV_OPTIONS=\-help shows all possible \(lqenvironment options\(rq) .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-readjoiner-assembly.10000664000000000000000000000343112116110454014370 0ustar '\" t .\" Title: gt-readjoiner-assembly .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-READJOINER\-ASSE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-readjoiner-assembly \- Construct string graph and output contigs\&. .SH "SYNOPSIS" .sp gt readjoiner assembly [option \&...] .SH "OPTIONS" .PP \fB\-readset\fR .RS 4 specify the readset name (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-q\fR .RS 4 suppress standard output messages (default: no) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-dupfeat.10000664000000000000000000000364712116110454012072 0ustar '\" t .\" Title: gt-dupfeat .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-DUPFEAT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-dupfeat \- Duplicate internal feature nodes in given GFF3_file(s)\&. .SH "SYNOPSIS" .sp gt dupfeat [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-dest\fR .RS 4 set destination type (default: undefined) .RE .PP \fB\-source\fR .RS 4 set source type (default: undefined) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-mgth.10000664000000000000000000000630412116110454011372 0ustar '\" t .\" Title: gt-mgth .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MGTH" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-mgth \- Metagenomethreader, for predicting genes in metagenomeprojects\&. .SH "SYNOPSIS" .sp gt mgth [option \&...] XML\-File Query\-FASTA\-File Hit\-FASTA\-File .SH "OPTIONS" .PP \fB\-s\fR .RS 4 score for synonymic base exchanges (default: 1\&.00) .RE .PP \fB\-n\fR .RS 4 score for non\-synonymic base exchanges (default: \-1\&.00) .RE .PP \fB\-b\fR .RS 4 score for blast\-hit\-end within query sequence (default: \-10\&.00) .RE .PP \fB\-q\fR .RS 4 score for stop\-codon within querysequence (default: \-2\&.00) .RE .PP \fB\-h\fR .RS 4 score for stop\-codon within hitsequence (default: \-5\&.00) .RE .PP \fB\-l\fR .RS 4 score for leaving a gene on forward/reverse strand or enter a gene on forward/reverse strand (default: \-2\&.00) .RE .PP \fB\-p\fR .RS 4 max\&. span between coding\-regions resume as one prediction (default: 400\&.00) .RE .PP \fB\-f\fR .RS 4 max\&. span between coding\-regions in different reading frames resume as coding\-regions in the optimal reading\-frame (default: 200\&.00) .RE .PP \fB\-c\fR .RS 4 db\-name for fcgi\-db (default: nucleotide) .RE .PP \fB\-o\fR .RS 4 name for resulting output\-file (default: output) .RE .PP \fB\-k\fR .RS 4 name for the Hit\-Sequence\-DB (default: nucleotide database) .RE .PP \fB\-t\fR .RS 4 true or false if a Hit\-FASTA\-File exist (default: no) .RE .PP \fB\-r\fR .RS 4 format of the output\-file (default: 1) .RE .PP \fB\-a\fR .RS 4 minimum length of the as\-sequence (default: 15) .RE .PP \fB\-d\fR .RS 4 minimum percent\-value for hit\-statistic\-output (default: 0\&.00) .RE .PP \fB\-e\fR .RS 4 use of alternative start\-codons (default: 1) .RE .PP \fB\-m\fR .RS 4 search for homology (default: no) .RE .PP \fB\-g\fR .RS 4 testmodus, output without creating date (default: no) .RE .PP \fB\-x\fR .RS 4 extend the EGTs to max (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp For detailed information, please refer to the manual of mgth\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-cds.10000664000000000000000000000744512116110454011213 0ustar '\" t .\" Title: gt-cds .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-CDS" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-cds \- Add CDS (coding sequence) features to exon features given in GFF3 file\&. .SH "SYNOPSIS" .sp gt cds [option \&...] [GFF3_file] .SH "OPTIONS" .PP \fB\-minorflen\fR .RS 4 set the minimum length an open reading frame (ORF) must have to be added as a CDS feature (measured in amino acids) (default: 64) .RE .PP \fB\-startcodon\fR .RS 4 require than an ORF must begin with a start codon (default: no) .RE .PP \fB\-finalstopcodon\fR .RS 4 require that the final ORF must end with a stop codon (default: no) .RE .PP \fB\-seqfile\fR .RS 4 set the sequence file from which to extract the features (default: undefined) .RE .PP \fB\-seqfiles\fR .RS 4 set the sequence files from which to extract the features use \fI\-\-\fR to terminate the list of sequence files .RE .PP \fB\-matchdesc\fR .RS 4 match the sequence descriptions from the input files for the desired sequence IDs (in GFF3) (default: no) .RE .PP \fB\-usedesc\fR .RS 4 use sequence descriptions to map the sequence IDs (in GFF3) to actual sequence entries\&. If a description contains a sequence range (e\&.g\&., III:1000001\&.\&.2000000), the first part is used as sequence ID (\fIIII\fR) and the first range position as offset (\fI1000001\fR) (default: no) .RE .PP \fB\-regionmapping\fR .RS 4 set file containing sequence\-region to sequence file mapping (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp File format for option \-regionmapping: .sp The file supplied to option \-regionmapping defines a \(lqmapping\(rq\&. A mapping maps the sequence\-regions given in the GFF3_file to a sequence file containing the corresponding sequence\&. Mappings can be defined in one of the following two forms: .sp mapping = { chr1 = "hs_ref_chr1\&.fa\&.gz", chr2 = "hs_ref_chr2\&.fa\&.gz" } .sp or .sp function mapping(sequence_region) return "hs_ref_"\&.\&.sequence_region\&.\&."\&.fa\&.gz" end .sp The first form defines a Lua (http://www\&.lua\&.org/) table named \(lqmapping\(rq which maps each sequence region to the corresponding sequence file\&. The second one defines a Lua function \(lqmapping\(rq, which has to return the sequence file name when it is called with the sequence_region as argument\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-encseq-bench.10000664000000000000000000000346712116110454012775 0ustar '\" t .\" Title: gt-encseq-bench .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ\-BENCH" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq-bench \- Perform benchmark on extractions from encseq\&. .SH "SYNOPSIS" .sp gt encseq bench [option \&...] indexname .SH "OPTIONS" .PP \fB\-ccext\fR .RS 4 specify number of random character extractions (default: 0) .RE .PP \fB\-solepr\fR .RS 4 prepare data structure for sequences ordered by their length (default: no) .RE .PP \fB\-sain\fR .RS 4 run induced suffix sorting in given mode (default: 0) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-compreads-refcompress.10000664000000000000000000000510512116110454014734 0ustar '\" t .\" Title: gt-compreads-refcompress .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-COMPREADS\-REFCO" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-compreads-refcompress \- Generates compact encoding for fastq data using Reference Compressed Reads (RCR)\&. .SH "SYNOPSIS" .sp gt compreads refcompress [option \&...] (\-bam file \-ref file) .SH "OPTIONS" .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-mquals\fR .RS 4 store mapping quality for each read (default: no) .RE .PP \fB\-quals\fR .RS 4 store all quality values for each read, this implies enabling of option "vquals" (default: no) .RE .PP \fB\-vquals\fR .RS 4 store quality values of read positions having variations compared to reference (default: no) .RE .PP \fB\-descs\fR .RS 4 store read name for each read (default: no) .RE .PP \fB\-ureads\fR .RS 4 store unmapped reads in a separated fastq file (base name will be the value given in name and suffix will be " _unmapped\&.fastq" (default: no) .RE .PP \fB\-ref\fR .RS 4 Index file (generated by the gt encseq tool) for reference genome\&. (default: undefined) .RE .PP \fB\-bam\fR .RS 4 File containing alignment of reads to genome (sorted "\&.bam" file)\&. (default: undefined) .RE .PP \fB\-name\fR .RS 4 specify base name for RCR to be generated\&. If not set, base name will be set to base name of value given for option "bam" (default: undefined) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-compreads-refdecompress.10000664000000000000000000000376412116110454015256 0ustar '\" t .\" Title: gt-compreads-refdecompress .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-COMPREADS\-REFDE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-compreads-refdecompress \- Decodes a given RCR (Reference Compressed Reads)\&. .SH "SYNOPSIS" .sp gt compreads refdecompress [option \&...] (\-file file) .SH "OPTIONS" .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-qnames\fR .RS 4 decode read names, default is to just number them (default: no) .RE .PP \fB\-ref\fR .RS 4 Index file (generated by the gt encseq tool) for reference genome\&. (default: undefined) .RE .PP \fB\-rcr\fR .RS 4 specify base name of file containing RCR\&. (default: undefined) .RE .PP \fB\-name\fR .RS 4 specify base name for decoded RCR (suffix will be "\&.rcr\&.decoded") (default: undefined) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-packedindex-trsuftab.10000664000000000000000000000537012116110454014544 0ustar '\" t .\" Title: gt-packedindex-trsuftab .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-PACKEDINDEX\-TRS" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-packedindex-trsuftab \- Build BWT packedindex for project [indexname]\&. .SH "SYNOPSIS" .sp gt packedindex trsuftab indexname .SH "OPTIONS" .PP \fB\-bsize\fR .RS 4 specify size of blocks (default: 8) .RE .PP \fB\-blbuck\fR .RS 4 specify number of blocks per bucket (default: 8) .RE .PP \fB\-locfreq\fR .RS 4 specify the locate frequency parameter i means that each i\-th position of input string is stored 0 ⇒ no locate information (default: 16) .RE .PP \fB\-locbitmap\fR .RS 4 marked/unmarked positions for locate are stored as bitmaps this gives faster location of hits but increases the index by 1 bit per symbol (default: yes) .RE .PP \fB\-sprank\fR .RS 4 build rank table for special symbols this produces an index which can be used to regenerate the original sequence but increases the memory used during index creation (default: no) .RE .PP \fB\-sprankilog\fR .RS 4 specify the interval of rank sampling as log value parameter i means that each 2^i\-th position of source is sampled for rank undefined ⇒ chooses default of log(log(sequence length)) (default: undefined) .RE .PP \fB\-ctxilog\fR .RS 4 specify the interval of context sampling as log value parameter i means that each 2^i\-th position of source is sampled for rank \-1 ⇒ chooses default of log(log(sequence length)) \-2 ⇒ generates no map (default: \-2) .RE .PP \fB\-v\fR .RS 4 print verbose progress information (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-readjoiner-prefilter.10000664000000000000000000000441712116110454014552 0ustar '\" t .\" Title: gt-readjoiner-prefilter .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-READJOINER\-PREF" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-readjoiner-prefilter \- Remove contained and low\-quality reads and encode read set in GtEncseq format\&. .SH "SYNOPSIS" .sp gt readjoiner prefilter [option \&...] .SH "OPTIONS" .PP \fB\-readset\fR .RS 4 specify the readset name (default: filename of first input sequence_file) .RE .PP \fB\-db\fR .RS 4 specify a list of input libraries (Fasta/FastQ); for single\-end libraries use the filename (which is not allowed to contain \fI:\fR symbols); for paired\-end libraries with reads interleaved (f,r,f,r,\&...) in a single file use the notation :[,] (stdev may be omitted); for paired\-end with reads in two files (f, r) use the notation ::[,] .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-q\fR .RS 4 suppress standard output messages (default: no) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-encseq.10000664000000000000000000000312412116110454011706 0ustar '\" t .\" Title: gt-encseq .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq \- Call encoded sequence manipulation tool [tool] and pass argument(s) to it\&. .SH "SYNOPSIS" .sp gt encseq [option \&...] tool [argument \&...] .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Tools: .sp bench bitextract check decode encode info md5 .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-featureindex.10000664000000000000000000000372612116110454013123 0ustar '\" t .\" Title: gt-featureindex .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-FEATUREINDEX" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-featureindex \- Retrieve annotations from a persistent feature index as GFF3 output\&. .SH "SYNOPSIS" .sp gt featureindex [option \&...] indexfilename .SH "OPTIONS" .PP \fB\-range\fR .RS 4 range constraint for index query (default: undefined) .RE .PP \fB\-seqid\fR .RS 4 sequence region (default: undefined) .RE .PP \fB\-retain\fR .RS 4 retain attributes (default: yes) .RE .PP \fB\-backend\fR .RS 4 database backend to use choose from [sqlite] (default: sqlite) .RE .PP \fB\-filename\fR .RS 4 filename for feature database (sqlite backend only) (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-gff3.10000664000000000000000000000745612116110454011271 0ustar '\" t .\" Title: gt-gff3 .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-GFF3" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-gff3 \- Parse, possibly transform, and output GFF3 files\&. .SH "SYNOPSIS" .sp gt gff3 [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-sort\fR .RS 4 sort the GFF3 features (memory consumption is proportional to the input file size(s)) (default: no) .RE .PP \fB\-tidy\fR .RS 4 try to tidy the GFF3 files up during parsing (default: no) .RE .PP \fB\-retainids\fR .RS 4 when available, use the original IDs provided in the source file (memory consumption is proportional to the input file size(s)) (default: no) .RE .PP \fB\-checkids\fR .RS 4 make sure the ID attributes are unique within the scope of each GFF3_file, as required by GFF3 specification (memory consumption is proportional to the input file size(s)) (default: no) .RE .PP \fB\-addids\fR .RS 4 add missing "##sequence\-region" lines automatically (default: yes) .RE .PP \fB\-fixregionboundaries\fR .RS 4 automatically adjust "##sequence\-region" lines to contain all their features (memory consumption is proportional to the input file size(s)) (default: no) .RE .PP \fB\-addintrons\fR .RS 4 add intron features between existing exon features (default: no) .RE .PP \fB\-offset\fR .RS 4 transform all features by the given offset (default: undefined) .RE .PP \fB\-offsetfile\fR .RS 4 transform all features by the offsets given in file (default: undefined) .RE .PP \fB\-typecheck\fR .RS 4 check GFF3 types against "id" and "name" tags in given OBO file (default: undefined) .RE .PP \fB\-show\fR .RS 4 show GFF3 output (default: yes) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp File format for option \-offsetfile: .sp The file supplied to option \-offsetfile defines a mapping table named \(lqoffsets\(rq\&. It maps the sequence\-regions given in the GFF3_file to offsets\&. It can be defined as follows: .sp offsets = { chr1 = 1000, chr2 = 500 } .sp When this example is used, all features with seqid \(lqchr1\(rq will be offset by 1000 and all features with seqid \(lqchr2\(rq by 500\&. .sp If \-offsetfile is used, offsets for all sequence\-regions contained in the given GFF3 files must be defined\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-seqtransform.10000664000000000000000000000406312116110454013157 0ustar '\" t .\" Title: gt-seqtransform .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQTRANSFORM" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-seqtransform \- Perform simple transformations on the given sequence file(s)\&. .SH "SYNOPSIS" .sp gt seqtransform [option \&...] [sequence_file \&...] .SH "OPTIONS" .PP \fB\-addstopaminos\fR .RS 4 append stop amino acids (\fI*\fR) to given protein sequences, if not already present (default: no) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-bed_to_gff3.10000664000000000000000000000403012116110454012566 0ustar '\" t .\" Title: gt-bed_to_gff3 .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-BED_TO_GFF3" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-bed_to_gff3 \- Parse BED file and convert it to GFF3\&. .SH "SYNOPSIS" .sp gt bed_to_gff3 [BED_file] .SH "OPTIONS" .PP \fB\-featuretype\fR .RS 4 Set type of parsed BED features (default: BED_feature) .RE .PP \fB\-thicktype\fR .RS 4 Set type of parsed thick BED features (default: BED_thick_feature) .RE .PP \fB\-blocktype\fR .RS 4 Set type of parsed BED blocks (default: BED_block) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-ltrdigest.10000664000000000000000000000626612116110454012443 0ustar '\" t .\" Title: gt-ltrdigest .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-LTRDIGEST" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-ltrdigest \- Identifies and annotates sequence features in LTR retrotransposon candidates\&. .SH "SYNOPSIS" .sp gt ltrdigest [option \&...] gff3_file indexname .SH "OPTIONS" .PP \fB\-outfileprefix\fR .RS 4 prefix for output files (e\&.g\&. \fIfoo\fR will create files called \fIfoo_*\&.csv\fR and \fIfoo_*\&.fas\fR) Omit this option for GFF3 output only\&. .RE .PP \fB\-seqnamelen\fR .RS 4 set maximal length of sequence names in FASTA headers (e\&.g\&. for clustalw or similar tools) (default: 20) .RE .PP \fB\-pptlen\fR .RS 4 required PPT length range (default: 8 30) .RE .PP \fB\-uboxlen\fR .RS 4 required U\-box length range (default: 3 30) .RE .PP \fB\-uboxdist\fR .RS 4 allowed U\-box distance range from PPT (default: 0) .RE .PP \fB\-pptradius\fR .RS 4 radius around beginning of 3\*(Aq LTR to search for PPT (default: 30) .RE .PP \fB\-trnas\fR .RS 4 tRNA library in multiple FASTA format for PBS detection Omit this option to disable PBS search\&. .RE .PP \fB\-pbsalilen\fR .RS 4 required PBS/tRNA alignment length range (default: 11 30) .RE .PP \fB\-pbsoffset\fR .RS 4 allowed PBS offset from LTR boundary range (default: 0 5) .RE .PP \fB\-pbstrnaoffset\fR .RS 4 allowed PBS/tRNA 3\*(Aq end alignment offset range (default: 0 5) .RE .PP \fB\-pbsmaxedist\fR .RS 4 maximal allowed PBS/tRNA alignment unit edit distance (default: 1) .RE .PP \fB\-pbsradius\fR .RS 4 radius around end of 5\*(Aq LTR to search for PBS (default: 30) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-fingerprint.10000664000000000000000000000755112116110454012767 0ustar '\" t .\" Title: gt-fingerprint .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/10/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-FINGERPRINT" "1" "10/10/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-fingerprint \- Compute MD5 fingerprints for each sequence given in sequence_file(s)\&. .SH "SYNOPSIS" .sp gt fingerprint [option \&...] sequence_file [\&...] .SH "OPTIONS" .PP \fB\-check\fR .RS 4 compare all fingerprints contained in the given checklist file with checksums in given sequence_files(s)\&. The comparison is successful, if all fingerprints given in checkfile can be found in the sequence_file(s) in the exact same quantity and vice versa\&. (default: undefined) .RE .PP \fB\-duplicates\fR .RS 4 show duplicate fingerprints from given sequence_file(s)\&. (default: no) .RE .PP \fB\-extract\fR .RS 4 extract the sequence(s) with the given fingerprint from sequence_file(s) and show them on stdout\&. (default: undefined) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp If neither option \-check nor option \-duplicates is used, the fingerprints for all sequences are shown on stdout\&. .sp Examples: .sp Compute (unified) list of fingerprints: .sp .if n \{\ .RS 4 .\} .nf $ gt fingerprint U89959_ests\&.fas | sort | uniq > U89959_ests\&.checklist_uniq .fi .if n \{\ .RE .\} .sp Compare fingerprints: .sp .if n \{\ .RS 4 .\} .nf $ gt fingerprint \-check U89959_ests\&.checklist_uniq U89959_ests\&.fas 950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s) .fi .if n \{\ .RE .\} .sp Make sure a sequence file contains no duplicates (not the case here): .sp .if n \{\ .RS 4 .\} .nf $ gt fingerprint \-duplicates U89959_ests\&.fas 950b7715ab6cc030a8c810a0dba2dd33 2 gt fingerprint: error: duplicates found: 1 out of 200 (0\&.500%) .fi .if n \{\ .RE .\} .sp Extract sequence with given fingerprint: .sp .if n \{\ .RS 4 .\} .nf $ gt fingerprint \-extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests\&.fas >SQ;8720010 TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATACCAACGTAATG GGAGCTTAAAAATA .fi .if n \{\ .RE .\} .sp Return values: .sp .if n \{\ .RS 4 .\} .nf 0 everything went fine (\-check: the comparison was successful; \-duplicates: no duplicates found) 1 an error occured (\-check: the comparison was not successful; \-duplicates: duplicates found) .fi .if n \{\ .RE .\} .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-seqfilter.10000664000000000000000000000436612116110454012437 0ustar '\" t .\" Title: gt-seqfilter .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQFILTER" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-seqfilter \- Filter the given sequence_file(s) and show the results on stdout\&. .SH "SYNOPSIS" .sp gt seqfilter [option \&...] [sequence_file \&...] .SH "OPTIONS" .PP \fB\-minlength\fR .RS 4 set minimum length a sequence must have to pass the filter (default: undefined) .RE .PP \fB\-maxlength\fR .RS 4 set maximum length a sequence can have to pass the filter (default: undefined) .RE .PP \fB\-maxseqnum\fR .RS 4 set the maximum number of sequences which can pass the filter (default: undefined) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-encseq-decode.10000664000000000000000000000445512116110454013137 0ustar '\" t .\" Title: gt-encseq-decode .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ\-DECODE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq-decode \- Decode/extract encoded sequences\&. .SH "SYNOPSIS" .sp gt encseq decode (sequence_file|indexname) .SH "OPTIONS" .PP \fB\-mirrored\fR .RS 4 virtually append the reverse complement of each sequence (default: no) .RE .PP \fB\-lossless\fR .RS 4 allow lossless original sequence retrieval (default: no) .RE .PP \fB\-dir\fR .RS 4 specify reading direction (fwd, cpl, rev, rcl) (default: fwd) .RE .PP \fB\-seq\fR .RS 4 extract sequence identified by its number (default: undefined) .RE .PP \fB\-seqrange\fR .RS 4 extract multiple consecutive sequences (default: undefined) .RE .PP \fB\-output\fR .RS 4 specify output format (choose from fasta|concat) (default: fasta) .RE .PP \fB\-range\fR .RS 4 concatenated range to extract (implies \fI\-output concat\fR) (default: undefined) .RE .PP \fB\-sepchar\fR .RS 4 specify character to print as SEPARATOR (default: |) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-seq.10000664000000000000000000000463312116110454011226 0ustar '\" t .\" Title: gt-seq .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQ" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-seq \- Parse the given sequence file(s) and construct the corresponding index files\&. .SH "SYNOPSIS" .sp gt seq [option \&...] sequence_file [\&...] .SH "OPTIONS" .PP \fB\-recreate\fR .RS 4 recreate index files, even if they exist already (default: no) .RE .PP \fB\-showfasta\fR .RS 4 show all sequences (in FASTA format) (default: no) .RE .PP \fB\-showseqnum\fR .RS 4 show sequence with given number (in FASTA format) (default: undefined) .RE .PP \fB\-gc\-content\fR .RS 4 print GC\-content (for DNA files) (default: no) .RE .PP \fB\-stat\fR .RS 4 show sequence statistics (default: no) .RE .PP \fB\-seqlengthdistri\fR .RS 4 show sequence length distribution (default: no) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-tallymer-occratio.10000664000000000000000000000461012116110454014063 0ustar '\" t .\" Title: gt-tallymer-occratio .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-TALLYMER\-OCCRAT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-tallymer-occratio \- Compute occurrence ratio for a set of sequences represented by an enhanced suffix array\&. .SH "SYNOPSIS" .sp gt tallymer occratio [options] \-esa suffixerator\-index [options] .SH "OPTIONS" .PP \fB\-esa\fR .RS 4 specify suffixerator\-index (mandatory option) (default: undefined) .RE .PP \fB\-minmersize\fR .RS 4 specify minimum mer size for which to compute the occurrence distribution (default: 0) .RE .PP \fB\-maxmersize\fR .RS 4 specify maximum mer size for which to compute the occurrence distribution (default: 0) .RE .PP \fB\-step\fR .RS 4 specify step size when specifying mer sizes (default: 1) .RE .PP \fB\-mersizes\fR .RS 4 specify mer sizes as non\-empty sequence of non decreasing positive integers .RE .PP \fB\-output\fR .RS 4 use combination of the following keywords: unique nonunique nonuniquemulti relative total to specify kind of output .RE .PP \fB\-scan\fR .RS 4 read suffixerator\-index sequentially instead of mapping it to memory (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-seqids.10000664000000000000000000000271112116110454011721 0ustar '\" t .\" Title: gt-seqids .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQIDS" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-seqids \- Show sequence IDs from annotation file\&. .SH "SYNOPSIS" .sp gt seqids [GFF3_file] .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-chseqids.10000664000000000000000000000465212116110454012242 0ustar '\" t .\" Title: gt-chseqids .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-CHSEQIDS" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-chseqids \- Change sequence ids by the mapping given in mapping_file\&. .SH "SYNOPSIS" .sp gt chseqids [option \&...] mapping_file [GFF3_file] .SH "OPTIONS" .PP \fB\-sort\fR .RS 4 sort the GFF3 features after changing the sequence ids (memory consumption is proportional to the input file size) (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp File format for mapping_file: .sp The supplied mapping file defines a mapping table named \(lqchseqids\(rq\&. It maps the sequence\-regions given in the GFF3_file to other names\&. It can be defined as follows: .sp chseqids = { chr1 = "seq1", chr2 = "seq2" } .sp When this example is used, all sequence ids \(lqchr1\(rq will be changed to \(lqseq1\*(Aq \*(Aq and all sequence ids ``chr2\(rq to \(lqseq2\(rq\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-gff3validator.10000664000000000000000000000315312116110454013165 0ustar '\" t .\" Title: gt-gff3validator .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-GFF3VALIDATOR" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-gff3validator \- Strictly validate given GFF3 files\&. .SH "SYNOPSIS" .sp gt gff3validator [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-typecheck\fR .RS 4 check GFF3 types against "id" and "name" tags in given OBO file (default: undefined) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-mmapandread.10000664000000000000000000000275512116110454012712 0ustar '\" t .\" Title: gt-mmapandread .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MMAPANDREAD" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-mmapandread \- Map the supplied files into memory and read them once\&. .SH "SYNOPSIS" .sp gt mmapandread file [\&...] .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-packedindex-chkintegrity.10000664000000000000000000000356012116110454015415 0ustar '\" t .\" Title: gt-packedindex-chkintegrity .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-PACKEDINDEX\-CHK" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-packedindex-chkintegrity \- Map [indexname] block composition indexand bwt and check index integrity\&. .SH "SYNOPSIS" .sp gt packedindex chkintegrity indexname .SH "OPTIONS" .PP \fB\-v\fR .RS 4 print verbose progress information (default: no) .RE .PP \fB\-skip\fR .RS 4 number of symbols to skip (default: 0) .RE .PP \fB\-ticks\fR .RS 4 print dot after this many symbols tested okay (default: 100000) .RE .PP \fB\-ext\-rank\-check\fR .RS 4 do additional checks of rank query results (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-extractseq.10000664000000000000000000001244612116110454012622 0ustar '\" t .\" Title: gt-extractseq .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-EXTRACTSEQ" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-extractseq \- Extract sequences from given sequence file(s) or fastaindex\&. .SH "SYNOPSIS" .sp gt extractseq [option \&...] [sequence_file(s)] | fastaindex .SH "OPTIONS" .PP \fB\-frompos\fR .RS 4 extract sequence from this position counting from 1 on (default: 0) .RE .PP \fB\-topos\fR .RS 4 extract sequence up to this position counting from 1 on (default: 0) .RE .PP \fB\-match\fR .RS 4 extract all sequences whose description matches the given pattern\&. The given pattern must be a valid extended regular expression\&. (default: undefined) .RE .PP \fB\-keys\fR .RS 4 extract substrings for keys in specified file (default: undefined) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp The option \-keys allows one to extract substrings or sequences from the given sequence file or from a fasta index\&. The substrings to be extracted are specified in a key file given as argument to this option\&. The key file must contain lines of the form .sp k .sp or .sp k i j .sp where k is a string (the key) and the optional i and j are positive integers such that i⇐j\&. k is the key and the optional numbers i and j specify the first position of the substring and the last position of the substring to be extracted\&. The positions are counted from 1\&. If k is identical to the string between the first first and second occurrence of the symbol | in a fasta header, then the fasta header and the corresponding sequence is output\&. For example in the fasta header .sp >tr|A0AQI4|A0AQI4_9ARCH Putative ammonia monooxygenase (Fragment) OS=uncultured archaeon GN=amoA PE=4 SV=1 .sp the fasta key is A0AQI4\&. If i and j are both specified, then the corresponding substring is shown in fasta format\&. In the latter case the header of the fasta formatted sequence in the output begins with .sp >k i j .sp followed by the original original fasta header\&. If the sequence input are fasta files, then the following holds: \- duplicated lines in the input file lead to only one sequence in the output \- the sequences are output according to the order in the original sequence files \- the formatting of the output can be controlled by the options \-width, \-o, \-gzip, and \-bzip2 .sp If the sequence input comes from a fasta index (see below), the following holds : \- option \-width is required \- option \-o, \-gzip and \-bzip2 do not work \- the sequences are output in the order the corresponding keys appear in the key file .sp If the end of the argument list only contains one filename, say fastaindex, then it is checked if there is a file fastaindex\&.kys\&. This makes up part of the fasta index, which is contructed by calling the suffixerator tool as follows: .sp gt suffixerator \-protein \-ssp \-tis \-des \-sds \-kys \-indexname fastaindex \-db inp utfile1 [inputfile2 \&.\&.] .sp This reads the protein sequence files given to the option \-db and creates several files: \- a file fastaindex\&.esq representing the sequence\&. \- a file fastaindex\&.ssp specifying the sequence separator positions\&. \- a file fastaindex\&.des showing the fasta headers line by line\&. \- a file fastaindex\&.sds giving the sequence header delimiter positions\&. \- a file fastaindex\&.kys containing the keys in the fasta files\&. .sp For the suffixerator command to work, the keys of the form |key| in the fasta header must satisfy the following constraints: .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} they all have to be of the same length, not longer than 128, and not shorte r than 1 .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} they have to appear in lexicographic order .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-prebwt.10000664000000000000000000000317212116110454011736 0ustar '\" t .\" Title: gt-prebwt .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-PREBWT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-prebwt \- Precompute bwt\-bounds for some prefix length\&. .SH "SYNOPSIS" .sp gt prebwt [options] \-pck indexname .SH "OPTIONS" .PP \fB\-pck\fR .RS 4 Specify index (packed index) (default: undefined) .RE .PP \fB\-maxdepth\fR .RS 4 specify maximum depth (value > 0) (default: 0) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-md5_to_id.10000664000000000000000000000357712116110454012307 0ustar '\" t .\" Title: gt-md5_to_id .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MD5_TO_ID" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-md5_to_id \- Change MD5 fingerprints used as sequence IDs in given GFF3 files to ``regular\*(Aq\*(Aq ones\&. .SH "SYNOPSIS" .sp gt md5_to_id [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-mergefeat.10000664000000000000000000000350112116110454012366 0ustar '\" t .\" Title: gt-mergefeat .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MERGEFEAT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-mergefeat \- Merge adjacent features without children of the same type in given GFF3 file(s)\&. .SH "SYNOPSIS" .sp gt mergefeat [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-matstat.10000664000000000000000000000405312116110454012107 0ustar '\" t .\" Title: gt-matstat .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MATSTAT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-matstat \- Compute matching statistics\&. .SH "SYNOPSIS" .sp gt matstat [options \&...] \-query queryfile [\&...] .SH "OPTIONS" .PP \fB\-fmi\fR .RS 4 specify fmindex (default: undefined) .RE .PP \fB\-esa\fR .RS 4 specify suffix array (default: undefined) .RE .PP \fB\-pck\fR .RS 4 specify packed index (default: undefined) .RE .PP \fB\-query\fR .RS 4 specify queryfiles .RE .PP \fB\-min\fR .RS 4 only output length if >= given minimum length (default: 0) .RE .PP \fB\-max\fR .RS 4 only output length if ⇐ given maximum length (default: 0) .RE .PP \fB\-output\fR .RS 4 set output flags (sequence, querypos, subjectpos) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp For detailed information, please refer to the manual of matstat\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-sketch_page.10000664000000000000000000000455512116110454012716 0ustar '\" t .\" Title: gt-sketch_page .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SKETCH_PAGE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-sketch_page \- Draw a multi\-page PDF/PS representation of an annotation file\&. .SH "SYNOPSIS" .sp gt sketch_page outfile annotationfile .SH "OPTIONS" .PP \fB\-seqid\fR .RS 4 sequence region to draw (default: first in file) .RE .PP \fB\-text\fR .RS 4 text to show in header (default: file name) .RE .PP \fB\-fontsize\fR .RS 4 header and footer font size (in points) (default: 10\&.00) .RE .PP \fB\-range\fR .RS 4 range to draw (e\&.g\&. 100 10000) (default: full range) .RE .PP \fB\-linewidth\fR .RS 4 base width of a single repeated unit (default: 2000) .RE .PP \fB\-width\fR .RS 4 page width in millimeters .\" default: DIN A4default: DIN A4 (default: 210\&.00) .RE .PP \fB\-height\fR .RS 4 page height in millimeters .\" default: DIN A4default: DIN A4 (default: 297\&.00) .RE .PP \fB\-format\fR .RS 4 output format choose from: pdf|ps (default: pdf) .RE .PP \fB\-style\fR .RS 4 style file to use (default: gtdata/sketch/default\&.style) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-compreads.10000664000000000000000000000307612116110454012413 0ustar '\" t .\" Title: gt-compreads .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-COMPREADS" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-compreads \- Call fastq file compression tool [tool]\&. .SH "SYNOPSIS" .sp gt compreads [option \&...] tool [argument \&...] .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Tools: .sp compress decompress refcompress refdecompress .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-stat.10000664000000000000000000000507112116110454011406 0ustar '\" t .\" Title: gt-stat .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-STAT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-stat \- Show statistics about features contained in GFF3 files\&. .SH "SYNOPSIS" .sp gt stat [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-genelengthdistri\fR .RS 4 show gene length distribution (default: no) .RE .PP \fB\-genescoredistri\fR .RS 4 show gene score distribution (default: no) .RE .PP \fB\-exonlengthdistri\fR .RS 4 show exon length distribution (default: no) .RE .PP \fB\-exonnumberdistri\fR .RS 4 show exon number distribution (default: no) .RE .PP \fB\-intronlengthdistri\fR .RS 4 show intron length distribution (default: no) .RE .PP \fB\-cdslengthdistri\fR .RS 4 show CDS length distribution (measured in amino acids) (default: no) .RE .PP \fB\-source\fR .RS 4 show the set of used source tags (column 2 in regular GFF3 lines) (default: no) .RE .PP \fB\-addintrons\fR .RS 4 add intron features between existing exon features (before computing stats) (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-orffinder.10000664000000000000000000000427312116110454012414 0ustar '\" t .\" Title: gt-orffinder .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ORFFINDER" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-orffinder \- Identifies ORFs (open reading frames) in sequences\&. .SH "SYNOPSIS" .sp gt orffinder [option \&...] indexname [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-types\fR .RS 4 Specify regions which should be searched for open reading frames, e\&.g\&. \fILTR_retrotransposon\fR .RE .PP \fB\-allorfs\fR .RS 4 search for all ORFs instead of only the longest (default: no) .RE .PP \fB\-min\fR .RS 4 minimum length of ORF (default: 30) .RE .PP \fB\-max\fR .RS 4 maximum length of ORF (default: 10000) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-encseq-check.10000664000000000000000000000354112116110454012764 0ustar '\" t .\" Title: gt-encseq-check .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ\-CHECK" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq-check \- Check the consistency of an encoded sequence file\&. .SH "SYNOPSIS" .sp gt encseq check [option \&...] [file] .SH "OPTIONS" .PP \fB\-scantrials\fR .RS 4 specify number of scan trials (default: 0) .RE .PP \fB\-multicharcmptrials\fR .RS 4 specify number of multicharacter trials (default: 0) .RE .PP \fB\-prefixlength\fR .RS 4 prefix length (default: 0) .RE .PP \fB\-nocheckunit\fR .RS 4 do not run checkextractunitatpos (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-interfeat.10000664000000000000000000000367512116110454012424 0ustar '\" t .\" Title: gt-interfeat .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-INTERFEAT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-interfeat \- Add intermediary features between outside features in given GFF3 file(s)\&. .SH "SYNOPSIS" .sp gt interfeat [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-outside\fR .RS 4 set outside type (default: exon) .RE .PP \fB\-inter\fR .RS 4 set intermediary type (default: intron) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-matchtool.10000664000000000000000000000434612116110454012431 0ustar '\" t .\" Title: gt-matchtool .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MATCHTOOL" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-matchtool \- Parse match formats and/or invoke matching tools\&. .SH "SYNOPSIS" .sp gt matchtool [option \&...] .SH "OPTIONS" .PP \fB\-type\fR .RS 4 choose match file format: OPENMATCH: \fIopen match\fR format, e\&.g\&. vmatch BLASTOUT : tabular BLAST output (\-m 8) BLASTALLP: invoke BLASTALL with blastp BLASTALLN: invoke BLASTALL with blastn BLASTP : invoke blastp BLASTN : invoke blastn LAST : invoke LAST SW : use Smith\-Waterman (default: OPENMATCH) .RE .PP \fB\-matchfile\fR .RS 4 set input file name (default: undefined) .RE .PP \fB\-db\fR .RS 4 set database file name (default: undefined) .RE .PP \fB\-swminlen\fR .RS 4 set minimum required alignment length (for Smith\-Waterman alignment) (default: 10) .RE .PP \fB\-swmaxedist\fR .RS 4 set maximum allowed edit distance (for Smith\-Waterman alignment) (default: 0) .RE .PP \fB\-query\fR .RS 4 set query file name (default: undefined) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-uniq.10000664000000000000000000000526312116110454011412 0ustar '\" t .\" Title: gt-uniq .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-UNIQ" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-uniq \- Filter out repeated feature node graphs in a sorted GFF3 file\&. .SH "SYNOPSIS" .sp gt uniq [option \&...] [GFF3_file] .SH "OPTIONS" .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp A depth\-first traversal of a feature node graph starts at the top\-level feature node (or pseudo\-node) and explores as far along each branch as possible before backtracking\&. Let\(cqs assume that the feature nodes are stored in a list in the order of their traversal (called the \(lqfeature node list\(rq)\&. .sp Two feature node graphs are considered to be repeated if their feature node lis t (from the depth\-first traversal) have the same length and each feature node pai r (from both lists at the same position) is \(lqsimilar\(rq\&. .sp Two feature nodes are \(lqsimilar\(rq, if they have the same sequence ID, feature type, range, strand, and phase\&. .sp For such a repeated feature node graph the one with the higher score (of the top\-level feature) is kept\&. If only one of the feature node graphs has a define d score, this one is kept\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-clean.10000664000000000000000000000274212116110454011517 0ustar '\" t .\" Title: gt-clean .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-CLEAN" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-clean \- Remove all files in the current directory which are automatically created by gt\&. .SH "SYNOPSIS" .sp gt clean .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-genomediff.10000664000000000000000000000667112116110454012545 0ustar '\" t .\" Title: gt-genomediff .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-GENOMEDIFF" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-genomediff \- Calculates Kr: pairwise distances between genomes\&. .SH "SYNOPSIS" .sp gt genomediff [option \&...] (INDEX | \-indexname NAME SEQFILE SEQFILE [\&...]) .SH "OPTIONS" .PP \fB\-indextype\fR .RS 4 specify type of index, one of: esa|pck|encseq\&. Where encseq is an encoded sequence and an enhanced suffix array will be constructed only in memory\&. (default: encseq) .RE .PP \fB\-indexname\fR .RS 4 Basename of encseq to construct\&. (default: undefined) .RE .PP \fB\-unitfile\fR .RS 4 specifies genomic units, see below for description\&. (default: undefined) .RE .PP \fB\-mirrored\fR .RS 4 virtually append the reverse complement of each sequence (default: no) .RE .PP \fB\-pl\fR .RS 4 specify prefix length for bucket sort recommendation: use without argument; then a reasonable prefix length is automatically determined\&. (default: 0) .RE .PP \fB\-dc\fR .RS 4 specify difference cover value (default: 0) .RE .PP \fB\-memlimit\fR .RS 4 specify maximal amount of memory to be used during index construction (in bytes, the keywords \fIMB\fR and \fIGB\fR are allowed) (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp The genomediff tool only accepts DNA input\&. .sp When used with sequence files or encseq, an enhanced suffix array will be built in memory\&. The ESA will not be created completely, but construction will use \-memlimit as a threshold and build it partwise, calculating the Shu\-length for each part\&. .sp File format for option \-unitfile (lua): .sp .if n \{\ .RS 4 .\} .nf units = { genome1 = { "path/file1\&.fa", "file2\&.fa" }, genome2 = { "file3\&.fa", "path/file4\&.fa" } } .fi .if n \{\ .RE .\} .sp Give the path to the files as they were given to the encseq tool! You can use gt encseq info INDEXNAME to get a list of files in an encoded sequence\&. .sp Comment lines start with \fI\-\-\fR and will be ignored\&. See GTDIR/testdata/genomediff/unitfile1\&.lua for an example\&. .sp Options \-pl \-dc \-memlimit are options to influence esa construction\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-encseq2spm.10000664000000000000000000000411012116110454012504 0ustar '\" t .\" Title: gt-encseq2spm .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ2SPM" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq2spm \- Compute suffix prefix matches from encoded sequence\&. .SH "SYNOPSIS" .sp gt encseq2spm [option \&...] [file] .SH "OPTIONS" .PP \fB\-l\fR .RS 4 specify the minimum length (default: 0) .RE .PP \fB\-parts\fR .RS 4 specify the number of parts (default: 0) .RE .PP \fB\-memlimit\fR .RS 4 specify maximal amount of memory to be used during index construction (in bytes, the keywords \fIMB\fR and \fIGB\fR are allowed) (default: undefined) .RE .PP \fB\-singlestrand\fR .RS 4 use only the forward strand of the sequence (default: no) .RE .PP \fB\-spm\fR .RS 4 specify output for spms (default: undefined) .RE .PP \fB\-ii\fR .RS 4 specify the input sequence (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-tallymer.10000664000000000000000000000322312116110454012261 0ustar '\" t .\" Title: gt-tallymer .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-TALLYMER" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-tallymer \- Call tallymer tool with name tallymer_tool and pass argument(s) to it\&. .SH "SYNOPSIS" .sp gt tallymer [option \&...] tallymer_tool [argument \&...] .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Tools: .sp mkindex occratio search .sp For detailed information, please refer to the manual of tallymer\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-encseq-encode.10000664000000000000000000000512112116110454013140 0ustar '\" t .\" Title: gt-encseq-encode .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ENCSEQ\-ENCODE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-encseq-encode \- Encode sequence files efficiently\&. .SH "SYNOPSIS" .sp gt encseq encode sequence_file [sequence_file [sequence_file \&...]] .SH "OPTIONS" .PP \fB\-showstats\fR .RS 4 show compression results (default: no) .RE .PP \fB\-ssp\fR .RS 4 output sequence separator positions to file (default: yes) .RE .PP \fB\-des\fR .RS 4 output sequence descriptions to file (default: yes) .RE .PP \fB\-sds\fR .RS 4 output sequence description separator positions to file (default: yes) .RE .PP \fB\-md5\fR .RS 4 output MD5 sums to file (default: yes) .RE .PP \fB\-sat\fR .RS 4 specify kind of sequence representation by one of the keywords direct, bytecompress, eqlen, bit, uchar, ushort, uint32 (default: undefined) .RE .PP \fB\-dna\fR .RS 4 input is DNA sequence (default: no) .RE .PP \fB\-protein\fR .RS 4 input is protein sequence (default: no) .RE .PP \fB\-indexname\fR .RS 4 specify name for index to be generated (default: undefined) .RE .PP \fB\-smap\fR .RS 4 specify file containing a symbol mapping (default: undefined) .RE .PP \fB\-lossless\fR .RS 4 allow lossless original sequence retrieval (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-merge.10000664000000000000000000000341312116110454011530 0ustar '\" t .\" Title: gt-merge .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MERGE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-merge \- Merge sorted GFF3 files in sorted fashion\&. .SH "SYNOPSIS" .sp gt merge [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-id_to_md5.10000664000000000000000000000710512116110454012276 0ustar '\" t .\" Title: gt-id_to_md5 .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-ID_TO_MD5" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-id_to_md5 \- Change sequence IDs in given GFF3 files to MD5 fingerprints of the corresponding sequences\&. .SH "SYNOPSIS" .sp gt id_to_md5 [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-seqfile\fR .RS 4 set the sequence file from which to extract the features (default: undefined) .RE .PP \fB\-seqfiles\fR .RS 4 set the sequence files from which to extract the features use \fI\-\-\fR to terminate the list of sequence files .RE .PP \fB\-matchdesc\fR .RS 4 match the sequence descriptions from the input files for the desired sequence IDs (in GFF3) (default: no) .RE .PP \fB\-usedesc\fR .RS 4 use sequence descriptions to map the sequence IDs (in GFF3) to actual sequence entries\&. If a description contains a sequence range (e\&.g\&., III:1000001\&.\&.2000000), the first part is used as sequence ID (\fIIII\fR) and the first range position as offset (\fI1000001\fR) (default: no) .RE .PP \fB\-regionmapping\fR .RS 4 set file containing sequence\-region to sequence file mapping (default: undefined) .RE .PP \fB\-subtargetids\fR .RS 4 substitute the target IDs with MD5 sums (default: yes) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp File format for option \-regionmapping: .sp The file supplied to option \-regionmapping defines a \(lqmapping\(rq\&. A mapping maps the sequence\-regions given in the GFF3_file to a sequence file containing the corresponding sequence\&. Mappings can be defined in one of the following two forms: .sp mapping = { chr1 = "hs_ref_chr1\&.fa\&.gz", chr2 = "hs_ref_chr2\&.fa\&.gz" } .sp or .sp function mapping(sequence_region) return "hs_ref_"\&.\&.sequence_region\&.\&."\&.fa\&.gz" end .sp The first form defines a Lua (http://www\&.lua\&.org/) table named \(lqmapping\(rq which maps each sequence region to the corresponding sequence file\&. The second one defines a Lua function \(lqmapping\(rq, which has to return the sequence file name when it is called with the sequence_region as argument\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-packedindex-mkctxmap.10000664000000000000000000000350712116110454014536 0ustar '\" t .\" Title: gt-packedindex-mkctxmap .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-PACKEDINDEX\-MKC" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-packedindex-mkctxmap \- Build BWT packedindex for project [indexname]\&. .SH "SYNOPSIS" .sp gt packedindex mkctxmap indexname .SH "OPTIONS" .PP \fB\-ctxilog\fR .RS 4 specify the interval of context sampling as log value parameter i means that each 2^i\-th position of source is sampled for rank \-1 ⇒ chooses default of log(log(sequence length)) \-2 ⇒ generates no map (default: \-2) .RE .PP \fB\-v\fR .RS 4 print verbose progress information (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-select.10000664000000000000000000001167412116110454011720 0ustar '\" t .\" Title: gt-select .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SELECT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-select \- Select certain features (specified by the used options) from given GFF3 file(s)\&. .SH "SYNOPSIS" .sp gt select [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-seqid\fR .RS 4 select feature with the given sequence ID (all comments are selected)\&. (default: undefined) .RE .PP \fB\-source\fR .RS 4 select feature with the given source (the source is column 2 in regular GFF3 lines) (default: undefined) .RE .PP \fB\-contain\fR .RS 4 select all features which are contained in the given range (default: undefined) .RE .PP \fB\-overlap\fR .RS 4 select all features which do overlap with the given range (default: undefined) .RE .PP \fB\-strand\fR .RS 4 select all top\-level features(i\&.e\&., features without parents) whose strand equals the given one (must be one of \fI+\-\&.?\fR) (default: undefined) .RE .PP \fB\-targetstrand\fR .RS 4 select all top\-level features (i\&.e\&., features without parents) which have exactly one target attribute whose strand equals the given one (must be one of \fI+\-\&.?\fR) (default: undefined) .RE .PP \fB\-targetbest\fR .RS 4 if multiple top\-level features (i\&.e\&., features without parents) with exactly one target attribute have the same target_id, keep only the feature with the best score\&. If \-targetstrand is used at the same time, this option is applied after \-targetstrand\&. Memory consumption is proportional to the input file size(s)\&. (default: no) .RE .PP \fB\-hascds\fR .RS 4 select all top\-level features which do have a CDS child (default: no) .RE .PP \fB\-maxgenelength\fR .RS 4 select genes up to the given maximum length (default: undefined) .RE .PP \fB\-maxgenenum\fR .RS 4 select the first genes up to the given maximum number (default: undefined) .RE .PP \fB\-mingenescore\fR .RS 4 select genes with the given minimum score (default: undefined) .RE .PP \fB\-maxgenescore\fR .RS 4 select genes with the given maximum score (default: undefined) .RE .PP \fB\-minaveragessp\fR .RS 4 set the minimum average splice site probability (default: undefined) .RE .PP \fB\-rule_files\fR .RS 4 specify Lua files to be used for selection .RE .PP \fB\-rule_logic\fR .RS 4 select how multiple Lua files should be combined choose from AND|OR (default: AND) .RE .PP \fB\-dropped_file\fR .RS 4 save non\-selected features to file (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp File format for option \-rule_files: .sp The files supplied to option \-rule_files define a function for filtering by user given criteria (see example below): .sp function filter(gn) target = "exon" gfi = gt\&.feature_node_iterator_new(gn) .sp .if n \{\ .RS 4 .\} .nf curnode = gfi:next() .fi .if n \{\ .RE .\} .sp .if n \{\ .RS 4 .\} .nf while not(curnode == nil) do .fi .if n \{\ .RE .\} .sp .if n \{\ .RS 4 .\} .nf if (curnode:get_type() == target) then return false end curnode = gfi:next() end .fi .if n \{\ .RE .\} .sp .if n \{\ .RS 4 .\} .nf return true end .fi .if n \{\ .RE .\} .sp The above function iterates over all children of \fIgn\fR and checks whether there is a node of type \fIexon\fR\&. If there is such a node the function returns \fIfalse\fR, indicating that the parent node \fIgn\fR will not be sorted out\&. .sp NOTE: The function must be named \fIfilter\fR and must return \fIfalse\fR, indicating that the node survived the filtering process\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-seqmutate.10000664000000000000000000000517212116110454012445 0ustar '\" t .\" Title: gt-seqmutate .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQMUTATE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-seqmutate \- Mutate the sequences of the given sequence file(s)\&. .SH "SYNOPSIS" .sp gt seqmutate [option \&...] [sequence_file \&...] .SH "OPTIONS" .PP \fB\-rate\fR .RS 4 set the mutation rate (default: 1) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp For each position in the given sequences it is randomly determined with probability (mutation rate / 100) if the given position is mutated\&. If so, in 80% of the cases a substitution is performed, in 10% an insertion, and in 10% a deletion, respectively\&. For substitution and insertion events, the nucleotide i s generated randomly without regard to the original nucleotide\&. That is, resubstitutions are possible\&. This procedure equals the one described on page 1867 of the following paper .sp T\&.D\&. Wu and C\&.K\&. Watanabe\&. GMAP: a genomic mapping and alignment program for mRNA and EST sequences\&. Bioinformatics, 21(9):1859\-1875, 2005\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-sketch.10000664000000000000000000000513212116110454011712 0ustar '\" t .\" Title: gt-sketch .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SKETCH" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-sketch \- Create graphical representation of GFF3 annotation files\&. .SH "SYNOPSIS" .sp gt sketch [option \&...] image_file [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-pipe\fR .RS 4 use pipe mode (i\&.e\&., show all gff3 features on stdout) (default: no) .RE .PP \fB\-flattenfiles\fR .RS 4 do not group tracks by source file name and remove file names from track description (default: no) .RE .PP \fB\-seqid\fR .RS 4 sequence region identifier (default: first one in file) .RE .PP \fB\-start\fR .RS 4 start position (default: first region start) .RE .PP \fB\-end\fR .RS 4 end position (default: last region end) .RE .PP \fB\-width\fR .RS 4 target image width (in pixel) (default: 800) .RE .PP \fB\-style\fR .RS 4 style file to use (default: bin/\&.\&./gtdata/sketch/default\&.style) .RE .PP \fB\-format\fR .RS 4 output graphics format choose from png|pdf|svg|ps (default: png) .RE .PP \fB\-input\fR .RS 4 input data format choose from gff|bed|gtf (default: gff) .RE .PP \fB\-addintrons\fR .RS 4 add intron features between existing exon features (before drawing) (default: no) .RE .PP \fB\-unsafe\fR .RS 4 enable unsafe mode for style file (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-tagerator.10000664000000000000000000000605212116110454012423 0ustar '\" t .\" Title: gt-tagerator .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-TAGERATOR" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-tagerator \- Map short sequence tags in given index\&. .SH "SYNOPSIS" .sp gt tagerator [options] \-q tagfile [\-esa|\-pck] indexname .SH "OPTIONS" .PP \fB\-q\fR .RS 4 Specify files containing the short sequence tags .RE .PP \fB\-e\fR .RS 4 Specify the allowed number of differences (replacements/insertions/deletions) (default: \-1) .RE .PP \fB\-esa\fR .RS 4 Specify index (enhanced suffix array) (default: undefined) .RE .PP \fB\-pck\fR .RS 4 Specify index (packed index) (default: undefined) .RE .PP \fB\-nod\fR .RS 4 Do not compute direct matches (default: no) .RE .PP \fB\-nop\fR .RS 4 Do not compute palindromic matches (i\&.e\&. no reverse complemented matches\&.) (default: no) .RE .PP \fB\-best\fR .RS 4 Compute only best matches, i\&.e\&. only for smallest edit distance with matches (default: no) .RE .PP \fB\-maxocc\fR .RS 4 specify max number of match\-occurrences (default: 0) .RE .PP \fB\-skpp\fR .RS 4 Skip prefix of pattern (only in pdiff mode) (default: no) .RE .PP \fB\-withwildcards\fR .RS 4 output matches containing wildcard characters (e\&.g\&. N); only relevant for approximate matching (default: yes) .RE .PP \fB\-output\fR .RS 4 use combination of the following keywords to specify output tagnum show ordinal number of tag tagseq show tag sequence dblength show length of match in database dbstartpos show start position of match in database abspos show absolute value of dbstartpos dbsequence show sequence of match strand show strand edist show edit distance tagstartpos show start position of match in tag (only for \-maxocc) taglength show length of match in tag (only for \-maxocc) tagsuffixseq show suffix tag involved in match (only for \-maxocc) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-extractfeat.10000664000000000000000000001004212116110454012737 0ustar '\" t .\" Title: gt-extractfeat .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-EXTRACTFEAT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-extractfeat \- Extract features given in GFF3 file from sequence file\&. .SH "SYNOPSIS" .sp gt extractfeat [option \&...] [GFF3_file] .SH "OPTIONS" .PP \fB\-type\fR .RS 4 set type of features to extract (default: undefined) .RE .PP \fB\-join\fR .RS 4 join feature sequences in the same subgraph into a single one (default: no) .RE .PP \fB\-translate\fR .RS 4 translate the features (of a DNA sequence) into protein (default: no) .RE .PP \fB\-seqid\fR .RS 4 add sequence ID of extracted features to FASTA descriptions (default: no) .RE .PP \fB\-target\fR .RS 4 add target ID(s) of extracted features to FASTA descriptions (default: no) .RE .PP \fB\-seqfile\fR .RS 4 set the sequence file from which to extract the features (default: undefined) .RE .PP \fB\-seqfiles\fR .RS 4 set the sequence files from which to extract the features use \fI\-\-\fR to terminate the list of sequence files .RE .PP \fB\-matchdesc\fR .RS 4 match the sequence descriptions from the input files for the desired sequence IDs (in GFF3) (default: no) .RE .PP \fB\-usedesc\fR .RS 4 use sequence descriptions to map the sequence IDs (in GFF3) to actual sequence entries\&. If a description contains a sequence range (e\&.g\&., III:1000001\&.\&.2000000), the first part is used as sequence ID (\fIIII\fR) and the first range position as offset (\fI1000001\fR) (default: no) .RE .PP \fB\-regionmapping\fR .RS 4 set file containing sequence\-region to sequence file mapping (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp File format for option \-regionmapping: .sp The file supplied to option \-regionmapping defines a \(lqmapping\(rq\&. A mapping maps the sequence\-regions given in the GFF3_file to a sequence file containing the corresponding sequence\&. Mappings can be defined in one of the following two forms: .sp mapping = { chr1 = "hs_ref_chr1\&.fa\&.gz", chr2 = "hs_ref_chr2\&.fa\&.gz" } .sp or .sp function mapping(sequence_region) return "hs_ref_"\&.\&.sequence_region\&.\&."\&.fa\&.gz" end .sp The first form defines a Lua (http://www\&.lua\&.org/) table named \(lqmapping\(rq which maps each sequence region to the corresponding sequence file\&. The second one defines a Lua function \(lqmapping\(rq, which has to return the sequence file name when it is called with the sequence_region as argument\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-chain2dim.10000664000000000000000000000662212116110454012274 0ustar '\" t .\" Title: gt-chain2dim .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-CHAIN2DIM" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-chain2dim \- Chain pairwise matches\&. .SH "SYNOPSIS" .sp gt chain2dim [options] \-m matchfile .SH "OPTIONS" .PP \fB\-m\fR .RS 4 Specify file containing the matches mandatory option (default: undefined) .RE .PP \fB\-global\fR .RS 4 perform global chaining .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} optional parameter gc switches on gap costs (according to L1\-model) .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} optional parameter ov means that overlaps between matches are allowed .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} optional parameter all means that all optimal chains are processed .RE .RE .PP \fB\-local\fR .RS 4 perform local chaining compute local chains (according to L1\-model)\&. .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} If no parameter is given, compute local chains with maximums score\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} If parameter is given, this must be a positive number optionally followed by the character b or p\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} If only the number, say k, is given, this is the minimum score of the chains output\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} If a number is followed by character b, then output all chains with the largest k scores\&. .RE .sp .RS 4 .ie n \{\ \h'-04'\(bu\h'+03'\c .\} .el \{\ .sp -1 .IP \(bu 2.3 .\} If a number is followed by character p, then output all chains with scores at most k percent away from the best score\&. .RE .RE .PP \fB\-wf\fR .RS 4 specify weight factor > 0\&.0 to obtain score of a fragment requires one of the options \-local const \-global gc \-global ov (default: 1\&.00) .RE .PP \fB\-maxgap\fR .RS 4 specify maximal width of gap in chain (default: 0) .RE .PP \fB\-silent\fR .RS 4 do not output the chains but only report their lengths and scores (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-shulengthdist.10000664000000000000000000000331512116110454013317 0ustar '\" t .\" Title: gt-shulengthdist .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SHULENGTHDIST" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-shulengthdist \- Compute distribution of pairwise shustring lengths\&. .SH "SYNOPSIS" .sp gt shulengthdist [options] \-ii indexname .SH "OPTIONS" .PP \fB\-ii\fR .RS 4 Specify input index (default: undefined) .RE .PP \fB\-scan\fR .RS 4 scan index rather than mapping it to main memory (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-gff3_to_gtf.10000664000000000000000000000342712116110454012625 0ustar '\" t .\" Title: gt-gff3_to_gtf .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-GFF3_TO_GTF" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-gff3_to_gtf \- Parse GFF3 file(s) and show them as GTF2\&.2\&. .SH "SYNOPSIS" .sp gt gff3_to_gtf [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-packedindex-mkindex.10000664000000000000000000001064112116110454014346 0ustar '\" t .\" Title: gt-packedindex-mkindex .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-PACKEDINDEX\-MKI" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-packedindex-mkindex \- Compute packed index\&. .SH "SYNOPSIS" .sp gt packedindex mkindex [option \&...] (\-db file [\&...] | \-ii index) .SH "OPTIONS" .PP \fB\-ssp\fR .RS 4 output sequence separator positions to file (default: yes) .RE .PP \fB\-des\fR .RS 4 output sequence descriptions to file (default: yes) .RE .PP \fB\-sds\fR .RS 4 output sequence description separator positions to file (default: yes) .RE .PP \fB\-md5\fR .RS 4 output MD5 sums to file (default: yes) .RE .PP \fB\-sat\fR .RS 4 specify kind of sequence representation by one of the keywords direct, bytecompress, eqlen, bit, uchar, ushort, uint32 (default: undefined) .RE .PP \fB\-dna\fR .RS 4 input is DNA sequence (default: no) .RE .PP \fB\-protein\fR .RS 4 input is protein sequence (default: no) .RE .PP \fB\-indexname\fR .RS 4 specify name for index to be generated (default: undefined) .RE .PP \fB\-db\fR .RS 4 specify database files .RE .PP \fB\-smap\fR .RS 4 specify file containing a symbol mapping (default: undefined) .RE .PP \fB\-lossless\fR .RS 4 allow lossless original sequence retrieval (default: no) .RE .PP \fB\-mirrored\fR .RS 4 virtually append the reverse complement of each sequence (default: no) .RE .PP \fB\-pl\fR .RS 4 specify prefix length for bucket sort recommendation: use without argument; then a reasonable prefix length is automatically determined\&. (default: 0) .RE .PP \fB\-dc\fR .RS 4 specify difference cover value (default: 0) .RE .PP \fB\-kys\fR .RS 4 output/sort according to keys of the form |key| in fasta header (default: nosort) .RE .PP \fB\-dir\fR .RS 4 specify reading direction (fwd, cpl, rev, rcl) (default: fwd) .RE .PP \fB\-bsize\fR .RS 4 specify size of blocks (default: 8) .RE .PP \fB\-blbuck\fR .RS 4 specify number of blocks per bucket (default: 8) .RE .PP \fB\-locfreq\fR .RS 4 specify the locate frequency parameter i means that each i\-th position of input string is stored 0 ⇒ no locate information (default: 16) .RE .PP \fB\-locbitmap\fR .RS 4 marked/unmarked positions for locate are stored as bitmaps this gives faster location of hits but increases the index by 1 bit per symbol (default: yes) .RE .PP \fB\-sprank\fR .RS 4 build rank table for special symbols this produces an index which can be used to regenerate the original sequence but increases the memory used during index creation (default: no) .RE .PP \fB\-sprankilog\fR .RS 4 specify the interval of rank sampling as log value parameter i means that each 2^i\-th position of source is sampled for rank undefined ⇒ chooses default of log(log(sequence length)) (default: undefined) .RE .PP \fB\-ctxilog\fR .RS 4 specify the interval of context sampling as log value parameter i means that each 2^i\-th position of source is sampled for rank \-1 ⇒ chooses default of log(log(sequence length)) \-2 ⇒ generates no map (default: \-2) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-showprogress\fR .RS 4 show a progress bar (default: no) .RE .PP \fB\-ii\fR .RS 4 specify existing encoded sequence (default: undefined) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-seqstat.10000664000000000000000000000405212116110454012115 0ustar '\" t .\" Title: gt-seqstat .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQSTAT" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-seqstat \- Calculate statistics for fasta file(s)\&. .SH "SYNOPSIS" .sp gt seqstat [options] file [\&...] .SH "OPTIONS" .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-distlen\fR .RS 4 show distribution of sequence length (default: no) .RE .PP \fB\-b\fR .RS 4 bucket size for distlen option (default: 100) .RE .PP \fB\-binary\fR .RS 4 use a binary format for distlen output output filename: \&.distlen bucketsize: 1 (default: no) .RE .PP \fB\-contigs\fR .RS 4 summary of contigs set statistics (default: no) .RE .PP \fB\-genome\fR .RS 4 set genome length for NG50/NG80 calculation (default: 0) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-simreads.10000664000000000000000000000504712116110454012245 0ustar '\" t .\" Title: gt-simreads .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SIMREADS" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-simreads \- Simulate sequencing reads from random positions in the input sequence(s)\&. .SH "SYNOPSIS" .sp gt simreads [option \&...] .SH "OPTIONS" .PP \fB\-num\fR .RS 4 desired number of reads (default: undefined) .RE .PP \fB\-coverage\fR .RS 4 desired coverage of the reads (default: undefined) .RE .PP \fB\-len\fR .RS 4 fixed read length (default: undefined) .RE .PP \fB\-minlen\fR .RS 4 minimal read length (default: undefined) .RE .PP \fB\-maxlen\fR .RS 4 maximal read length (default: undefined) .RE .PP \fB\-distlen\fR .RS 4 use read length distribution file (in the output format of the seqstat tool) (default: undefined) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-p\fR .RS 4 show a progress bar (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-ss\fR .RS 4 simulate reads in forward direction only (default: no) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-congruence-spacedseed.10000664000000000000000000000340312116110454014656 0ustar '\" t .\" Title: gt-congruence-spacedseed .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-CONGRUENCE\-SPAC" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-congruence-spacedseed \- Match spaced seeds\&. .SH "SYNOPSIS" .sp gt congruence spacedseed [options] .SH "OPTIONS" .PP \fB\-esa\fR .RS 4 Specify index (enhanced suffix array) (default: undefined) .RE .PP \fB\-pck\fR .RS 4 Specify index (packed index) (default: undefined) .RE .PP \fB\-q\fR .RS 4 Specify files containing the query sequences .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-ltrharvest.10000664000000000000000000000753212116110454012635 0ustar '\" t .\" Title: gt-ltrharvest .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-LTRHARVEST" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-ltrharvest \- Predict LTR retrotransposons\&. .SH "SYNOPSIS" .sp gt ltrharvest [option \&...] \-index .SH "OPTIONS" .PP \fB\-index\fR .RS 4 specify the name of the enhanced suffix array index (mandatory) (default: undefined) .RE .PP \fB\-range\fR .RS 4 specify range in the input sequence(s) in which LTR pairs are searched (default: 0 0) .RE .PP \fB\-seed\fR .RS 4 specify minimum seed length for exact repeats (default: 30) .RE .PP \fB\-minlenltr\fR .RS 4 specify minimum length for each LTR (default: 100) .RE .PP \fB\-maxlenltr\fR .RS 4 specify maximum length for each LTR (default: 1000) .RE .PP \fB\-mindistltr\fR .RS 4 specify minimum distance of LTR startpositions (default: 1000) .RE .PP \fB\-maxdistltr\fR .RS 4 specify maximum distance of LTR startpositions (default: 15000) .RE .PP \fB\-similar\fR .RS 4 specify similaritythreshold in range [1\&.\&.100%] (default: 85\&.00) .RE .PP \fB\-mintsd\fR .RS 4 specify minimum length for each TSD (default: 4) .RE .PP \fB\-maxtsd\fR .RS 4 specify maximum length for each TSD (default: 20) .RE .PP \fB\-motif\fR .RS 4 specify 2 nucleotides startmotif + 2 nucleotides endmotif: \fB*\fR* (default: undefined) .RE .PP \fB\-motifmis\fR .RS 4 specify maximum number of mismatches in motif [0,3] (default: 4) .RE .PP \fB\-vic\fR .RS 4 specify the number of nucleotides (to the left and to the right) that will be searched for TSDs and/or motifs around 5\*(Aq and 3\*(Aq boundary of predicted LTR retrotransposons (default: 60) .RE .PP \fB\-overlaps\fR .RS 4 specify no|best|all (default: best) .RE .PP \fB\-xdrop\fR .RS 4 specify xdropbelowscore for extension\-alignment (default: 5) .RE .PP \fB\-mat\fR .RS 4 specify matchscore for extension\-alignment (default: 2) .RE .PP \fB\-mis\fR .RS 4 specify mismatchscore for extension\-alignment (default: \-2) .RE .PP \fB\-ins\fR .RS 4 specify insertionscore for extension\-alignment (default: \-3) .RE .PP \fB\-del\fR .RS 4 specify deletionscore for extension\-alignment (default: \-3) .RE .PP \fB\-v\fR .RS 4 verbose mode (default: no) .RE .PP \fB\-longoutput\fR .RS 4 additional motif/TSD output (default: no) .RE .PP \fB\-out\fR .RS 4 specify FASTA outputfilename (default: undefined) .RE .PP \fB\-outinner\fR .RS 4 specify FASTA outputfilename for inner regions (default: undefined) .RE .PP \fB\-gff3\fR .RS 4 specify GFF3 outputfilename (default: undefined) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp For detailed information, please refer to the manual of ltrharvest\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-splicesiteinfo.10000664000000000000000000000707412116110454013460 0ustar '\" t .\" Title: gt-splicesiteinfo .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SPLICESITEINFO" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-splicesiteinfo \- Show information about splice sites given in GFF3 files\&. .SH "SYNOPSIS" .sp gt splicesiteinfo [option \&...] [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-seqfile\fR .RS 4 set the sequence file from which to extract the features (default: undefined) .RE .PP \fB\-seqfiles\fR .RS 4 set the sequence files from which to extract the features use \fI\-\-\fR to terminate the list of sequence files .RE .PP \fB\-matchdesc\fR .RS 4 match the sequence descriptions from the input files for the desired sequence IDs (in GFF3) (default: no) .RE .PP \fB\-usedesc\fR .RS 4 use sequence descriptions to map the sequence IDs (in GFF3) to actual sequence entries\&. If a description contains a sequence range (e\&.g\&., III:1000001\&.\&.2000000), the first part is used as sequence ID (\fIIII\fR) and the first range position as offset (\fI1000001\fR) (default: no) .RE .PP \fB\-regionmapping\fR .RS 4 set file containing sequence\-region to sequence file mapping (default: undefined) .RE .PP \fB\-addintrons\fR .RS 4 add intron features between existing exon features (before computing the information to be shown) (default: no) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp File format for option \-regionmapping: .sp The file supplied to option \-regionmapping defines a \(lqmapping\(rq\&. A mapping maps the sequence\-regions given in the GFF3_file to a sequence file containing the corresponding sequence\&. Mappings can be defined in one of the following two forms: .sp mapping = { chr1 = "hs_ref_chr1\&.fa\&.gz", chr2 = "hs_ref_chr2\&.fa\&.gz" } .sp or .sp function mapping(sequence_region) return "hs_ref_"\&.\&.sequence_region\&.\&."\&.fa\&.gz" end .sp The first form defines a Lua (http://www\&.lua\&.org/) table named \(lqmapping\(rq which maps each sequence region to the corresponding sequence file\&. The second one defines a Lua function \(lqmapping\(rq, which has to return the sequence file name when it is called with the sequence_region as argument\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-tallymer-search.10000664000000000000000000000377012116110454013533 0ustar '\" t .\" Title: gt-tallymer-search .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-TALLYMER\-SEARCH" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-tallymer-search \- Search a set of k\-mers in an index constructed by "gt tyr mkindex"\&. .SH "SYNOPSIS" .sp gt tallymer search [options] \-tyr tallymer\-index \-q queryfile0 [queryfile1\&.\&.] [options] .SH "OPTIONS" .PP \fB\-tyr\fR .RS 4 specify tallymer\-index (default: undefined) .RE .PP \fB\-q\fR .RS 4 specify query file names .RE .PP \fB\-strand\fR .RS 4 specify the strand to be searched: use f (for forward strand) or p (for reverse complemented strand) or fp (for both); default is f (default: f) .RE .PP \fB\-output\fR .RS 4 specify output flags (qseqnum, qpos, counts, sequence) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-seqtranslate.10000664000000000000000000000370512116110454013143 0ustar '\" t .\" Title: gt-seqtranslate .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SEQTRANSLATE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-seqtranslate \- Translates a nucleotide sequence into a protein sequence\&. .SH "SYNOPSIS" .sp gt seqtranslate [option \&...] [files] .SH "OPTIONS" .PP \fB\-reverse\fR .RS 4 also translate reverse complements (default: yes) .RE .PP \fB\-fastawidth\fR .RS 4 width of the FASTA output (default: 60) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-congruence.10000664000000000000000000000322612116110454012563 0ustar '\" t .\" Title: gt-congruence .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-CONGRUENCE" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-congruence \- Call congruence tool with name congruence_tool and pass argument(s) to it\&. .SH "SYNOPSIS" .sp gt congruence [option \&...] congruence_tool [argument \&...] .SH "OPTIONS" .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "DESCRIPTION" .sp Tools: .sp spacedseed .sp For detailed information, please refer to the manual of congruence\&. .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-suffixerator.10000664000000000000000000000746512116110454013165 0ustar '\" t .\" Title: gt-suffixerator .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SUFFIXERATOR" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-suffixerator \- Compute enhanced suffix array\&. .SH "SYNOPSIS" .sp gt suffixerator [option \&...] (\-db file [\&...] | \-ii index) .SH "OPTIONS" .PP \fB\-ssp\fR .RS 4 output sequence separator positions to file (default: yes) .RE .PP \fB\-des\fR .RS 4 output sequence descriptions to file (default: yes) .RE .PP \fB\-sds\fR .RS 4 output sequence description separator positions to file (default: yes) .RE .PP \fB\-md5\fR .RS 4 output MD5 sums to file (default: yes) .RE .PP \fB\-sat\fR .RS 4 specify kind of sequence representation by one of the keywords direct, bytecompress, eqlen, bit, uchar, ushort, uint32 (default: undefined) .RE .PP \fB\-dna\fR .RS 4 input is DNA sequence (default: no) .RE .PP \fB\-protein\fR .RS 4 input is protein sequence (default: no) .RE .PP \fB\-indexname\fR .RS 4 specify name for index to be generated (default: undefined) .RE .PP \fB\-db\fR .RS 4 specify database files .RE .PP \fB\-smap\fR .RS 4 specify file containing a symbol mapping (default: undefined) .RE .PP \fB\-lossless\fR .RS 4 allow lossless original sequence retrieval (default: no) .RE .PP \fB\-mirrored\fR .RS 4 virtually append the reverse complement of each sequence (default: no) .RE .PP \fB\-pl\fR .RS 4 specify prefix length for bucket sort recommendation: use without argument; then a reasonable prefix length is automatically determined\&. (default: 0) .RE .PP \fB\-dc\fR .RS 4 specify difference cover value (default: 0) .RE .PP \fB\-spmopt\fR .RS 4 optimize esa\-construction for suffix\-prefix matching (default: 0) .RE .PP \fB\-memlimit\fR .RS 4 specify maximal amount of memory to be used during index construction (in bytes, the keywords \fIMB\fR and \fIGB\fR are allowed) (default: undefined) .RE .PP \fB\-kys\fR .RS 4 output/sort according to keys of the form |key| in fasta header (default: nosort) .RE .PP \fB\-dir\fR .RS 4 specify reading direction (fwd, cpl, rev, rcl) (default: fwd) .RE .PP \fB\-suf\fR .RS 4 output suffix array (suftab) to file (default: no) .RE .PP \fB\-lcp\fR .RS 4 output lcp table (lcptab) to file (default: no) .RE .PP \fB\-bwt\fR .RS 4 output Burrows\-Wheeler Transformation (bwttab) to file (default: no) .RE .PP \fB\-bck\fR .RS 4 output bucket table to file (default: no) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-showprogress\fR .RS 4 show a progress bar (default: no) .RE .PP \fB\-ii\fR .RS 4 specify existing encoded sequence (default: undefined) .RE .PP \fB\-help\fR .RS 4 display help for basic options and exit .RE .PP \fB\-help+\fR .RS 4 display help for all options and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-splitfasta.10000664000000000000000000000367112116110454012611 0ustar '\" t .\" Title: gt-splitfasta .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SPLITFASTA" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-splitfasta \- Split the supplied fasta file\&. .SH "SYNOPSIS" .sp gt splitfasta [option \&...] fastafile .SH "OPTIONS" .PP \fB\-numfiles\fR .RS 4 set the number of target files (default: 0) .RE .PP \fB\-targetsize\fR .RS 4 set the target file size in MB (default: 50) .RE .PP \fB\-splitdesc\fR .RS 4 put every fasta entry in a separate file named by its description in the given directory (default: undefined) .RE .PP \fB\-width\fR .RS 4 set output width for FASTA sequence printing (0 disables formatting) (default: 0) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-readjoiner-overlap.10000664000000000000000000000402112116110454014215 0ustar '\" t .\" Title: gt-readjoiner-overlap .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-READJOINER\-OVER" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-readjoiner-overlap \- Compute suffix prefix matches from encoded sequence\&. .SH "SYNOPSIS" .sp gt readjoiner overlap [option \&...] [file] .SH "OPTIONS" .PP \fB\-readset\fR .RS 4 specify the readset name (default: undefined) .RE .PP \fB\-l\fR .RS 4 specify the minimum SPM length (default: 0) .RE .PP \fB\-parts\fR .RS 4 specify the number of parts (default: 0) .RE .PP \fB\-memlimit\fR .RS 4 specify maximal amount of memory to be used during index construction (in bytes, the keywords \fIMB\fR and \fIGB\fR are allowed) (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-q\fR .RS 4 suppress standard output messages (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-mkfmindex.10000664000000000000000000000360012116110454012411 0ustar '\" t .\" Title: gt-mkfmindex .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MKFMINDEX" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-mkfmindex \- Compute FM\-index\&. .SH "SYNOPSIS" .sp gt mkfmindex [option \&...] \-ii indexfile [\&...] .SH "OPTIONS" .PP \fB\-fmout\fR .RS 4 specify name of FM\-index to be generated (mandatory if more than one input index is specified) (default: undefined) .RE .PP \fB\-ii\fR .RS 4 specify indices to be used .RE .PP \fB\-size\fR .RS 4 specify size (tiny, small, medium, big) (default: medium) .RE .PP \fB\-noindexpos\fR .RS 4 store no index positions (hence the positions of matches in the index cannot be retrieved) (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-mkfeatureindex.10000664000000000000000000000363312116110454013450 0ustar '\" t .\" Title: gt-mkfeatureindex .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-MKFEATUREINDEX" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-mkfeatureindex \- Creates a new FeatureIndex from annotation data\&. .SH "SYNOPSIS" .sp gt mkfeatureindex [option \&...] .SH "OPTIONS" .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-backend\fR .RS 4 database backend to use choose from [sqlite] (default: sqlite) .RE .PP \fB\-input\fR .RS 4 input data format choose from gff|bed|gtf (default: gff) .RE .PP \fB\-filename\fR .RS 4 filename for feature database (sqlite backend only) (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-packedindex-chksearch.10000664000000000000000000000706012116110454014643 0ustar '\" t .\" Title: gt-packedindex-chksearch .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-PACKEDINDEX\-CHK" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-packedindex-chksearch \- Load (or build if necessary) BWT index for project [indexname] and perform verification of search results\&. .SH "SYNOPSIS" .sp gt packedindex chksearch indexname .SH "OPTIONS" .PP \fB\-bsize\fR .RS 4 specify size of blocks (default: 8) .RE .PP \fB\-blbuck\fR .RS 4 specify number of blocks per bucket (default: 8) .RE .PP \fB\-locfreq\fR .RS 4 specify the locate frequency parameter i means that each i\-th position of input string is stored 0 ⇒ no locate information (default: 16) .RE .PP \fB\-locbitmap\fR .RS 4 marked/unmarked positions for locate are stored as bitmaps this gives faster location of hits but increases the index by 1 bit per symbol (default: yes) .RE .PP \fB\-sprank\fR .RS 4 build rank table for special symbols this produces an index which can be used to regenerate the original sequence but increases the memory used during index creation (default: no) .RE .PP \fB\-sprankilog\fR .RS 4 specify the interval of rank sampling as log value parameter i means that each 2^i\-th position of source is sampled for rank undefined ⇒ chooses default of log(log(sequence length)) (default: undefined) .RE .PP \fB\-ctxilog\fR .RS 4 specify the interval of context sampling as log value parameter i means that each 2^i\-th position of source is sampled for rank \-1 ⇒ chooses default of log(log(sequence length)) \-2 ⇒ generates no map (default: \-2) .RE .PP \fB\-minpatlen\fR .RS 4 minimum length of patterns searched for, \-1 implies automatic choice based on index properties (default: \-1) .RE .PP \fB\-maxpatlen\fR .RS 4 maximum length of patterns searched for, \-1 implies automatic choice based on index properties (default: \-1) .RE .PP \fB\-nsamples\fR .RS 4 number of sequences to search for (default: 1000) .RE .PP \fB\-chksfxarray\fR .RS 4 verify integrity of stored suffix array positions (default: no) .RE .PP \fB\-full\-lfmap\fR .RS 4 verify complete backwards regeneration of original sequence (default: no) .RE .PP \fB\-chkcontext\fR .RS 4 verify integrity of regenerated sequence context (default: no) .RE .PP \fB\-ticks\fR .RS 4 print dot after this many symbols tested okay (default: 100000) .RE .PP \fB\-v\fR .RS 4 print verbose progress information (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-ltrclustering.10000664000000000000000000000416312116110454013335 0ustar '\" t .\" Title: gt-ltrclustering .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-LTRCLUSTERING" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-ltrclustering \- Cluster features of LTRs\&. .SH "SYNOPSIS" .sp gt ltrclustering [option \&...] indexname [GFF3_file \&...] .SH "OPTIONS" .PP \fB\-psmall\fR .RS 4 specify how many percent of the smaller sequence a match needs to cover in order to cluster the two sequences of the match\&. (default: 0) .RE .PP \fB\-plarge\fR .RS 4 specify how many percent of the larger sequence a match needs to cover in order to cluster the two sequences of the match\&. (default: 0) .RE .PP \fB\-o\fR .RS 4 redirect output to specified file (default: undefined) .RE .PP \fB\-gzip\fR .RS 4 write gzip compressed output file (default: no) .RE .PP \fB\-bzip2\fR .RS 4 write bzip2 compressed output file (default: no) .RE .PP \fB\-force\fR .RS 4 force writing to output file (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-scriptfilter.10000664000000000000000000000344212116110454013145 0ustar '\" t .\" Title: gt-scriptfilter .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-SCRIPTFILTER" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-scriptfilter \- Get info about and validate Lua script filters\&. .SH "SYNOPSIS" .sp gt scriptfilter [option \&...] [script file(s)] .SH "OPTIONS" .PP \fB\-showinfo\fR .RS 4 show information about filter (default: yes) .RE .PP \fB\-validate\fR .RS 4 validate filter function (default: yes) .RE .PP \fB\-oneline\fR .RS 4 show compact information on one line (default: no) .RE .PP \fB\-scriptname\fR .RS 4 show script name (default: yes) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/man/gt-repfind.10000664000000000000000000000355712116110454012071 0ustar '\" t .\" Title: gt-repfind .\" Author: [see the "AUTHOR" section] .\" Generator: DocBook XSL Stylesheets v1.76.1 .\" Date: 10/07/2012 .\" Manual: \ \& .\" Source: \ \& .\" Language: English .\" .TH "GT\-REPFIND" "1" "10/07/2012" "\ \&" "\ \&" .\" ----------------------------------------------------------------- .\" * Define some portability stuff .\" ----------------------------------------------------------------- .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .\" http://bugs.debian.org/507673 .\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html .\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" ----------------------------------------------------------------- .\" * set default formatting .\" ----------------------------------------------------------------- .\" disable hyphenation .nh .\" disable justification (adjust text to left margin only) .ad l .\" ----------------------------------------------------------------- .\" * MAIN CONTENT STARTS HERE * .\" ----------------------------------------------------------------- .SH "NAME" gt-repfind \- Compute maximal repeats\&. .SH "SYNOPSIS" .sp gt repfind [options] \-ii indexname .SH "OPTIONS" .PP \fB\-l\fR .RS 4 Specify minimum length of repeats (default: 20) .RE .PP \fB\-f\fR .RS 4 Compute maximal forward repeats (default: yes) .RE .PP \fB\-r\fR .RS 4 Compute maximal reverse matches (default: no) .RE .PP \fB\-scan\fR .RS 4 scan index rather than mapping it to main memory (default: no) .RE .PP \fB\-ii\fR .RS 4 Specify input index (default: undefined) .RE .PP \fB\-v\fR .RS 4 be verbose (default: no) .RE .PP \fB\-help\fR .RS 4 display help and exit .RE .PP \fB\-version\fR .RS 4 display version information and exit .RE .SH "AUTHOR" .sp Report bugs to \&. debian/libgenometools0.symbols0000664000000000000000000047725712233413050013723 0ustar libgenometools.so.0 libgenometools0 #MINVER# EISIntegrityCheckResultStrings@Base 1.5.1 __bam_get_lines@Base 1.5.1 anno_db_gfflike_build@Base 1.5.1 anno_db_gfflike_free@Base 1.5.1 anno_db_gfflike_init_mysql@Base 1.5.1 anno_db_gfflike_init_sqlite@Base 1.5.1 assemble_cluster@Base 1.5.1 bam_aux2A@Base 1.5.1 bam_aux2Z@Base 1.5.1 bam_aux2d@Base 1.5.1 bam_aux2f@Base 1.5.1 bam_aux2i@Base 1.5.1 bam_aux_append@Base 1.5.1 bam_aux_del@Base 1.5.1 bam_aux_drop_other@Base 1.5.1 bam_aux_get@Base 1.5.1 bam_aux_get_core@Base 1.5.1 bam_calend@Base 1.5.1 bam_char2flag_table@Base 1.5.1 bam_cigar2qlen@Base 1.5.1 bam_destroy_header_hash@Base 1.5.1 bam_flag2char_table@Base 1.5.1 bam_format1@Base 1.5.1 bam_format1_core@Base 1.5.1 bam_get_library@Base 1.5.1 bam_get_tid@Base 1.5.1 bam_header_destroy@Base 1.5.1 bam_header_dup@Base 1.5.1 bam_header_init@Base 1.5.1 bam_header_read@Base 1.5.1 bam_header_write@Base 1.5.1 bam_init_header_hash@Base 1.5.1 bam_is_be@Base 1.5.1 bam_mplp_auto@Base 1.5.1 bam_mplp_destroy@Base 1.5.1 bam_mplp_init@Base 1.5.1 bam_mplp_set_maxcnt@Base 1.5.1 bam_no_B@Base 1.5.1 bam_nt16_rev_table@Base 1.5.1 bam_nt16_table@Base 1.5.1 bam_parse_region@Base 1.5.1 bam_pileup_file@Base 1.5.1 bam_plbuf_destroy@Base 1.5.1 bam_plbuf_init@Base 1.5.1 bam_plbuf_push@Base 1.5.1 bam_plbuf_reset@Base 1.5.1 bam_plbuf_set_mask@Base 1.5.1 bam_plp_auto@Base 1.5.1 bam_plp_destroy@Base 1.5.1 bam_plp_init@Base 1.5.1 bam_plp_next@Base 1.5.1 bam_plp_push@Base 1.5.1 bam_plp_reset@Base 1.5.1 bam_plp_set_mask@Base 1.5.1 bam_plp_set_maxcnt@Base 1.5.1 bam_read1@Base 1.5.1 bam_remove_B@Base 1.5.1 bam_validate1@Base 1.5.1 bam_verbose@Base 1.5.1 bam_view1@Base 1.5.1 bam_write1@Base 1.5.1 bam_write1_core@Base 1.5.1 bgzf_check_EOF@Base 1.5.1 bgzf_close@Base 1.5.1 bgzf_dopen@Base 1.5.1 bgzf_flush@Base 1.5.1 bgzf_flush_try@Base 1.5.1 bgzf_getc@Base 1.5.1 bgzf_getline@Base 1.5.1 bgzf_is_bgzf@Base 1.5.1 bgzf_mt@Base 1.5.1 bgzf_open@Base 1.5.1 bgzf_read@Base 1.5.1 bgzf_read_block@Base 1.5.1 bgzf_seek@Base 1.5.1 bgzf_set_cache_size@Base 1.5.1 bgzf_write@Base 1.5.1 calculate_drawing_range@Base 1.5.1 download_and_open@Base 1.5.1 dp_param_alloc@Base 1.5.1 encdesc_hashmap_distr_get@Base 1.5.1 encdesc_hashmap_distr_get_corrected@Base 1.5.1 encdesc_read_header@Base 1.5.1 encdesc_write_header@Base 1.5.1 esa_exact_pattern_count@Base 1.5.1 fai_build@Base 1.5.1 fai_build_core@Base 1.5.1 fai_destroy@Base 1.5.1 fai_fetch@Base 1.5.1 fai_load@Base 1.5.1 fai_read@Base 1.5.1 fai_save@Base 1.5.1 faidx_fetch_nseq@Base 1.5.1 faidx_fetch_seq@Base 1.5.1 faidx_main@Base 1.5.1 feature_node_get_dfs_status@Base 1.5.1 feature_node_set_dfs_status@Base 1.5.1 genericindex_delete@Base 1.5.1 genericindex_get_packedindex@Base 1.5.1 genericindex_get_totallength@Base 1.5.1 genericindex_getencseq@Base 1.5.1 genericindex_getsuffixarray@Base 1.5.1 genericindex_new@Base 1.5.1 genericmstats@Base 1.5.1 get_current_frame@Base 1.5.1 get_matrix_row@Base 1.5.1 getcoreExonnodefromSA@Base 1.5.1 getencseqkmers@Base 1.5.1 getencseqkmers_twobitencoding@Base 1.5.1 getencseqkmersinsertkmerwithoutspecial@Base 1.5.1 greedyunitedist@Base 1.5.1 gt_BWTSCRFFinished@Base 1.5.1 gt_BWTSCRFGet@Base 1.5.1 gt_BWTSCRFMapAdvance@Base 1.5.1 gt_BWTSCRFReadAdvance@Base 1.5.1 gt_BWTSeqCRAccessSubseq@Base 1.5.1 gt_BWTSeqCRLoad@Base 1.5.1 gt_BWTSeqGetRankSort@Base 1.5.1 gt_BWTSeqInitLocateHandling@Base 1.5.1 gt_BWTSeqLocateMatch@Base 1.5.1 gt_BWTSeqMatchCount@Base 1.5.1 gt_BWTSeqNewSASeqSrc@Base 1.5.1 gt_BWTSeqPosHasLocateInfo@Base 1.5.1 gt_BWTSeqVerifyIntegrity@Base 1.5.1 gt_BwtSeqpositionextractor_extract@Base 1.5.1 gt_Bwtseqcontextiterator_delete@Base 1.5.1 gt_Bwtseqcontextiterator_new@Base 1.5.1 gt_Bwtseqcontextiterator_next@Base 1.5.1 gt_Bwtseqpositioniterator_delete@Base 1.5.1 gt_Bwtseqpositioniterator_new@Base 1.5.1 gt_Bwtseqpositioniterator_next@Base 1.5.1 gt_BwtseqpositionwithoutSEPiterator_next@Base 1.5.1 gt_EISVerifyIntegrity@Base 1.5.1 gt_EMINumMatchesLeft@Base 1.5.1 gt_EMINumMatchesTotal@Base 1.5.1 gt_Enumcodeatposition_delete@Base 1.5.1 gt_Enumcodeatposition_filledqgramcode@Base 1.5.1 gt_Enumcodeatposition_filledqgramcodestopatmax@Base 1.5.1 gt_Enumcodeatposition_new@Base 1.5.1 gt_Enumcodeatposition_next@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete_errfind@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete_maxpairs@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete_rdjce@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete_rdjcv@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete_shulen@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete_spmeq@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete_spmsk@Base 1.5.1 gt_GtArrayGtBUItvinfo_delete_spmvar@Base 1.5.1 gt_GtArrayGtBUItvinfo_new@Base 1.5.1 gt_GtArrayGtBUItvinfo_new_errfind@Base 1.5.1 gt_GtArrayGtBUItvinfo_new_maxpairs@Base 1.5.1 gt_GtArrayGtBUItvinfo_new_rdjce@Base 1.5.1 gt_GtArrayGtBUItvinfo_new_rdjcv@Base 1.5.1 gt_GtArrayGtBUItvinfo_new_shulen@Base 1.5.1 gt_GtArrayGtBUItvinfo_new_spmeq@Base 1.5.1 gt_GtArrayGtBUItvinfo_new_spmsk@Base 1.5.1 gt_GtArrayGtBUItvinfo_new_spmvar@Base 1.5.1 gt_GtSpecialcharinfo_check@Base 1.5.1 gt_MRAEncAddSymbolToRange@Base 1.5.1 gt_MRAEncCopy@Base 1.5.1 gt_MRAEncDelete@Base 1.5.1 gt_MRAEncGTAlphaNew@Base 1.5.1 gt_MRAEncGetSize@Base 1.5.1 gt_MRAEncReadAndTransform@Base 1.5.1 gt_MRAEncSecondaryMapping@Base 1.5.1 gt_MRAEncSymbolIsInSelectedRanges@Base 1.5.1 gt_MRAEncSymbolsRevTransform@Base 1.5.1 gt_MRAEncSymbolsTransform@Base 1.5.1 gt_Outlcpinfo_check_lcpvalues@Base 1.5.1 gt_Outlcpinfo_delete@Base 1.5.1 gt_Outlcpinfo_lcptabsum@Base 1.5.1 gt_Outlcpinfo_lcpvalues_ref@Base 1.5.1 gt_Outlcpinfo_maxbranchdepth@Base 1.5.1 gt_Outlcpinfo_new@Base 1.5.1 gt_Outlcpinfo_nonspecialsbucket@Base 1.5.1 gt_Outlcpinfo_numoflargelcpvalues@Base 1.5.1 gt_Outlcpinfo_numsuffixes2output_set@Base 1.5.1 gt_Outlcpinfo_postbucket@Base 1.5.1 gt_Outlcpinfo_prebucket@Base 1.5.1 gt_Outlcpinfo_reinit@Base 1.5.1 gt_Outlcpinfo_resizereservoir@Base 1.5.1 gt_Outlcpinfo_size@Base 1.5.1 gt_SAIBaseNewMRAEnc@Base 1.5.1 gt_SAIGetOrigSeq@Base 1.5.1 gt_SAIGetRot0Pos@Base 1.5.1 gt_SAIMakeBWTReader@Base 1.5.1 gt_SAIMakeReader@Base 1.5.1 gt_SAIMakeSufTabReader@Base 1.5.1 gt_SANewMRAEnc@Base 1.5.1 gt_SASSGenericCreateReader@Base 1.5.1 gt_SPRTGetOrigEncseq@Base 1.5.1 gt_SRLAddPosition@Base 1.5.1 gt_SRLAllSymbolsCountInSeqRegion@Base 1.5.1 gt_SRLAppendNewRange@Base 1.5.1 gt_SRLApplyRangesToSubString@Base 1.5.1 gt_SRLCompact@Base 1.5.1 gt_SRLFindPositionLast@Base 1.5.1 gt_SRLFindPositionNext@Base 1.5.1 gt_SRLInitListSearchHint@Base 1.5.1 gt_SRLOverlapsPosition@Base 1.5.1 gt_SRLPrintRangesInfo@Base 1.5.1 gt_SRLReadFromStream@Base 1.5.1 gt_SRLSaveToStream@Base 1.5.1 gt_SRLSymbolCountInSeqRegion@Base 1.5.1 gt_SRLSymbolsInSeqRegion@Base 1.5.1 gt_SRLinsertNewRange@Base 1.5.1 gt_Sequentialsuffixarrayreader_bcktab@Base 1.5.1 gt_Sequentialsuffixarrayreader_nonspecials@Base 1.5.1 gt_Sequentialsuffixarrayreader_prefixlength@Base 1.5.1 gt_Sequentialsuffixarrayreader_totallength@Base 1.5.1 gt_SfxI2SASS@Base 1.5.1 gt_SfxIGetAlphabet@Base 1.5.1 gt_SfxIGetEncSeq@Base 1.5.1 gt_SfxIGetLength@Base 1.5.1 gt_SfxIGetOrigSeq@Base 1.5.1 gt_SfxIGetReadmode@Base 1.5.1 gt_SfxIGetRot0Pos@Base 1.5.1 gt_SfxIGetSeqStats@Base 1.5.1 gt_SfxINewMRAEnc@Base 1.5.1 gt_SfxIRegisterReader@Base 1.5.1 gt_SfxInterface2Sfxiterator@Base 1.5.1 gt_Sfxiterator_bcktab2file@Base 1.5.1 gt_Sfxiterator_delete@Base 1.5.1 gt_Sfxiterator_longest@Base 1.5.1 gt_Sfxiterator_new@Base 1.5.1 gt_Sfxiterator_new_withadditionalvalues@Base 1.5.1 gt_Sfxiterator_next@Base 1.5.1 gt_Sfxmappedrange_checkindex@Base 1.5.1 gt_Sfxmappedrange_delete@Base 1.5.1 gt_Sfxmappedrange_map@Base 1.5.1 gt_Sfxmappedrange_map_entire@Base 1.5.1 gt_Sfxmappedrange_new@Base 1.5.1 gt_Sfxmappedrange_size_entire@Base 1.5.1 gt_Sfxmappedrange_size_mapped@Base 1.5.1 gt_Sfxmappedrange_storetmp_bitsequence@Base 1.5.1 gt_Sfxmappedrange_storetmp_uint32@Base 1.5.1 gt_Sfxmappedrange_storetmp_ulong@Base 1.5.1 gt_Sfxmappedrange_unmap@Base 1.5.1 gt_Sfxmappedrange_usetmp@Base 1.5.1 gt_Sfxmappedrangelist_add@Base 1.5.1 gt_Sfxmappedrangelist_delete@Base 1.5.1 gt_Sfxmappedrangelist_new@Base 1.5.1 gt_Sfxmappedrangelist_size_entire@Base 1.5.1 gt_Sfxmappedrangelist_size_mapped@Base 1.5.1 gt_Viatwobitkeyvalues_delete@Base 1.5.1 gt_Viatwobitkeyvalues_new@Base 1.5.1 gt_Viatwobitkeyvalues_reinit@Base 1.5.1 gt_addSuffixarrayXltor@Base 1.5.1 gt_add_ids_stream_class@Base 1.5.1 gt_add_ids_stream_disable@Base 1.5.1 gt_add_ids_stream_new@Base 1.5.1 gt_add_ids_visitor_class@Base 1.5.1 gt_add_ids_visitor_finalize@Base 1.5.1 gt_add_ids_visitor_get_node@Base 1.5.1 gt_add_ids_visitor_new@Base 1.5.1 gt_add_ids_visitor_node_buffer_size@Base 1.5.1 gt_add_introns_stream_new@Base 1.5.1 gt_affinealign@Base 1.5.1 gt_aligned_segment_assign_refregion_chars@Base 1.5.1 gt_aligned_segment_delete@Base 1.5.1 gt_aligned_segment_description@Base 1.5.1 gt_aligned_segment_enable_edit_tracking@Base 1.5.1 gt_aligned_segment_has_indels@Base 1.5.1 gt_aligned_segment_is_reverse@Base 1.5.1 gt_aligned_segment_length@Base 1.5.1 gt_aligned_segment_mapping_quality@Base 1.5.1 gt_aligned_segment_new_from_sa@Base 1.5.1 gt_aligned_segment_offset_for_refpos@Base 1.5.1 gt_aligned_segment_orig_seq@Base 1.5.1 gt_aligned_segment_orig_seqlen@Base 1.5.1 gt_aligned_segment_orig_seqpos_for_refpos@Base 1.5.1 gt_aligned_segment_qual@Base 1.5.1 gt_aligned_segment_refregion@Base 1.5.1 gt_aligned_segment_refregion_edited@Base 1.5.1 gt_aligned_segment_refregion_endpos@Base 1.5.1 gt_aligned_segment_refregion_set_edited@Base 1.5.1 gt_aligned_segment_refregion_startpos@Base 1.5.1 gt_aligned_segment_seq@Base 1.5.1 gt_aligned_segment_seq_edited@Base 1.5.1 gt_aligned_segment_seq_set_edited@Base 1.5.1 gt_aligned_segment_show@Base 1.5.1 gt_aligned_segment_ungap_refregion@Base 1.5.1 gt_aligned_segment_ungap_seq_and_qual@Base 1.5.1 gt_aligned_segments_pile_compare_as@Base 1.5.1 gt_aligned_segments_pile_delete@Base 1.5.1 gt_aligned_segments_pile_disable_segment_deletion@Base 1.5.1 gt_aligned_segments_pile_enable_edit_tracking@Base 1.5.1 gt_aligned_segments_pile_flush@Base 1.5.1 gt_aligned_segments_pile_get@Base 1.5.1 gt_aligned_segments_pile_move_over_position@Base 1.5.1 gt_aligned_segments_pile_new@Base 1.5.1 gt_aligned_segments_pile_register_process_complete@Base 1.5.1 gt_aligned_segments_pile_register_process_skipped@Base 1.5.1 gt_aligned_segments_pile_register_process_unmapped@Base 1.5.1 gt_aligned_segments_pile_size@Base 1.5.1 gt_alignment_add_deletion@Base 1.5.1 gt_alignment_add_insertion@Base 1.5.1 gt_alignment_add_replacement@Base 1.5.1 gt_alignment_delete@Base 1.5.1 gt_alignment_eval@Base 1.5.1 gt_alignment_eval_with_score@Base 1.5.1 gt_alignment_get_length@Base 1.5.1 gt_alignment_get_urange@Base 1.5.1 gt_alignment_get_vrange@Base 1.5.1 gt_alignment_new@Base 1.5.1 gt_alignment_new_with_seqs@Base 1.5.1 gt_alignment_remove_last@Base 1.5.1 gt_alignment_reset@Base 1.5.1 gt_alignment_set_seqs@Base 1.5.1 gt_alignment_set_urange@Base 1.5.1 gt_alignment_set_vrange@Base 1.5.1 gt_alignment_show@Base 1.5.1 gt_alignment_show_multieop_list@Base 1.5.1 gt_alignment_show_with_mapped_chars@Base 1.5.1 gt_alignment_unit_test@Base 1.5.1 gt_alphabet_add_mapping@Base 1.5.1 gt_alphabet_add_wildcard@Base 1.5.1 gt_alphabet_bits_per_symbol@Base 1.5.1 gt_alphabet_characters@Base 1.5.1 gt_alphabet_clone@Base 1.5.1 gt_alphabet_decode@Base 1.5.1 gt_alphabet_decode_seq_to_cstr@Base 1.5.1 gt_alphabet_decode_seq_to_fp@Base 1.5.1 gt_alphabet_decode_seq_to_str@Base 1.5.1 gt_alphabet_delete@Base 1.5.1 gt_alphabet_echo_pretty_symbol@Base 1.5.1 gt_alphabet_encode@Base 1.5.1 gt_alphabet_encode_seq@Base 1.5.1 gt_alphabet_equals@Base 1.5.1 gt_alphabet_guess@Base 1.5.1 gt_alphabet_is_dna@Base 1.5.1 gt_alphabet_is_protein@Base 1.5.1 gt_alphabet_new_dna@Base 1.5.1 gt_alphabet_new_empty@Base 1.5.1 gt_alphabet_new_from_file@Base 1.5.1 gt_alphabet_new_from_file_no_suffix@Base 1.5.1 gt_alphabet_new_from_sequence@Base 1.5.1 gt_alphabet_new_from_string@Base 1.5.1 gt_alphabet_new_protein@Base 1.5.1 gt_alphabet_num_of_chars@Base 1.5.1 gt_alphabet_output@Base 1.5.1 gt_alphabet_pretty_symbol@Base 1.5.1 gt_alphabet_printf_symbolstring@Base 1.5.1 gt_alphabet_ref@Base 1.5.1 gt_alphabet_size@Base 1.5.1 gt_alphabet_symbolmap@Base 1.5.1 gt_alphabet_to_file@Base 1.5.1 gt_alphabet_to_str@Base 1.5.1 gt_alphabet_unit_test@Base 1.5.1 gt_alphabet_valid_input@Base 1.5.1 gt_alphabet_wildcard_show@Base 1.5.1 gt_anno_db_gfflike_class@Base 1.5.1 gt_anno_db_gfflike_new@Base 1.5.1 gt_anno_db_gfflike_unit_test@Base 1.5.1 gt_anno_db_schema_cast@Base 1.5.1 gt_anno_db_schema_class_new@Base 1.5.1 gt_anno_db_schema_create@Base 1.5.1 gt_anno_db_schema_delete@Base 1.5.1 gt_anno_db_schema_get_feature_index@Base 1.5.1 gt_anno_db_schema_ref@Base 1.5.1 gt_apme_AbstractDfstransformer@Base 1.5.1 gt_applycheckfunctiontotext@Base 1.5.1 gt_array2dim_example@Base 1.5.1 gt_array2dim_sparse_example@Base 1.5.1 gt_array3dim_example@Base 1.5.1 gt_array_add_array@Base 1.5.1 gt_array_add_elem@Base 1.5.1 gt_array_add_ptr@Base 1.5.1 gt_array_clone@Base 1.5.1 gt_array_cmp@Base 1.5.1 gt_array_delete@Base 1.5.1 gt_array_elem_size@Base 1.5.1 gt_array_equal@Base 1.5.1 gt_array_example@Base 1.5.1 gt_array_get@Base 1.5.1 gt_array_get_first@Base 1.5.1 gt_array_get_last@Base 1.5.1 gt_array_get_space@Base 1.5.1 gt_array_in_stream_class@Base 1.5.1 gt_array_in_stream_new@Base 1.5.1 gt_array_iterate@Base 1.5.1 gt_array_iterate_reverse@Base 1.5.1 gt_array_new@Base 1.5.1 gt_array_out_stream_class@Base 1.5.1 gt_array_out_stream_new@Base 1.5.1 gt_array_pop@Base 1.5.1 gt_array_prepend_array@Base 1.5.1 gt_array_ref@Base 1.5.1 gt_array_rem@Base 1.5.1 gt_array_rem_span@Base 1.5.1 gt_array_reset@Base 1.5.1 gt_array_reverse@Base 1.5.1 gt_array_set_size@Base 1.5.1 gt_array_size@Base 1.5.1 gt_array_sort@Base 1.5.1 gt_array_sort_stable@Base 1.5.1 gt_array_sort_stable_with_data@Base 1.5.1 gt_array_sort_with_data@Base 1.5.1 gt_array_unit_test@Base 1.5.1 gt_asqg_writer_delete@Base 1.5.1 gt_asqg_writer_new@Base 1.5.1 gt_asqg_writer_show_header@Base 1.5.1 gt_asqg_writer_show_vertices@Base 1.5.1 gt_assembly_stats_calculator_add@Base 1.5.1 gt_assembly_stats_calculator_delete@Base 1.5.1 gt_assembly_stats_calculator_new@Base 1.5.1 gt_assembly_stats_calculator_set_genome_length@Base 1.5.1 gt_assembly_stats_calculator_show@Base 1.5.1 gt_availBWTSeq@Base 1.5.1 gt_availBWTSeqFromSA@Base 1.5.1 gt_basename@Base 1.5.1 gt_basename_unit_test@Base 1.5.1 gt_bcktab_addfinalspecials@Base 1.5.1 gt_bcktab_assignboundsforpart@Base 1.5.1 gt_bcktab_calcboundaries@Base 1.5.1 gt_bcktab_calcboundsparts@Base 1.5.1 gt_bcktab_calcrightbounds@Base 1.5.1 gt_bcktab_checkcountspecialcodes@Base 1.5.1 gt_bcktab_codedownscale@Base 1.5.1 gt_bcktab_delete@Base 1.5.1 gt_bcktab_determinemaxsize@Base 1.5.1 gt_bcktab_distpfxidxpartialsums@Base 1.5.1 gt_bcktab_filltable@Base 1.5.1 gt_bcktab_findfirstlarger@Base 1.5.1 gt_bcktab_flush_to_file@Base 1.5.1 gt_bcktab_get_leftborder@Base 1.5.1 gt_bcktab_leftborder@Base 1.5.1 gt_bcktab_leftborder_assign@Base 1.5.1 gt_bcktab_leftborder_show@Base 1.5.1 gt_bcktab_leftborderpartialsums@Base 1.5.1 gt_bcktab_map@Base 1.5.1 gt_bcktab_maprange_lb_cs@Base 1.5.1 gt_bcktab_maxbucketsize@Base 1.5.1 gt_bcktab_multimappower@Base 1.5.1 gt_bcktab_new@Base 1.5.1 gt_bcktab_nonspecialsmaxsize@Base 1.5.1 gt_bcktab_numofallcodes@Base 1.5.1 gt_bcktab_pfxidx2lcpvalues_Lcpvaluetype@Base 1.5.1 gt_bcktab_pfxidx2lcpvalues_uint8@Base 1.5.1 gt_bcktab_prefixlength@Base 1.5.1 gt_bcktab_remap_all@Base 1.5.1 gt_bcktab_show@Base 1.5.1 gt_bcktab_singletonmaxprefixindex@Base 1.5.1 gt_bcktab_sizeforlcpvalues@Base 1.5.1 gt_bcktab_sizeoftable@Base 1.5.1 gt_bcktab_sizeofworkspace@Base 1.5.1 gt_bcktab_storetmp@Base 1.5.1 gt_bcktab_updatespecials@Base 1.5.1 gt_bed_in_stream_class@Base 1.5.1 gt_bed_in_stream_new@Base 1.5.1 gt_bed_in_stream_set_block_type@Base 1.5.1 gt_bed_in_stream_set_feature_type@Base 1.5.1 gt_bed_in_stream_set_thick_feature_type@Base 1.5.1 gt_bed_parser_delete@Base 1.5.1 gt_bed_parser_new@Base 1.5.1 gt_bed_parser_parse@Base 1.5.1 gt_bed_parser_set_block_type@Base 1.5.1 gt_bed_parser_set_feature_type@Base 1.5.1 gt_bed_parser_set_thick_feature_type@Base 1.5.1 gt_bioseq_col_class@Base 1.5.1 gt_bioseq_col_md5_to_sequence_length@Base 1.5.1 gt_bioseq_col_new@Base 1.5.1 gt_bioseq_delete@Base 1.5.1 gt_bioseq_filename@Base 1.5.1 gt_bioseq_get_alphabet@Base 1.5.1 gt_bioseq_get_char@Base 1.5.1 gt_bioseq_get_description@Base 1.5.1 gt_bioseq_get_encoded_char@Base 1.5.1 gt_bioseq_get_encoded_sequence@Base 1.5.1 gt_bioseq_get_encoded_sequence_range@Base 1.5.1 gt_bioseq_get_md5_fingerprint@Base 1.5.1 gt_bioseq_get_seq@Base 1.5.1 gt_bioseq_get_seq_range@Base 1.5.1 gt_bioseq_get_sequence@Base 1.5.1 gt_bioseq_get_sequence_length@Base 1.5.1 gt_bioseq_get_sequence_range@Base 1.5.1 gt_bioseq_get_total_length@Base 1.5.1 gt_bioseq_iterator_delete@Base 1.5.1 gt_bioseq_iterator_new@Base 1.5.1 gt_bioseq_iterator_next@Base 1.5.1 gt_bioseq_md5_to_index@Base 1.5.1 gt_bioseq_new@Base 1.5.1 gt_bioseq_new_recreate@Base 1.5.1 gt_bioseq_new_str@Base 1.5.1 gt_bioseq_number_of_sequences@Base 1.5.1 gt_bioseq_show_as_fasta@Base 1.5.1 gt_bioseq_show_gc_content@Base 1.5.1 gt_bioseq_show_seqlengthdistri@Base 1.5.1 gt_bioseq_show_sequence_as_fasta@Base 1.5.1 gt_bioseq_show_stat@Base 1.5.1 gt_bitPackStringInt16_unit_test@Base 1.5.1 gt_bitPackStringInt32_unit_test@Base 1.5.1 gt_bitPackStringInt64_unit_test@Base 1.5.1 gt_bitPackStringInt8_unit_test@Base 1.5.1 gt_bitPackStringInt_unit_test@Base 1.5.1 gt_bitPackString_unit_test@Base 1.5.1 gt_bitinstream_delete@Base 1.5.1 gt_bitinstream_get_next_bit@Base 1.5.1 gt_bitinstream_new@Base 1.5.1 gt_bitinstream_reinit@Base 1.5.1 gt_bitoutstream_append@Base 1.5.1 gt_bitoutstream_append_bittab@Base 1.5.1 gt_bitoutstream_delete@Base 1.5.1 gt_bitoutstream_flush@Base 1.5.1 gt_bitoutstream_flush_advance@Base 1.5.1 gt_bitoutstream_new@Base 1.5.1 gt_bitoutstream_pos@Base 1.5.1 gt_bitpackarray_unit_test@Base 1.5.1 gt_bittab_and@Base 1.5.1 gt_bittab_and_equal@Base 1.5.1 gt_bittab_bit_is_set@Base 1.5.1 gt_bittab_cmp@Base 1.5.1 gt_bittab_complement@Base 1.5.1 gt_bittab_count_set_bits@Base 1.5.1 gt_bittab_delete@Base 1.5.1 gt_bittab_equal@Base 1.5.1 gt_bittab_example@Base 1.5.1 gt_bittab_get_all_bitnums@Base 1.5.1 gt_bittab_get_first_bitnum@Base 1.5.1 gt_bittab_get_last_bitnum@Base 1.5.1 gt_bittab_get_next_bitnum@Base 1.5.1 gt_bittab_is_true@Base 1.5.1 gt_bittab_nand@Base 1.5.1 gt_bittab_new@Base 1.5.1 gt_bittab_or@Base 1.5.1 gt_bittab_or_equal@Base 1.5.1 gt_bittab_set_bit@Base 1.5.1 gt_bittab_shift_left_equal@Base 1.5.1 gt_bittab_shift_right_equal@Base 1.5.1 gt_bittab_show@Base 1.5.1 gt_bittab_size@Base 1.5.1 gt_bittab_unit_test@Base 1.5.1 gt_bittab_unset@Base 1.5.1 gt_bittab_unset_bit@Base 1.5.1 gt_blindtrie_current_size@Base 1.5.1 gt_blindtrie_delete@Base 1.5.1 gt_blindtrie_new@Base 1.5.1 gt_blindtrie_reset@Base 1.5.1 gt_blindtrie_resize@Base 1.5.1 gt_blindtrie_retrieve@Base 1.5.1 gt_blindtrie_size@Base 1.5.1 gt_blindtrie_suffixsort@Base 1.5.1 gt_block2IndexPair@Base 1.5.1 gt_blockEncIdxSeqSegmentLen@Base 1.5.1 gt_block_caption_is_visible@Base 1.5.1 gt_block_clone@Base 1.5.1 gt_block_compare@Base 1.5.1 gt_block_delete@Base 1.5.1 gt_block_get_caption@Base 1.5.1 gt_block_get_max_height@Base 1.5.1 gt_block_get_range@Base 1.5.1 gt_block_get_range_ptr@Base 1.5.1 gt_block_get_size@Base 1.5.1 gt_block_get_strand@Base 1.5.1 gt_block_get_top_level_feature@Base 1.5.1 gt_block_get_type@Base 1.5.1 gt_block_has_only_one_fullsize_element@Base 1.5.1 gt_block_insert_element@Base 1.5.1 gt_block_merge@Base 1.5.1 gt_block_new@Base 1.5.1 gt_block_new_from_node@Base 1.5.1 gt_block_print@Base 1.5.1 gt_block_ref@Base 1.5.1 gt_block_set_caption@Base 1.5.1 gt_block_set_caption_visibility@Base 1.5.1 gt_block_set_range@Base 1.5.1 gt_block_set_strand@Base 1.5.1 gt_block_set_type@Base 1.5.1 gt_block_sketch@Base 1.5.1 gt_block_unit_test@Base 1.5.1 gt_bool_matrix_delete@Base 1.5.1 gt_bool_matrix_get@Base 1.5.1 gt_bool_matrix_get_first_column@Base 1.5.1 gt_bool_matrix_get_last_column@Base 1.5.1 gt_bool_matrix_get_next_column@Base 1.5.1 gt_bool_matrix_new@Base 1.5.1 gt_bool_matrix_set@Base 1.5.1 gt_bs1BitsCount@Base 1.5.1 gt_bsClear@Base 1.5.1 gt_bsCompare@Base 1.5.1 gt_bsCopy@Base 1.5.1 gt_bsGetNonUniformInt16Array@Base 1.5.1 gt_bsGetNonUniformInt16ArrayAdd@Base 1.5.1 gt_bsGetNonUniformInt32Array@Base 1.5.1 gt_bsGetNonUniformInt32ArrayAdd@Base 1.5.1 gt_bsGetNonUniformInt64Array@Base 1.5.1 gt_bsGetNonUniformInt64ArrayAdd@Base 1.5.1 gt_bsGetNonUniformInt8Array@Base 1.5.1 gt_bsGetNonUniformInt8ArrayAdd@Base 1.5.1 gt_bsGetNonUniformUInt16Array@Base 1.5.1 gt_bsGetNonUniformUInt16ArrayAdd@Base 1.5.1 gt_bsGetNonUniformUInt32Array@Base 1.5.1 gt_bsGetNonUniformUInt32ArrayAdd@Base 1.5.1 gt_bsGetNonUniformUInt64Array@Base 1.5.1 gt_bsGetNonUniformUInt64ArrayAdd@Base 1.5.1 gt_bsGetNonUniformUInt8Array@Base 1.5.1 gt_bsGetNonUniformUInt8ArrayAdd@Base 1.5.1 gt_bsGetUInt16@Base 1.5.1 gt_bsGetUInt32@Base 1.5.1 gt_bsGetUInt64@Base 1.5.1 gt_bsGetUInt8@Base 1.5.1 gt_bsGetUniformUInt16Array@Base 1.5.1 gt_bsGetUniformUInt16ArrayAdd@Base 1.5.1 gt_bsGetUniformUInt32Array@Base 1.5.1 gt_bsGetUniformUInt32ArrayAdd@Base 1.5.1 gt_bsGetUniformUInt64Array@Base 1.5.1 gt_bsGetUniformUInt64ArrayAdd@Base 1.5.1 gt_bsGetUniformUInt8Array@Base 1.5.1 gt_bsGetUniformUInt8ArrayAdd@Base 1.5.1 gt_bsPrint@Base 1.5.1 gt_bsStoreNonUniformUInt16Array@Base 1.5.1 gt_bsStoreNonUniformUInt32Array@Base 1.5.1 gt_bsStoreNonUniformUInt64Array@Base 1.5.1 gt_bsStoreNonUniformUInt8Array@Base 1.5.1 gt_bsStoreUInt16@Base 1.5.1 gt_bsStoreUInt32@Base 1.5.1 gt_bsStoreUInt64@Base 1.5.1 gt_bsStoreUInt8@Base 1.5.1 gt_bsStoreUniformUInt16Array@Base 1.5.1 gt_bsStoreUniformUInt32Array@Base 1.5.1 gt_bsStoreUniformUInt64Array@Base 1.5.1 gt_bsStoreUniformUInt8Array@Base 1.5.1 gt_bsearch_all@Base 1.5.1 gt_bsearch_all_mark@Base 1.5.1 gt_bsearch_data@Base 1.5.1 gt_bsearch_unit_test@Base 1.5.1 gt_buffer_stream_class@Base 1.5.1 gt_buffer_stream_dequeue@Base 1.5.1 gt_buffer_stream_new@Base 1.5.1 gt_bwtrangesplitallwithoutspecial@Base 1.5.1 gt_bwtrangesplitallwithspecial@Base 1.5.1 gt_bwtrangesplitwithoutspecial@Base 1.5.1 gt_bwtseq2maxdepth@Base 1.5.1 gt_bwtseq2mbtab@Base 1.5.1 gt_bwtseq2numofchars@Base 1.5.1 gt_bwtseqfirstmatch@Base 1.5.1 gt_bwtseqgetsymbol@Base 1.5.1 gt_calc_linearedist@Base 1.5.1 gt_calculateKr@Base 1.5.1 gt_callenumquerymatches@Base 1.5.1 gt_callenumselfmatches@Base 1.5.1 gt_calloc_mem@Base 1.5.1 gt_canvas_cairo_context_class@Base 1.5.1 gt_canvas_cairo_context_new@Base 1.5.1 gt_canvas_cairo_draw_ruler@Base 1.5.1 gt_canvas_cairo_file_class@Base 1.5.1 gt_canvas_cairo_file_new@Base 1.5.1 gt_canvas_cairo_file_to_file@Base 1.5.1 gt_canvas_cairo_file_to_stream@Base 1.5.1 gt_canvas_cairo_visit_block@Base 1.5.1 gt_canvas_cairo_visit_custom_track@Base 1.5.1 gt_canvas_cairo_visit_element@Base 1.5.1 gt_canvas_cairo_visit_layout_post@Base 1.5.1 gt_canvas_cairo_visit_layout_pre@Base 1.5.1 gt_canvas_cairo_visit_line_post@Base 1.5.1 gt_canvas_cairo_visit_line_pre@Base 1.5.1 gt_canvas_cairo_visit_track_post@Base 1.5.1 gt_canvas_cairo_visit_track_pre@Base 1.5.1 gt_canvas_cast@Base 1.5.1 gt_canvas_class_new@Base 1.5.1 gt_canvas_create@Base 1.5.1 gt_canvas_delete@Base 1.5.1 gt_canvas_draw_ruler@Base 1.5.1 gt_canvas_get_height@Base 1.5.1 gt_canvas_get_style@Base 1.5.1 gt_canvas_try_cast@Base 1.5.1 gt_canvas_visit_block@Base 1.5.1 gt_canvas_visit_custom_track@Base 1.5.1 gt_canvas_visit_element@Base 1.5.1 gt_canvas_visit_layout_post@Base 1.5.1 gt_canvas_visit_layout_pre@Base 1.5.1 gt_canvas_visit_line_post@Base 1.5.1 gt_canvas_visit_line_pre@Base 1.5.1 gt_canvas_visit_track_post@Base 1.5.1 gt_canvas_visit_track_pre@Base 1.5.1 gt_cds_check_stream_class@Base 1.5.1 gt_cds_check_stream_enable_tidy_mode@Base 1.5.1 gt_cds_check_stream_new@Base 1.5.1 gt_cds_check_visitor_class@Base 1.5.1 gt_cds_check_visitor_enable_tidy_mode@Base 1.5.1 gt_cds_check_visitor_new@Base 1.5.1 gt_cds_stream_new@Base 1.5.1 gt_cds_visitor_class@Base 1.5.1 gt_cds_visitor_new@Base 1.5.1 gt_cds_visitor_set_region_mapping@Base 1.5.1 gt_chain_add_fragnum@Base 1.5.1 gt_chain_analyzeopenformatfile@Base 1.5.1 gt_chain_applyweight@Base 1.5.1 gt_chain_chain_delete@Base 1.5.1 gt_chain_chain_new@Base 1.5.1 gt_chain_chainlength@Base 1.5.1 gt_chain_chainmode_delete@Base 1.5.1 gt_chain_chainmode_new@Base 1.5.1 gt_chain_chainscore@Base 1.5.1 gt_chain_delete@Base 1.5.1 gt_chain_extractchainelem@Base 1.5.1 gt_chain_fastchaining@Base 1.5.1 gt_chain_fillthegapvalues@Base 1.5.1 gt_chain_get_fragnum@Base 1.5.1 gt_chain_get_score@Base 1.5.1 gt_chain_matchtable_add@Base 1.5.1 gt_chain_matchtable_delete@Base 1.5.1 gt_chain_matchtable_empty@Base 1.5.1 gt_chain_matchtable_new@Base 1.5.1 gt_chain_new@Base 1.5.1 gt_chain_possiblysortmatches@Base 1.5.1 gt_chain_printchainelem@Base 1.5.1 gt_chain_reset@Base 1.5.1 gt_chain_set_fragnum@Base 1.5.1 gt_chain_set_score@Base 1.5.1 gt_chain_size@Base 1.5.1 gt_chain_storedinreverseorder@Base 1.5.1 gt_check_stopcodon@Base 1.5.1 gt_checkandresetstorematch@Base 1.5.1 gt_checkgreedyunitedist@Base 1.5.1 gt_checkifprefixesareidentical@Base 1.5.1 gt_checkprefixlength@Base 1.5.1 gt_checksortedsuffixes@Base 1.5.1 gt_chseqids_stream_class@Base 1.5.1 gt_chseqids_stream_new@Base 1.5.1 gt_class_alloc@Base 1.5.1 gt_class_alloc_clean@Base 1.5.1 gt_class_alloc_lock_clean@Base 1.5.1 gt_class_alloc_lock_enter_func@Base 1.5.1 gt_class_alloc_lock_init@Base 1.5.1 gt_class_alloc_lock_leave_func@Base 1.5.1 gt_clustered_set_class_new@Base 1.5.1 gt_clustered_set_cluster_num@Base 1.5.1 gt_clustered_set_create@Base 1.5.1 gt_clustered_set_delete@Base 1.5.1 gt_clustered_set_get_iterator@Base 1.5.1 gt_clustered_set_iterator_delete@Base 1.5.1 gt_clustered_set_iterator_next@Base 1.5.1 gt_clustered_set_merge_clusters@Base 1.5.1 gt_clustered_set_num_of_clusters@Base 1.5.1 gt_clustered_set_num_of_elements@Base 1.5.1 gt_clustered_set_union_find_class@Base 1.5.1 gt_clustered_set_union_find_cluster_num@Base 1.5.1 gt_clustered_set_union_find_delete@Base 1.5.1 gt_clustered_set_union_find_iterator_new@Base 1.5.1 gt_clustered_set_union_find_merge_clusters@Base 1.5.1 gt_clustered_set_union_find_new@Base 1.5.1 gt_clustered_set_union_find_num_of_clusters@Base 1.5.1 gt_clustered_set_union_find_num_of_elements@Base 1.5.1 gt_clustered_set_union_find_unit_test@Base 1.5.1 gt_cntlist_count@Base 1.5.1 gt_cntlist_parse@Base 1.5.1 gt_cntlist_show@Base 1.5.1 gt_cntlist_write_bin_header@Base 1.5.1 gt_cntlist_xload@Base 1.5.1 gt_codon_iterator_cast@Base 1.5.1 gt_codon_iterator_class_new@Base 1.5.1 gt_codon_iterator_create@Base 1.5.1 gt_codon_iterator_current_position@Base 1.5.1 gt_codon_iterator_delete@Base 1.5.1 gt_codon_iterator_encseq_class@Base 1.5.1 gt_codon_iterator_encseq_new@Base 1.5.1 gt_codon_iterator_encseq_new_with_readmode@Base 1.5.1 gt_codon_iterator_encseq_unit_test@Base 1.5.1 gt_codon_iterator_length@Base 1.5.1 gt_codon_iterator_next@Base 1.5.1 gt_codon_iterator_rewind@Base 1.5.1 gt_codon_iterator_simple_class@Base 1.5.1 gt_codon_iterator_simple_new@Base 1.5.1 gt_codon_iterator_simple_unit_test@Base 1.5.1 gt_codon_iterator_try_cast@Base 1.5.1 gt_coin_hmm_alphabet@Base 1.5.1 gt_coin_hmm_fair@Base 1.5.1 gt_coin_hmm_loaded@Base 1.5.1 gt_collect_ids_visitor_class@Base 1.5.1 gt_collect_ids_visitor_new@Base 1.5.1 gt_color_delete@Base 1.5.1 gt_color_equals@Base 1.5.1 gt_color_new@Base 1.5.1 gt_color_set@Base 1.5.1 gt_colorspace_decode_string@Base 1.5.1 gt_colorspace_unit_test@Base 1.5.1 gt_combinatorics_binomial_dp@Base 1.5.1 gt_combinatorics_binomial_ln@Base 1.5.1 gt_combinatorics_binomial_simple@Base 1.5.1 gt_combinatorics_clean@Base 1.5.1 gt_combinatorics_init@Base 1.5.1 gt_combinatorics_unit_test@Base 1.5.1 gt_comment_node_class@Base 1.5.1 gt_comment_node_get_comment@Base 1.5.1 gt_comment_node_new@Base 1.5.1 gt_compact_ulong_store_delete@Base 1.5.1 gt_compact_ulong_store_get@Base 1.5.1 gt_compact_ulong_store_new@Base 1.5.1 gt_compact_ulong_store_size@Base 1.5.1 gt_compact_ulong_store_unit_test@Base 1.5.1 gt_compact_ulong_store_update@Base 1.5.1 gt_complement@Base 1.5.1 gt_completealignmentfromLocaliTracebackstate@Base 1.5.1 gt_computePackedIndexDefaults@Base 1.5.1 gt_compute_indelcount@Base 1.5.1 gt_computefmkeyvalues@Base 1.5.1 gt_consensus_sa@Base 1.5.1 gt_constructmerbuckets@Base 1.5.1 gt_contfind_bottomup@Base 1.5.1 gt_contfinder_contained@Base 1.5.1 gt_contfinder_delete@Base 1.5.1 gt_contfinder_new@Base 1.5.1 gt_contfinder_nofcontained@Base 1.5.1 gt_contfinder_radixsort_str_eqlen_tester@Base 1.5.1 gt_contfinder_run@Base 1.5.1 gt_contfinder_write_cntlist@Base 1.5.1 gt_contfinder_write_copynum@Base 1.5.1 gt_contfinder_write_seqnums@Base 1.5.1 gt_contfinder_write_sorted_seqnums@Base 1.5.1 gt_contigpaths_to_fasta@Base 1.5.1 gt_contigs_writer_abort@Base 1.5.1 gt_contigs_writer_append@Base 1.5.1 gt_contigs_writer_delete@Base 1.5.1 gt_contigs_writer_new@Base 1.5.1 gt_contigs_writer_show_stats@Base 1.5.1 gt_contigs_writer_start@Base 1.5.1 gt_contigs_writer_write@Base 1.5.1 gt_convertBWTOptFlags2EISFeatures@Base 1.5.1 gt_coords_calc_generic_range@Base 1.5.1 gt_coords_convert_point@Base 1.5.1 gt_copy_reversecomplement@Base 1.5.1 gt_copysort_checkhardwork@Base 1.5.1 gt_copysort_delete@Base 1.5.1 gt_copysort_derivesorting@Base 1.5.1 gt_copysort_new@Base 1.5.1 gt_countingsort@Base 1.5.1 gt_countingsort_get_max@Base 1.5.1 gt_countingsort_unit_test@Base 1.5.1 gt_createBWTSeqFromSA@Base 1.5.1 gt_createBWTSeqFromSAI@Base 1.5.1 gt_createBWTSeqFromSfxI@Base 1.5.1 gt_createBWTSeqGeneric@Base 1.5.1 gt_createEncIdxSeq@Base 1.5.1 gt_createEncIdxSeqFromSA@Base 1.5.1 gt_createEncIdxSeqFromSAI@Base 1.5.1 gt_createEncIdxSeqFromSfxI@Base 1.5.1 gt_createEncIdxSeqGen@Base 1.5.1 gt_csa_gene_add_splice_form@Base 1.5.1 gt_csa_gene_delete@Base 1.5.1 gt_csa_gene_genomic_range@Base 1.5.1 gt_csa_gene_get_representative@Base 1.5.1 gt_csa_gene_get_splice_form@Base 1.5.1 gt_csa_gene_new@Base 1.5.1 gt_csa_gene_num_of_splice_forms@Base 1.5.1 gt_csa_gene_strand@Base 1.5.1 gt_csa_splice_form_add_sa@Base 1.5.1 gt_csa_splice_form_delete@Base 1.5.1 gt_csa_splice_form_genomic_range@Base 1.5.1 gt_csa_splice_form_get_representative@Base 1.5.1 gt_csa_splice_form_get_sa@Base 1.5.1 gt_csa_splice_form_new@Base 1.5.1 gt_csa_splice_form_num_of_sas@Base 1.5.1 gt_csa_splice_form_strand@Base 1.5.1 gt_csa_stream_class@Base 1.5.1 gt_csa_stream_new@Base 1.5.1 gt_csa_variable_strands@Base 1.5.1 gt_csa_visitor_class@Base 1.5.1 gt_csa_visitor_get_node@Base 1.5.1 gt_csa_visitor_new@Base 1.5.1 gt_csa_visitor_node_buffer_size@Base 1.5.1 gt_csa_visitor_process_cluster@Base 1.5.1 gt_cstr_array_delete@Base 1.5.1 gt_cstr_array_dup@Base 1.5.1 gt_cstr_array_prefix_first@Base 1.5.1 gt_cstr_array_preprend@Base 1.5.1 gt_cstr_array_show@Base 1.5.1 gt_cstr_array_show_genfile@Base 1.5.1 gt_cstr_array_size@Base 1.5.1 gt_cstr_dup@Base 1.5.1 gt_cstr_dup_nt@Base 1.5.1 gt_cstr_iterator_cast@Base 1.5.1 gt_cstr_iterator_class_new@Base 1.5.1 gt_cstr_iterator_create@Base 1.5.1 gt_cstr_iterator_delete@Base 1.5.1 gt_cstr_iterator_next@Base 1.5.1 gt_cstr_iterator_reset@Base 1.5.1 gt_cstr_length_up_to_char@Base 1.5.1 gt_cstr_nofree_ulp_destruct@Base 1.5.1 gt_cstr_nofree_ulp_gt_hashmap_foreach@Base 1.5.1 gt_cstr_nofree_ulp_gt_hashmap_foreach_in_default_order@Base 1.5.1 gt_cstr_nofree_ulp_gt_hashmap_foreach_ordered@Base 1.5.1 gt_cstr_nofree_ulp_hashtype@Base 1.5.1 gt_cstr_rep@Base 1.5.1 gt_cstr_rtrim@Base 1.5.1 gt_cstr_show@Base 1.5.1 gt_cstr_split@Base 1.5.1 gt_cstr_table_add@Base 1.5.1 gt_cstr_table_delete@Base 1.5.1 gt_cstr_table_get@Base 1.5.1 gt_cstr_table_get_all@Base 1.5.1 gt_cstr_table_new@Base 1.5.1 gt_cstr_table_remove@Base 1.5.1 gt_cstr_table_reset@Base 1.5.1 gt_cstr_table_unit_test@Base 1.5.1 gt_cstr_unit_test@Base 1.5.1 gt_custom_track_cast@Base 1.5.1 gt_custom_track_class_new@Base 1.5.1 gt_custom_track_create@Base 1.5.1 gt_custom_track_delete@Base 1.5.1 gt_custom_track_example_class@Base 1.5.1 gt_custom_track_example_delete@Base 1.5.1 gt_custom_track_example_get_height@Base 1.5.1 gt_custom_track_example_get_title@Base 1.5.1 gt_custom_track_example_new@Base 1.5.1 gt_custom_track_example_sketch@Base 1.5.1 gt_custom_track_gc_content_class@Base 1.5.1 gt_custom_track_gc_content_delete@Base 1.5.1 gt_custom_track_gc_content_get_height@Base 1.5.1 gt_custom_track_gc_content_get_title@Base 1.5.1 gt_custom_track_gc_content_new@Base 1.5.1 gt_custom_track_gc_content_sketch@Base 1.5.1 gt_custom_track_get_height@Base 1.5.1 gt_custom_track_get_title@Base 1.5.1 gt_custom_track_ref@Base 1.5.1 gt_custom_track_render@Base 1.5.1 gt_custom_track_script_wrapper_class@Base 1.5.1 gt_custom_track_script_wrapper_delete@Base 1.5.1 gt_custom_track_script_wrapper_get_height@Base 1.5.1 gt_custom_track_script_wrapper_get_title@Base 1.5.1 gt_custom_track_script_wrapper_new@Base 1.5.1 gt_custom_track_script_wrapper_sketch@Base 1.5.1 gt_custom_track_sketch@Base 1.5.1 gt_decodesingleinteger@Base 1.5.1 gt_deleteBWTSeq@Base 1.5.1 gt_deleteBWTSeqCR@Base 1.5.1 gt_deleteBWTSeqContextRetrieverFactory@Base 1.5.1 gt_deleteCompositionList@Base 1.5.1 gt_deleteEMIterator@Base 1.5.1 gt_deleteEncIdxSeq@Base 1.5.1 gt_deleteSeqRangeList@Base 1.5.1 gt_deleteSfxInterface@Base 1.5.1 gt_deleteSpecialsRankLookup@Base 1.5.1 gt_deleteSuffixarrayFileInterface@Base 1.5.1 gt_deletevoidBWTSeq@Base 1.5.1 gt_depthfirstesa@Base 1.5.1 gt_desc_buffer_append_char@Base 1.5.1 gt_desc_buffer_delete@Base 1.5.1 gt_desc_buffer_finish@Base 1.5.1 gt_desc_buffer_get_next@Base 1.5.1 gt_desc_buffer_length@Base 1.5.1 gt_desc_buffer_new@Base 1.5.1 gt_desc_buffer_ref@Base 1.5.1 gt_desc_buffer_reset@Base 1.5.1 gt_desc_buffer_show@Base 1.5.1 gt_desc_buffer_unit_test@Base 1.5.1 gt_deskeysfileexists@Base 1.5.1 gt_destructCompositionList@Base 1.5.1 gt_destructEMIterator@Base 1.5.1 gt_destructSATaggedXltorStateList@Base 1.5.1 gt_destructSeqReaderSet@Base 1.5.1 gt_destructSuffixarrayFileInterface@Base 1.5.1 gt_determine_ORFs@Base 1.5.1 gt_determinebitspervalue@Base 1.5.1 gt_determinenumberofspecialstostore@Base 1.5.1 gt_determinetyrbckpfxlen@Base 1.5.1 gt_diagram_add_custom_track@Base 1.5.1 gt_diagram_delete@Base 1.5.1 gt_diagram_get_blocks@Base 1.5.1 gt_diagram_get_custom_tracks@Base 1.5.1 gt_diagram_get_range@Base 1.5.1 gt_diagram_new@Base 1.5.1 gt_diagram_new_from_array@Base 1.5.1 gt_diagram_reset_track_selector_func@Base 1.5.1 gt_diagram_set_track_selector_func@Base 1.5.1 gt_diagram_unit_test@Base 1.5.1 gt_diagram_unit_test_sketch_func@Base 1.5.1 gt_dice_hmm_alphabet@Base 1.5.1 gt_dice_hmm_fair@Base 1.5.1 gt_dice_hmm_loaded@Base 1.5.1 gt_differencecover_check@Base 1.5.1 gt_differencecover_compare@Base 1.5.1 gt_differencecover_completelargelcpvalues@Base 1.5.1 gt_differencecover_delete@Base 1.5.1 gt_differencecover_is_empty@Base 1.5.1 gt_differencecover_new@Base 1.5.1 gt_differencecover_prepare_sample@Base 1.5.1 gt_differencecover_requiredspace@Base 1.5.1 gt_differencecover_samplesize@Base 1.5.1 gt_differencecover_set_sssp_lcp@Base 1.5.1 gt_differencecover_sortunsortedbucket@Base 1.5.1 gt_direct_qsort_ulong@Base 1.5.1 gt_disc_distri_add@Base 1.5.1 gt_disc_distri_add_multi@Base 1.5.1 gt_disc_distri_delete@Base 1.5.1 gt_disc_distri_foreach@Base 1.5.1 gt_disc_distri_foreach_in_reverse_order@Base 1.5.1 gt_disc_distri_get@Base 1.5.1 gt_disc_distri_new@Base 1.5.1 gt_disc_distri_show@Base 1.5.1 gt_disc_distri_unit_test@Base 1.5.1 gt_distanceofshortstringsbytearray@Base 1.5.1 gt_distanceofshortstringsencseq@Base 1.5.1 gt_divergence@Base 1.5.1 gt_dlist_add@Base 1.5.1 gt_dlist_delete@Base 1.5.1 gt_dlist_example@Base 1.5.1 gt_dlist_find@Base 1.5.1 gt_dlist_first@Base 1.5.1 gt_dlist_last@Base 1.5.1 gt_dlist_new@Base 1.5.1 gt_dlist_new_with_data@Base 1.5.1 gt_dlist_remove@Base 1.5.1 gt_dlist_size@Base 1.5.1 gt_dlist_unit_test@Base 1.5.1 gt_dlistelem_get_data@Base 1.5.1 gt_dlistelem_next@Base 1.5.1 gt_dlistelem_previous@Base 1.5.1 gt_dot_out_stream_new@Base 1.5.1 gt_dot_visitor_class@Base 1.5.1 gt_dot_visitor_finalize@Base 1.5.1 gt_dot_visitor_new@Base 1.5.1 gt_double_compare@Base 1.5.1 gt_double_equals_double@Base 1.5.1 gt_double_equals_one@Base 1.5.1 gt_double_larger_double@Base 1.5.1 gt_double_smaller_double@Base 1.5.1 gt_drawing_range_compare@Base 1.5.1 gt_drawing_range_contains@Base 1.5.1 gt_drawing_range_length@Base 1.5.1 gt_drawing_range_overlap@Base 1.5.1 gt_dup_feature_stream_new@Base 1.5.1 gt_dup_feature_visitor_class@Base 1.5.1 gt_dup_feature_visitor_new@Base 1.5.1 gt_dyn_bittab_bit_is_set@Base 1.5.1 gt_dyn_bittab_delete@Base 1.5.1 gt_dyn_bittab_get_first_bitnum@Base 1.5.1 gt_dyn_bittab_get_last_bitnum@Base 1.5.1 gt_dyn_bittab_get_next_bitnum@Base 1.5.1 gt_dyn_bittab_new@Base 1.5.1 gt_dyn_bittab_set_bit@Base 1.5.1 gt_dyn_bittab_unit_test@Base 1.5.1 gt_dyn_bittab_unset_bit@Base 1.5.1 gt_dynalloc@Base 1.5.1 gt_ebzopen@Base 1.5.1 gt_echodescriptionandsequence@Base 1.5.1 gt_edistmyersbitvectorAPM@Base 1.5.1 gt_editoperation_length@Base 1.5.1 gt_editoperation_set_length@Base 1.5.1 gt_editoperation_show@Base 1.5.1 gt_editoperation_type@Base 1.5.1 gt_efopen@Base 1.5.1 gt_egzopen@Base 1.5.1 gt_element_delete@Base 1.5.1 gt_element_get_node_ref@Base 1.5.1 gt_element_get_range@Base 1.5.1 gt_element_get_strand@Base 1.5.1 gt_element_get_type@Base 1.5.1 gt_element_is_marked@Base 1.5.1 gt_element_new@Base 1.5.1 gt_element_new_empty@Base 1.5.1 gt_element_ref@Base 1.5.1 gt_element_set_range@Base 1.5.1 gt_element_set_type@Base 1.5.1 gt_element_sketch@Base 1.5.1 gt_element_unit_test@Base 1.5.1 gt_elias_gamma_bitwise_decoder_delete@Base 1.5.1 gt_elias_gamma_bitwise_decoder_new@Base 1.5.1 gt_elias_gamma_bitwise_decoder_next@Base 1.5.1 gt_elias_gamma_encode@Base 1.5.1 gt_elias_gamma_unit_test@Base 1.5.1 gt_emissionmergedesa_init@Base 1.5.1 gt_emissionmergedesa_stepdeleteandinsertothersuffixes@Base 1.5.1 gt_emissionmergedesa_wrap@Base 1.5.1 gt_encdesc_decode@Base 1.5.1 gt_encdesc_delete@Base 1.5.1 gt_encdesc_encoder_delete@Base 1.5.1 gt_encdesc_encoder_encode@Base 1.5.1 gt_encdesc_encoder_get_sampling_rate@Base 1.5.1 gt_encdesc_encoder_get_timer@Base 1.5.1 gt_encdesc_encoder_new@Base 1.5.1 gt_encdesc_encoder_set_sampling_none@Base 1.5.1 gt_encdesc_encoder_set_sampling_page@Base 1.5.1 gt_encdesc_encoder_set_sampling_rate@Base 1.5.1 gt_encdesc_encoder_set_sampling_regular@Base 1.5.1 gt_encdesc_encoder_set_timer@Base 1.5.1 gt_encdesc_load@Base 1.5.1 gt_encdesc_num_of_descriptions@Base 1.5.1 gt_encdesc_sampling_is_page@Base 1.5.1 gt_encdesc_sampling_is_regular@Base 1.5.1 gt_encdesc_unit_test@Base 1.5.1 gt_encseq2fastaoutput@Base 1.5.1 gt_encseq2symbolstring@Base 1.5.1 gt_encseqSequentialsuffixarrayreader@Base 1.5.1 gt_encseq_access_type_determine@Base 1.5.1 gt_encseq_access_type_get@Base 1.5.1 gt_encseq_access_type_isviautables@Base 1.5.1 gt_encseq_access_type_list@Base 1.5.1 gt_encseq_access_type_str@Base 1.5.1 gt_encseq_accessname@Base 1.5.1 gt_encseq_accesstype_get@Base 1.5.1 gt_encseq_alphabet@Base 1.5.1 gt_encseq_alphabetcharacters@Base 1.5.1 gt_encseq_alphabetnumofchars@Base 1.5.1 gt_encseq_alphabetsymbolmap@Base 1.5.1 gt_encseq_alphabetwildcardshow@Base 1.5.1 gt_encseq_bitwise_cmp_ok@Base 1.5.1 gt_encseq_builder_add_cstr@Base 1.5.1 gt_encseq_builder_add_encoded@Base 1.5.1 gt_encseq_builder_add_encoded_own@Base 1.5.1 gt_encseq_builder_add_str@Base 1.5.1 gt_encseq_builder_build@Base 1.5.1 gt_encseq_builder_create_des_tab@Base 1.5.1 gt_encseq_builder_create_sds_tab@Base 1.5.1 gt_encseq_builder_create_ssp_tab@Base 1.5.1 gt_encseq_builder_delete@Base 1.5.1 gt_encseq_builder_disable_description_support@Base 1.5.1 gt_encseq_builder_disable_multiseq_support@Base 1.5.1 gt_encseq_builder_do_not_create_des_tab@Base 1.5.1 gt_encseq_builder_do_not_create_sds_tab@Base 1.5.1 gt_encseq_builder_do_not_create_ssp_tab@Base 1.5.1 gt_encseq_builder_enable_description_support@Base 1.5.1 gt_encseq_builder_enable_multiseq_support@Base 1.5.1 gt_encseq_builder_new@Base 1.5.1 gt_encseq_builder_reset@Base 1.5.1 gt_encseq_builder_set_logger@Base 1.5.1 gt_encseq_builder_unit_test@Base 1.5.1 gt_encseq_charcount@Base 1.5.1 gt_encseq_chardistri_mapoffset@Base 1.5.1 gt_encseq_check_comparetwosuffixes@Base 1.5.1 gt_encseq_check_consistency@Base 1.5.1 gt_encseq_check_descriptions@Base 1.5.1 gt_encseq_check_external_twobitencoding_to_file@Base 1.5.1 gt_encseq_check_markpos@Base 1.5.1 gt_encseq_check_minmax@Base 1.5.1 gt_encseq_check_specialranges@Base 1.5.1 gt_encseq_check_startpositions@Base 1.5.1 gt_encseq_col_class@Base 1.5.1 gt_encseq_col_md5_to_sequence_length@Base 1.5.1 gt_encseq_col_new@Base 1.5.1 gt_encseq_compare_pairof_different_twobitencodings@Base 1.5.1 gt_encseq_compare_pairof_twobitencodings@Base 1.5.1 gt_encseq_compare_viatwobitencoding@Base 1.5.1 gt_encseq_contains_special@Base 1.5.1 gt_encseq_create_reader_with_readmode@Base 1.5.1 gt_encseq_create_reader_with_readmode_p@Base 1.5.1 gt_encseq_delete@Base 1.5.1 gt_encseq_description@Base 1.5.1 gt_encseq_description_p@Base 1.5.1 gt_encseq_determine_size@Base 1.5.1 gt_encseq_effective_filelength@Base 1.5.1 gt_encseq_effective_filelength_p@Base 1.5.1 gt_encseq_encoder_create_des_tab@Base 1.5.1 gt_encseq_encoder_create_esq_tab@Base 1.5.1 gt_encseq_encoder_create_md5_tab@Base 1.5.1 gt_encseq_encoder_create_ois_tab@Base 1.5.1 gt_encseq_encoder_create_sds_tab@Base 1.5.1 gt_encseq_encoder_create_ssp_tab@Base 1.5.1 gt_encseq_encoder_delete@Base 1.5.1 gt_encseq_encoder_des_tab_requested@Base 1.5.1 gt_encseq_encoder_disable_description_support@Base 1.5.1 gt_encseq_encoder_disable_esq_header@Base 1.5.1 gt_encseq_encoder_disable_lossless_support@Base 1.5.1 gt_encseq_encoder_disable_md5_support@Base 1.5.1 gt_encseq_encoder_disable_multiseq_support@Base 1.5.1 gt_encseq_encoder_do_not_create_des_tab@Base 1.5.1 gt_encseq_encoder_do_not_create_esq_tab@Base 1.5.1 gt_encseq_encoder_do_not_create_md5_tab@Base 1.5.1 gt_encseq_encoder_do_not_create_ois_tab@Base 1.5.1 gt_encseq_encoder_do_not_create_sds_tab@Base 1.5.1 gt_encseq_encoder_do_not_create_ssp_tab@Base 1.5.1 gt_encseq_encoder_enable_description_support@Base 1.5.1 gt_encseq_encoder_enable_lossless_support@Base 1.5.1 gt_encseq_encoder_enable_md5_support@Base 1.5.1 gt_encseq_encoder_enable_multiseq_support@Base 1.5.1 gt_encseq_encoder_encode@Base 1.5.1 gt_encseq_encoder_get_timer@Base 1.5.1 gt_encseq_encoder_is_input_dna@Base 1.5.1 gt_encseq_encoder_is_input_preencoded@Base 1.5.1 gt_encseq_encoder_is_input_protein@Base 1.5.1 gt_encseq_encoder_md5_tab_requested@Base 1.5.1 gt_encseq_encoder_new@Base 1.5.1 gt_encseq_encoder_new_from_options@Base 1.5.1 gt_encseq_encoder_representation@Base 1.5.1 gt_encseq_encoder_sds_tab_requested@Base 1.5.1 gt_encseq_encoder_set_input_dna@Base 1.5.1 gt_encseq_encoder_set_input_preencoded@Base 1.5.1 gt_encseq_encoder_set_input_protein@Base 1.5.1 gt_encseq_encoder_set_logger@Base 1.5.1 gt_encseq_encoder_set_timer@Base 1.5.1 gt_encseq_encoder_ssp_tab_requested@Base 1.5.1 gt_encseq_encoder_symbolmap_file@Base 1.5.1 gt_encseq_encoder_use_representation@Base 1.5.1 gt_encseq_encoder_use_symbolmap_file@Base 1.5.1 gt_encseq_equallength@Base 1.5.1 gt_encseq_equallength_write_twobitencoding_to_file@Base 1.5.1 gt_encseq_exceptioncharacters@Base 1.5.1 gt_encseq_exceptionranges@Base 1.5.1 gt_encseq_extract2bitencvector@Base 1.5.1 gt_encseq_extract2bitencwithtwobitencodingstoppos@Base 1.5.1 gt_encseq_extract_decoded@Base 1.5.1 gt_encseq_extract_decoded_p@Base 1.5.1 gt_encseq_extract_encoded@Base 1.5.1 gt_encseq_extract_encoded_p@Base 1.5.1 gt_encseq_extractprefixcode@Base 1.5.1 gt_encseq_faststream@Base 1.5.1 gt_encseq_filenames@Base 1.5.1 gt_encseq_filenum@Base 1.5.1 gt_encseq_filenum_first_seqnum@Base 1.5.1 gt_encseq_filenum_p@Base 1.5.1 gt_encseq_filestartpos@Base 1.5.1 gt_encseq_filestartpos_p@Base 1.5.1 gt_encseq_gc_count@Base 1.5.1 gt_encseq_gc_unit_test@Base 1.5.1 gt_encseq_generic_write_twobitencoding_to_file@Base 1.5.1 gt_encseq_get_decoded_char@Base 1.5.1 gt_encseq_get_decoded_char_p@Base 1.5.1 gt_encseq_get_encoded_char@Base 1.5.1 gt_encseq_get_encoded_char_nospecial@Base 1.5.1 gt_encseq_get_encoded_char_p@Base 1.5.1 gt_encseq_get_md5_tab@Base 1.5.1 gt_encseq_get_rel_gc@Base 1.5.1 gt_encseq_has_description_support@Base 1.5.1 gt_encseq_has_md5_support@Base 1.5.1 gt_encseq_has_multiseq_support@Base 1.5.1 gt_encseq_has_specialranges@Base 1.5.1 gt_encseq_has_twobitencoding@Base 1.5.1 gt_encseq_has_twobitencoding_stoppos_support@Base 1.5.1 gt_encseq_has_wildcardranges@Base 1.5.1 gt_encseq_indexname@Base 1.5.1 gt_encseq_is_64_bit@Base 1.5.1 gt_encseq_is_mirrored@Base 1.5.1 gt_encseq_lcpofdifferenttwobitencodings@Base 1.5.1 gt_encseq_lengthoflongestnonspecial@Base 1.5.1 gt_encseq_lengthofspecialprefix@Base 1.5.1 gt_encseq_lengthofspecialsuffix@Base 1.5.1 gt_encseq_lengthofwildcardprefix@Base 1.5.1 gt_encseq_lengthofwildcardsuffix@Base 1.5.1 gt_encseq_loader_delete@Base 1.5.1 gt_encseq_loader_des_tab_required@Base 1.5.1 gt_encseq_loader_disable_autosupport@Base 1.5.1 gt_encseq_loader_do_not_mirror@Base 1.5.1 gt_encseq_loader_do_not_require_des_tab@Base 1.5.1 gt_encseq_loader_do_not_require_esq_tab@Base 1.5.1 gt_encseq_loader_do_not_require_md5_tab@Base 1.5.1 gt_encseq_loader_do_not_require_ois_tab@Base 1.5.1 gt_encseq_loader_do_not_require_sds_tab@Base 1.5.1 gt_encseq_loader_do_not_require_ssp_tab@Base 1.5.1 gt_encseq_loader_drop_description_support@Base 1.5.1 gt_encseq_loader_drop_lossless_support@Base 1.5.1 gt_encseq_loader_drop_md5_support@Base 1.5.1 gt_encseq_loader_drop_multiseq_support@Base 1.5.1 gt_encseq_loader_enable_autosupport@Base 1.5.1 gt_encseq_loader_load@Base 1.5.1 gt_encseq_loader_md5_tab_required@Base 1.5.1 gt_encseq_loader_mirror@Base 1.5.1 gt_encseq_loader_new@Base 1.5.1 gt_encseq_loader_new_from_options@Base 1.5.1 gt_encseq_loader_ois_tab_required@Base 1.5.1 gt_encseq_loader_require_des_tab@Base 1.5.1 gt_encseq_loader_require_description_support@Base 1.5.1 gt_encseq_loader_require_esq_tab@Base 1.5.1 gt_encseq_loader_require_lossless_support@Base 1.5.1 gt_encseq_loader_require_md5_support@Base 1.5.1 gt_encseq_loader_require_md5_tab@Base 1.5.1 gt_encseq_loader_require_multiseq_support@Base 1.5.1 gt_encseq_loader_require_ois_tab@Base 1.5.1 gt_encseq_loader_require_sds_tab@Base 1.5.1 gt_encseq_loader_require_ssp_tab@Base 1.5.1 gt_encseq_loader_sds_tab_required@Base 1.5.1 gt_encseq_loader_set_logger@Base 1.5.1 gt_encseq_loader_ssp_tab_required@Base 1.5.1 gt_encseq_max_seq_length@Base 1.5.1 gt_encseq_max_subalpha_size@Base 1.5.1 gt_encseq_metadata_accesstype@Base 1.5.1 gt_encseq_metadata_alphabet@Base 1.5.1 gt_encseq_metadata_delete@Base 1.5.1 gt_encseq_metadata_has_custom_alphabet@Base 1.5.1 gt_encseq_metadata_is64bit@Base 1.5.1 gt_encseq_metadata_length_of_alphadef@Base 1.5.1 gt_encseq_metadata_length_of_filenames@Base 1.5.1 gt_encseq_metadata_max_seq_length@Base 1.5.1 gt_encseq_metadata_min_seq_length@Base 1.5.1 gt_encseq_metadata_new@Base 1.5.1 gt_encseq_metadata_num_of_files@Base 1.5.1 gt_encseq_metadata_num_of_sequences@Base 1.5.1 gt_encseq_metadata_specialcharinfo@Base 1.5.1 gt_encseq_metadata_total_length@Base 1.5.1 gt_encseq_metadata_version@Base 1.5.1 gt_encseq_min_seq_length@Base 1.5.1 gt_encseq_mirror@Base 1.5.1 gt_encseq_num_of_files@Base 1.5.1 gt_encseq_num_of_files_p@Base 1.5.1 gt_encseq_num_of_sequences@Base 1.5.1 gt_encseq_num_of_sequences_p@Base 1.5.1 gt_encseq_options_add_readmode_option@Base 1.5.1 gt_encseq_options_db_option@Base 1.5.1 gt_encseq_options_db_value@Base 1.5.1 gt_encseq_options_delete@Base 1.5.1 gt_encseq_options_des_option@Base 1.5.1 gt_encseq_options_des_value@Base 1.5.1 gt_encseq_options_dir_option@Base 1.5.1 gt_encseq_options_dna_option@Base 1.5.1 gt_encseq_options_dna_value@Base 1.5.1 gt_encseq_options_indexname_option@Base 1.5.1 gt_encseq_options_indexname_value@Base 1.5.1 gt_encseq_options_lossless_option@Base 1.5.1 gt_encseq_options_lossless_value@Base 1.5.1 gt_encseq_options_md5_option@Base 1.5.1 gt_encseq_options_md5_value@Base 1.5.1 gt_encseq_options_mirrored_option@Base 1.5.1 gt_encseq_options_mirrored_value@Base 1.5.1 gt_encseq_options_plain_option@Base 1.5.1 gt_encseq_options_plain_value@Base 1.5.1 gt_encseq_options_protein_option@Base 1.5.1 gt_encseq_options_protein_value@Base 1.5.1 gt_encseq_options_register_encoding@Base 1.5.1 gt_encseq_options_register_loading@Base 1.5.1 gt_encseq_options_sat_option@Base 1.5.1 gt_encseq_options_sat_value@Base 1.5.1 gt_encseq_options_sds_option@Base 1.5.1 gt_encseq_options_sds_value@Base 1.5.1 gt_encseq_options_smap_option@Base 1.5.1 gt_encseq_options_smap_value@Base 1.5.1 gt_encseq_options_ssp_option@Base 1.5.1 gt_encseq_options_ssp_value@Base 1.5.1 gt_encseq_options_tis_option@Base 1.5.1 gt_encseq_options_tis_value@Base 1.5.1 gt_encseq_pairbitsum@Base 1.5.1 gt_encseq_plainseq2bytecode@Base 1.5.1 gt_encseq_position_is_separator@Base 1.5.1 gt_encseq_reader_delete@Base 1.5.1 gt_encseq_reader_next_decoded_char@Base 1.5.1 gt_encseq_reader_next_encoded_char@Base 1.5.1 gt_encseq_reader_reinit_with_readmode@Base 1.5.1 gt_encseq_realspecialranges@Base 1.5.1 gt_encseq_realwildcardranges@Base 1.5.1 gt_encseq_ref@Base 1.5.1 gt_encseq_relpos_extract2bitencvector@Base 1.5.1 gt_encseq_relpos_seqnum_check@Base 1.5.1 gt_encseq_sep2seqnum@Base 1.5.1 gt_encseq_seppos2ssptab@Base 1.5.1 gt_encseq_seqlength@Base 1.5.1 gt_encseq_seqlength_p@Base 1.5.1 gt_encseq_seqnum@Base 1.5.1 gt_encseq_seqnum_p@Base 1.5.1 gt_encseq_seqnum_ssptab@Base 1.5.1 gt_encseq_seqstartpos@Base 1.5.1 gt_encseq_seqstartpos_p@Base 1.5.1 gt_encseq_sequence2bytecode@Base 1.5.1 gt_encseq_show_features@Base 1.5.1 gt_encseq_showatstartpos@Base 1.5.1 gt_encseq_showatstartposwithdepth@Base 1.5.1 gt_encseq_sizeofrep@Base 1.5.1 gt_encseq_sizeofstructure@Base 1.5.1 gt_encseq_specialcharacters@Base 1.5.1 gt_encseq_specialranges@Base 1.5.1 gt_encseq_total_length@Base 1.5.1 gt_encseq_total_length_p@Base 1.5.1 gt_encseq_twobitencoding_export@Base 1.5.1 gt_encseq_twobitencoding_mapoffset@Base 1.5.1 gt_encseq_twobitencoding_strcmp@Base 1.5.1 gt_encseq_unmirror@Base 1.5.1 gt_encseq_version@Base 1.5.1 gt_encseq_wildcardranges@Base 1.5.1 gt_encseq_wildcards@Base 1.5.1 gt_encseqtable2sequenceoffsets@Base 1.5.1 gt_enumeratemaxpairs@Base 1.5.1 gt_eof_node_class@Base 1.5.1 gt_eof_node_new@Base 1.5.1 gt_eops_equal_referencelength@Base 1.5.1 gt_errfind@Base 1.5.1 gt_error_delete@Base 1.5.1 gt_error_get@Base 1.5.1 gt_error_get_progname@Base 1.5.1 gt_error_is_set@Base 1.5.1 gt_error_new@Base 1.5.1 gt_error_set@Base 1.5.1 gt_error_set_nonvariadic@Base 1.5.1 gt_error_set_progname@Base 1.5.1 gt_error_unset@Base 1.5.1 gt_error_vset@Base 1.5.1 gt_esa2shulengthqueryfiles@Base 1.5.1 gt_esa_bottomup@Base 1.5.1 gt_esa_bottomup_RAM@Base 1.5.1 gt_esa_lcpitvs_visitor_new@Base 1.5.1 gt_esa_spmitvs_visitor_class@Base 1.5.1 gt_esa_spmitvs_visitor_delete@Base 1.5.1 gt_esa_spmitvs_visitor_new@Base 1.5.1 gt_esa_spmitvs_visitor_print_results@Base 1.5.1 gt_esa_visitor_cast@Base 1.5.1 gt_esa_visitor_class_new@Base 1.5.1 gt_esa_visitor_create@Base 1.5.1 gt_esa_visitor_delete@Base 1.5.1 gt_esa_visitor_info_delete@Base 1.5.1 gt_esa_visitor_info_new@Base 1.5.1 gt_esa_visitor_visit_branching_edge@Base 1.5.1 gt_esa_visitor_visit_lcp_interval@Base 1.5.1 gt_esa_visitor_visit_leaf_edge@Base 1.5.1 gt_estimateSegmentSize@Base 1.5.1 gt_evaluator_add_actual@Base 1.5.1 gt_evaluator_add_predicted@Base 1.5.1 gt_evaluator_add_true@Base 1.5.1 gt_evaluator_delete@Base 1.5.1 gt_evaluator_get_sensitivity@Base 1.5.1 gt_evaluator_get_specificity@Base 1.5.1 gt_evaluator_new@Base 1.5.1 gt_evaluator_reset@Base 1.5.1 gt_evaluator_show_sensitivity@Base 1.5.1 gt_evaluator_show_specificity@Base 1.5.1 gt_evaluator_unit_test@Base 1.5.1 gt_evalxdroparbitscoresextend@Base 1.5.1 gt_example_a_class@Base 1.5.1 gt_example_a_new@Base 1.5.1 gt_example_b_class@Base 1.5.1 gt_example_b_new@Base 1.5.1 gt_example_create@Base 1.5.1 gt_example_delete@Base 1.5.1 gt_example_run@Base 1.5.1 gt_extract_feature_sequence@Base 1.5.1 gt_extract_feature_stream_new@Base 1.5.1 gt_extract_feature_visitor_class@Base 1.5.1 gt_extract_feature_visitor_new@Base 1.5.1 gt_extractkeysfromdesfile@Base 1.5.1 gt_extractkeysfromfastafile@Base 1.5.1 gt_extractkeysfromfastaindex@Base 1.5.1 gt_fa_bzclose@Base 1.5.1 gt_fa_bzopen_func@Base 1.5.1 gt_fa_check_fptr_leak@Base 1.5.1 gt_fa_check_mmap_leak@Base 1.5.1 gt_fa_clean@Base 1.5.1 gt_fa_enable_global_spacepeak@Base 1.5.1 gt_fa_fclose@Base 1.5.1 gt_fa_fopen_func@Base 1.5.1 gt_fa_fopen_with_suffix_func@Base 1.5.1 gt_fa_get_space_current@Base 1.5.1 gt_fa_get_space_peak@Base 1.5.1 gt_fa_gzclose@Base 1.5.1 gt_fa_gzopen_func@Base 1.5.1 gt_fa_init@Base 1.5.1 gt_fa_lock_exclusive@Base 1.5.1 gt_fa_lock_shared@Base 1.5.1 gt_fa_mmap_check_size_with_suffix@Base 1.5.1 gt_fa_mmap_generic_fd_func@Base 1.5.1 gt_fa_mmap_read_func@Base 1.5.1 gt_fa_mmap_read_func_range@Base 1.5.1 gt_fa_mmap_read_with_suffix_func@Base 1.5.1 gt_fa_mmap_write_func@Base 1.5.1 gt_fa_mmap_write_func_range@Base 1.5.1 gt_fa_show_space_peak@Base 1.5.1 gt_fa_unlock@Base 1.5.1 gt_fa_xbzclose@Base 1.5.1 gt_fa_xbzopen_func@Base 1.5.1 gt_fa_xfclose@Base 1.5.1 gt_fa_xfopen_func@Base 1.5.1 gt_fa_xgzclose@Base 1.5.1 gt_fa_xgzopen_func@Base 1.5.1 gt_fa_xmmap_read_func@Base 1.5.1 gt_fa_xmmap_read_func_range@Base 1.5.1 gt_fa_xmmap_write_func@Base 1.5.1 gt_fa_xmmap_write_func_range@Base 1.5.1 gt_fa_xmunmap@Base 1.5.1 gt_fasta_header_iterator_class@Base 1.5.1 gt_fasta_header_iterator_new@Base 1.5.1 gt_fasta_reader_cast@Base 1.5.1 gt_fasta_reader_create@Base 1.5.1 gt_fasta_reader_delete@Base 1.5.1 gt_fasta_reader_fsm_class@Base 1.5.1 gt_fasta_reader_fsm_new@Base 1.5.1 gt_fasta_reader_rec_class@Base 1.5.1 gt_fasta_reader_rec_new@Base 1.5.1 gt_fasta_reader_run@Base 1.5.1 gt_fasta_reader_seqit_class@Base 1.5.1 gt_fasta_reader_seqit_new@Base 1.5.1 gt_fasta_show_entry@Base 1.5.1 gt_fasta_show_entry_with_suffix@Base 1.5.1 gt_fastq_show_entry@Base 1.5.1 gt_feature_index_add_feature_node@Base 1.5.1 gt_feature_index_add_gff3file@Base 1.5.1 gt_feature_index_add_region_node@Base 1.5.1 gt_feature_index_cast@Base 1.5.1 gt_feature_index_class_new@Base 1.5.1 gt_feature_index_create@Base 1.5.1 gt_feature_index_delete@Base 1.5.1 gt_feature_index_get_features_for_range@Base 1.5.1 gt_feature_index_get_features_for_seqid@Base 1.5.1 gt_feature_index_get_first_seqid@Base 1.5.1 gt_feature_index_get_range_for_seqid@Base 1.5.1 gt_feature_index_get_seqids@Base 1.5.1 gt_feature_index_gfflike_add_feature_node@Base 1.5.1 gt_feature_index_gfflike_add_region_node@Base 1.5.1 gt_feature_index_gfflike_delete@Base 1.5.1 gt_feature_index_gfflike_get_all_features@Base 1.5.1 gt_feature_index_gfflike_get_features_for_range@Base 1.5.1 gt_feature_index_gfflike_get_features_for_seqid@Base 1.5.1 gt_feature_index_gfflike_get_first_seqid@Base 1.5.1 gt_feature_index_gfflike_get_range_for_seqid@Base 1.5.1 gt_feature_index_gfflike_get_seqids@Base 1.5.1 gt_feature_index_gfflike_has_seqid@Base 1.5.1 gt_feature_index_gfflike_remove_node@Base 1.5.1 gt_feature_index_has_seqid@Base 1.5.1 gt_feature_index_memory_add_feature_node@Base 1.5.1 gt_feature_index_memory_add_region_node@Base 1.5.1 gt_feature_index_memory_class@Base 1.5.1 gt_feature_index_memory_delete@Base 1.5.1 gt_feature_index_memory_get_features_for_range@Base 1.5.1 gt_feature_index_memory_get_features_for_seqid@Base 1.5.1 gt_feature_index_memory_get_first_seqid@Base 1.5.1 gt_feature_index_memory_get_node_by_ptr@Base 1.5.1 gt_feature_index_memory_get_range_for_seqid@Base 1.5.1 gt_feature_index_memory_get_seqids@Base 1.5.1 gt_feature_index_memory_has_seqid@Base 1.5.1 gt_feature_index_memory_new@Base 1.5.1 gt_feature_index_memory_remove_node@Base 1.5.1 gt_feature_index_memory_unit_test@Base 1.5.1 gt_feature_index_ref@Base 1.5.1 gt_feature_index_remove_node@Base 1.5.1 gt_feature_index_save@Base 1.5.1 gt_feature_index_unit_test@Base 1.5.1 gt_feature_info_add@Base 1.5.1 gt_feature_info_add_pseudo_parent@Base 1.5.1 gt_feature_info_delete@Base 1.5.1 gt_feature_info_find_root@Base 1.5.1 gt_feature_info_get@Base 1.5.1 gt_feature_info_get_pseudo_parent@Base 1.5.1 gt_feature_info_new@Base 1.5.1 gt_feature_info_replace_pseudo_parent@Base 1.5.1 gt_feature_info_reset@Base 1.5.1 gt_feature_node_add_attribute@Base 1.5.1 gt_feature_node_add_child@Base 1.5.1 gt_feature_node_average_splice_site_prob@Base 1.5.1 gt_feature_node_class@Base 1.5.1 gt_feature_node_clone@Base 1.5.1 gt_feature_node_contains_marked@Base 1.5.1 gt_feature_node_determine_transcripttypes@Base 1.5.1 gt_feature_node_direct_children_do_not_overlap@Base 1.5.1 gt_feature_node_direct_children_do_not_overlap_generic@Base 1.5.1 gt_feature_node_direct_children_do_not_overlap_st@Base 1.5.1 gt_feature_node_foreach_attribute@Base 1.5.1 gt_feature_node_get_attribute@Base 1.5.1 gt_feature_node_get_attribute_list@Base 1.5.1 gt_feature_node_get_exons@Base 1.5.1 gt_feature_node_get_multi_representative@Base 1.5.1 gt_feature_node_get_phase@Base 1.5.1 gt_feature_node_get_score@Base 1.5.1 gt_feature_node_get_source@Base 1.5.1 gt_feature_node_get_strand@Base 1.5.1 gt_feature_node_get_transcriptfeaturetype@Base 1.5.1 gt_feature_node_get_type@Base 1.5.1 gt_feature_node_has_CDS@Base 1.5.1 gt_feature_node_has_children@Base 1.5.1 gt_feature_node_has_source@Base 1.5.1 gt_feature_node_has_splice_site@Base 1.5.1 gt_feature_node_has_type@Base 1.5.1 gt_feature_node_is_marked@Base 1.5.1 gt_feature_node_is_multi@Base 1.5.1 gt_feature_node_is_pseudo@Base 1.5.1 gt_feature_node_is_similar@Base 1.5.1 gt_feature_node_is_tree@Base 1.5.1 gt_feature_node_iterator_delete@Base 1.5.1 gt_feature_node_iterator_example@Base 1.5.1 gt_feature_node_iterator_new@Base 1.5.1 gt_feature_node_iterator_new_direct@Base 1.5.1 gt_feature_node_iterator_next@Base 1.5.1 gt_feature_node_make_multi_representative@Base 1.5.1 gt_feature_node_mark@Base 1.5.1 gt_feature_node_new@Base 1.5.1 gt_feature_node_new_pseudo@Base 1.5.1 gt_feature_node_new_pseudo_template@Base 1.5.1 gt_feature_node_new_standard_gene@Base 1.5.1 gt_feature_node_number_of_children@Base 1.5.1 gt_feature_node_number_of_children_of_type@Base 1.5.1 gt_feature_node_observer_delete@Base 1.5.1 gt_feature_node_observer_new@Base 1.5.1 gt_feature_node_observer_ref@Base 1.5.1 gt_feature_node_overlaps_nodes@Base 1.5.1 gt_feature_node_overlaps_nodes_mark@Base 1.5.1 gt_feature_node_remove_attribute@Base 1.5.1 gt_feature_node_remove_leaf@Base 1.5.1 gt_feature_node_score_is_defined@Base 1.5.1 gt_feature_node_set_attribute@Base 1.5.1 gt_feature_node_set_end@Base 1.5.1 gt_feature_node_set_multi_representative@Base 1.5.1 gt_feature_node_set_observer@Base 1.5.1 gt_feature_node_set_phase@Base 1.5.1 gt_feature_node_set_score@Base 1.5.1 gt_feature_node_set_source@Base 1.5.1 gt_feature_node_set_strand@Base 1.5.1 gt_feature_node_set_type@Base 1.5.1 gt_feature_node_traverse_children@Base 1.5.1 gt_feature_node_traverse_children_top@Base 1.5.1 gt_feature_node_traverse_direct_children@Base 1.5.1 gt_feature_node_unit_test@Base 1.5.1 gt_feature_node_unmark@Base 1.5.1 gt_feature_node_unset_multi@Base 1.5.1 gt_feature_node_unset_observer@Base 1.5.1 gt_feature_node_unset_score@Base 1.5.1 gt_feature_stream_new@Base 1.5.1 gt_feature_visitor_class@Base 1.5.1 gt_feature_visitor_new@Base 1.5.1 gt_file_basename_length@Base 1.5.1 gt_file_delete@Base 1.5.1 gt_file_delete_without_handle@Base 1.5.1 gt_file_dirname@Base 1.5.1 gt_file_estimate_size@Base 1.5.1 gt_file_exists@Base 1.5.1 gt_file_exists_with_suffix@Base 1.5.1 gt_file_find_exec_in_path@Base 1.5.1 gt_file_find_in_env@Base 1.5.1 gt_file_find_in_path@Base 1.5.1 gt_file_is_newer@Base 1.5.1 gt_file_mode@Base 1.5.1 gt_file_mode_determine@Base 1.5.1 gt_file_mode_suffix@Base 1.5.1 gt_file_new@Base 1.5.1 gt_file_new_from_fileptr@Base 1.5.1 gt_file_number_of_lines@Base 1.5.1 gt_file_open@Base 1.5.1 gt_file_size@Base 1.5.1 gt_file_size_with_suffix@Base 1.5.1 gt_file_suffix@Base 1.5.1 gt_file_unget_char@Base 1.5.1 gt_file_xfgetc@Base 1.5.1 gt_file_xfputc@Base 1.5.1 gt_file_xfputs@Base 1.5.1 gt_file_xopen@Base 1.5.1 gt_file_xopen_file_mode@Base 1.5.1 gt_file_xprintf@Base 1.5.1 gt_file_xread@Base 1.5.1 gt_file_xrewind@Base 1.5.1 gt_file_xwrite@Base 1.5.1 gt_files_estimate_total_size@Base 1.5.1 gt_files_guess_if_protein_sequences@Base 1.5.1 gt_fillfmmapspecstartptr@Base 1.5.1 gt_filllargestchartable@Base 1.5.1 gt_fillrankbounds@Base 1.5.1 gt_fillspecialranklist@Base 1.5.1 gt_findsubquerygmatchforward@Base 1.5.1 gt_firstcode_runkmerscan@Base 1.5.1 gt_firstcodes_accum_runkmerscan@Base 1.5.1 gt_firstcodes_accumulatecounts_merge@Base 1.5.1 gt_firstcodes_binsearchcache_check@Base 1.5.1 gt_firstcodes_binsearchcache_delete@Base 1.5.1 gt_firstcodes_binsearchcache_new@Base 1.5.1 gt_firstcodes_binsearchcache_set_index_code@Base 1.5.1 gt_firstcodes_binsearchcache_width@Base 1.5.1 gt_firstcodes_countocc_delete@Base 1.5.1 gt_firstcodes_countocc_setnull@Base 1.5.1 gt_firstcodes_find_accu@Base 1.5.1 gt_firstcodes_find_insert@Base 1.5.1 gt_firstcodes_findfirstsamplelarger@Base 1.5.1 gt_firstcodes_get_leftborder@Base 1.5.1 gt_firstcodes_get_sample@Base 1.5.1 gt_firstcodes_insert_runkmerscan@Base 1.5.1 gt_firstcodes_kmerscan@Base 1.5.1 gt_firstcodes_kmerscan_eqlen@Base 1.5.1 gt_firstcodes_leftborder_address@Base 1.5.1 gt_firstcodes_leftborder_entries@Base 1.5.1 gt_firstcodes_leftborder_remap@Base 1.5.1 gt_firstcodes_numofsamples@Base 1.5.1 gt_firstcodes_outfilenameleftborder@Base 1.5.1 gt_firstcodes_partialsums@Base 1.5.1 gt_firstcodes_remdups@Base 1.5.1 gt_firstcodes_sample2full@Base 1.5.1 gt_firstcodes_samples_delete@Base 1.5.1 gt_firstcodes_spacelog_add@Base 1.5.1 gt_firstcodes_spacelog_delete@Base 1.5.1 gt_firstcodes_spacelog_new@Base 1.5.1 gt_firstcodes_spacelog_peak@Base 1.5.1 gt_firstcodes_spacelog_showentries@Base 1.5.1 gt_firstcodes_spacelog_start_diff@Base 1.5.1 gt_firstcodes_spacelog_stop_diff@Base 1.5.1 gt_firstcodes_spacelog_total@Base 1.5.1 gt_firstcodes_spacelog_workspace@Base 1.5.1 gt_firstcodes_tab_delete@Base 1.5.1 gt_flushfmindex2file@Base 1.5.1 gt_fmfindtextpos@Base 1.5.1 gt_fmindex_dfstraverse@Base 1.5.1 gt_fmindexexists@Base 1.5.1 gt_format_ruler_label@Base 1.5.1 gt_forwardprefixmatch@Base 1.5.1 gt_fprintfencseq@Base 1.5.1 gt_freeBwtSeqpositionextractor@Base 1.5.1 gt_freeEnumpatterniterator@Base 1.5.1 gt_freeLcpvalueiterator@Base 1.5.1 gt_freeLimdfsresources@Base 1.5.1 gt_freeMyersonlineresources@Base 1.5.1 gt_freeSWdpresource@Base 1.5.1 gt_freeSequentialsuffixarrayreader@Base 1.5.1 gt_free_func@Base 1.5.1 gt_free_mem@Base 1.5.1 gt_freebucketenumerator@Base 1.5.1 gt_freefmindex@Base 1.5.1 gt_freestorematch@Base 1.5.1 gt_freesuffixarray@Base 1.5.1 gt_fromitv2sortedmatchpositions@Base 1.5.1 gt_fromkmercode2string@Base 1.5.1 gt_frompos2rank@Base 1.5.1 gt_fromrank2pos@Base 1.5.1 gt_frontresource_delete@Base 1.5.1 gt_frontresource_new@Base 1.5.1 gt_gc_content_show@Base 1.5.1 gt_genome_node_accept@Base 1.5.1 gt_genome_node_add_user_data@Base 1.5.1 gt_genome_node_cast@Base 1.5.1 gt_genome_node_change_seqid@Base 1.5.1 gt_genome_node_class_new@Base 1.5.1 gt_genome_node_cmp@Base 1.5.1 gt_genome_node_compare@Base 1.5.1 gt_genome_node_compare_delta@Base 1.5.1 gt_genome_node_compare_with_data@Base 1.5.1 gt_genome_node_create@Base 1.5.1 gt_genome_node_delete@Base 1.5.1 gt_genome_node_get_end@Base 1.5.1 gt_genome_node_get_filename@Base 1.5.1 gt_genome_node_get_idstr@Base 1.5.1 gt_genome_node_get_length@Base 1.5.1 gt_genome_node_get_line_number@Base 1.5.1 gt_genome_node_get_range@Base 1.5.1 gt_genome_node_get_seqid@Base 1.5.1 gt_genome_node_get_start@Base 1.5.1 gt_genome_node_get_user_data@Base 1.5.1 gt_genome_node_ref@Base 1.5.1 gt_genome_node_release_user_data@Base 1.5.1 gt_genome_node_set_origin@Base 1.5.1 gt_genome_node_set_range@Base 1.5.1 gt_genome_node_try_cast@Base 1.5.1 gt_genome_node_unit_test@Base 1.5.1 gt_genome_nodes_are_equal_region_nodes@Base 1.5.1 gt_genome_nodes_are_sorted@Base 1.5.1 gt_genome_nodes_show@Base 1.5.1 gt_genome_nodes_sort@Base 1.5.1 gt_genome_nodes_sort_stable@Base 1.5.1 gt_genomediff_calculate_div_from_avg@Base 1.5.1 gt_genomediff_kr_calc@Base 1.5.1 gt_genomediff_shulen_sum@Base 1.5.1 gt_get_gtdata_path@Base 1.5.1 gt_get_ln_n_fac@Base 1.5.1 gt_get_password@Base 1.5.1 gt_getargmodekeywords@Base 1.5.1 gt_getnexttwobitencodingstoppos@Base 1.5.1 gt_getsetargmodekeywords@Base 1.5.1 gt_gff3_escape@Base 1.5.1 gt_gff3_escaping_unit_test@Base 1.5.1 gt_gff3_in_stream_check_id_attributes@Base 1.5.1 gt_gff3_in_stream_class@Base 1.5.1 gt_gff3_in_stream_disable_add_ids@Base 1.5.1 gt_gff3_in_stream_enable_strict_mode@Base 1.5.1 gt_gff3_in_stream_enable_tidy_mode@Base 1.5.1 gt_gff3_in_stream_fix_region_boundaries@Base 1.5.1 gt_gff3_in_stream_get_used_types@Base 1.5.1 gt_gff3_in_stream_new_sorted@Base 1.5.1 gt_gff3_in_stream_new_unsorted@Base 1.5.1 gt_gff3_in_stream_plain_check_id_attributes@Base 1.5.1 gt_gff3_in_stream_plain_check_region_boundaries@Base 1.5.1 gt_gff3_in_stream_plain_class@Base 1.5.1 gt_gff3_in_stream_plain_do_not_check_region_boundaries@Base 1.5.1 gt_gff3_in_stream_plain_enable_strict_mode@Base 1.5.1 gt_gff3_in_stream_plain_enable_tidy_mode@Base 1.5.1 gt_gff3_in_stream_plain_get_used_types@Base 1.5.1 gt_gff3_in_stream_plain_new_sorted@Base 1.5.1 gt_gff3_in_stream_plain_new_unsorted@Base 1.5.1 gt_gff3_in_stream_plain_set_offset@Base 1.5.1 gt_gff3_in_stream_plain_set_offsetfile@Base 1.5.1 gt_gff3_in_stream_plain_set_type_checker@Base 1.5.1 gt_gff3_in_stream_plain_show_progress_bar@Base 1.5.1 gt_gff3_in_stream_set_offset@Base 1.5.1 gt_gff3_in_stream_set_offsetfile@Base 1.5.1 gt_gff3_in_stream_set_type_checker@Base 1.5.1 gt_gff3_in_stream_show_progress_bar@Base 1.5.1 gt_gff3_out_stream_class@Base 1.5.1 gt_gff3_out_stream_new@Base 1.5.1 gt_gff3_out_stream_retain_id_attributes@Base 1.5.1 gt_gff3_out_stream_set_fasta_width@Base 1.5.1 gt_gff3_output_leading@Base 1.5.1 gt_gff3_parser_build_target_str@Base 1.5.1 gt_gff3_parser_check_id_attributes@Base 1.5.1 gt_gff3_parser_check_region_boundaries@Base 1.5.1 gt_gff3_parser_delete@Base 1.5.1 gt_gff3_parser_do_not_check_region_boundaries@Base 1.5.1 gt_gff3_parser_enable_strict_mode@Base 1.5.1 gt_gff3_parser_enable_tidy_mode@Base 1.5.1 gt_gff3_parser_new@Base 1.5.1 gt_gff3_parser_parse_all_target_attributes@Base 1.5.1 gt_gff3_parser_parse_genome_nodes@Base 1.5.1 gt_gff3_parser_parse_target_attributes@Base 1.5.1 gt_gff3_parser_reset@Base 1.5.1 gt_gff3_parser_set_offset@Base 1.5.1 gt_gff3_parser_set_offsetfile@Base 1.5.1 gt_gff3_parser_set_type_checker@Base 1.5.1 gt_gff3_unescape@Base 1.5.1 gt_gff3_visitor_class@Base 1.5.1 gt_gff3_visitor_new@Base 1.5.1 gt_gff3_visitor_retain_id_attributes@Base 1.5.1 gt_gff3_visitor_set_fasta_width@Base 1.5.1 gt_globalchaining_coverage@Base 1.5.1 gt_globalchaining_max@Base 1.5.1 gt_golomb_bitwise_decoder_delete@Base 1.5.1 gt_golomb_bitwise_decoder_new@Base 1.5.1 gt_golomb_bitwise_decoder_next@Base 1.5.1 gt_golomb_delete@Base 1.5.1 gt_golomb_encode@Base 1.5.1 gt_golomb_get_m@Base 1.5.1 gt_golomb_new@Base 1.5.1 gt_golomb_unit_test@Base 1.5.1 gt_graphics_cairo_class@Base 1.5.1 gt_graphics_cairo_delete@Base 1.5.1 gt_graphics_cairo_draw_arrowhead@Base 1.5.1 gt_graphics_cairo_draw_box@Base 1.5.1 gt_graphics_cairo_draw_caret@Base 1.5.1 gt_graphics_cairo_draw_colored_text@Base 1.5.1 gt_graphics_cairo_draw_curve_data@Base 1.5.1 gt_graphics_cairo_draw_dashes@Base 1.5.1 gt_graphics_cairo_draw_horizontal_line@Base 1.5.1 gt_graphics_cairo_draw_line@Base 1.5.1 gt_graphics_cairo_draw_rectangle@Base 1.5.1 gt_graphics_cairo_draw_text@Base 1.5.1 gt_graphics_cairo_draw_text_centered@Base 1.5.1 gt_graphics_cairo_draw_text_clip@Base 1.5.1 gt_graphics_cairo_draw_text_right@Base 1.5.1 gt_graphics_cairo_draw_vertical_line@Base 1.5.1 gt_graphics_cairo_get_image_height@Base 1.5.1 gt_graphics_cairo_get_image_width@Base 1.5.1 gt_graphics_cairo_get_text_height@Base 1.5.1 gt_graphics_cairo_get_text_width@Base 1.5.1 gt_graphics_cairo_get_xmargins@Base 1.5.1 gt_graphics_cairo_get_ymargins@Base 1.5.1 gt_graphics_cairo_initialize@Base 1.5.1 gt_graphics_cairo_new@Base 1.5.1 gt_graphics_cairo_new_from_context@Base 1.5.1 gt_graphics_cairo_save_to_file@Base 1.5.1 gt_graphics_cairo_save_to_stream@Base 1.5.1 gt_graphics_cairo_set_background_color@Base 1.5.1 gt_graphics_cairo_set_font@Base 1.5.1 gt_graphics_cairo_set_margins@Base 1.5.1 gt_graphics_cast@Base 1.5.1 gt_graphics_class_new@Base 1.5.1 gt_graphics_create@Base 1.5.1 gt_graphics_delete@Base 1.5.1 gt_graphics_draw_arrowhead@Base 1.5.1 gt_graphics_draw_arrowhead_p@Base 1.5.1 gt_graphics_draw_box@Base 1.5.1 gt_graphics_draw_box_p@Base 1.5.1 gt_graphics_draw_caret@Base 1.5.1 gt_graphics_draw_caret_p@Base 1.5.1 gt_graphics_draw_colored_text@Base 1.5.1 gt_graphics_draw_colored_text_p@Base 1.5.1 gt_graphics_draw_curve_data@Base 1.5.1 gt_graphics_draw_curve_data_p@Base 1.5.1 gt_graphics_draw_dashes@Base 1.5.1 gt_graphics_draw_dashes_p@Base 1.5.1 gt_graphics_draw_horizontal_line@Base 1.5.1 gt_graphics_draw_horizontal_line_p@Base 1.5.1 gt_graphics_draw_line@Base 1.5.1 gt_graphics_draw_line_p@Base 1.5.1 gt_graphics_draw_rectangle@Base 1.5.1 gt_graphics_draw_rectangle_p@Base 1.5.1 gt_graphics_draw_text@Base 1.5.1 gt_graphics_draw_text_centered@Base 1.5.1 gt_graphics_draw_text_centered_p@Base 1.5.1 gt_graphics_draw_text_clip@Base 1.5.1 gt_graphics_draw_text_clip_p@Base 1.5.1 gt_graphics_draw_text_p@Base 1.5.1 gt_graphics_draw_text_right@Base 1.5.1 gt_graphics_draw_text_right_p@Base 1.5.1 gt_graphics_draw_vertical_line@Base 1.5.1 gt_graphics_draw_vertical_line_p@Base 1.5.1 gt_graphics_get_image_height@Base 1.5.1 gt_graphics_get_image_width@Base 1.5.1 gt_graphics_get_text_height@Base 1.5.1 gt_graphics_get_text_width@Base 1.5.1 gt_graphics_get_xmargins@Base 1.5.1 gt_graphics_get_ymargins@Base 1.5.1 gt_graphics_ref@Base 1.5.1 gt_graphics_save_to_file@Base 1.5.1 gt_graphics_save_to_stream@Base 1.5.1 gt_graphics_set_background_color@Base 1.5.1 gt_graphics_set_font@Base 1.5.1 gt_graphics_set_margins@Base 1.5.1 gt_graphics_set_margins_p@Base 1.5.1 gt_grep@Base 1.5.1 gt_grep_unit_test@Base 1.5.1 gt_gtdata_show_help@Base 1.5.1 gt_gtf_in_stream_class@Base 1.5.1 gt_gtf_in_stream_enable_tidy_mode@Base 1.5.1 gt_gtf_in_stream_new@Base 1.5.1 gt_gtf_out_stream_new@Base 1.5.1 gt_gtf_parser_delete@Base 1.5.1 gt_gtf_parser_new@Base 1.5.1 gt_gtf_parser_parse@Base 1.5.1 gt_gtf_visitor_class@Base 1.5.1 gt_gtf_visitor_new@Base 1.5.1 gt_gth@Base 1.5.1 gt_gthbssmbuild@Base 1.5.1 gt_gthbssmfileinfo@Base 1.5.1 gt_gthbssmprint@Base 1.5.1 gt_gthconsensus@Base 1.5.1 gt_gthfilestat@Base 1.5.1 gt_gthmkbssmfiles@Base 1.5.1 gt_gthsplit@Base 1.5.1 gt_hashmap_add@Base 1.5.1 gt_hashmap_delete@Base 1.5.1 gt_hashmap_foreach@Base 1.5.1 gt_hashmap_foreach_in_key_order@Base 1.5.1 gt_hashmap_foreach_ordered@Base 1.5.1 gt_hashmap_get@Base 1.5.1 gt_hashmap_get_key@Base 1.5.1 gt_hashmap_new@Base 1.5.1 gt_hashmap_ref@Base 1.5.1 gt_hashmap_remove@Base 1.5.1 gt_hashmap_reset@Base 1.5.1 gt_hashmap_unit_test@Base 1.5.1 gt_hashtable_add@Base 1.5.1 gt_hashtable_add_with_storage_ptr@Base 1.5.1 gt_hashtable_delete@Base 1.5.1 gt_hashtable_fill@Base 1.5.1 gt_hashtable_foreach@Base 1.5.1 gt_hashtable_foreach_in_default_order@Base 1.5.1 gt_hashtable_foreach_ordered@Base 1.5.1 gt_hashtable_get@Base 1.5.1 gt_hashtable_new@Base 1.5.1 gt_hashtable_new_with_start_size@Base 1.5.1 gt_hashtable_ref@Base 1.5.1 gt_hashtable_remove@Base 1.5.1 gt_hashtable_reset@Base 1.5.1 gt_hashtable_unit_test@Base 1.5.1 gt_hcr_decoder_decode@Base 1.5.1 gt_hcr_decoder_decode_range@Base 1.5.1 gt_hcr_decoder_delete@Base 1.5.1 gt_hcr_decoder_has_descs_support@Base 1.5.1 gt_hcr_decoder_new@Base 1.5.1 gt_hcr_decoder_num_of_reads@Base 1.5.1 gt_hcr_decoder_readlength@Base 1.5.1 gt_hcr_encoder_delete@Base 1.5.1 gt_hcr_encoder_encode@Base 1.5.1 gt_hcr_encoder_get_sampling_rate@Base 1.5.1 gt_hcr_encoder_has_descs_support@Base 1.5.1 gt_hcr_encoder_new@Base 1.5.1 gt_hcr_encoder_set_sampling_none@Base 1.5.1 gt_hcr_encoder_set_sampling_page@Base 1.5.1 gt_hcr_encoder_set_sampling_rate@Base 1.5.1 gt_hcr_encoder_set_sampling_regular@Base 1.5.1 gt_hmm_backward@Base 1.5.1 gt_hmm_decode@Base 1.5.1 gt_hmm_delete@Base 1.5.1 gt_hmm_emit@Base 1.5.1 gt_hmm_forward@Base 1.5.1 gt_hmm_get_emission_probability@Base 1.5.1 gt_hmm_get_initial_state_probability@Base 1.5.1 gt_hmm_get_transition_probability@Base 1.5.1 gt_hmm_init_random@Base 1.5.1 gt_hmm_is_valid@Base 1.5.1 gt_hmm_new@Base 1.5.1 gt_hmm_rmsd@Base 1.5.1 gt_hmm_set_emission_probability@Base 1.5.1 gt_hmm_set_initial_state_probability@Base 1.5.1 gt_hmm_set_missing_transition_probabilities@Base 1.5.1 gt_hmm_set_transition_probability@Base 1.5.1 gt_hmm_show@Base 1.5.1 gt_hmm_unit_test@Base 1.5.1 gt_hpol_processor_delete@Base 1.5.1 gt_hpol_processor_enable_aligned_segments_refregionscheck@Base 1.5.1 gt_hpol_processor_enable_direct_segments_output@Base 1.5.1 gt_hpol_processor_enable_segments_hlen_adjustment@Base 1.5.1 gt_hpol_processor_enable_sorted_segments_output@Base 1.5.1 gt_hpol_processor_enable_statistics_output@Base 1.5.1 gt_hpol_processor_new@Base 1.5.1 gt_hpol_processor_restrict_to_feature_type@Base 1.5.1 gt_hpol_processor_run@Base 1.5.1 gt_ht_2ptr_elem_free@Base 1.5.1 gt_ht_cstr_elem_cmp@Base 1.5.1 gt_ht_cstr_elem_hash@Base 1.5.1 gt_ht_ptr_elem_cmp@Base 1.5.1 gt_ht_ptr_elem_hash@Base 1.5.1 gt_ht_ul_elem_cmp@Base 1.5.1 gt_ht_ul_elem_hash@Base 1.5.1 gt_huffman_bitwise_decoder_delete@Base 1.5.1 gt_huffman_bitwise_decoder_new@Base 1.5.1 gt_huffman_bitwise_decoder_next@Base 1.5.1 gt_huffman_decoder_delete@Base 1.5.1 gt_huffman_decoder_get_new_mem_chunk@Base 1.5.1 gt_huffman_decoder_new@Base 1.5.1 gt_huffman_decoder_new_from_memory@Base 1.5.1 gt_huffman_decoder_next@Base 1.5.1 gt_huffman_delete@Base 1.5.1 gt_huffman_encode@Base 1.5.1 gt_huffman_iterate@Base 1.5.1 gt_huffman_new@Base 1.5.1 gt_huffman_numofsymbols@Base 1.5.1 gt_huffman_print_codes@Base 1.5.1 gt_huffman_size@Base 1.5.1 gt_huffman_totalnumofsymbols@Base 1.5.1 gt_huffman_unit_test@Base 1.5.1 gt_id_to_md5_stream_new@Base 1.5.1 gt_id_to_md5_visitor_class@Base 1.5.1 gt_id_to_md5_visitor_new@Base 1.5.1 gt_image_info_add_rec_map@Base 1.5.1 gt_image_info_delete@Base 1.5.1 gt_image_info_get_height@Base 1.5.1 gt_image_info_get_rec_map@Base 1.5.1 gt_image_info_new@Base 1.5.1 gt_image_info_num_of_rec_maps@Base 1.5.1 gt_image_info_ref@Base 1.5.1 gt_image_info_set_height@Base 1.5.1 gt_image_info_unit_test@Base 1.5.1 gt_index_options_algbounds_option@Base 1.5.1 gt_index_options_algbounds_value@Base 1.5.1 gt_index_options_bwtIdxParams_value@Base 1.5.1 gt_index_options_delete@Base 1.5.1 gt_index_options_lcpdist_value@Base 1.5.1 gt_index_options_maximumspace_value@Base 1.5.1 gt_index_options_numofparts_value@Base 1.5.1 gt_index_options_outbcktab_option@Base 1.5.1 gt_index_options_outbcktab_value@Base 1.5.1 gt_index_options_outbwttab_option@Base 1.5.1 gt_index_options_outbwttab_value@Base 1.5.1 gt_index_options_outkyssort_value@Base 1.5.1 gt_index_options_outkystab_value@Base 1.5.1 gt_index_options_outlcptab_option@Base 1.5.1 gt_index_options_outlcptab_value@Base 1.5.1 gt_index_options_outsuftab_option@Base 1.5.1 gt_index_options_outsuftab_value@Base 1.5.1 gt_index_options_prefixlength_option@Base 1.5.1 gt_index_options_prefixlength_value@Base 1.5.1 gt_index_options_readmode_value@Base 1.5.1 gt_index_options_register_esa@Base 1.5.1 gt_index_options_register_esa_noout@Base 1.5.1 gt_index_options_register_packedidx@Base 1.5.1 gt_index_options_sfxstrategy_value@Base 1.5.1 gt_index_options_spmopt_option@Base 1.5.1 gt_index_options_swallow_tail_value@Base 1.5.1 gt_indexbased_exact_pattern_count@Base 1.5.1 gt_indexbasedapproxpatternmatching@Base 1.5.1 gt_indexbasedexactpatternmatching@Base 1.5.1 gt_indexbasedlocali@Base 1.5.1 gt_indexbasedmstats@Base 1.5.1 gt_indexbasedspacedseeds@Base 1.5.1 gt_initCompositionList@Base 1.5.1 gt_initEMIterator@Base 1.5.1 gt_initEmptyEMIterator@Base 1.5.1 gt_initEmptySeqReaderSet@Base 1.5.1 gt_initMinimalcutoffsTravfunctions@Base 1.5.1 gt_initMinimalcutoffsdata@Base 1.5.1 gt_initRelaxedcutoffsTravfunctions@Base 1.5.1 gt_initRelaxedcutoffsdata@Base 1.5.1 gt_initSATaggedXltorStateList@Base 1.5.1 gt_initStrictcutoffsTravfunctions@Base 1.5.1 gt_initStrictcutoffsdata@Base 1.5.1 gt_initSuffixarrayFileInterface@Base 1.5.1 gt_initbasepower@Base 1.5.1 gt_initeqsvector@Base 1.5.1 gt_initeqsvectorrev@Base 1.5.1 gt_initfilltable@Base 1.5.1 gt_initmultimappower@Base 1.5.1 gt_initstorematch@Base 1.5.1 gt_inplace_reversecomplement@Base 1.5.1 gt_inter_feature_stream_new@Base 1.5.1 gt_inter_feature_visitor_class@Base 1.5.1 gt_inter_feature_visitor_new@Base 1.5.1 gt_interval_tree_delete@Base 1.5.1 gt_interval_tree_find_all_overlapping@Base 1.5.1 gt_interval_tree_find_first_overlapping@Base 1.5.1 gt_interval_tree_get_successor@Base 1.5.1 gt_interval_tree_insert@Base 1.5.1 gt_interval_tree_iterate_overlapping@Base 1.5.1 gt_interval_tree_new@Base 1.5.1 gt_interval_tree_node_delete@Base 1.5.1 gt_interval_tree_node_get_data@Base 1.5.1 gt_interval_tree_node_new@Base 1.5.1 gt_interval_tree_print@Base 1.5.1 gt_interval_tree_remove@Base 1.5.1 gt_interval_tree_size@Base 1.5.1 gt_interval_tree_traverse@Base 1.5.1 gt_interval_tree_unit_test@Base 1.5.1 gt_intervalwidthleq@Base 1.5.1 gt_io_delete@Base 1.5.1 gt_io_expect@Base 1.5.1 gt_io_get_char@Base 1.5.1 gt_io_get_filename@Base 1.5.1 gt_io_get_filename_str@Base 1.5.1 gt_io_get_line_number@Base 1.5.1 gt_io_has_char@Base 1.5.1 gt_io_line_start@Base 1.5.1 gt_io_new@Base 1.5.1 gt_io_next@Base 1.5.1 gt_io_peek@Base 1.5.1 gt_io_unget_char@Base 1.5.1 gt_is_little_endian@Base 1.5.1 gt_jobs@Base 1.5.1 gt_kmercode_at_firstpos@Base 1.5.1 gt_kmercodeiterator_delete@Base 1.5.1 gt_kmercodeiterator_encseq_new@Base 1.5.1 gt_kmercodeiterator_encseq_next@Base 1.5.1 gt_kmercodeiterator_encseq_nonspecial_next@Base 1.5.1 gt_kmercodeiterator_filetab_new@Base 1.5.1 gt_kmercodeiterator_filetab_next@Base 1.5.1 gt_kmercodeiterator_inputexhausted@Base 1.5.1 gt_kmp_preproc@Base 1.5.1 gt_kmp_preproc_unit_test@Base 1.5.1 gt_layout_delete@Base 1.5.1 gt_layout_get_height@Base 1.5.1 gt_layout_get_range@Base 1.5.1 gt_layout_get_twc@Base 1.5.1 gt_layout_new@Base 1.5.1 gt_layout_new_with_twc@Base 1.5.1 gt_layout_set_block_ordering_func@Base 1.5.1 gt_layout_set_track_ordering_func@Base 1.5.1 gt_layout_sketch@Base 1.5.1 gt_layout_unset_block_ordering_func@Base 1.5.1 gt_layout_unset_track_ordering_func@Base 1.5.1 gt_lcp13_manzini@Base 1.5.1 gt_lcp9_manzini@Base 1.5.1 gt_lcpintervalextendlcp@Base 1.5.1 gt_lcpintervalfindcharchildintv@Base 1.5.1 gt_lcpintervalsplitwithoutspecial@Base 1.5.1 gt_lcptab_getptr@Base 1.5.1 gt_lcptab_lightweightcheck@Base 1.5.1 gt_lcpvalues_rmq_new@Base 1.5.1 gt_leftborderbuffer_delete@Base 1.5.1 gt_leftborderbuffer_flush@Base 1.5.1 gt_leftborderbuffer_new@Base 1.5.1 gt_lib_clean@Base 1.5.1 gt_lib_init@Base 1.5.1 gt_lib_reg_atexit_func@Base 1.5.1 gt_limdfs_getencodedchar@Base 1.5.1 gt_line_breaker_bases_class@Base 1.5.1 gt_line_breaker_bases_delete@Base 1.5.1 gt_line_breaker_bases_is_line_occupied@Base 1.5.1 gt_line_breaker_bases_new@Base 1.5.1 gt_line_breaker_bases_register_block@Base 1.5.1 gt_line_breaker_captions_class@Base 1.5.1 gt_line_breaker_captions_delete@Base 1.5.1 gt_line_breaker_captions_is_line_occupied@Base 1.5.1 gt_line_breaker_captions_new@Base 1.5.1 gt_line_breaker_captions_register_block@Base 1.5.1 gt_line_breaker_cast@Base 1.5.1 gt_line_breaker_class_new@Base 1.5.1 gt_line_breaker_create@Base 1.5.1 gt_line_breaker_delete@Base 1.5.1 gt_line_breaker_line_is_occupied@Base 1.5.1 gt_line_breaker_ref@Base 1.5.1 gt_line_breaker_register_block@Base 1.5.1 gt_line_delete@Base 1.5.1 gt_line_get_blocks@Base 1.5.1 gt_line_get_height@Base 1.5.1 gt_line_has_captions@Base 1.5.1 gt_line_insert_block@Base 1.5.1 gt_line_new@Base 1.5.1 gt_line_sketch@Base 1.5.1 gt_line_unit_test@Base 1.5.1 gt_loadBWTSeq@Base 1.5.1 gt_loadBWTSeqForSA@Base 1.5.1 gt_loadBlockEncIdxSeqGen@Base 1.5.1 gt_loadEncIdxSeq@Base 1.5.1 gt_loadEncIdxSeqForSA@Base 1.5.1 gt_load_stream_class@Base 1.5.1 gt_load_stream_new@Base 1.5.1 gt_loadvoidBWTSeqForSA@Base 1.5.1 gt_locali_AbstractDfstransformer@Base 1.5.1 gt_log_clean@Base 1.5.1 gt_log_enable@Base 1.5.1 gt_log_enabled@Base 1.5.1 gt_log_fp@Base 1.5.1 gt_log_init@Base 1.5.1 gt_log_log@Base 1.5.1 gt_log_set_fp@Base 1.5.1 gt_log_vlog@Base 1.5.1 gt_logger_delete@Base 1.5.1 gt_logger_disable@Base 1.5.1 gt_logger_enable@Base 1.5.1 gt_logger_enabled@Base 1.5.1 gt_logger_log@Base 1.5.1 gt_logger_log_force@Base 1.5.1 gt_logger_log_va@Base 1.5.1 gt_logger_log_va_force@Base 1.5.1 gt_logger_new@Base 1.5.1 gt_logger_set_target@Base 1.5.1 gt_logger_target@Base 1.5.1 gt_logsum@Base 1.5.1 gt_lookaheadsearchPSSM@Base 1.5.1 gt_ltr_classify_stream_class@Base 1.5.1 gt_ltr_classify_stream_new@Base 1.5.1 gt_ltr_cluster_prepare_seq_finish_encseqs@Base 1.5.1 gt_ltr_cluster_prepare_seq_visitor_class@Base 1.5.1 gt_ltr_cluster_prepare_seq_visitor_free@Base 1.5.1 gt_ltr_cluster_prepare_seq_visitor_get_encseqs@Base 1.5.1 gt_ltr_cluster_prepare_seq_visitor_get_features@Base 1.5.1 gt_ltr_cluster_prepare_seq_visitor_new@Base 1.5.1 gt_ltr_cluster_stream_class@Base 1.5.1 gt_ltr_cluster_stream_new@Base 1.5.1 gt_ltr_fileout_stream_class@Base 1.5.1 gt_ltr_fileout_stream_enable_aa_sequence_output@Base 1.5.1 gt_ltr_fileout_stream_enable_pdom_alignment_output@Base 1.5.1 gt_ltr_fileout_stream_new@Base 1.5.1 gt_ltr_four_char_motif_encode@Base 1.5.1 gt_ltr_orf_annotator_stream_class@Base 1.5.1 gt_ltr_orf_annotator_stream_new@Base 1.5.1 gt_ltr_orf_annotator_stream_set_progress_location@Base 1.5.1 gt_ltr_refseq_match_stream_class@Base 1.5.1 gt_ltr_refseq_match_stream_new@Base 1.5.1 gt_ltr_visitor_class@Base 1.5.1 gt_ltr_visitor_new@Base 1.5.1 gt_ltrclustering@Base 1.5.1 gt_ltrdigest@Base 1.5.1 gt_ltrdigest_arguments_check@Base 1.5.1 gt_ltrdigest_stream_class@Base 1.5.1 gt_ltrdigest_stream_new@Base 1.5.1 gt_ltrelement_format_description@Base 1.5.1 gt_ltrelement_get_sequence@Base 1.5.1 gt_ltrelement_leftltrlen@Base 1.5.1 gt_ltrelement_length@Base 1.5.1 gt_ltrelement_rightltrlen@Base 1.5.1 gt_ltrelement_unit_test@Base 1.5.1 gt_ltrfileout_stream_free@Base 1.5.1 gt_ltrfileout_stream_next@Base 1.5.1 gt_ltrharvest@Base 1.5.1 gt_ltrharvest_fasta_out_stream_new@Base 1.5.1 gt_ltrharvest_fasta_out_visitor_class@Base 1.5.1 gt_ltrharvest_fasta_out_visitor_new@Base 1.5.1 gt_ltrharvest_stream_class@Base 1.5.1 gt_ltrharvest_stream_get_encseq@Base 1.5.1 gt_ltrharvest_stream_new@Base 1.5.1 gt_ltrharvest_tabout_stream_new@Base 1.5.1 gt_ltrharvest_tabout_stream_printlongheader@Base 1.5.1 gt_ltrharvest_tabout_stream_printshortheader@Base 1.5.1 gt_ltrharvest_tabout_visitor_class@Base 1.5.1 gt_ltrharvest_tabout_visitor_new@Base 1.5.1 gt_ltrharvest_tabout_visitor_new_longoutput@Base 1.5.1 gt_lua_alphabet_push@Base 1.5.1 gt_lua_encseq_push@Base 1.5.1 gt_lua_error@Base 1.5.1 gt_lua_export_metatable@Base 1.5.1 gt_lua_genome_node_push@Base 1.5.1 gt_lua_get_style_from_registry@Base 1.5.1 gt_lua_get_table_as_strarray@Base 1.5.1 gt_lua_open_alphabet@Base 1.5.1 gt_lua_open_annotationsketch@Base 1.5.1 gt_lua_open_bittab@Base 1.5.1 gt_lua_open_canvas@Base 1.5.1 gt_lua_open_cds_stream@Base 1.5.1 gt_lua_open_core@Base 1.5.1 gt_lua_open_csa_stream@Base 1.5.1 gt_lua_open_diagram@Base 1.5.1 gt_lua_open_encseq@Base 1.5.1 gt_lua_open_extended@Base 1.5.1 gt_lua_open_feature_index@Base 1.5.1 gt_lua_open_feature_node_iterator@Base 1.5.1 gt_lua_open_feature_stream@Base 1.5.1 gt_lua_open_feature_visitor@Base 1.5.1 gt_lua_open_genome_node@Base 1.5.1 gt_lua_open_genome_stream@Base 1.5.1 gt_lua_open_genome_visitor@Base 1.5.1 gt_lua_open_imageinfo@Base 1.5.1 gt_lua_open_layout@Base 1.5.1 gt_lua_open_lib@Base 1.5.1 gt_lua_open_mathsupport@Base 1.5.1 gt_lua_open_range@Base 1.5.1 gt_lua_open_region_mapping@Base 1.5.1 gt_lua_open_score_matrix@Base 1.5.1 gt_lua_open_stream_evaluator@Base 1.5.1 gt_lua_open_translate@Base 1.5.1 gt_lua_push_strarray_as_table@Base 1.5.1 gt_lua_put_style_in_registry@Base 1.5.1 gt_lua_range_push@Base 1.5.1 gt_lua_serializer_unit_test@Base 1.5.1 gt_lua_set_arg@Base 1.5.1 gt_lua_set_modules_path@Base 1.5.1 gt_lua_stack_dump@Base 1.5.1 gt_lua_table_to_str@Base 1.5.1 gt_ma_bookkeeping_enabled@Base 1.5.1 gt_ma_check_space_leak@Base 1.5.1 gt_ma_clean@Base 1.5.1 gt_ma_disable_global_spacepeak@Base 1.5.1 gt_ma_enable_global_spacepeak@Base 1.5.1 gt_ma_get_space_current@Base 1.5.1 gt_ma_get_space_peak@Base 1.5.1 gt_ma_init@Base 1.5.1 gt_ma_show_allocations@Base 1.5.1 gt_ma_show_space_peak@Base 1.5.1 gt_ma_unit_test@Base 1.5.1 gt_maintainnullcols@Base 1.5.1 gt_makeitmthresholds@Base 1.5.1 gt_malloc_mem@Base 1.5.1 gt_mapfmindex@Base 1.5.1 gt_mapping_delete@Base 1.5.1 gt_mapping_map_integer@Base 1.5.1 gt_mapping_map_string@Base 1.5.1 gt_mapping_new@Base 1.5.1 gt_mapspec_add_bitelem_ptr@Base 1.5.1 gt_mapspec_add_bitsequence_ptr@Base 1.5.1 gt_mapspec_add_char_ptr@Base 1.5.1 gt_mapspec_add_filelengthvalues_ptr@Base 1.5.1 gt_mapspec_add_pairbwtindex_ptr@Base 1.5.1 gt_mapspec_add_specialcharinfo_ptr@Base 1.5.1 gt_mapspec_add_twobitencoding_ptr@Base 1.5.1 gt_mapspec_add_uchar_ptr@Base 1.5.1 gt_mapspec_add_uint16_ptr@Base 1.5.1 gt_mapspec_add_uint32_ptr@Base 1.5.1 gt_mapspec_add_uint64_ptr@Base 1.5.1 gt_mapspec_add_ulong_ptr@Base 1.5.1 gt_mapspec_add_ulongbound_ptr@Base 1.5.1 gt_mapspec_pad@Base 1.5.1 gt_mapspec_read@Base 1.5.1 gt_mapspec_write@Base 1.5.1 gt_mapsuffixarray@Base 1.5.1 gt_marksubstring_bits_address@Base 1.5.1 gt_marksubstring_bits_map@Base 1.5.1 gt_marksubstring_bits_null@Base 1.5.1 gt_marksubstring_checkmark@Base 1.5.1 gt_marksubstring_delete@Base 1.5.1 gt_marksubstring_entries@Base 1.5.1 gt_marksubstring_mark@Base 1.5.1 gt_marksubstring_new@Base 1.5.1 gt_marksubstring_shiftright@Base 1.5.1 gt_marksubstring_size@Base 1.5.1 gt_match_blast_class@Base 1.5.1 gt_match_blast_get_align_length@Base 1.5.1 gt_match_blast_get_bitscore@Base 1.5.1 gt_match_blast_get_evalue@Base 1.5.1 gt_match_blast_get_similarity@Base 1.5.1 gt_match_blast_new@Base 1.5.1 gt_match_blast_set_align_length@Base 1.5.1 gt_match_blast_set_bitscore@Base 1.5.1 gt_match_blast_set_evalue@Base 1.5.1 gt_match_blast_set_similarity@Base 1.5.1 gt_match_cast@Base 1.5.1 gt_match_class_new@Base 1.5.1 gt_match_create@Base 1.5.1 gt_match_delete@Base 1.5.1 gt_match_get_direction@Base 1.5.1 gt_match_get_range_seq1@Base 1.5.1 gt_match_get_range_seq2@Base 1.5.1 gt_match_get_seqid1@Base 1.5.1 gt_match_get_seqid2@Base 1.5.1 gt_match_iterator_blast_class@Base 1.5.1 gt_match_iterator_blast_file_new@Base 1.5.1 gt_match_iterator_blastalln_process_new@Base 1.5.1 gt_match_iterator_blastallp_process_new@Base 1.5.1 gt_match_iterator_blastn_process_new@Base 1.5.1 gt_match_iterator_blastp_process_new@Base 1.5.1 gt_match_iterator_cast@Base 1.5.1 gt_match_iterator_class_new@Base 1.5.1 gt_match_iterator_create@Base 1.5.1 gt_match_iterator_delete@Base 1.5.1 gt_match_iterator_last_class@Base 1.5.1 gt_match_iterator_last_new@Base 1.5.1 gt_match_iterator_next@Base 1.5.1 gt_match_iterator_open_class@Base 1.5.1 gt_match_iterator_open_new@Base 1.5.1 gt_match_iterator_sw_class@Base 1.5.1 gt_match_iterator_sw_new@Base 1.5.1 gt_match_last_class@Base 1.5.1 gt_match_last_get_score@Base 1.5.1 gt_match_last_get_seqno1@Base 1.5.1 gt_match_last_get_seqno2@Base 1.5.1 gt_match_last_new@Base 1.5.1 gt_match_open_class@Base 1.5.1 gt_match_open_get_weight@Base 1.5.1 gt_match_open_new@Base 1.5.1 gt_match_open_set_weight@Base 1.5.1 gt_match_set_range_seq1@Base 1.5.1 gt_match_set_range_seq2@Base 1.5.1 gt_match_set_seqid1@Base 1.5.1 gt_match_set_seqid1_nt@Base 1.5.1 gt_match_set_seqid2@Base 1.5.1 gt_match_set_seqid2_nt@Base 1.5.1 gt_match_sw_class@Base 1.5.1 gt_match_sw_get_alignment_length@Base 1.5.1 gt_match_sw_get_edist@Base 1.5.1 gt_match_sw_get_seqno1@Base 1.5.1 gt_match_sw_get_seqno2@Base 1.5.1 gt_match_sw_new@Base 1.5.1 gt_match_try_cast@Base 1.5.1 gt_match_visitor_cast@Base 1.5.1 gt_match_visitor_class_new@Base 1.5.1 gt_match_visitor_create@Base 1.5.1 gt_match_visitor_delete@Base 1.5.1 gt_match_visitor_visit_match_blast@Base 1.5.1 gt_match_visitor_visit_match_open@Base 1.5.1 gt_matchspacedseed@Base 1.5.1 gt_mathsupport_unit_test@Base 1.5.1 gt_maxbasepower@Base 1.5.1 gt_md5_encoder_add_block@Base 1.5.1 gt_md5_encoder_delete@Base 1.5.1 gt_md5_encoder_finish@Base 1.5.1 gt_md5_encoder_new@Base 1.5.1 gt_md5_encoder_reset@Base 1.5.1 gt_md5_fingerprint@Base 1.5.1 gt_md5_seqid_cmp_seqids@Base 1.5.1 gt_md5_seqid_has_prefix@Base 1.5.1 gt_md5_seqid_unit_test@Base 1.5.1 gt_md5_tab_delete@Base 1.5.1 gt_md5_tab_get@Base 1.5.1 gt_md5_tab_map@Base 1.5.1 gt_md5_tab_new@Base 1.5.1 gt_md5_tab_new_from_cache_file@Base 1.5.1 gt_md5_tab_ref@Base 1.5.1 gt_md5_tab_size@Base 1.5.1 gt_md5_to_id_stream_new@Base 1.5.1 gt_md5_to_id_visitor_class@Base 1.5.1 gt_md5_to_id_visitor_new@Base 1.5.1 gt_md5set_add_sequence@Base 1.5.1 gt_md5set_delete@Base 1.5.1 gt_md5set_new@Base 1.5.1 gt_merge_feature_stream_new@Base 1.5.1 gt_merge_feature_visitor_class@Base 1.5.1 gt_merge_feature_visitor_new@Base 1.5.1 gt_merge_stream_class@Base 1.5.1 gt_merge_stream_new@Base 1.5.1 gt_mergertrie_delete@Base 1.5.1 gt_mergertrie_deletesmallestpath@Base 1.5.1 gt_mergertrie_findsmallestnode@Base 1.5.1 gt_mergertrie_initnodetable@Base 1.5.1 gt_mergertrie_insertsuffix@Base 1.5.1 gt_merstatistics@Base 1.5.1 gt_meta_node_class@Base 1.5.1 gt_meta_node_get_data@Base 1.5.1 gt_meta_node_get_directive@Base 1.5.1 gt_meta_node_new@Base 1.5.1 gt_metagenomethreader@Base 1.5.1 gt_mmsearchiterator_count@Base 1.5.1 gt_mmsearchiterator_delete@Base 1.5.1 gt_mmsearchiterator_identical@Base 1.5.1 gt_mmsearchiterator_isempty@Base 1.5.1 gt_mmsearchiterator_new_complete_olain@Base 1.5.1 gt_mmsearchiterator_next@Base 1.5.1 gt_msort@Base 1.5.1 gt_msort_r@Base 1.5.1 gt_multi_sanitizer_visitor_class@Base 1.5.1 gt_multi_sanitizer_visitor_new@Base 1.5.1 gt_multiapplysmithwaterman@Base 1.5.1 gt_multiesa2shulengthdist@Base 1.5.1 gt_multiesa2shulengthdist_print@Base 1.5.1 gt_multimappower_delete@Base 1.5.1 gt_multithread@Base 1.5.1 gt_mutate_seq@Base 1.5.1 gt_mutex_delete@Base 1.5.1 gt_mutex_new@Base 1.5.1 gt_newBWTSeq@Base 1.5.1 gt_newBWTSeqContextRetrieverFactory@Base 1.5.1 gt_newBwtSeqpositionextractor@Base 1.5.1 gt_newCharatpos@Base 1.5.1 gt_newCompositionList@Base 1.5.1 gt_newEMIterator@Base 1.5.1 gt_newGenBlockEncIdxSeq@Base 1.5.1 gt_newLcpvalueiterator@Base 1.5.1 gt_newLimdfsresources@Base 1.5.1 gt_newMultiRangeAlphabetEncodingUInt8@Base 1.5.1 gt_newMyersonlineresources@Base 1.5.1 gt_newSWdpresource@Base 1.5.1 gt_newSeqRangeList@Base 1.5.1 gt_newSequentialsuffixarrayreaderfromRAM@Base 1.5.1 gt_newSequentialsuffixarrayreaderfromfile@Base 1.5.1 gt_newSfxInterface@Base 1.5.1 gt_newSfxInterfaceWithReaders@Base 1.5.1 gt_newSpecialsRankLookup@Base 1.5.1 gt_newSuffixarrayFileInterface@Base 1.5.1 gt_newbucketenumerator@Base 1.5.1 gt_newenumpatterniterator@Base 1.5.1 gt_nextEnumpatterniterator@Base 1.5.1 gt_nextLcpvalueiterator@Base 1.5.1 gt_nextSequentiallcpvalue@Base 1.5.1 gt_nextSequentialsuftabvalue@Base 1.5.1 gt_nextbucketenumerator@Base 1.5.1 gt_node_stream_cast@Base 1.5.1 gt_node_stream_class_new@Base 1.5.1 gt_node_stream_create@Base 1.5.1 gt_node_stream_delete@Base 1.5.1 gt_node_stream_is_sorted@Base 1.5.1 gt_node_stream_next@Base 1.5.1 gt_node_stream_pull@Base 1.5.1 gt_node_stream_ref@Base 1.5.1 gt_node_visitor_cast@Base 1.5.1 gt_node_visitor_class_new@Base 1.5.1 gt_node_visitor_class_set_meta_node_func@Base 1.5.1 gt_node_visitor_create@Base 1.5.1 gt_node_visitor_delete@Base 1.5.1 gt_node_visitor_visit_comment_node@Base 1.5.1 gt_node_visitor_visit_eof_node@Base 1.5.1 gt_node_visitor_visit_feature_node@Base 1.5.1 gt_node_visitor_visit_meta_node@Base 1.5.1 gt_node_visitor_visit_region_node@Base 1.5.1 gt_node_visitor_visit_sequence_node@Base 1.5.1 gt_non_r_cmpfunc@Base 1.5.1 gt_obo_parse_tree_delete@Base 1.5.1 gt_obo_parse_tree_get_stanza@Base 1.5.1 gt_obo_parse_tree_get_stanza_type@Base 1.5.1 gt_obo_parse_tree_get_stanza_value@Base 1.5.1 gt_obo_parse_tree_new@Base 1.5.1 gt_obo_parse_tree_num_of_stanzas@Base 1.5.1 gt_obo_stanza_add@Base 1.5.1 gt_obo_stanza_delete@Base 1.5.1 gt_obo_stanza_filename@Base 1.5.1 gt_obo_stanza_get_type@Base 1.5.1 gt_obo_stanza_get_value@Base 1.5.1 gt_obo_stanza_line@Base 1.5.1 gt_obo_stanza_new@Base 1.5.1 gt_obo_stanza_size@Base 1.5.1 gt_option_argument_is_optional@Base 1.5.1 gt_option_delete@Base 1.5.1 gt_option_exclude@Base 1.5.1 gt_option_get_name@Base 1.5.1 gt_option_hide_default@Base 1.5.1 gt_option_imply@Base 1.5.1 gt_option_imply_either_2@Base 1.5.1 gt_option_imply_either_3@Base 1.5.1 gt_option_is_development_option@Base 1.5.1 gt_option_is_extended_option@Base 1.5.1 gt_option_is_mandatory@Base 1.5.1 gt_option_is_mandatory_either@Base 1.5.1 gt_option_is_mandatory_either_3@Base 1.5.1 gt_option_is_mandatory_either_4@Base 1.5.1 gt_option_is_set@Base 1.5.1 gt_option_new_bool@Base 1.5.1 gt_option_new_choice@Base 1.5.1 gt_option_new_debug@Base 1.5.1 gt_option_new_double@Base 1.5.1 gt_option_new_double_min@Base 1.5.1 gt_option_new_double_min_max@Base 1.5.1 gt_option_new_filename@Base 1.5.1 gt_option_new_filename_array@Base 1.5.1 gt_option_new_int@Base 1.5.1 gt_option_new_int_max@Base 1.5.1 gt_option_new_int_min@Base 1.5.1 gt_option_new_int_min_max@Base 1.5.1 gt_option_new_long@Base 1.5.1 gt_option_new_probability@Base 1.5.1 gt_option_new_range@Base 1.5.1 gt_option_new_range_min_max@Base 1.5.1 gt_option_new_string@Base 1.5.1 gt_option_new_string_array@Base 1.5.1 gt_option_new_uint@Base 1.5.1 gt_option_new_uint_max@Base 1.5.1 gt_option_new_uint_min@Base 1.5.1 gt_option_new_uint_min_max@Base 1.5.1 gt_option_new_ulong@Base 1.5.1 gt_option_new_ulong_min@Base 1.5.1 gt_option_new_ulong_min_max@Base 1.5.1 gt_option_new_verbose@Base 1.5.1 gt_option_new_width@Base 1.5.1 gt_option_parse_spacespec@Base 1.5.1 gt_option_parser_add_option@Base 1.5.1 gt_option_parser_delete@Base 1.5.1 gt_option_parser_get_option@Base 1.5.1 gt_option_parser_new@Base 1.5.1 gt_option_parser_parse@Base 1.5.1 gt_option_parser_refer_to_manual@Base 1.5.1 gt_option_parser_register_hook@Base 1.5.1 gt_option_parser_set_comment_func@Base 1.5.1 gt_option_parser_set_mail_address@Base 1.5.1 gt_option_parser_set_max_args@Base 1.5.1 gt_option_parser_set_min_args@Base 1.5.1 gt_option_parser_set_min_max_args@Base 1.5.1 gt_option_parser_set_version_func@Base 1.5.1 gt_option_ref@Base 1.5.1 gt_optionargaddbitmask@Base 1.5.1 gt_optionargsetsingle@Base 1.5.1 gt_orf_finder_stream_class@Base 1.5.1 gt_orf_finder_stream_new@Base 1.5.1 gt_orf_finder_visitor_class@Base 1.5.1 gt_orf_finder_visitor_new@Base 1.5.1 gt_orf_iterator_delete@Base 1.5.1 gt_orf_iterator_new@Base 1.5.1 gt_orf_iterator_next@Base 1.5.1 gt_orphanage_add@Base 1.5.1 gt_orphanage_delete@Base 1.5.1 gt_orphanage_get_orphan@Base 1.5.1 gt_orphanage_is_orphan@Base 1.5.1 gt_orphanage_new@Base 1.5.1 gt_orphanage_parent_is_missing@Base 1.5.1 gt_orphanage_reg_parent@Base 1.5.1 gt_orphanage_reset@Base 1.5.1 gt_out_power_for_small_exponents@Base 1.5.1 gt_outprjfile@Base 1.5.1 gt_output_file_info_delete@Base 1.5.1 gt_output_file_info_new@Base 1.5.1 gt_output_file_register_options@Base 1.5.1 gt_output_file_xopen_forcecheck@Base 1.5.1 gt_outputtranslationandorf@Base 1.5.1 gt_ovlfind_bf@Base 1.5.1 gt_ovlfind_bf_unit_test@Base 1.5.1 gt_ovlfind_dp@Base 1.5.1 gt_ovlfind_dp_unit_test@Base 1.5.1 gt_ovlfind_kmp@Base 1.5.1 gt_ovlfind_kmp_unit_test@Base 1.5.1 gt_packedindexmstatsforward@Base 1.5.1 gt_packedindexuniqueforward@Base 1.5.1 gt_parse_algbounds@Base 1.5.1 gt_parse_description_range@Base 1.5.1 gt_parse_double@Base 1.5.1 gt_parse_int@Base 1.5.1 gt_parse_int_line@Base 1.5.1 gt_parse_intermediate_output@Base 1.5.1 gt_parse_long@Base 1.5.1 gt_parse_phase@Base 1.5.1 gt_parse_range@Base 1.5.1 gt_parse_range_correct_neg@Base 1.5.1 gt_parse_range_tidy@Base 1.5.1 gt_parse_score@Base 1.5.1 gt_parse_strand@Base 1.5.1 gt_parse_uint@Base 1.5.1 gt_parse_ulong@Base 1.5.1 gt_parseargsandcallmkfmindex@Base 1.5.1 gt_parseargsandcallsuffixerator@Base 1.5.1 gt_parsequalifiedinteger@Base 1.5.1 gt_pbs_find@Base 1.5.1 gt_pbs_hit_get_alignment_length@Base 1.5.1 gt_pbs_hit_get_coords@Base 1.5.1 gt_pbs_hit_get_edist@Base 1.5.1 gt_pbs_hit_get_offset@Base 1.5.1 gt_pbs_hit_get_score@Base 1.5.1 gt_pbs_hit_get_strand@Base 1.5.1 gt_pbs_hit_get_trna@Base 1.5.1 gt_pbs_hit_get_tstart@Base 1.5.1 gt_pbs_results_delete@Base 1.5.1 gt_pbs_results_get_number_of_hits@Base 1.5.1 gt_pbs_results_get_ranked_hit@Base 1.5.1 gt_pbs_unit_test@Base 1.5.1 gt_pck_calculate_shulen@Base 1.5.1 gt_pck_count_nodes_dfs@Base 1.5.1 gt_pck_exact_pattern_count@Base 1.5.1 gt_pck_exactpatternmatching@Base 1.5.1 gt_pck_getGCcontent@Base 1.5.1 gt_pck_getShuStringLength@Base 1.5.1 gt_pck_get_nonspecial_count@Base 1.5.1 gt_pck_special_occ_in_nonspecial_intervals@Base 1.5.1 gt_pckbuckettable_2file@Base 1.5.1 gt_pckbuckettable_delete@Base 1.5.1 gt_pckbuckettable_exists@Base 1.5.1 gt_pckbuckettable_map@Base 1.5.1 gt_pckbuckettable_maxdepth_get@Base 1.5.1 gt_pckbuckettable_mbtab_get@Base 1.5.1 gt_pckbuckettable_new@Base 1.5.1 gt_pckbuckettable_numofchars_get@Base 1.5.1 gt_performtheindexmerging@Base 1.5.1 gt_permute_word_init@Base 1.5.1 gt_permute_word_next@Base 1.5.1 gt_phase_get@Base 1.5.1 gt_pms_AbstractDfstransformer@Base 1.5.1 gt_popcount_tab_calculate_size@Base 1.5.1 gt_popcount_tab_class@Base 1.5.1 gt_popcount_tab_delete@Base 1.5.1 gt_popcount_tab_get@Base 1.5.1 gt_popcount_tab_get_offset_for_block@Base 1.5.1 gt_popcount_tab_new@Base 1.5.1 gt_popcount_tab_offset_bits@Base 1.5.1 gt_popcount_tab_rank_0@Base 1.5.1 gt_popcount_tab_rank_1@Base 1.5.1 gt_popcount_tab_unit_test@Base 1.5.1 gt_power_for_small_exponents@Base 1.5.1 gt_ppt_find@Base 1.5.1 gt_ppt_hit_get_coords@Base 1.5.1 gt_ppt_hit_get_strand@Base 1.5.1 gt_ppt_hit_get_ubox@Base 1.5.1 gt_ppt_hmm_new@Base 1.5.1 gt_ppt_results_delete@Base 1.5.1 gt_ppt_results_get_number_of_hits@Base 1.5.1 gt_ppt_results_get_ranked_hit@Base 1.5.1 gt_ppt_unit_test@Base 1.5.1 gt_priorityqueue_add@Base 1.5.1 gt_priorityqueue_delete@Base 1.5.1 gt_priorityqueue_delete_min@Base 1.5.1 gt_priorityqueue_find_min@Base 1.5.1 gt_priorityqueue_is_empty@Base 1.5.1 gt_priorityqueue_is_full@Base 1.5.1 gt_priorityqueue_new@Base 1.5.1 gt_process_is_foreground@Base 1.5.1 gt_process_spmitv@Base 1.5.1 gt_processelemLocaliTracebackstate@Base 1.5.1 gt_progressbar_start@Base 1.5.1 gt_progressbar_stop@Base 1.5.1 gt_qsort_r@Base 1.5.1 gt_quality_fastq_to_phred@Base 1.5.1 gt_quality_fastq_to_solexa@Base 1.5.1 gt_quality_phred_to_errorprob@Base 1.5.1 gt_quality_phred_to_solexa@Base 1.5.1 gt_quality_solexa_to_errorprob@Base 1.5.1 gt_quality_solexa_to_phred@Base 1.5.1 gt_quality_unit_test@Base 1.5.1 gt_querymatch_dbseqnum@Base 1.5.1 gt_querymatch_dbstart@Base 1.5.1 gt_querymatch_delete@Base 1.5.1 gt_querymatch_fill@Base 1.5.1 gt_querymatch_new@Base 1.5.1 gt_querymatch_output@Base 1.5.1 gt_querymatch_querylen@Base 1.5.1 gt_querymatch_queryreverse@Base 1.5.1 gt_querymatch_queryseqnum@Base 1.5.1 gt_querymatch_querystart@Base 1.5.1 gt_queue_add@Base 1.5.1 gt_queue_delete@Base 1.5.1 gt_queue_delete_with_contents@Base 1.5.1 gt_queue_get@Base 1.5.1 gt_queue_head@Base 1.5.1 gt_queue_iterate@Base 1.5.1 gt_queue_iterate_reverse@Base 1.5.1 gt_queue_new@Base 1.5.1 gt_queue_remove@Base 1.5.1 gt_queue_size@Base 1.5.1 gt_queue_unit_test@Base 1.5.1 gt_radixsort_delete@Base 1.5.1 gt_radixsort_inplace_GtUlongPair@Base 1.5.1 gt_radixsort_inplace_sort@Base 1.5.1 gt_radixsort_inplace_ulong@Base 1.5.1 gt_radixsort_lsb_linear@Base 1.5.1 gt_radixsort_max_num_of_entries_ulong@Base 1.5.1 gt_radixsort_max_num_of_entries_ulongpair@Base 1.5.1 gt_radixsort_new_ulong@Base 1.5.1 gt_radixsort_new_ulongpair@Base 1.5.1 gt_radixsort_size@Base 1.5.1 gt_radixsort_space_ulong@Base 1.5.1 gt_radixsort_space_ulongpair@Base 1.5.1 gt_radixsort_str_delete@Base 1.5.1 gt_radixsort_str_eqlen@Base 1.5.1 gt_radixsort_str_maxwidth@Base 1.5.1 gt_radixsort_str_minwidth@Base 1.5.1 gt_radixsort_str_new@Base 1.5.1 gt_rand_0_to_1@Base 1.5.1 gt_rand_char@Base 1.5.1 gt_rand_max@Base 1.5.1 gt_rand_max_double@Base 1.5.1 gt_randomcodes_correct_data_collect_stats@Base 1.5.1 gt_randomcodes_correct_data_delete@Base 1.5.1 gt_randomcodes_correct_data_new@Base 1.5.1 gt_randomcodes_correct_process_bucket@Base 1.5.1 gt_randomcodes_countocc_delete@Base 1.5.1 gt_randomcodes_countocc_new@Base 1.5.1 gt_randomcodes_countocc_resize@Base 1.5.1 gt_randomcodes_countocc_setnull@Base 1.5.1 gt_randomcodes_find_accu@Base 1.5.1 gt_randomcodes_find_insert@Base 1.5.1 gt_randomcodes_findfirstsamplelarger@Base 1.5.1 gt_randomcodes_get_leftborder@Base 1.5.1 gt_randomcodes_get_sample@Base 1.5.1 gt_randomcodes_insert_runkmerscan@Base 1.5.1 gt_randomcodes_leftborder_address@Base 1.5.1 gt_randomcodes_leftborder_entries@Base 1.5.1 gt_randomcodes_leftborder_remap@Base 1.5.1 gt_randomcodes_numofsamples@Base 1.5.1 gt_randomcodes_outfilenameleftborder@Base 1.5.1 gt_randomcodes_partialsums@Base 1.5.1 gt_randomcodes_remdups@Base 1.5.1 gt_randomcodes_sample2full@Base 1.5.1 gt_randomcodes_samples_delete@Base 1.5.1 gt_randomcodes_tab_delete@Base 1.5.1 gt_range_compare@Base 1.5.1 gt_range_compare_by_length_ptr@Base 1.5.1 gt_range_compare_with_delta@Base 1.5.1 gt_range_contains@Base 1.5.1 gt_range_join@Base 1.5.1 gt_range_length@Base 1.5.1 gt_range_offset@Base 1.5.1 gt_range_overlap@Base 1.5.1 gt_range_overlap_delta@Base 1.5.1 gt_range_reorder@Base 1.5.1 gt_range_reverse@Base 1.5.1 gt_range_unit_test@Base 1.5.1 gt_range_within@Base 1.5.1 gt_ranges_are_consecutive@Base 1.5.1 gt_ranges_are_equal@Base 1.5.1 gt_ranges_are_sorted@Base 1.5.1 gt_ranges_are_sorted_and_do_not_overlap@Base 1.5.1 gt_ranges_borders_are_in_region@Base 1.5.1 gt_ranges_copy_to_opposite_strand@Base 1.5.1 gt_ranges_do_not_overlap@Base 1.5.1 gt_ranges_show@Base 1.5.1 gt_ranges_sort@Base 1.5.1 gt_ranges_sort_by_length_stable@Base 1.5.1 gt_ranges_spanned_length@Base 1.5.1 gt_ranges_total_length@Base 1.5.1 gt_ranges_uniq@Base 1.5.1 gt_ranges_uniq_count@Base 1.5.1 gt_ranges_uniq_in_place@Base 1.5.1 gt_ranges_uniq_in_place_count@Base 1.5.1 gt_ranked_list_delete@Base 1.5.1 gt_ranked_list_first@Base 1.5.1 gt_ranked_list_insert@Base 1.5.1 gt_ranked_list_iter_delete@Base 1.5.1 gt_ranked_list_iter_new_from_first@Base 1.5.1 gt_ranked_list_iter_new_from_last@Base 1.5.1 gt_ranked_list_iter_next@Base 1.5.1 gt_ranked_list_iter_prev@Base 1.5.1 gt_ranked_list_last@Base 1.5.1 gt_ranked_list_new@Base 1.5.1 gt_ranked_list_size@Base 1.5.1 gt_ranked_list_unit_test@Base 1.5.1 gt_rbtree_clear@Base 1.5.1 gt_rbtree_delete@Base 1.5.1 gt_rbtree_erase@Base 1.5.1 gt_rbtree_find@Base 1.5.1 gt_rbtree_find_with_cmp@Base 1.5.1 gt_rbtree_insert@Base 1.5.1 gt_rbtree_insert_with_cmp@Base 1.5.1 gt_rbtree_iter_data@Base 1.5.1 gt_rbtree_iter_delete@Base 1.5.1 gt_rbtree_iter_new_from_first@Base 1.5.1 gt_rbtree_iter_new_from_last@Base 1.5.1 gt_rbtree_iter_next@Base 1.5.1 gt_rbtree_iter_prev@Base 1.5.1 gt_rbtree_maximum_key@Base 1.5.1 gt_rbtree_minimum_key@Base 1.5.1 gt_rbtree_new@Base 1.5.1 gt_rbtree_next_equal_key@Base 1.5.1 gt_rbtree_next_key@Base 1.5.1 gt_rbtree_previous_equal_key@Base 1.5.1 gt_rbtree_previous_key@Base 1.5.1 gt_rbtree_root_key@Base 1.5.1 gt_rbtree_search@Base 1.5.1 gt_rbtree_search_with_cmp@Base 1.5.1 gt_rbtree_size@Base 1.5.1 gt_rbtree_unit_test@Base 1.5.1 gt_rbtree_walk@Base 1.5.1 gt_rbtree_walk_reverse@Base 1.5.1 gt_rbtree_walk_stop@Base 1.5.1 gt_rcr_decoder_decode@Base 1.5.1 gt_rcr_decoder_delete@Base 1.5.1 gt_rcr_decoder_disable_description_support@Base 1.5.1 gt_rcr_decoder_enable_description_support@Base 1.5.1 gt_rcr_decoder_new@Base 1.5.1 gt_rcr_encoder_delete@Base 1.5.1 gt_rcr_encoder_disable_verbosity@Base 1.5.1 gt_rcr_encoder_enable_verbosity@Base 1.5.1 gt_rcr_encoder_encode@Base 1.5.1 gt_rcr_encoder_new@Base 1.5.1 gt_rdb_accept@Base 1.5.1 gt_rdb_cast@Base 1.5.1 gt_rdb_class_new@Base 1.5.1 gt_rdb_create@Base 1.5.1 gt_rdb_delete@Base 1.5.1 gt_rdb_get_indexes@Base 1.5.1 gt_rdb_get_tables@Base 1.5.1 gt_rdb_last_inserted_id@Base 1.5.1 gt_rdb_prepare@Base 1.5.1 gt_rdb_ref@Base 1.5.1 gt_rdb_sqlite_class@Base 1.5.1 gt_rdb_sqlite_new@Base 1.5.1 gt_rdb_stmt_bind_double@Base 1.5.1 gt_rdb_stmt_bind_int@Base 1.5.1 gt_rdb_stmt_bind_string@Base 1.5.1 gt_rdb_stmt_bind_ulong@Base 1.5.1 gt_rdb_stmt_cast@Base 1.5.1 gt_rdb_stmt_class_new@Base 1.5.1 gt_rdb_stmt_create@Base 1.5.1 gt_rdb_stmt_delete@Base 1.5.1 gt_rdb_stmt_exec@Base 1.5.1 gt_rdb_stmt_get_double@Base 1.5.1 gt_rdb_stmt_get_int@Base 1.5.1 gt_rdb_stmt_get_string@Base 1.5.1 gt_rdb_stmt_get_ulong@Base 1.5.1 gt_rdb_stmt_reset@Base 1.5.1 gt_rdb_stmt_sqlite_class@Base 1.5.1 gt_rdb_visitor_cast@Base 1.5.1 gt_rdb_visitor_class_new@Base 1.5.1 gt_rdb_visitor_create@Base 1.5.1 gt_rdb_visitor_delete@Base 1.5.1 gt_rdb_visitor_visit_mysql@Base 1.5.1 gt_rdb_visitor_visit_sqlite@Base 1.5.1 gt_rdj_gusfield@Base 1.5.1 gt_rdj_pairwise_approx@Base 1.5.1 gt_rdj_pairwise_exact@Base 1.5.1 gt_readjoiner_show_version@Base 1.5.1 gt_readjoiner_ssar_delete@Base 1.5.1 gt_readjoiner_ssar_new@Base 1.5.1 gt_readmodeSequentialsuffixarrayreader@Base 1.5.1 gt_readmode_parse@Base 1.5.1 gt_readmode_show@Base 1.5.1 gt_reads2twobit_add@Base 1.5.1 gt_reads2twobit_add_library@Base 1.5.1 gt_reads2twobit_decode_range@Base 1.5.1 gt_reads2twobit_decode_sequence@Base 1.5.1 gt_reads2twobit_delete@Base 1.5.1 gt_reads2twobit_delete_sequences@Base 1.5.1 gt_reads2twobit_encode@Base 1.5.1 gt_reads2twobit_export_seppos@Base 1.5.1 gt_reads2twobit_export_twobitencoding@Base 1.5.1 gt_reads2twobit_invalid_seqs_totallength@Base 1.5.1 gt_reads2twobit_new@Base 1.5.1 gt_reads2twobit_nof_invalid_seqs@Base 1.5.1 gt_reads2twobit_nofseqs@Base 1.5.1 gt_reads2twobit_seqlen_eqlen@Base 1.5.1 gt_reads2twobit_seqlen_max@Base 1.5.1 gt_reads2twobit_seqlen_min@Base 1.5.1 gt_reads2twobit_set_quality_filter@Base 1.5.1 gt_reads2twobit_sort@Base 1.5.1 gt_reads2twobit_total_seqlength@Base 1.5.1 gt_reads2twobit_use_phred64@Base 1.5.1 gt_reads2twobit_write_encoded@Base 1.5.1 gt_reads2twobit_write_encseq@Base 1.5.1 gt_reads2twobit_write_fasta@Base 1.5.1 gt_reads2twobit_write_libraries_table@Base 1.5.1 gt_reads2twobit_write_seppos@Base 1.5.1 gt_reads_library_table_read@Base 1.5.1 gt_reads_library_table_write@Base 1.5.1 gt_realloc_mem@Base 1.5.1 gt_rec_map_delete@Base 1.5.1 gt_rec_map_format_html_imagemap_coords@Base 1.5.1 gt_rec_map_get_genome_feature@Base 1.5.1 gt_rec_map_get_northwest_x@Base 1.5.1 gt_rec_map_get_northwest_y@Base 1.5.1 gt_rec_map_get_southeast_x@Base 1.5.1 gt_rec_map_get_southeast_y@Base 1.5.1 gt_rec_map_has_omitted_children@Base 1.5.1 gt_rec_map_new@Base 1.5.1 gt_rec_map_ref@Base 1.5.1 gt_rec_map_set_omitted_children@Base 1.5.1 gt_recommendedprefixlength@Base 1.5.1 gt_region_mapping_delete@Base 1.5.1 gt_region_mapping_get_description@Base 1.5.1 gt_region_mapping_get_md5_fingerprint@Base 1.5.1 gt_region_mapping_get_sequence@Base 1.5.1 gt_region_mapping_get_sequence_length@Base 1.5.1 gt_region_mapping_new_encseq@Base 1.5.1 gt_region_mapping_new_mapping@Base 1.5.1 gt_region_mapping_new_rawseq@Base 1.5.1 gt_region_mapping_new_seqfiles@Base 1.5.1 gt_region_mapping_ref@Base 1.5.1 gt_region_node_builder_add_region@Base 1.5.1 gt_region_node_builder_build@Base 1.5.1 gt_region_node_builder_delete@Base 1.5.1 gt_region_node_builder_new@Base 1.5.1 gt_region_node_builder_reset@Base 1.5.1 gt_region_node_class@Base 1.5.1 gt_region_node_consolidate@Base 1.5.1 gt_region_node_new@Base 1.5.1 gt_regioncov_visitor_class@Base 1.5.1 gt_regioncov_visitor_new@Base 1.5.1 gt_regioncov_visitor_show_coverage@Base 1.5.1 gt_registerBlockEncOptions@Base 1.5.1 gt_registerCtxMapOptions@Base 1.5.1 gt_registerEncIdxSeqOptions@Base 1.5.1 gt_registerPackedIndexOptions@Base 1.5.1 gt_regular_seqid_save@Base 1.5.1 gt_reinitCharatpos@Base 1.5.1 gt_reinitEMIterator@Base 1.5.1 gt_reinitLocaliTracebackstate@Base 1.5.1 gt_remove_zero_base_exons@Base 1.5.1 gt_requiredUInt32Bits@Base 1.5.1 gt_requiredUInt64Bits@Base 1.5.1 gt_reverse_complement@Base 1.5.1 gt_reversesuffixmatch@Base 1.5.1 gt_rmq_delete@Base 1.5.1 gt_rmq_find_min_index@Base 1.5.1 gt_rmq_find_min_value@Base 1.5.1 gt_rmq_new@Base 1.5.1 gt_rmq_size@Base 1.5.1 gt_rmq_unit_test@Base 1.5.1 gt_round_to_long@Base 1.5.1 gt_runcheckfunctiononalphalen@Base 1.5.1 gt_runcheckfunctionontext@Base 1.5.1 gt_runcheckfunctionontwofiles@Base 1.5.1 gt_runenumlcpvalues@Base 1.5.1 gt_rungetencseqkmers@Base 1.5.1 gt_rungetencseqkmers_rc@Base 1.5.1 gt_runidxlocali@Base 1.5.1 gt_runscanesa@Base 1.5.1 gt_runtagerator@Base 1.5.1 gt_rwlock_delete@Base 1.5.1 gt_rwlock_new@Base 1.5.1 gt_safe_abs_check_func@Base 1.5.1 gt_safe_cast2long_check_func@Base 1.5.1 gt_safe_cast2ulong_64_check_func@Base 1.5.1 gt_safe_cast2ulong_check_func@Base 1.5.1 gt_safe_default_overflow_handler@Base 1.5.1 gt_safe_labs_check_func@Base 1.5.1 gt_safe_llabs_check_func@Base 1.5.1 gt_safe_mult_u32_check_func@Base 1.5.1 gt_safe_mult_u64_check_func@Base 1.5.1 gt_safe_mult_ulong_check_func@Base 1.5.1 gt_safearith_example@Base 1.5.1 gt_safearith_unit_test@Base 1.5.1 gt_sain_encseq_sortsuffixes@Base 1.5.1 gt_sain_plain_sortsuffixes@Base 1.5.1 gt_sam_alignment_cigar_i_length@Base 1.5.1 gt_sam_alignment_cigar_i_operation@Base 1.5.1 gt_sam_alignment_cigar_length@Base 1.5.1 gt_sam_alignment_clone@Base 1.5.1 gt_sam_alignment_delete@Base 1.5.1 gt_sam_alignment_flag@Base 1.5.1 gt_sam_alignment_has_qc_failure@Base 1.5.1 gt_sam_alignment_identifier@Base 1.5.1 gt_sam_alignment_is_optical_pcr_duplicate@Base 1.5.1 gt_sam_alignment_is_paired@Base 1.5.1 gt_sam_alignment_is_proper_paired@Base 1.5.1 gt_sam_alignment_is_read1@Base 1.5.1 gt_sam_alignment_is_read2@Base 1.5.1 gt_sam_alignment_is_reverse@Base 1.5.1 gt_sam_alignment_is_secondary@Base 1.5.1 gt_sam_alignment_is_unmapped@Base 1.5.1 gt_sam_alignment_mapping_quality@Base 1.5.1 gt_sam_alignment_mate_is_reverse@Base 1.5.1 gt_sam_alignment_mate_is_unmapped@Base 1.5.1 gt_sam_alignment_new@Base 1.5.1 gt_sam_alignment_pos@Base 1.5.1 gt_sam_alignment_qualitystring@Base 1.5.1 gt_sam_alignment_qualitystring_external_buffer@Base 1.5.1 gt_sam_alignment_read_length@Base 1.5.1 gt_sam_alignment_ref_num@Base 1.5.1 gt_sam_alignment_rightmost_pos@Base 1.5.1 gt_sam_alignment_sequence@Base 1.5.1 gt_sam_alignment_sequence_external_buffer@Base 1.5.1 gt_sam_query_name_iterator_class@Base 1.5.1 gt_sam_query_name_iterator_new@Base 1.5.1 gt_samfile_encseq_mapping_delete@Base 1.5.1 gt_samfile_encseq_mapping_new@Base 1.5.1 gt_samfile_encseq_mapping_seqpos@Base 1.5.1 gt_samfile_iterator_delete@Base 1.5.1 gt_samfile_iterator_new@Base 1.5.1 gt_samfile_iterator_new_bam@Base 1.5.1 gt_samfile_iterator_new_sam@Base 1.5.1 gt_samfile_iterator_next@Base 1.5.1 gt_samfile_iterator_number_of_references@Base 1.5.1 gt_samfile_iterator_ref@Base 1.5.1 gt_samfile_iterator_reference_name@Base 1.5.1 gt_samfile_iterator_reset@Base 1.5.1 gt_sampling_add_sample@Base 1.5.1 gt_sampling_delete@Base 1.5.1 gt_sampling_get_current_elementnum@Base 1.5.1 gt_sampling_get_next_elementnum@Base 1.5.1 gt_sampling_get_next_sample@Base 1.5.1 gt_sampling_get_page@Base 1.5.1 gt_sampling_get_rate@Base 1.5.1 gt_sampling_is_next_element_sample@Base 1.5.1 gt_sampling_is_regular@Base 1.5.1 gt_sampling_new_page@Base 1.5.1 gt_sampling_new_regular@Base 1.5.1 gt_sampling_read@Base 1.5.1 gt_sampling_write@Base 1.5.1 gt_sarrquerysubstringmatch@Base 1.5.1 gt_saveFmindex@Base 1.5.1 gt_scannedprjkey_add@Base 1.5.1 gt_scannedprjkey_allkeysdefined@Base 1.5.1 gt_scannedprjkey_analyze@Base 1.5.1 gt_scannedprjkeytable_delete@Base 1.5.1 gt_scannedprjkeytable_new@Base 1.5.1 gt_score_function_delete@Base 1.5.1 gt_score_function_get_deletion_score@Base 1.5.1 gt_score_function_get_insertion_score@Base 1.5.1 gt_score_function_get_score@Base 1.5.1 gt_score_function_get_scores@Base 1.5.1 gt_score_function_new@Base 1.5.1 gt_score_function_ref@Base 1.5.1 gt_score_matrix_delete@Base 1.5.1 gt_score_matrix_get_dimension@Base 1.5.1 gt_score_matrix_get_score@Base 1.5.1 gt_score_matrix_get_scores@Base 1.5.1 gt_score_matrix_new@Base 1.5.1 gt_score_matrix_new_read@Base 1.5.1 gt_score_matrix_new_read_protein@Base 1.5.1 gt_score_matrix_set_score@Base 1.5.1 gt_score_matrix_show@Base 1.5.1 gt_script_filter_delete@Base 1.5.1 gt_script_filter_get_author@Base 1.5.1 gt_script_filter_get_description@Base 1.5.1 gt_script_filter_get_email@Base 1.5.1 gt_script_filter_get_name@Base 1.5.1 gt_script_filter_get_short_description@Base 1.5.1 gt_script_filter_get_version@Base 1.5.1 gt_script_filter_new@Base 1.5.1 gt_script_filter_new_from_string@Base 1.5.1 gt_script_filter_ref@Base 1.5.1 gt_script_filter_run@Base 1.5.1 gt_script_filter_validate@Base 1.5.1 gt_script_wrapper_stream_class@Base 1.5.1 gt_script_wrapper_stream_new@Base 1.5.1 gt_script_wrapper_visitor_class@Base 1.5.1 gt_script_wrapper_visitor_new@Base 1.5.1 gt_searchinbuckets@Base 1.5.1 gt_searchsinglemer@Base 1.5.1 gt_select_stream_class@Base 1.5.1 gt_select_stream_new@Base 1.5.1 gt_select_stream_set_drophandler@Base 1.5.1 gt_select_stream_set_single_intron_factor@Base 1.5.1 gt_select_visitor_class@Base 1.5.1 gt_select_visitor_get_node@Base 1.5.1 gt_select_visitor_new@Base 1.5.1 gt_select_visitor_node_buffer_size@Base 1.5.1 gt_select_visitor_set_drophandler@Base 1.5.1 gt_select_visitor_set_single_intron_factor@Base 1.5.1 gt_seqReaderSetRegisterAutoConsumer@Base 1.5.1 gt_seqReaderSetRegisterConsumer@Base 1.5.1 gt_seq_col_cast@Base 1.5.1 gt_seq_col_class_new@Base 1.5.1 gt_seq_col_create@Base 1.5.1 gt_seq_col_delete@Base 1.5.1 gt_seq_col_get_description@Base 1.5.1 gt_seq_col_get_md5_fingerprint@Base 1.5.1 gt_seq_col_get_sequence@Base 1.5.1 gt_seq_col_get_sequence_length@Base 1.5.1 gt_seq_col_grep_desc@Base 1.5.1 gt_seq_col_grep_desc_md5@Base 1.5.1 gt_seq_col_grep_desc_sequence_length@Base 1.5.1 gt_seq_col_md5_to_description@Base 1.5.1 gt_seq_col_md5_to_seq@Base 1.5.1 gt_seq_col_md5_to_sequence_length@Base 1.5.1 gt_seq_col_num_of_files@Base 1.5.1 gt_seq_col_num_of_seqs@Base 1.5.1 gt_seq_delete@Base 1.5.1 gt_seq_get_alphabet@Base 1.5.1 gt_seq_get_description@Base 1.5.1 gt_seq_get_encoded@Base 1.5.1 gt_seq_get_orig@Base 1.5.1 gt_seq_info_cache_add@Base 1.5.1 gt_seq_info_cache_delete@Base 1.5.1 gt_seq_info_cache_get@Base 1.5.1 gt_seq_info_cache_new@Base 1.5.1 gt_seq_iterator_cast@Base 1.5.1 gt_seq_iterator_class_new@Base 1.5.1 gt_seq_iterator_colorspace_fastq_new@Base 1.5.1 gt_seq_iterator_create@Base 1.5.1 gt_seq_iterator_delete@Base 1.5.1 gt_seq_iterator_fastq_class@Base 1.5.1 gt_seq_iterator_fastq_delete@Base 1.5.1 gt_seq_iterator_fastq_get_file_index@Base 1.5.1 gt_seq_iterator_fastq_get_lastspeciallength@Base 1.5.1 gt_seq_iterator_fastq_getcurrentcounter@Base 1.5.1 gt_seq_iterator_fastq_new@Base 1.5.1 gt_seq_iterator_fastq_next@Base 1.5.1 gt_seq_iterator_fastq_relax_check_of_quality_description@Base 1.5.1 gt_seq_iterator_fastq_set_chardisttab@Base 1.5.1 gt_seq_iterator_fastq_set_quality_buffer@Base 1.5.1 gt_seq_iterator_fastq_set_symbolmap@Base 1.5.1 gt_seq_iterator_getcurrentcounter@Base 1.5.1 gt_seq_iterator_has_qualities@Base 1.5.1 gt_seq_iterator_next@Base 1.5.1 gt_seq_iterator_sequence_buffer_class@Base 1.5.1 gt_seq_iterator_sequence_buffer_new@Base 1.5.1 gt_seq_iterator_sequence_buffer_new_with_buffer@Base 1.5.1 gt_seq_iterator_set_quality_buffer@Base 1.5.1 gt_seq_iterator_set_sequence_output@Base 1.5.1 gt_seq_iterator_set_symbolmap@Base 1.5.1 gt_seq_length@Base 1.5.1 gt_seq_new@Base 1.5.1 gt_seq_new_own@Base 1.5.1 gt_seq_set_description@Base 1.5.1 gt_seq_set_description_own@Base 1.5.1 gt_seqabstract_delete@Base 1.5.1 gt_seqabstract_encoded_char@Base 1.5.1 gt_seqabstract_lcp@Base 1.5.1 gt_seqabstract_length_get@Base 1.5.1 gt_seqabstract_new_empty@Base 1.5.1 gt_seqabstract_new_encseq@Base 1.5.1 gt_seqabstract_new_ptr@Base 1.5.1 gt_seqabstract_reinit_encseq@Base 1.5.1 gt_seqabstract_reinit_ptr@Base 1.5.1 gt_seqid2file_info_delete@Base 1.5.1 gt_seqid2file_info_new@Base 1.5.1 gt_seqid2file_option_used@Base 1.5.1 gt_seqid2file_region_mapping_new@Base 1.5.1 gt_seqid2file_register_options@Base 1.5.1 gt_seqid2file_register_options_ext@Base 1.5.1 gt_seqid2seqnum_mapping_delete@Base 1.5.1 gt_seqid2seqnum_mapping_map@Base 1.5.1 gt_seqid2seqnum_mapping_new_bioseq@Base 1.5.1 gt_seqid2seqnum_mapping_new_seqcol@Base 1.5.1 gt_seqnumrelpos_decode_pos@Base 1.5.1 gt_seqnumrelpos_decode_relpos@Base 1.5.1 gt_seqnumrelpos_decode_seqnum@Base 1.5.1 gt_seqnumrelpos_delete@Base 1.5.1 gt_seqnumrelpos_encode@Base 1.5.1 gt_seqnumrelpos_new@Base 1.5.1 gt_seqpos_classifier_delete@Base 1.5.1 gt_seqpos_classifier_new@Base 1.5.1 gt_seqpos_classifier_nof_features_found@Base 1.5.1 gt_seqpos_classifier_position_is_inside_feature@Base 1.5.1 gt_sequence_buffer_advance@Base 1.5.1 gt_sequence_buffer_cast@Base 1.5.1 gt_sequence_buffer_create@Base 1.5.1 gt_sequence_buffer_delete@Base 1.5.1 gt_sequence_buffer_embl_class@Base 1.5.1 gt_sequence_buffer_embl_guess@Base 1.5.1 gt_sequence_buffer_embl_new@Base 1.5.1 gt_sequence_buffer_fasta_class@Base 1.5.1 gt_sequence_buffer_fasta_guess@Base 1.5.1 gt_sequence_buffer_fasta_new@Base 1.5.1 gt_sequence_buffer_fastq_class@Base 1.5.1 gt_sequence_buffer_fastq_guess@Base 1.5.1 gt_sequence_buffer_fastq_new@Base 1.5.1 gt_sequence_buffer_gb_class@Base 1.5.1 gt_sequence_buffer_gb_guess@Base 1.5.1 gt_sequence_buffer_gb_new@Base 1.5.1 gt_sequence_buffer_get_counter@Base 1.5.1 gt_sequence_buffer_get_file_index@Base 1.5.1 gt_sequence_buffer_new_guess_type@Base 1.5.1 gt_sequence_buffer_next@Base 1.5.1 gt_sequence_buffer_next_with_original@Base 1.5.1 gt_sequence_buffer_plain_class@Base 1.5.1 gt_sequence_buffer_plain_free@Base 1.5.1 gt_sequence_buffer_plain_new@Base 1.5.1 gt_sequence_buffer_ref@Base 1.5.1 gt_sequence_buffer_set_chardisttab@Base 1.5.1 gt_sequence_buffer_set_desc_buffer@Base 1.5.1 gt_sequence_buffer_set_filelengthtab@Base 1.5.1 gt_sequence_buffer_set_symbolmap@Base 1.5.1 gt_sequence_buffer_unit_test@Base 1.5.1 gt_sequence_node_class@Base 1.5.1 gt_sequence_node_get_description@Base 1.5.1 gt_sequence_node_get_sequence@Base 1.5.1 gt_sequence_node_get_sequence_length@Base 1.5.1 gt_sequence_node_new@Base 1.5.1 gt_sfx_multiesa2shulengthdist@Base 1.5.1 gt_sfx_multiesa2shulengthdist_last@Base 1.5.1 gt_sfx_multiesashulengthdist_delete@Base 1.5.1 gt_sfx_multiesashulengthdist_new@Base 1.5.1 gt_sfx_radixsort_str@Base 1.5.1 gt_sfxoptions_delete@Base 1.5.1 gt_shortreadsort_assigntableoflcpvalues@Base 1.5.1 gt_shortreadsort_delete@Base 1.5.1 gt_shortreadsort_firstcodes_sort@Base 1.5.1 gt_shortreadsort_maxwidth@Base 1.5.1 gt_shortreadsort_new@Base 1.5.1 gt_shortreadsort_size@Base 1.5.1 gt_shortreadsort_sssp_add_unsorted@Base 1.5.1 gt_shortreadsort_sssp_sort@Base 1.5.1 gt_shortreadsort_sumofstoredvalues@Base 1.5.1 gt_showPatterndistribution@Base 1.5.1 gt_showProfilematrix@Base 1.5.1 gt_showentiresuftab@Base 1.5.1 gt_showfrontvalues@Base 1.5.1 gt_showmaximalprefixlength@Base 1.5.1 gt_showshortversion@Base 1.5.1 gt_showtime_disable@Base 1.5.1 gt_showtime_enable@Base 1.5.1 gt_showtime_enabled@Base 1.5.1 gt_shredder_delete@Base 1.5.1 gt_shredder_new@Base 1.5.1 gt_shredder_set_overlap@Base 1.5.1 gt_shredder_set_sample_probability@Base 1.5.1 gt_shredder_shred@Base 1.5.1 gt_shu_unit_file_info_read@Base 1.5.1 gt_shu_unit_info_delete@Base 1.5.1 gt_shu_unit_info_new@Base 1.5.1 gt_sig_register_all@Base 1.5.1 gt_sig_unregister_all@Base 1.5.1 gt_size_of_sort_workspace@Base 1.5.1 gt_sketch@Base 1.5.1 gt_sketch_page@Base 1.5.1 gt_skfmmstats@Base 1.5.1 gt_skfmuniqueforward@Base 1.5.1 gt_snp_annotator_stream_class@Base 1.5.1 gt_snp_annotator_stream_new@Base 1.5.1 gt_snp_annotator_visitor_class@Base 1.5.1 gt_snp_annotator_visitor_new@Base 1.5.1 gt_sort_stream_class@Base 1.5.1 gt_sort_stream_new@Base 1.5.1 gt_sortallbuckets@Base 1.5.1 gt_sortallsuffixesfromstart@Base 1.5.1 gt_spacepeak_add@Base 1.5.1 gt_spacepeak_clean@Base 1.5.1 gt_spacepeak_free@Base 1.5.1 gt_spacepeak_get_space_peak@Base 1.5.1 gt_spacepeak_init@Base 1.5.1 gt_spacepeak_show_space_peak@Base 1.5.1 gt_specialcharinfo_read@Base 1.5.1 gt_specialrangeiterator_delete@Base 1.5.1 gt_specialrangeiterator_new@Base 1.5.1 gt_specialrangeiterator_next@Base 1.5.1 gt_specialrangeiterator_reinit@Base 1.5.1 gt_specialrangeiterator_reinit_with_startpos@Base 1.5.1 gt_splice_site_info_stream_class@Base 1.5.1 gt_splice_site_info_stream_intron_processed@Base 1.5.1 gt_splice_site_info_stream_new@Base 1.5.1 gt_splice_site_info_stream_show@Base 1.5.1 gt_splice_site_info_stream_show_canonical@Base 1.5.1 gt_splice_site_info_visitor_class@Base 1.5.1 gt_splice_site_info_visitor_intron_processed@Base 1.5.1 gt_splice_site_info_visitor_new@Base 1.5.1 gt_splice_site_info_visitor_show@Base 1.5.1 gt_splice_site_info_visitor_show_canonical@Base 1.5.1 gt_splicedseq_add@Base 1.5.1 gt_splicedseq_delete@Base 1.5.1 gt_splicedseq_get@Base 1.5.1 gt_splicedseq_length@Base 1.5.1 gt_splicedseq_map@Base 1.5.1 gt_splicedseq_new@Base 1.5.1 gt_splicedseq_pos_is_border@Base 1.5.1 gt_splicedseq_reset@Base 1.5.1 gt_splicedseq_reverse@Base 1.5.1 gt_splicedseq_unit_test@Base 1.5.1 gt_splitter_delete@Base 1.5.1 gt_splitter_get_token@Base 1.5.1 gt_splitter_get_tokens@Base 1.5.1 gt_splitter_new@Base 1.5.1 gt_splitter_reset@Base 1.5.1 gt_splitter_size@Base 1.5.1 gt_splitter_split@Base 1.5.1 gt_splitter_unit_test@Base 1.5.1 gt_spmfind_eqlen_nof_irr_spm@Base 1.5.1 gt_spmfind_eqlen_nof_trans_spm@Base 1.5.1 gt_spmfind_eqlen_process@Base 1.5.1 gt_spmfind_eqlen_process_end@Base 1.5.1 gt_spmfind_eqlen_state_delete@Base 1.5.1 gt_spmfind_eqlen_state_new@Base 1.5.1 gt_spmfind_varlen_nof_irr_spm@Base 1.5.1 gt_spmfind_varlen_nof_trans_spm@Base 1.5.1 gt_spmfind_varlen_process@Base 1.5.1 gt_spmfind_varlen_process_end@Base 1.5.1 gt_spmfind_varlen_state_delete@Base 1.5.1 gt_spmfind_varlen_state_new@Base 1.5.1 gt_spmlist_parse@Base 1.5.1 gt_spmlist_parse_ascii_approx@Base 1.5.1 gt_spmlist_unit_test@Base 1.5.1 gt_spmlist_write_header_bin32@Base 1.5.1 gt_spmlist_write_header_bin64@Base 1.5.1 gt_spmproc_a_e@Base 1.5.1 gt_spmproc_a_show_ascii@Base 1.5.1 gt_spmproc_a_skip@Base 1.5.1 gt_spmproc_show_ascii@Base 1.5.1 gt_spmproc_show_asgq@Base 1.5.1 gt_spmproc_show_bin32@Base 1.5.1 gt_spmproc_show_bin64@Base 1.5.1 gt_spmproc_show_count@Base 1.5.1 gt_spmproc_skip@Base 1.5.1 gt_spmproc_skip_unit_test@Base 1.5.1 gt_spmproc_strgraph_add@Base 1.5.1 gt_spmproc_strgraph_count@Base 1.5.1 gt_spmproc_strgraph_count_and_save@Base 1.5.1 gt_spmsk_inl_delete@Base 1.5.1 gt_spmsk_inl_new@Base 1.5.1 gt_spmsk_inl_process@Base 1.5.1 gt_spmsk_inl_process_end@Base 1.5.1 gt_spmsuftab_delete@Base 1.5.1 gt_spmsuftab_new@Base 1.5.1 gt_spmsuftab_partoffset@Base 1.5.1 gt_spmsuftab_requiredspace@Base 1.5.1 gt_spmsuftab_usebitsforpositions@Base 1.5.1 gt_spse_AbstractDfstransformer@Base 1.5.1 gt_squarededistunit@Base 1.5.1 gt_sspliced_alignment_add_exon@Base 1.5.1 gt_sspliced_alignment_compare_ptr@Base 1.5.1 gt_sspliced_alignment_delete@Base 1.5.1 gt_sspliced_alignment_genomic_range@Base 1.5.1 gt_sspliced_alignment_get_exon@Base 1.5.1 gt_sspliced_alignment_is_forward@Base 1.5.1 gt_sspliced_alignment_new@Base 1.5.1 gt_sspliced_alignment_num_of_exons@Base 1.5.1 gt_sspliced_alignment_parse@Base 1.5.1 gt_stat_stream_class@Base 1.5.1 gt_stat_stream_new@Base 1.5.1 gt_stat_stream_show_stats@Base 1.5.1 gt_stat_visitor_class@Base 1.5.1 gt_stat_visitor_new@Base 1.5.1 gt_stat_visitor_show_stats@Base 1.5.1 gt_str_append_char@Base 1.5.1 gt_str_append_cstr@Base 1.5.1 gt_str_append_cstr_nt@Base 1.5.1 gt_str_append_double@Base 1.5.1 gt_str_append_int@Base 1.5.1 gt_str_append_str@Base 1.5.1 gt_str_append_uint@Base 1.5.1 gt_str_append_ulong@Base 1.5.1 gt_str_array_add@Base 1.5.1 gt_str_array_add_cstr@Base 1.5.1 gt_str_array_add_cstr_nt@Base 1.5.1 gt_str_array_delete@Base 1.5.1 gt_str_array_get@Base 1.5.1 gt_str_array_get_str@Base 1.5.1 gt_str_array_new@Base 1.5.1 gt_str_array_new_file@Base 1.5.1 gt_str_array_ref@Base 1.5.1 gt_str_array_reset@Base 1.5.1 gt_str_array_set@Base 1.5.1 gt_str_array_set_cstr@Base 1.5.1 gt_str_array_set_size@Base 1.5.1 gt_str_array_size@Base 1.5.1 gt_str_cache_delete@Base 1.5.1 gt_str_cache_get@Base 1.5.1 gt_str_cache_new@Base 1.5.1 gt_str_clone@Base 1.5.1 gt_str_cmp@Base 1.5.1 gt_str_delete@Base 1.5.1 gt_str_get@Base 1.5.1 gt_str_get_mem@Base 1.5.1 gt_str_length@Base 1.5.1 gt_str_new@Base 1.5.1 gt_str_new_cstr@Base 1.5.1 gt_str_read_next_line@Base 1.5.1 gt_str_read_next_line_generic@Base 1.5.1 gt_str_ref@Base 1.5.1 gt_str_reset@Base 1.5.1 gt_str_set@Base 1.5.1 gt_str_set_length@Base 1.5.1 gt_str_unit_test@Base 1.5.1 gt_strand_get@Base 1.5.1 gt_strand_join@Base 1.5.1 gt_strcmp@Base 1.5.1 gt_strcmpptr@Base 1.5.1 gt_stream_evaluator_delete@Base 1.5.1 gt_stream_evaluator_evaluate@Base 1.5.1 gt_stream_evaluator_new@Base 1.5.1 gt_stream_evaluator_show@Base 1.5.1 gt_strgraph__save_large_count@Base 1.5.1 gt_strgraph_allocate_graph@Base 1.5.1 gt_strgraph_close_spmlist_file@Base 1.5.1 gt_strgraph_compact@Base 1.5.1 gt_strgraph_counts_sum@Base 1.5.1 gt_strgraph_delete@Base 1.5.1 gt_strgraph_edges_compare_by_length@Base 1.5.1 gt_strgraph_largest_count@Base 1.5.1 gt_strgraph_load_counts@Base 1.5.1 gt_strgraph_load_spm_from_file@Base 1.5.1 gt_strgraph_log_space@Base 1.5.1 gt_strgraph_log_stats@Base 1.5.1 gt_strgraph_longest_read@Base 1.5.1 gt_strgraph_new@Base 1.5.1 gt_strgraph_new_from_file@Base 1.5.1 gt_strgraph_nofedges@Base 1.5.1 gt_strgraph_nofreads@Base 1.5.1 gt_strgraph_nofspm@Base 1.5.1 gt_strgraph_nofvertices@Base 1.5.1 gt_strgraph_open_spmlist_file@Base 1.5.1 gt_strgraph_reddepaths@Base 1.5.1 gt_strgraph_redpbubbles@Base 1.5.1 gt_strgraph_redself@Base 1.5.1 gt_strgraph_redsubmax@Base 1.5.1 gt_strgraph_redtrans@Base 1.5.1 gt_strgraph_redwithrc@Base 1.5.1 gt_strgraph_save_counts@Base 1.5.1 gt_strgraph_set_encseq@Base 1.5.1 gt_strgraph_show@Base 1.5.1 gt_strgraph_show_context@Base 1.5.1 gt_strgraph_show_counts_distribution@Base 1.5.1 gt_strgraph_show_edge_lengths_distribution@Base 1.5.1 gt_strgraph_show_limits@Base 1.5.1 gt_strgraph_show_limits_debug_log@Base 1.5.1 gt_strgraph_sort_edges_by_len@Base 1.5.1 gt_strgraph_spell@Base 1.5.1 gt_strgraph_unit_test@Base 1.5.1 gt_string_distri_add@Base 1.5.1 gt_string_distri_delete@Base 1.5.1 gt_string_distri_foreach@Base 1.5.1 gt_string_distri_get@Base 1.5.1 gt_string_distri_get_prob@Base 1.5.1 gt_string_distri_new@Base 1.5.1 gt_string_distri_sub@Base 1.5.1 gt_string_matching_bmh@Base 1.5.1 gt_string_matching_brute_force@Base 1.5.1 gt_string_matching_kmp@Base 1.5.1 gt_string_matching_shift_and@Base 1.5.1 gt_string_matching_unit_test@Base 1.5.1 gt_style_clone@Base 1.5.1 gt_style_delete@Base 1.5.1 gt_style_delete_without_state@Base 1.5.1 gt_style_get_bool@Base 1.5.1 gt_style_get_bool_with_track@Base 1.5.1 gt_style_get_color@Base 1.5.1 gt_style_get_color_with_track@Base 1.5.1 gt_style_get_num@Base 1.5.1 gt_style_get_num_with_track@Base 1.5.1 gt_style_get_str@Base 1.5.1 gt_style_get_str_with_track@Base 1.5.1 gt_style_is_unsafe@Base 1.5.1 gt_style_load_file@Base 1.5.1 gt_style_load_str@Base 1.5.1 gt_style_new@Base 1.5.1 gt_style_new_with_state@Base 1.5.1 gt_style_ref@Base 1.5.1 gt_style_reload@Base 1.5.1 gt_style_safe_mode@Base 1.5.1 gt_style_set_bool@Base 1.5.1 gt_style_set_color@Base 1.5.1 gt_style_set_num@Base 1.5.1 gt_style_set_num_p@Base 1.5.1 gt_style_set_str@Base 1.5.1 gt_style_to_str@Base 1.5.1 gt_style_unit_test@Base 1.5.1 gt_style_unsafe_mode@Base 1.5.1 gt_style_unset@Base 1.5.1 gt_substriter_delete@Base 1.5.1 gt_substriter_init@Base 1.5.1 gt_substriter_new@Base 1.5.1 gt_substriter_next@Base 1.5.1 gt_sufbwt2fmindex@Base 1.5.1 gt_suffixarraySequentialsuffixarrayreader@Base 1.5.1 gt_suffixarrayfindinterval@Base 1.5.1 gt_suffixarrayfindmums@Base 1.5.1 gt_suffixarraymstats@Base 1.5.1 gt_suffixarrayuniqueforward@Base 1.5.1 gt_suffixeratoroptions@Base 1.5.1 gt_suffixsortspace_bucketleftidx_get@Base 1.5.1 gt_suffixsortspace_bucketleftidx_set@Base 1.5.1 gt_suffixsortspace_checkorder@Base 1.5.1 gt_suffixsortspace_delete@Base 1.5.1 gt_suffixsortspace_export_done@Base 1.5.1 gt_suffixsortspace_exportptr@Base 1.5.1 gt_suffixsortspace_get@Base 1.5.1 gt_suffixsortspace_getdirect@Base 1.5.1 gt_suffixsortspace_getptr_uint32@Base 1.5.1 gt_suffixsortspace_getptr_ulong@Base 1.5.1 gt_suffixsortspace_longest@Base 1.5.1 gt_suffixsortspace_new@Base 1.5.1 gt_suffixsortspace_new_fromfile@Base 1.5.1 gt_suffixsortspace_nooffsets@Base 1.5.1 gt_suffixsortspace_partoffset_set@Base 1.5.1 gt_suffixsortspace_requiredspace@Base 1.5.1 gt_suffixsortspace_set@Base 1.5.1 gt_suffixsortspace_setdirect@Base 1.5.1 gt_suffixsortspace_showrange@Base 1.5.1 gt_suffixsortspace_sortspace_delete@Base 1.5.1 gt_suffixsortspace_to_file@Base 1.5.1 gt_suffixsortspace_ulong_get@Base 1.5.1 gt_suffixsortspace_updatelongest@Base 1.5.1 gt_suftabSequentialsuffixarrayreader@Base 1.5.1 gt_suftab_lightweightcheck@Base 1.5.1 gt_suftabparts_delete@Base 1.5.1 gt_suftabparts_fit_memlimit@Base 1.5.1 gt_suftabparts_largest_width@Base 1.5.1 gt_suftabparts_largestsizemappedpartwise@Base 1.5.1 gt_suftabparts_maxindex@Base 1.5.1 gt_suftabparts_maxindex_last@Base 1.5.1 gt_suftabparts_minindex@Base 1.5.1 gt_suftabparts_new@Base 1.5.1 gt_suftabparts_numofparts@Base 1.5.1 gt_suftabparts_offset@Base 1.5.1 gt_suftabparts_rc_delete@Base 1.5.1 gt_suftabparts_rc_fit_memlimit@Base 1.5.1 gt_suftabparts_rc_largest_width@Base 1.5.1 gt_suftabparts_rc_largestsizemappedpartwise@Base 1.5.1 gt_suftabparts_rc_maxindex@Base 1.5.1 gt_suftabparts_rc_maxindex_last@Base 1.5.1 gt_suftabparts_rc_minindex@Base 1.5.1 gt_suftabparts_rc_new@Base 1.5.1 gt_suftabparts_rc_numofparts@Base 1.5.1 gt_suftabparts_rc_offset@Base 1.5.1 gt_suftabparts_rc_showallrecords@Base 1.5.1 gt_suftabparts_rc_sumofwidth@Base 1.5.1 gt_suftabparts_rc_variance@Base 1.5.1 gt_suftabparts_rc_widthofpart@Base 1.5.1 gt_suftabparts_showallrecords@Base 1.5.1 gt_suftabparts_sumofwidth@Base 1.5.1 gt_suftabparts_variance@Base 1.5.1 gt_suftabparts_widthofpart@Base 1.5.1 gt_swalign@Base 1.5.1 gt_symbol@Base 1.5.1 gt_symbol_clean@Base 1.5.1 gt_symbol_init@Base 1.5.1 gt_symbol_unit_test@Base 1.5.1 gt_symbolstring2fasta@Base 1.5.1 gt_tag_value_map_add@Base 1.5.1 gt_tag_value_map_delete@Base 1.5.1 gt_tag_value_map_example@Base 1.5.1 gt_tag_value_map_foreach@Base 1.5.1 gt_tag_value_map_get@Base 1.5.1 gt_tag_value_map_new@Base 1.5.1 gt_tag_value_map_remove@Base 1.5.1 gt_tag_value_map_set@Base 1.5.1 gt_tag_value_map_show@Base 1.5.1 gt_tag_value_map_unit_test@Base 1.5.1 gt_targetbest_select_stream_class@Base 1.5.1 gt_targetbest_select_stream_new@Base 1.5.1 gt_test_trieins@Base 1.5.1 gt_testmaxpairs@Base 1.5.1 gt_text_width_calculator_cairo_class@Base 1.5.1 gt_text_width_calculator_cairo_delete@Base 1.5.1 gt_text_width_calculator_cairo_get_text_width@Base 1.5.1 gt_text_width_calculator_cairo_new@Base 1.5.1 gt_text_width_calculator_cast@Base 1.5.1 gt_text_width_calculator_class_new@Base 1.5.1 gt_text_width_calculator_create@Base 1.5.1 gt_text_width_calculator_delete@Base 1.5.1 gt_text_width_calculator_get_text_width@Base 1.5.1 gt_text_width_calculator_ref@Base 1.5.1 gt_text_width_calculator_try_cast@Base 1.5.1 gt_thread_delete@Base 1.5.1 gt_thread_new@Base 1.5.1 gt_tidy_region_node_stream_class@Base 1.5.1 gt_tidy_region_node_stream_new@Base 1.5.1 gt_tidy_region_node_visitor_class@Base 1.5.1 gt_tidy_region_node_visitor_get_node@Base 1.5.1 gt_tidy_region_node_visitor_new@Base 1.5.1 gt_tidy_region_node_visitor_node_buffer_size@Base 1.5.1 gt_timer_delete@Base 1.5.1 gt_timer_new@Base 1.5.1 gt_timer_new_with_progress_description@Base 1.5.1 gt_timer_omit_last_stage@Base 1.5.1 gt_timer_show@Base 1.5.1 gt_timer_show_cpu_time_by_progress@Base 1.5.1 gt_timer_show_formatted@Base 1.5.1 gt_timer_show_progress@Base 1.5.1 gt_timer_show_progress_final@Base 1.5.1 gt_timer_show_progress_formatted@Base 1.5.1 gt_timer_show_progress_va@Base 1.5.1 gt_timer_start@Base 1.5.1 gt_timer_stop@Base 1.5.1 gt_today@Base 1.5.1 gt_tokenizer_delete@Base 1.5.1 gt_tokenizer_get_filename@Base 1.5.1 gt_tokenizer_get_line_number@Base 1.5.1 gt_tokenizer_get_token@Base 1.5.1 gt_tokenizer_has_token@Base 1.5.1 gt_tokenizer_line_start@Base 1.5.1 gt_tokenizer_new@Base 1.5.1 gt_tokenizer_next_token@Base 1.5.1 gt_tokenizer_skip_comment_lines@Base 1.5.1 gt_tokenizer_unit_test@Base 1.5.1 gt_tool_delete@Base 1.5.1 gt_tool_new@Base 1.5.1 gt_tool_run@Base 1.5.1 gt_toolbox_add@Base 1.5.1 gt_toolbox_add_hidden_tool@Base 1.5.1 gt_toolbox_add_tool@Base 1.5.1 gt_toolbox_delete@Base 1.5.1 gt_toolbox_get@Base 1.5.1 gt_toolbox_get_tool@Base 1.5.1 gt_toolbox_has_tool@Base 1.5.1 gt_toolbox_new@Base 1.5.1 gt_toolbox_show@Base 1.5.1 gt_tooldriver@Base 1.5.1 gt_tooldriver_with_license@Base 1.5.1 gt_toolinfo_delete@Base 1.5.1 gt_toolinfo_new@Base 1.5.1 gt_toolobjdriver@Base 1.5.1 gt_toolobjdriver_with_license@Base 1.5.1 gt_trSuftab2BWTSeq@Base 1.5.1 gt_track_delete@Base 1.5.1 gt_track_get_height@Base 1.5.1 gt_track_get_number_of_discarded_blocks@Base 1.5.1 gt_track_get_title@Base 1.5.1 gt_track_get_y_index@Base 1.5.1 gt_track_insert_block@Base 1.5.1 gt_track_new@Base 1.5.1 gt_track_set_y_index@Base 1.5.1 gt_track_sketch@Base 1.5.1 gt_track_unit_test@Base 1.5.1 gt_trans_table_delete@Base 1.5.1 gt_trans_table_description@Base 1.5.1 gt_trans_table_get_scheme_descriptions@Base 1.5.1 gt_trans_table_is_start_codon@Base 1.5.1 gt_trans_table_is_stop_codon@Base 1.5.1 gt_trans_table_new@Base 1.5.1 gt_trans_table_new_standard@Base 1.5.1 gt_trans_table_translate_codon@Base 1.5.1 gt_trans_table_unit_test@Base 1.5.1 gt_transcript_bittabs_delete@Base 1.5.1 gt_transcript_bittabs_get_all@Base 1.5.1 gt_transcript_bittabs_get_initial@Base 1.5.1 gt_transcript_bittabs_get_internal@Base 1.5.1 gt_transcript_bittabs_get_single@Base 1.5.1 gt_transcript_bittabs_get_terminal@Base 1.5.1 gt_transcript_bittabs_new@Base 1.5.1 gt_transcript_counts_delete@Base 1.5.1 gt_transcript_counts_get_all@Base 1.5.1 gt_transcript_counts_get_initial@Base 1.5.1 gt_transcript_counts_get_internal@Base 1.5.1 gt_transcript_counts_get_single@Base 1.5.1 gt_transcript_counts_get_terminal@Base 1.5.1 gt_transcript_counts_new@Base 1.5.1 gt_transcript_counts_set_all@Base 1.5.1 gt_transcript_counts_set_initial@Base 1.5.1 gt_transcript_counts_set_internal@Base 1.5.1 gt_transcript_counts_set_single@Base 1.5.1 gt_transcript_counts_set_terminal@Base 1.5.1 gt_transcript_evaluators_add_actuals@Base 1.5.1 gt_transcript_evaluators_delete@Base 1.5.1 gt_transcript_evaluators_get_all@Base 1.5.1 gt_transcript_evaluators_get_initial@Base 1.5.1 gt_transcript_evaluators_get_internal@Base 1.5.1 gt_transcript_evaluators_get_single@Base 1.5.1 gt_transcript_evaluators_get_terminal@Base 1.5.1 gt_transcript_evaluators_new@Base 1.5.1 gt_transcript_exons_are_sorted@Base 1.5.1 gt_transcript_exons_create_bittabs@Base 1.5.1 gt_transcript_exons_delete@Base 1.5.1 gt_transcript_exons_get_all@Base 1.5.1 gt_transcript_exons_get_initial@Base 1.5.1 gt_transcript_exons_get_internal@Base 1.5.1 gt_transcript_exons_get_single@Base 1.5.1 gt_transcript_exons_get_terminal@Base 1.5.1 gt_transcript_exons_new@Base 1.5.1 gt_transcript_exons_sort@Base 1.5.1 gt_transcript_exons_uniq_in_place_count@Base 1.5.1 gt_transcript_used_exons_delete@Base 1.5.1 gt_transcript_used_exons_get_all@Base 1.5.1 gt_transcript_used_exons_get_initial@Base 1.5.1 gt_transcript_used_exons_get_internal@Base 1.5.1 gt_transcript_used_exons_get_single@Base 1.5.1 gt_transcript_used_exons_get_terminal@Base 1.5.1 gt_transcript_used_exons_new@Base 1.5.1 gt_translateSuftab2BWT@Base 1.5.1 gt_translateSuftab2BWTSuffixsortspace@Base 1.5.1 gt_translator_delete@Base 1.5.1 gt_translator_find_codon@Base 1.5.1 gt_translator_find_startcodon@Base 1.5.1 gt_translator_find_stopcodon@Base 1.5.1 gt_translator_new@Base 1.5.1 gt_translator_new_with_table@Base 1.5.1 gt_translator_next@Base 1.5.1 gt_translator_next_with_start@Base 1.5.1 gt_translator_reset@Base 1.5.1 gt_translator_set_codon_iterator@Base 1.5.1 gt_translator_set_translation_table@Base 1.5.1 gt_translator_unit_test@Base 1.5.1 gt_turningwheel_delete@Base 1.5.1 gt_turningwheel_minchanged@Base 1.5.1 gt_turningwheel_new@Base 1.5.1 gt_turningwheel_next@Base 1.5.1 gt_turningwheel_output@Base 1.5.1 gt_turningwheel_size@Base 1.5.1 gt_twobitenc_editor_delete@Base 1.5.1 gt_twobitenc_editor_edit@Base 1.5.1 gt_twobitenc_editor_new@Base 1.5.1 gt_type_checker_builtin_class@Base 1.5.1 gt_type_checker_builtin_new@Base 1.5.1 gt_type_checker_cast@Base 1.5.1 gt_type_checker_create@Base 1.5.1 gt_type_checker_delete@Base 1.5.1 gt_type_checker_description@Base 1.5.1 gt_type_checker_is_partof@Base 1.5.1 gt_type_checker_is_valid@Base 1.5.1 gt_type_checker_obo_class@Base 1.5.1 gt_type_checker_obo_new@Base 1.5.1 gt_type_checker_ref@Base 1.5.1 gt_type_graph_add_stanza@Base 1.5.1 gt_type_graph_delete@Base 1.5.1 gt_type_graph_is_partof@Base 1.5.1 gt_type_graph_new@Base 1.5.1 gt_type_node_add_is_a_vertex@Base 1.5.1 gt_type_node_delete@Base 1.5.1 gt_type_node_has_parent@Base 1.5.1 gt_type_node_is_a_add@Base 1.5.1 gt_type_node_is_a_get@Base 1.5.1 gt_type_node_is_a_size@Base 1.5.1 gt_type_node_new@Base 1.5.1 gt_type_node_num@Base 1.5.1 gt_type_node_part_of_add@Base 1.5.1 gt_type_node_part_of_get@Base 1.5.1 gt_type_node_part_of_size@Base 1.5.1 gt_typecheck_info_create_type_checker@Base 1.5.1 gt_typecheck_info_delete@Base 1.5.1 gt_typecheck_info_new@Base 1.5.1 gt_typecheck_info_option_used@Base 1.5.1 gt_typecheck_info_register_options@Base 1.5.1 gt_tyr_occratio_func@Base 1.5.1 gt_tyrbckinfo_delete@Base 1.5.1 gt_tyrbckinfo_new@Base 1.5.1 gt_tyrcountinfo_delete@Base 1.5.1 gt_tyrcountinfo_get@Base 1.5.1 gt_tyrcountinfo_new@Base 1.5.1 gt_tyrindex_alphasize@Base 1.5.1 gt_tyrindex_binmersearch@Base 1.5.1 gt_tyrindex_check@Base 1.5.1 gt_tyrindex_delete@Base 1.5.1 gt_tyrindex_isempty@Base 1.5.1 gt_tyrindex_lastmer@Base 1.5.1 gt_tyrindex_merbytes@Base 1.5.1 gt_tyrindex_mersize@Base 1.5.1 gt_tyrindex_mertable@Base 1.5.1 gt_tyrindex_new@Base 1.5.1 gt_tyrindex_ptr2number@Base 1.5.1 gt_tyrindex_show@Base 1.5.1 gt_tyrsearch@Base 1.5.1 gt_uint32_data_hash@Base 1.5.1 gt_uint64hashtable_countsum_get@Base 1.5.1 gt_uint64hashtable_delete@Base 1.5.1 gt_uint64hashtable_insertionindex@Base 1.5.1 gt_uint64hashtable_new@Base 1.5.1 gt_uint64hashtable_partialsums@Base 1.5.1 gt_uint64hashtable_search@Base 1.5.1 gt_uint64hashtable_unit_test@Base 1.5.1 gt_union_find_delete@Base 1.5.1 gt_union_find_find@Base 1.5.1 gt_union_find_new@Base 1.5.1 gt_union_find_union@Base 1.5.1 gt_union_find_unit_test@Base 1.5.1 gt_uniq_stream_class@Base 1.5.1 gt_uniq_stream_new@Base 1.5.1 gt_unit_test_run@Base 1.5.1 gt_updateSequentialsuffixarrayreaderfromRAM@Base 1.5.1 gt_verifymappedstr@Base 1.5.1 gt_version_check@Base 1.5.1 gt_versionfunc@Base 1.5.1 gt_visitor_stream_class@Base 1.5.1 gt_visitor_stream_new@Base 1.5.1 gt_voidpackedfindfirstmatchconvert@Base 1.5.1 gt_voidpackedindex_totallength_get@Base 1.5.1 gt_voidpackedindexmstatsforward@Base 1.5.1 gt_voidpackedindexuniqueforward@Base 1.5.1 gt_warning@Base 1.5.1 gt_warning_default_handler@Base 1.5.1 gt_warning_disable@Base 1.5.1 gt_warning_get_data@Base 1.5.1 gt_warning_get_handler@Base 1.5.1 gt_warning_set_handler@Base 1.5.1 gt_whatisthemaximalprefixlength@Base 1.5.1 gt_windowiterator_delete@Base 1.5.1 gt_windowiterator_new@Base 1.5.1 gt_windowiterator_next@Base 1.5.1 gt_wrapCharatpos@Base 1.5.1 gt_xatexit@Base 1.5.1 gt_xbzfgetc@Base 1.5.1 gt_xbzfputc@Base 1.5.1 gt_xbzfputs@Base 1.5.1 gt_xbzopen@Base 1.5.1 gt_xbzread@Base 1.5.1 gt_xbzrewind@Base 1.5.1 gt_xbzwrite@Base 1.5.1 gt_xclose@Base 1.5.1 gt_xdrop_resources_delete@Base 1.5.1 gt_xdrop_resources_new@Base 1.5.1 gt_xfclose@Base 1.5.1 gt_xfdopen@Base 1.5.1 gt_xfflush@Base 1.5.1 gt_xfgetc@Base 1.5.1 gt_xfgetpos@Base 1.5.1 gt_xfgets@Base 1.5.1 gt_xfile_cmp@Base 1.5.1 gt_xflock_exclusive@Base 1.5.1 gt_xflock_shared@Base 1.5.1 gt_xflock_unlock@Base 1.5.1 gt_xfopen@Base 1.5.1 gt_xfputc@Base 1.5.1 gt_xfputs@Base 1.5.1 gt_xfread@Base 1.5.1 gt_xfseek@Base 1.5.1 gt_xfsetpos@Base 1.5.1 gt_xfstat@Base 1.5.1 gt_xfwrite@Base 1.5.1 gt_xgetrusage@Base 1.5.1 gt_xglob@Base 1.5.1 gt_xgzclose@Base 1.5.1 gt_xgzfgetc@Base 1.5.1 gt_xgzfputc@Base 1.5.1 gt_xgzfputs@Base 1.5.1 gt_xgzopen@Base 1.5.1 gt_xgzread@Base 1.5.1 gt_xgzrewind@Base 1.5.1 gt_xgzwrite@Base 1.5.1 gt_xmkdir@Base 1.5.1 gt_xmkstemp@Base 1.5.1 gt_xmmap@Base 1.5.1 gt_xmunmap@Base 1.5.1 gt_xopen@Base 1.5.1 gt_xputchar@Base 1.5.1 gt_xputs@Base 1.5.1 gt_xraise@Base 1.5.1 gt_xremove@Base 1.5.1 gt_xsignal@Base 1.5.1 gt_xstat@Base 1.5.1 gt_xtime@Base 1.5.1 gt_xtmpfp_generic_func@Base 1.5.1 gt_xungetc@Base 1.5.1 gt_xunlink@Base 1.5.1 gt_xvfprintf@Base 1.5.1 gt_xvsnprintf@Base 1.5.1 gt_xwrite@Base 1.5.1 gt_ya_rand_clean@Base 1.5.1 gt_ya_rand_init@Base 1.5.1 gt_ya_random@Base 1.5.1 gth_ags_acceptor_site_prob@Base 1.5.1 gth_ags_acceptor_site_range@Base 1.5.1 gth_ags_delete@Base 1.5.1 gth_ags_donor_site_prob@Base 1.5.1 gth_ags_donor_site_range@Base 1.5.1 gth_ags_filenum@Base 1.5.1 gth_ags_genomic_offset@Base 1.5.1 gth_ags_genomic_strand@Base 1.5.1 gth_ags_get_exon@Base 1.5.1 gth_ags_get_gen_id@Base 1.5.1 gth_ags_is_forward@Base 1.5.1 gth_ags_new@Base 1.5.1 gth_ags_num_of_exons@Base 1.5.1 gth_ags_total_length@Base 1.5.1 gth_align_dna@Base 1.5.1 gth_align_dna_simple@Base 1.5.1 gth_align_protein@Base 1.5.1 gth_backtrace_path_add_deletion@Base 1.5.1 gth_backtrace_path_add_deletion_with_1_gap@Base 1.5.1 gth_backtrace_path_add_deletion_with_2_gaps@Base 1.5.1 gth_backtrace_path_add_dummy@Base 1.5.1 gth_backtrace_path_add_eop@Base 1.5.1 gth_backtrace_path_add_insertion@Base 1.5.1 gth_backtrace_path_add_intron@Base 1.5.1 gth_backtrace_path_add_intron_with_1_base_left@Base 1.5.1 gth_backtrace_path_add_intron_with_2_bases_left@Base 1.5.1 gth_backtrace_path_add_match@Base 1.5.1 gth_backtrace_path_add_mismatch@Base 1.5.1 gth_backtrace_path_add_mismatch_with_1_gap@Base 1.5.1 gth_backtrace_path_add_mismatch_with_2_gaps@Base 1.5.1 gth_backtrace_path_alphatype@Base 1.5.1 gth_backtrace_path_append@Base 1.5.1 gth_backtrace_path_contain_dummy@Base 1.5.1 gth_backtrace_path_contains_no_zero_base_exons@Base 1.5.1 gth_backtrace_path_cutoff_end@Base 1.5.1 gth_backtrace_path_cutoff_start@Base 1.5.1 gth_backtrace_path_cutoff_walked_path@Base 1.5.1 gth_backtrace_path_delete@Base 1.5.1 gth_backtrace_path_determine_cutoffs@Base 1.5.1 gth_backtrace_path_ensure_length_1_before_introns@Base 1.5.1 gth_backtrace_path_eopcutoff_end@Base 1.5.1 gth_backtrace_path_eopcutoff_start@Base 1.5.1 gth_backtrace_path_gen_dp_length@Base 1.5.1 gth_backtrace_path_gen_dp_start@Base 1.5.1 gth_backtrace_path_genomiccutoff_end@Base 1.5.1 gth_backtrace_path_genomiccutoff_start@Base 1.5.1 gth_backtrace_path_get@Base 1.5.1 gth_backtrace_path_indelcount@Base 1.5.1 gth_backtrace_path_is_valid@Base 1.5.1 gth_backtrace_path_last_is_intron@Base 1.5.1 gth_backtrace_path_length@Base 1.5.1 gth_backtrace_path_new@Base 1.5.1 gth_backtrace_path_prepend@Base 1.5.1 gth_backtrace_path_ref_dp_length@Base 1.5.1 gth_backtrace_path_referencecutoff_end@Base 1.5.1 gth_backtrace_path_referencecutoff_start@Base 1.5.1 gth_backtrace_path_remove_zero_base_exons@Base 1.5.1 gth_backtrace_path_reset@Base 1.5.1 gth_backtrace_path_reverse@Base 1.5.1 gth_backtrace_path_set_alphatype@Base 1.5.1 gth_backtrace_path_set_cutoffs_end@Base 1.5.1 gth_backtrace_path_set_cutoffs_start@Base 1.5.1 gth_backtrace_path_set_dummy@Base 1.5.1 gth_backtrace_path_set_gen_dp_length@Base 1.5.1 gth_backtrace_path_set_gen_dp_start@Base 1.5.1 gth_backtrace_path_set_ref_dp_length@Base 1.5.1 gth_backtrace_path_show@Base 1.5.1 gth_backtrace_path_show_complete@Base 1.5.1 gth_backtrace_path_sizeof@Base 1.5.1 gth_bssm_param_delete@Base 1.5.1 gth_bssm_param_echo@Base 1.5.1 gth_bssm_param_extract@Base 1.5.1 gth_bssm_param_is_seven_class@Base 1.5.1 gth_bssm_param_load@Base 1.5.1 gth_bssm_param_new@Base 1.5.1 gth_bssm_param_parameterize@Base 1.5.1 gth_bssm_param_save@Base 1.5.1 gth_bssm_param_show_info@Base 1.5.1 gth_build_AGS_from_assembly@Base 1.5.1 gth_build_sa_collection@Base 1.5.1 gth_call_info_delete@Base 1.5.1 gth_call_info_new@Base 1.5.1 gth_chain_collection_add@Base 1.5.1 gth_chain_collection_delete@Base 1.5.1 gth_chain_collection_get@Base 1.5.1 gth_chain_collection_new@Base 1.5.1 gth_chain_collection_size@Base 1.5.1 gth_chain_collection_sort@Base 1.5.1 gth_chain_contract@Base 1.5.1 gth_chain_copy@Base 1.5.1 gth_chain_delete@Base 1.5.1 gth_chain_extend_borders@Base 1.5.1 gth_chain_new@Base 1.5.1 gth_chain_shorten_introns@Base 1.5.1 gth_chaining@Base 1.5.1 gth_compute_scores@Base 1.5.1 gth_desc_cache_delete@Base 1.5.1 gth_desc_cache_get@Base 1.5.1 gth_desc_cache_new@Base 1.5.1 gth_dp_options_core_clone@Base 1.5.1 gth_dp_options_core_delete@Base 1.5.1 gth_dp_options_core_new@Base 1.5.1 gth_dp_options_est_clone@Base 1.5.1 gth_dp_options_est_delete@Base 1.5.1 gth_dp_options_est_new@Base 1.5.1 gth_dp_options_postpro_delete@Base 1.5.1 gth_dp_options_postpro_new@Base 1.5.1 gth_dp_param_delete@Base 1.5.1 gth_dp_param_new@Base 1.5.1 gth_dp_param_new_with_range@Base 1.5.1 gth_dp_scores_protein_delete@Base 1.5.1 gth_dp_scores_protein_new@Base 1.5.1 gth_get_time@Base 1.5.1 gth_gff3_pgl_visitor_class@Base 1.5.1 gth_gff3_pgl_visitor_new@Base 1.5.1 gth_gff3_sa_visitor_class@Base 1.5.1 gth_gff3_sa_visitor_new@Base 1.5.1 gth_indent@Base 1.5.1 gth_input_add_cdna_file@Base 1.5.1 gth_input_add_genomic_file@Base 1.5.1 gth_input_add_protein_file@Base 1.5.1 gth_input_add_reference_file@Base 1.5.1 gth_input_both@Base 1.5.1 gth_input_bssmfile@Base 1.5.1 gth_input_bssmfilename@Base 1.5.1 gth_input_current_gen_alphabet@Base 1.5.1 gth_input_current_gen_seq_con@Base 1.5.1 gth_input_current_gen_seq_orig@Base 1.5.1 gth_input_current_gen_seq_orig_rc@Base 1.5.1 gth_input_current_gen_seq_tran@Base 1.5.1 gth_input_current_gen_seq_tran_rc@Base 1.5.1 gth_input_current_ref_alphabet@Base 1.5.1 gth_input_current_ref_seq_con@Base 1.5.1 gth_input_current_ref_seq_orig@Base 1.5.1 gth_input_current_ref_seq_orig_rc@Base 1.5.1 gth_input_current_ref_seq_tran@Base 1.5.1 gth_input_current_ref_seq_tran_rc@Base 1.5.1 gth_input_delete_complete@Base 1.5.1 gth_input_delete_current@Base 1.5.1 gth_input_determine_genomic_file_index@Base 1.5.1 gth_input_determine_reference_file_index@Base 1.5.1 gth_input_echo_genomic_description@Base 1.5.1 gth_input_echo_reference_description@Base 1.5.1 gth_input_echo_reference_sequence@Base 1.5.1 gth_input_forward@Base 1.5.1 gth_input_genomic_file_total_length@Base 1.5.1 gth_input_genomic_substring_from@Base 1.5.1 gth_input_genomic_substring_to@Base 1.5.1 gth_input_genomicfrompos_ptr@Base 1.5.1 gth_input_genomictopos_ptr@Base 1.5.1 gth_input_genomicwidth_ptr@Base 1.5.1 gth_input_get_alphatype@Base 1.5.1 gth_input_get_genomic_description@Base 1.5.1 gth_input_get_genomic_filename@Base 1.5.1 gth_input_get_genomic_range@Base 1.5.1 gth_input_get_reference_filename@Base 1.5.1 gth_input_get_reference_range@Base 1.5.1 gth_input_get_relative_genomic_range@Base 1.5.1 gth_input_load_genomic_file_func@Base 1.5.1 gth_input_load_reference_file_func@Base 1.5.1 gth_input_load_scorematrix@Base 1.5.1 gth_input_make_indices@Base 1.5.1 gth_input_md5ids@Base 1.5.1 gth_input_new@Base 1.5.1 gth_input_num_of_gen_files@Base 1.5.1 gth_input_num_of_gen_seqs@Base 1.5.1 gth_input_num_of_ref_files@Base 1.5.1 gth_input_num_of_ref_seqs@Base 1.5.1 gth_input_original_genomic_sequence@Base 1.5.1 gth_input_overall_alphatype@Base 1.5.1 gth_input_preprocess@Base 1.5.1 gth_input_proteinsmap@Base 1.5.1 gth_input_ref_file_is_dna@Base 1.5.1 gth_input_reverse@Base 1.5.1 gth_input_save_gen_desc@Base 1.5.1 gth_input_save_gen_id@Base 1.5.1 gth_input_save_gen_identifier@Base 1.5.1 gth_input_save_gen_md5@Base 1.5.1 gth_input_save_ref_desc@Base 1.5.1 gth_input_save_ref_id@Base 1.5.1 gth_input_save_ref_md5@Base 1.5.1 gth_input_score_matrix@Base 1.5.1 gth_input_score_matrix_alpha@Base 1.5.1 gth_input_set_and_check_substring_spec@Base 1.5.1 gth_input_set_forward_only@Base 1.5.1 gth_input_set_reverse_only@Base 1.5.1 gth_input_use_substring_spec@Base 1.5.1 gth_intermediate_output_is_correct@Base 1.5.1 gth_match_processor@Base 1.5.1 gth_matches_are_equal@Base 1.5.1 gth_md5_cache_delete@Base 1.5.1 gth_md5_cache_get@Base 1.5.1 gth_md5_cache_new@Base 1.5.1 gth_parse_options@Base 1.5.1 gth_path_matrix_delete@Base 1.5.1 gth_path_matrix_new@Base 1.5.1 gth_path_matrix_set_max_path@Base 1.5.1 gth_path_matrix_show@Base 1.5.1 gth_path_walker_actual_eops@Base 1.5.1 gth_path_walker_delete@Base 1.5.1 gth_path_walker_eop_distance@Base 1.5.1 gth_path_walker_gen_distance@Base 1.5.1 gth_path_walker_has_next@Base 1.5.1 gth_path_walker_is_forward@Base 1.5.1 gth_path_walker_new@Base 1.5.1 gth_path_walker_next@Base 1.5.1 gth_path_walker_ref_distance@Base 1.5.1 gth_path_walker_show@Base 1.5.1 gth_path_walker_steps_in_current_eop@Base 1.5.1 gth_path_walker_try_steps@Base 1.5.1 gth_pgl_add_sa@Base 1.5.1 gth_pgl_collection_delete@Base 1.5.1 gth_pgl_collection_new@Base 1.5.1 gth_pgl_collection_set_max_ags@Base 1.5.1 gth_pgl_collection_size@Base 1.5.1 gth_pgl_collection_sortAGSs@Base 1.5.1 gth_pgl_collection_traverse@Base 1.5.1 gth_pgl_delete@Base 1.5.1 gth_pgl_filenum@Base 1.5.1 gth_pgl_gen_id@Base 1.5.1 gth_pgl_genomic_offset@Base 1.5.1 gth_pgl_genomic_range@Base 1.5.1 gth_pgl_genomic_strand@Base 1.5.1 gth_pgl_get_ags@Base 1.5.1 gth_pgl_is_forward@Base 1.5.1 gth_pgl_new@Base 1.5.1 gth_pgl_num_of_ags@Base 1.5.1 gth_pgl_seqnum@Base 1.5.1 gth_pgl_set_max_ags@Base 1.5.1 gth_pgl_total_length@Base 1.5.1 gth_pgl_visitor_cast@Base 1.5.1 gth_pgl_visitor_create@Base 1.5.1 gth_pgl_visitor_delete@Base 1.5.1 gth_pgl_visitor_preface@Base 1.5.1 gth_pgl_visitor_set_region_mapping@Base 1.5.1 gth_pgl_visitor_trailer@Base 1.5.1 gth_pgl_visitor_visit_pgl@Base 1.5.1 gth_proc_sa_collection@Base 1.5.1 gth_process_intermediate_files@Base 1.5.1 gth_region_factory_delete@Base 1.5.1 gth_region_factory_get_seqid@Base 1.5.1 gth_region_factory_new@Base 1.5.1 gth_region_factory_offset@Base 1.5.1 gth_region_factory_save@Base 1.5.1 gth_run_header_show@Base 1.5.1 gth_sa_B_is_better_than_A@Base 1.5.1 gth_sa_acceptor_site_prob@Base 1.5.1 gth_sa_acceptor_site_range@Base 1.5.1 gth_sa_add_exon@Base 1.5.1 gth_sa_add_intron@Base 1.5.1 gth_sa_alphastring@Base 1.5.1 gth_sa_alphatype@Base 1.5.1 gth_sa_append@Base 1.5.1 gth_sa_average_splice_site_prob@Base 1.5.1 gth_sa_backtrace_path@Base 1.5.1 gth_sa_calc_polyAtailpos@Base 1.5.1 gth_sa_call_number@Base 1.5.1 gth_sa_cmp_genomic_actual@Base 1.5.1 gth_sa_cmp_genomic_forward@Base 1.5.1 gth_sa_collection_contains_sa@Base 1.5.1 gth_sa_collection_delete@Base 1.5.1 gth_sa_collection_insert_sa@Base 1.5.1 gth_sa_collection_iterator_delete@Base 1.5.1 gth_sa_collection_iterator_new@Base 1.5.1 gth_sa_collection_iterator_next@Base 1.5.1 gth_sa_collection_new@Base 1.5.1 gth_sa_collection_set_md5s@Base 1.5.1 gth_sa_collection_traverse@Base 1.5.1 gth_sa_collections_are_equal@Base 1.5.1 gth_sa_contains_no_zero_base_exons@Base 1.5.1 gth_sa_coverage@Base 1.5.1 gth_sa_coverage_char@Base 1.5.1 gth_sa_cumlen_scored_exons@Base 1.5.1 gth_sa_cutoff_end@Base 1.5.1 gth_sa_cutoff_start@Base 1.5.1 gth_sa_cutoff_walked_path@Base 1.5.1 gth_sa_delete@Base 1.5.1 gth_sa_determine_cutoffs@Base 1.5.1 gth_sa_donor_site_prob@Base 1.5.1 gth_sa_donor_site_range@Base 1.5.1 gth_sa_echo_alignment@Base 1.5.1 gth_sa_echo_genomic_description@Base 1.5.1 gth_sa_echo_reference_description@Base 1.5.1 gth_sa_echo_reference_sequence@Base 1.5.1 gth_sa_eopcutoff_end@Base 1.5.1 gth_sa_eopcutoff_start@Base 1.5.1 gth_sa_exon_score@Base 1.5.1 gth_sa_exons_are_forward_and_consecutive@Base 1.5.1 gth_sa_filter_delete@Base 1.5.1 gth_sa_filter_filter_sa@Base 1.5.1 gth_sa_filter_new@Base 1.5.1 gth_sa_filter_register_options@Base 1.5.1 gth_sa_gen_desc@Base 1.5.1 gth_sa_gen_dp_end@Base 1.5.1 gth_sa_gen_dp_end_show@Base 1.5.1 gth_sa_gen_dp_length@Base 1.5.1 gth_sa_gen_dp_start@Base 1.5.1 gth_sa_gen_dp_start_show@Base 1.5.1 gth_sa_gen_file_num@Base 1.5.1 gth_sa_gen_id@Base 1.5.1 gth_sa_gen_id_str@Base 1.5.1 gth_sa_gen_md5@Base 1.5.1 gth_sa_gen_offset@Base 1.5.1 gth_sa_gen_seq_num@Base 1.5.1 gth_sa_gen_strand@Base 1.5.1 gth_sa_gen_strand_char@Base 1.5.1 gth_sa_gen_strand_forward@Base 1.5.1 gth_sa_gen_total_length@Base 1.5.1 gth_sa_genomic_cov_is_highest@Base 1.5.1 gth_sa_genomic_exon_length@Base 1.5.1 gth_sa_genomiccutoff_end@Base 1.5.1 gth_sa_genomiccutoff_start@Base 1.5.1 gth_sa_get_alignment_lines@Base 1.5.1 gth_sa_get_editoperations@Base 1.5.1 gth_sa_get_editoperations_length@Base 1.5.1 gth_sa_get_exon@Base 1.5.1 gth_sa_get_exons@Base 1.5.1 gth_sa_get_intron@Base 1.5.1 gth_sa_gff3_target_attribute@Base 1.5.1 gth_sa_indelcount@Base 1.5.1 gth_sa_intron_length@Base 1.5.1 gth_sa_is_poor@Base 1.5.1 gth_sa_is_valid@Base 1.5.1 gth_sa_left_genomic_exon_border@Base 1.5.1 gth_sa_left_intron_border@Base 1.5.1 gth_sa_new@Base 1.5.1 gth_sa_new_and_set@Base 1.5.1 gth_sa_num_of_exons@Base 1.5.1 gth_sa_num_of_introns@Base 1.5.1 gth_sa_polyAtail_start@Base 1.5.1 gth_sa_polyAtail_stop@Base 1.5.1 gth_sa_prepend@Base 1.5.1 gth_sa_range_actual@Base 1.5.1 gth_sa_range_forward@Base 1.5.1 gth_sa_ref_desc@Base 1.5.1 gth_sa_ref_file_num@Base 1.5.1 gth_sa_ref_id@Base 1.5.1 gth_sa_ref_id_str@Base 1.5.1 gth_sa_ref_md5@Base 1.5.1 gth_sa_ref_seq_num@Base 1.5.1 gth_sa_ref_strand_char@Base 1.5.1 gth_sa_ref_strand_forward@Base 1.5.1 gth_sa_ref_total_length@Base 1.5.1 gth_sa_referencecutoff_end@Base 1.5.1 gth_sa_referencecutoff_start@Base 1.5.1 gth_sa_remove_zero_base_exons@Base 1.5.1 gth_sa_right_genomic_exon_border@Base 1.5.1 gth_sa_right_intron_border@Base 1.5.1 gth_sa_save_ref_md5@Base 1.5.1 gth_sa_score@Base 1.5.1 gth_sa_set@Base 1.5.1 gth_sa_set_alphatype@Base 1.5.1 gth_sa_set_coverage@Base 1.5.1 gth_sa_set_cumlen_scored_exons@Base 1.5.1 gth_sa_set_cutoffs_end@Base 1.5.1 gth_sa_set_cutoffs_start@Base 1.5.1 gth_sa_set_gen_dp_length@Base 1.5.1 gth_sa_set_gen_dp_start@Base 1.5.1 gth_sa_set_gen_file_num@Base 1.5.1 gth_sa_set_gen_id@Base 1.5.1 gth_sa_set_gen_offset@Base 1.5.1 gth_sa_set_gen_seq_num@Base 1.5.1 gth_sa_set_gen_strand@Base 1.5.1 gth_sa_set_gen_total_length@Base 1.5.1 gth_sa_set_highest_cov@Base 1.5.1 gth_sa_set_polyAtail_start@Base 1.5.1 gth_sa_set_polyAtail_stop@Base 1.5.1 gth_sa_set_ref_file_num@Base 1.5.1 gth_sa_set_ref_id@Base 1.5.1 gth_sa_set_ref_seq_num@Base 1.5.1 gth_sa_set_ref_strand@Base 1.5.1 gth_sa_set_ref_total_length@Base 1.5.1 gth_sa_set_score@Base 1.5.1 gth_sa_show@Base 1.5.1 gth_sa_show_exons@Base 1.5.1 gth_sa_visitor_cast@Base 1.5.1 gth_sa_visitor_create@Base 1.5.1 gth_sa_visitor_delete@Base 1.5.1 gth_sa_visitor_preface@Base 1.5.1 gth_sa_visitor_trailer@Base 1.5.1 gth_sa_visitor_visit_sa@Base 1.5.1 gth_sas_are_equal@Base 1.5.1 gth_save_chain@Base 1.5.1 gth_seq_con_cast@Base 1.5.1 gth_seq_con_class_new@Base 1.5.1 gth_seq_con_create@Base 1.5.1 gth_seq_con_delete@Base 1.5.1 gth_seq_con_demand_orig_seq@Base 1.5.1 gth_seq_con_echo_description@Base 1.5.1 gth_seq_con_get_alphabet@Base 1.5.1 gth_seq_con_get_description@Base 1.5.1 gth_seq_con_get_length@Base 1.5.1 gth_seq_con_get_orig_seq@Base 1.5.1 gth_seq_con_get_orig_seq_rc@Base 1.5.1 gth_seq_con_get_range@Base 1.5.1 gth_seq_con_get_relative_range@Base 1.5.1 gth_seq_con_get_tran_seq@Base 1.5.1 gth_seq_con_get_tran_seq_rc@Base 1.5.1 gth_seq_con_num_of_seqs@Base 1.5.1 gth_seq_con_total_length@Base 1.5.1 gth_show_on_stdout@Base 1.5.1 gth_show_on_stdout_vmatch@Base 1.5.1 gth_similarity_filter@Base 1.5.1 gth_sortAGSs@Base 1.5.1 gth_splice_site_model_U12intronmodel_set_usage@Base 1.5.1 gth_splice_site_model_delete@Base 1.5.1 gth_splice_site_model_load_bssm@Base 1.5.1 gth_splice_site_model_new@Base 1.5.1 gth_splice_site_model_set_U12typedonorprob@Base 1.5.1 gth_splice_site_model_set_U12typedonorprob_one_mismatch@Base 1.5.1 gth_spliced_seq_border_length@Base 1.5.1 gth_spliced_seq_delete@Base 1.5.1 gth_spliced_seq_new@Base 1.5.1 gth_spliced_seq_new_with_comments@Base 1.5.1 gth_spliced_seq_num_of_borders@Base 1.5.1 gth_spliced_seq_orig_to_spliced_pos@Base 1.5.1 gth_spliced_seq_pos_is_border@Base 1.5.1 gth_stat_add_to_matchnumdistri@Base 1.5.1 gth_stat_add_to_refseqcovdistri@Base 1.5.1 gth_stat_add_to_sa_alignment_score_distri@Base 1.5.1 gth_stat_add_to_sa_coverage_distri@Base 1.5.1 gth_stat_delete@Base 1.5.1 gth_stat_enable_exondistri@Base 1.5.1 gth_stat_enable_gthfilestat_mode@Base 1.5.1 gth_stat_enable_introndistri@Base 1.5.1 gth_stat_enable_matchnumdistri@Base 1.5.1 gth_stat_enable_refseqcovdistri@Base 1.5.1 gth_stat_enable_sa_stats@Base 1.5.1 gth_stat_get_exondistri@Base 1.5.1 gth_stat_get_exondistribution@Base 1.5.1 gth_stat_get_introndistri@Base 1.5.1 gth_stat_get_introndistribution@Base 1.5.1 gth_stat_get_matchnumdistri@Base 1.5.1 gth_stat_get_numofSAs@Base 1.5.1 gth_stat_get_refseqcovdistri@Base 1.5.1 gth_stat_increase_numofPGLs_stored@Base 1.5.1 gth_stat_increase_numofchains@Base 1.5.1 gth_stat_increase_totalsizeofbacktracematricesinMB@Base 1.5.1 gth_stat_increment_numofSAs@Base 1.5.1 gth_stat_increment_numofautointroncutoutcalls@Base 1.5.1 gth_stat_increment_numofbacktracematrixallocations@Base 1.5.1 gth_stat_increment_numoffailedDPparameterallocations@Base 1.5.1 gth_stat_increment_numoffailedmatrixallocations@Base 1.5.1 gth_stat_increment_numofremovedzerobaseexons@Base 1.5.1 gth_stat_increment_numofundeterminedSAs@Base 1.5.1 gth_stat_increment_numofunsuccessfulintroncutoutDPs@Base 1.5.1 gth_stat_new@Base 1.5.1 gth_stat_show@Base 1.5.1 gth_txt_pgl_visitor_class@Base 1.5.1 gth_txt_pgl_visitor_new@Base 1.5.1 gth_txt_sa_visitor_class@Base 1.5.1 gth_txt_sa_visitor_new@Base 1.5.1 gth_xml_final_sa_visitor_class@Base 1.5.1 gth_xml_final_sa_visitor_new@Base 1.5.1 gth_xml_inter_sa_visitor_class@Base 1.5.1 gth_xml_inter_sa_visitor_new@Base 1.5.1 gth_xml_inter_sa_visitor_set_outfp@Base 1.5.1 gth_xml_pgl_visitor_class@Base 1.5.1 gth_xml_pgl_visitor_new@Base 1.5.1 gth_xml_show_leader@Base 1.5.1 gth_xml_show_trailer@Base 1.5.1 gthcalcSAdistributions@Base 1.5.1 gthcalcsplicesitescore@Base 1.5.1 gthclusterSAstoPGLs@Base 1.5.1 gthfillthethreealignmentlines@Base 1.5.1 gthfillthetwoalignmentlines@Base 1.5.1 gthgetcodon@Base 1.5.1 gthoutput_delete@Base 1.5.1 gthoutput_new@Base 1.5.1 gthshowORFs@Base 1.5.1 gthshowalignmentdna@Base 1.5.1 gthshowalignmentprotein@Base 1.5.1 gthtraversealignment@Base 1.5.1 hashfirstcodes_getencseqkmers_twobitencoding@Base 1.5.1 kftp_connect@Base 1.5.1 kftp_connect_file@Base 1.5.1 kftp_parse_url@Base 1.5.1 kftp_reconnect@Base 1.5.1 khttp_connect_file@Base 1.5.1 khttp_parse_url@Base 1.5.1 kmemmem@Base 1.5.1 knet_close@Base 1.5.1 knet_dopen@Base 1.5.1 knet_open@Base 1.5.1 knet_read@Base 1.5.1 knet_seek@Base 1.5.1 ksplit_core@Base 1.5.1 ksprintf@Base 1.5.1 kstrnstr@Base 1.5.1 kstrstr@Base 1.5.1 kstrtok@Base 1.5.1 mg_codon2amino@Base 1.5.1 mg_combinedscore@Base 1.5.1 mg_compute_gene_prediction@Base 1.5.1 mg_computepath@Base 1.5.1 mg_outputwriter@Base 1.5.1 mg_reverse_complement@Base 1.5.1 mg_xmlparser@Base 1.5.1 o_hd_tags@Base 1.5.1 o_pg_tags@Base 1.5.1 o_rg_tags@Base 1.5.1 o_sq_tags@Base 1.5.1 optional_tags@Base 1.5.1 r_hd_tags@Base 1.5.1 r_pg_tags@Base 1.5.1 r_rg_tags@Base 1.5.1 r_sq_tags@Base 1.5.1 razf_close@Base 1.5.1 razf_dopen2@Base 1.5.1 razf_dopen@Base 1.5.1 razf_get_data_size@Base 1.5.1 razf_jump@Base 1.5.1 razf_open2@Base 1.5.1 razf_open@Base 1.5.1 razf_read@Base 1.5.1 razf_seek2@Base 1.5.1 razf_seek@Base 1.5.1 razf_skip@Base 1.5.1 razf_tell2@Base 1.5.1 razf_write@Base 1.5.1 required_tags@Base 1.5.1 reset_decoder@Base 1.5.1 runsuffixerator@Base 1.5.1 sam_close@Base 1.5.1 sam_header2key_val@Base 1.5.1 sam_header2list@Base 1.5.1 sam_header2tbl@Base 1.5.1 sam_header2tbl_n@Base 1.5.1 sam_header_clone@Base 1.5.1 sam_header_free@Base 1.5.1 sam_header_merge@Base 1.5.1 sam_header_parse2@Base 1.5.1 sam_header_parse@Base 1.5.1 sam_header_read2@Base 1.5.1 sam_header_read@Base 1.5.1 sam_header_write@Base 1.5.1 sam_open@Base 1.5.1 sam_read1@Base 1.5.1 sam_tbl_destroy@Base 1.5.1 sam_tbl_get@Base 1.5.1 sam_tbl_size@Base 1.5.1 samclose@Base 1.5.1 samfaipath@Base 1.5.1 samopen@Base 1.5.1 sampileup@Base 1.5.1 samread@Base 1.5.1 samthreads@Base 1.5.1 samwrite@Base 1.5.1 storefirstcodes_getencseqkmers_twobitencoding@Base 1.5.1 storerandomcodes_getencseqkmers_twobitencoding@Base 1.5.1 streamsuffixarray@Base 1.5.1 test_mem@Base 1.5.1 types@Base 1.5.1 u_rg_tags@Base 1.5.1 u_sq_tags@Base 1.5.1 unique_tags@Base 1.5.1 unit_test_distr_func@Base 1.5.1 debian/genometools-common.install0000664000000000000000000000177612116110454014407 0ustar usr/bin/gtdata/doc usr/share/genometools/gtdata usr/bin/gtdata/obo_files usr/share/genometools/gtdata usr/bin/gtdata/sketch usr/share/genometools/gtdata usr/bin/gtdata/trans usr/share/genometools/gtdata usr/bin/gtdata/modules/fileutils.lua usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/gtdoclib.lua usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/gtdoclib usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/gtlua.lua usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/gtlua usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/gtmodulehelper.lua usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/stringext.lua usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/warning.lua usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/gtlua.lua usr/share/genometools/gtdata/modules usr/bin/gtdata/modules/external/md5.lua usr/share/genometools/gtdata/modules/external usr/bin/gtdata/modules/external/re.lua usr/share/genometools/gtdata/modules/external debian/genometools.manpages0000664000000000000000000000001512116110454013227 0ustar debian/man/* debian/changelog0000664000000000000000000000541312313344327011047 0ustar genometools (1.5.1-2ubuntu1) trusty; urgency=low * Build with correct machine flags on arm64, resolving FTBFS. -- Daniel T Chen Sat, 22 Mar 2014 13:30:31 -0400 genometools (1.5.1-2) unstable; urgency=low * debian/control - Add myself to Uploaders - cme fix dpkg-control - Follow liblua package name transition Closes: #728017 - Remove depends from virtual package python-ctypes which is provided by python * provide symbols file -- Andreas Tille Mon, 28 Oct 2013 08:17:04 +0100 genometools (1.5.1-1) unstable; urgency=low * New upstream release. -- Sascha Steinbiss Thu, 07 Mar 2013 14:08:05 +0100 genometools (1.5.0-2) unstable; urgency=low * Patch manuals not to use includecomment/excludecomment -- Sascha Steinbiss Sat, 16 Feb 2013 16:58:11 +0100 genometools (1.5.0-1) unstable; urgency=low * New upstream release * bugfixes and cleanups * development tool `gt sain' added to run an induced suffix array sorting algorithm * the -typecheck option in the `gt gff3` and `gt gff3validator` tools now also validates parent (part-of) relationships, see -help output for details * new option -encseq besides -seqfile(s) and -regionmapping to select a encseq index as a sequence source * GtBioseq backend switched to GtEncseq * GtSeqCol is now an interface, GtEncseqCol added * GtRankedList added * GtSNPAnnotatorStream and `gt snpper' tool added * node sorting code is now aware of MD5 hash presence * compatibility with old Pango versions inproved -- Sascha Steinbiss Tue, 05 Feb 2013 18:52:22 +0100 genometools (1.4.2-4) unstable; urgency=low * Remove shlibs.local file -- Sascha Steinbiss Tue, 09 Oct 2012 12:24:17 +0200 genometools (1.4.2-3) unstable; urgency=low * Build with pbuilder to obtain reasonable libc dependency (>= 2.13) -- Sascha Steinbiss Tue, 09 Oct 2012 10:04:34 +0200 genometools (1.4.2-2) unstable; urgency=low * Fixed libpango-dev dependency * Updated manpages -- Sascha Steinbiss Mon, 08 Oct 2012 07:51:52 +0200 genometools (1.4.2-1) unstable; urgency=low * New upstream release [ Sponsor Steffen Moeller ] * Update of policy to 3.9.4 * Added DMUA flag -- Sascha Steinbiss Fri, 05 Oct 2012 15:47:56 +0200 genometools (1.4.1-1) unstable; urgency=low * Initial release (Closes: #657923) * the GFF3 parser now handles children which are defined before their parents * many small improvements to the GFF3 parser -- Sascha Steinbiss Mon, 09 Jul 2012 14:10:23 +0100 debian/genometools-doc.docs0000664000000000000000000000005412116110454013132 0ustar doc/manuals/*.pdf doc/devguide/devguide.pdf debian/genometools.install0000664000000000000000000000002712116110454013105 0ustar usr/bin/gt usr/bin/gt debian/patches/0000775000000000000000000000000012313344260010615 5ustar debian/patches/add-hardening0000664000000000000000000000064412116110454013226 0ustar --- genometools-1.4.1.orig/Makefile +++ genometools-1.4.1/Makefile @@ -25,6 +25,8 @@ -I$(CURDIR)/src/external/bzip2-1.0.6 \ -I$(CURDIR)/src/external/libtecla-1.6.1 \ -I$(CURDIR)/src/external/samtools-0.1.18 +#Debian hardening +CFLAGS+=`dpkg-buildflags --get CFLAGS` `dpkg-buildflags --get CPPFLAGS` # these variables are exported by the configuration script ifndef CC CC:=gcc debian/patches/arm64_no_m64.patch0000664000000000000000000000117512313344260013755 0ustar Index: genometools-1.5.1/Makefile =================================================================== --- genometools-1.5.1.orig/Makefile 2014-03-22 13:29:40.893536571 -0400 +++ genometools-1.5.1/Makefile 2014-03-22 13:30:23.407728091 -0400 @@ -374,10 +374,12 @@ ifeq ($(m64),yes) ifneq ($(MACHINE),ia64) ifneq ($(MACHINE),alpha) - GT_CFLAGS += -m64 - HMMER_CFLAGS += -m64 - GT_LDFLAGS += -m64 - SQLITE_CFLAGS += -m64 + ifneq ($(MACHINE),aarch64) + GT_CFLAGS += -m64 + HMMER_CFLAGS += -m64 + GT_LDFLAGS += -m64 + SQLITE_CFLAGS += -m64 + endif endif endif endif debian/patches/remove-gitignores0000664000000000000000000000062712116110454014207 0ustar Description: Remove unneeded .gitignores or .gitignore entries Author: Sascha Steinbiss --- a/doc/devguide/.gitignore +++ /dev/null @@ -1 +0,0 @@ -devguide.pdf --- a/doc/manuals/.gitignore +++ b/doc/manuals/.gitignore @@ -1,10 +1,2 @@ -comment.cut -*.pdf -api_reference.tex -gtscript_reference.tex -U89959.fna -read1.fna -read2.fna -tallymer-tmp.tex Q1.gz tagerator-tmp.tex debian/patches/series0000664000000000000000000000011412313343630012026 0ustar split_manuals adding_soname libbam-fix remove-gitignores arm64_no_m64.patch debian/patches/libbam-fix0000664000000000000000000001113312116110454012546 0ustar Description: add static link to libbam.a The Debian libbam package only provides a static library to link to, adding this to the Makefile. Author: Sascha Steinbiss --- a/Makefile +++ b/Makefile @@ -251,7 +251,7 @@ # add necessary shared lib dependencies then not building them ourselves ifeq ($(useshared),yes) DEPLIBS:=-lm -lbz2 -lz -lexpat -llua5.1-lpeg -llua5.1 -llua5.1-md5 \ - -llua5.1-filesystem -llua5.1-des56 -lbam + -llua5.1-filesystem -llua5.1-des56 else DEPLIBS:= endif @@ -591,6 +591,10 @@ @$(RANLIB) $@ endif +ifeq ($(useshared),yes) + ADDITIONAL_STATIC_DEPS:=/usr/lib/libbam.a +endif + lib/libgenometools.a: obj/gt_config.h $(LIBGENOMETOOLS_OBJ) @echo "[link $(@F)]" @test -d $(@D) || mkdir -p $(@D) @@ -608,12 +612,13 @@ lib/libgenometools$(SHARED_OBJ_NAME_EXT): obj/gt_config.h \ $(LIBGENOMETOOLS_OBJ) \ $(ADDITIONAL_SO_DEPS) \ - $(ADDITIONAL_ZLIBS) + $(ADDITIONAL_ZLIBS) \ + $(ADDITIONAL_STATIC_DEPS) @echo "[link $(@F)]" @test -d $(@D) || mkdir -p $(@D) @$(CC) $(EXP_LDFLAGS) $(GT_LDFLAGS) $(ADDITIONAL_SO_DEPS) $(SHARED) \ -Wl,-soname,$(notdir $@)$(SONAME_VERSION) $(LIBGENOMETOOLS_OBJ) \ - -o $@$(SONAME_VERSION) $(GTSHAREDLIB_LIBDEP) + -o $@$(SONAME_VERSION) $(GTSHAREDLIB_LIBDEP) $(ADDITIONAL_STATIC_DEPS) lib/libtecla.a: $(LIBTECLA_OBJ) @echo "[link $(@F)]" @@ -634,51 +639,61 @@ $(eval $(call PROGRAM_template, bin/skproto, $(SKPROTO_OBJ) \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/gt, $(GTMAIN_OBJ) $(TOOLS_OBJ) \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(GTLIBS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/examples/custom_stream, \ obj/src/examples/custom_stream.o \ lib/libgenometools.a\ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/examples/gff3sort, \ obj/src/examples/gff3sort.o \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/examples/gff3validator, \ obj/src/examples/gff3validator.o \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/examples/noop, \ obj/src/examples/noop.o \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/examples/sketch_constructed, \ obj/src/examples/sketch_constructed.o \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/examples/sketch_parsed, \ obj/src/examples/sketch_parsed.o \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/examples/sketch_parsed_with_ctrack, \ obj/src/examples/sketch_parsed_with_ctrack.o \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) $(eval $(call PROGRAM_template, bin/examples/sketch_parsed_with_ordering, \ obj/src/examples/sketch_parsed_with_ordering.o \ lib/libgenometools.a \ + $(ADDITIONAL_STATIC_DEPS) \ $(ADDITIONAL_ZLIBS))) bin/lua: $(LUAMAIN_OBJ) debian/patches/adding_soname0000664000000000000000000000364412116110454013334 0ustar Description: add soname to linker call in Makefile Upstream Makefile does not build a shared object with soname or version number. This patch adds support for sonames, as well a symlink from the .so to the .so.X file. Author: Sascha Steinbiss --- a/Makefile +++ b/Makefile @@ -96,6 +96,7 @@ SHARED_OBJ_NAME_EXT:=.so SHARED:=-shared endif +SONAME_VERSION:=.0 # compiled executables GTMAIN_SRC:=src/gt.c src/gtr.c src/gtt.c src/interactive.c @@ -249,7 +250,7 @@ # add necessary shared lib dependencies then not building them ourselves ifeq ($(useshared),yes) - DEPLIBS:=-lbz2 -lz -lexpat -llua5.1-lpeg -llua5.1 -llua5.1-md5 \ + DEPLIBS:=-lm -lbz2 -lz -lexpat -llua5.1-lpeg -llua5.1 -llua5.1-md5 \ -llua5.1-filesystem -llua5.1-des56 -lbam else DEPLIBS:= @@ -532,7 +533,7 @@ ifdef DESTDIR prefix:=$(DESTDIR)$(prefix) -endif + endif # allow to set patch program patch ?= patch @@ -610,8 +611,9 @@ $(ADDITIONAL_ZLIBS) @echo "[link $(@F)]" @test -d $(@D) || mkdir -p $(@D) - @$(CC) $(EXP_LDFLAGS) $(GT_LDFLAGS) $(ADDITIONAL_SO_DEPS) $(SHARED) $(LIBGENOMETOOLS_OBJ) \ - -o $@ $(GTSHAREDLIB_LIBDEP) + @$(CC) $(EXP_LDFLAGS) $(GT_LDFLAGS) $(ADDITIONAL_SO_DEPS) $(SHARED) \ + -Wl,-soname,$(notdir $@)$(SONAME_VERSION) $(LIBGENOMETOOLS_OBJ) \ + -o $@$(SONAME_VERSION) $(GTSHAREDLIB_LIBDEP) lib/libtecla.a: $(LIBTECLA_OBJ) @echo "[link $(@F)]" @@ -950,7 +952,8 @@ ifdef RANLIB $(RANLIB) $(prefix)/lib/libgenometools.a endif - cp lib/libgenometools$(SHARED_OBJ_NAME_EXT) $(prefix)/lib + cp lib/libgenometools$(SHARED_OBJ_NAME_EXT)$(SONAME_VERSION) $(prefix)/lib + ln -fs $(prefix)/lib/$(SHARED_OBJ_NAME_EXT)$(SONAME_VERSION) $(prefix)/lib/$(SHARED_OBJ_NAME_EXT) @echo '[build config script $(@F)]' sed -e 's!@CC@!$(CC)!' -e 's!@CFLAGS@!$(EXP_CFLAGS)!' \ -e 's!@CPPFLAGS@!$(subst ",\\",-I"$(prefix)/include" $(EXP_CPPFLAGS))!' \ debian/patches/split_manuals0000664000000000000000000003666712116110454013432 0ustar Description: split manuals into individual LaTeX files On some platforms, LaTeX will not build manuals properly when they share a single file in which text sections are marked or unmarked as comments using includecomment/excludecomment. Author: Sascha Steinbiss --- a/doc/manuals/matstat.tex +++ b/doc/manuals/matstat.tex @@ -1,2 +1,158 @@ -\def\BuildMatstat{} -\input{uniquesub} +\documentclass[12pt]{article} +\usepackage[a4paper,top=20mm,bottom=20mm,left=20mm,right=20mm]{geometry} +\usepackage{url} +\usepackage{alltt} +\usepackage{xspace} +\usepackage{times} +\usepackage{listings} +\usepackage{bbm} +\usepackage{verbatim} +\usepackage{optionman} + +\newcommand{\Substring}[3]{#1[#2..#3]} + +\newcommand{\Program}[0]{\texttt{matstat}\xspace} +\newcommand{\MS}[1]{\mathit{ms(s,#1)}} +\title{\Program: a program for computing\\ + matching statistics\\ + a manual} + +\author{\begin{tabular}{c} + \textit{Stefan Kurtz}\\ + Center for Bioinformatics,\\ + University of Hamburg + \end{tabular}} + +\begin{document} +\maketitle + +\section{The program \Program} + +The program \Program is called as follows: +\par +\noindent\Program [\textit{options}] \Showoption{query} \Showoptionarg{files} [\textit{options}] +\par +\Showoptionarg{files} is a white space separated list of at least one +filename. Any sequence occurring in any file specified in \Showoptionarg{files} +is called \textit{unit} in the following. +In addition to the mandatory option \Showoption{query}, the program +must be called with either option \Showoption{pck} or \Showoption{esa} +which specify to use a packed index or an enhanced suffix array for +a given set of subject sequences. + +\Program computes the \textit{matching statistics} for each unit. That is, +for each position \(i\) in +each unit, say \(s\) of length \(n\), \(\MS{i}=(l,j)\) is computed. Here +\(l\) is the largest integer such that \(\Substring{s}{i}{i+l-1}\) matches +a substring represented by the index and \(j\) is a start position of the +matching substring in the index. We say that \(l\) is the length of \(\MS{i}\) +and \(j\) is the subject position of \(\MS{i}\). + +The following options are available in \Program: + +\begin{Justshowoptions} +\begin{comment} +\Option{fmi}{$\Showoptionarg{indexname}$}{ +Use the old implementation of the FMindex. This option is not recommended. +} +\end{comment} + +\Option{esa}{$\Showoptionarg{indexname}$}{ +Use the given enhanced suffix array to compute the matches. +} + +\Option{pck}{$\Showoptionarg{indexname}$}{ +Use the packed index (an efficient representation of the FMindex) +to compute the matches. +} + + +\Option{query}{$\Showoptionarg{files}$}{ +Specify a white space separated list of query files containing the units. +At least one query file must be given. The files may be in +gzipped format, in which case they have to end with the suffix \texttt{.gz}. +} + +\Option{min}{$\ell$}{ +Specify the minimum value $\ell$ for the length of the matching statistics. +That is, for each unit \(s\) and each position \(i\) in \(s\), the program +reports all values \(i\) and \(\MS{i}\) if the +length of \(\MS{i}\) is at least \(\ell\). +} + +\Option{max}{$\ell$}{ +Specify the maximum length $\ell$ for the length of the matching statistics. +That is, for each unit \(s\) and each positions \(i\) in \(s\), the program +reports the values \(i\) and \(\MS{i}\) if the length of \(\MS{i}\) +is at most \(\ell\). +} + +\Option{output}{(\Showoptionkey{subjectpos}$\mid$\Showoptionkey{querypos}$\mid$\Showoptionkey{sequence})}{ +Specify what to output. At least one of the three keys words +$\Showoptionkey{subjectpos}$, +$\Showoptionkey{querypos}$, and +$\Showoptionkey{sequence}$ must be used. +Using the keyword $\Showoptionkey{subjectpos}$ shows the +subject position of the matching statistics. +Using the keyword $\Showoptionkey{querypos}$ shows the query position. +Using the keyword $\Showoptionkey{sequence}$ shows the sequence content +} + +\Helpoption + +\end{Justshowoptions} +The following conditions must be satisfied: +\begin{enumerate} +\item +Either option \Showoption{min} or option \Showoption{max} must be used. +\item +If both options \Showoption{min} and \Showoption{max} are used, then +the value specified by option \(\Showoption{min}\) must be smaller +than the value specified by option \(\Showoption{max}\). +\item +Either option \Showoption{pck} or \Showoption{esa} must be used. Both cannot +be combined. +\end{enumerate} + +\section{Examples} + +Suppose that in some directory, say \texttt{homo-sapiens}, we have 25 gzipped +fasta files containing all 24 human chromomsomes plus one file with +mitrochondrial sequences. These may have been downloaded from +\url{ftp://ftp.ensembl.org/pub/current_fasta/homo_sapiens_47_36i/dna}. + +In the first step, we construct the packed index for the entire genome: + +\begin{Output} +gt packedindex mkindex -dna -dir rev -parts 15 -bsize 10 -locfreq 32 + -indexname human-all -db homo-sapiens/*.gz +\end{Output} + +The program runs for almost two hours and delivers +an index \texttt{human-all} consisting of three files: + +\begin{Output} +ls -lh human-all.* +-rw-r----- 1 kurtz gistaff 37 2008-01-24 00:47 human-all.al1 +-rw-r----- 1 kurtz gistaff 1.9G 2008-01-24 02:37 human-all.bdx +-rw-r----- 1 kurtz gistaff 3.4K 2008-01-24 02:37 human-all.prj +\end{Output} + +This is used in the following call to the program \Program: + +\begin{Output} +gt matstat -output subjectpos querypos sequence -min 20 -max 30 + -query queryfile.fna -pck human-all +unit 0 (Mus musculus, chr 1, complete sequence) +22 20 390765125 actgtatctcaaaatataaa +253 21 258488266 gggaataaacatgtcattgag +254 20 258488267 ggaataaacatgtcattgag +275 20 900483549 taattctatttttctttctt +480 20 1008274536 gcttgaagatcatgatccag +.. +\end{Output} +Here, the first column shows the relative positions in unit 0 for which the +length of the matching statistics is between 20 and 30. The second column is +the corresponding length value. The third column shows position of the +matching sequence in the index, and the fourth shows the sequence content. +\end{document} --- a/doc/manuals/uniquesub.tex +++ b/doc/manuals/uniquesub.tex @@ -7,39 +7,14 @@ \usepackage{listings} \usepackage{bbm} \usepackage{verbatim} -\usepackage{ifthen} -\usepackage{comment} \usepackage{optionman} - -\ifthenelse{\isundefined{\BuildMatstat}}{% -\includecomment{AboutUniquesub} -\excludecomment{AboutMatstat} -\newcommand{\AboutUniquesubcmd}[1]{#1} -\newcommand{\AboutMatstatcmd}[1]{} -}{% -\includecomment{AboutMatstat} -\excludecomment{AboutUniquesub} -\newcommand{\AboutMatstatcmd}[1]{#1} -\newcommand{\AboutUniquesubcmd}[1]{} -} - \newcommand{\Substring}[3]{#1[#2..#3]} -\begin{AboutUniquesub} \newcommand{\Program}[0]{\texttt{uniquesub}\xspace} \newcommand{\Mup}[1]{\mathit{mup(s,#1)}} \title{\Program: a program for computing\\ minimum unique substrings\\ a manual} -\end{AboutUniquesub} - -\begin{AboutMatstat} -\newcommand{\Program}[0]{\texttt{matstat}\xspace} -\newcommand{\MS}[1]{\mathit{ms(s,#1)}} -\title{\Program: a program for computing\\ - matching statistics\\ - a manual} -\end{AboutMatstat} \author{\begin{tabular}{c} \textit{Stefan Kurtz}\\ @@ -54,47 +29,35 @@ The program \Program is called as follows: \par -\noindent\Program [\textit{options}] \Showoption{query} \Showoptionarg{files} [\textit{options}] +\noindent\Program [\textit{options}] \Showoption{query} \Showoptionarg{files} [\textit{options}] \par -\Showoptionarg{files} is a white space separated list of at least one +\Showoptionarg{files} is a white space separated list of at least one filename. Any sequence occurring in any file specified in \Showoptionarg{files} is called \textit{unit} in the following. In addition to the mandatory option \Showoption{query}, the program must be called with either option \Showoption{pck} or \Showoption{esa} -which specify to use a packed index or an enhanced suffix array for +which specify to use a packed index or an enhanced suffix array for a given set of subject sequences. -\begin{AboutUniquesub} \Program computes for all positions \(i\) in each unit, say \(s\) of length -\(n\), the length \(\Mup{i}\) of the minimum unique prefix +\(n\), the length \(\Mup{i}\) of the minimum unique prefix at position \(i\), if it exists. Uniqueness always refers to all substrings -represented by the index. \(\Mup{i}\) is defined by the following two +represented by the index. \(\Mup{i}\) is defined by the following two statements: \begin{itemize} \item If \(\Substring{s}{i}{n-1}\) is not unique in the index, then \(\Mup{i}=\bot\). That is, it is undefined. \item -If \(\Substring{s}{i}{n-1}\) is unique in the index, then \(\Mup{i}=m\), where -\(m\) is the smallest value such that \(i+m-1\leq n-1\) and +If \(\Substring{s}{i}{n-1}\) is unique in the index, then \(\Mup{i}=m\), where +\(m\) is the smallest value such that \(i+m-1\leq n-1\) and \(\Substring{s}{i}{i+m-1}\) occurs exactly once as a substring in the index. \end{itemize} -Note that it is possible that for all \(i\in[0,n-1]\) we have -\(\Mup{i}=\bot\), which means that unit \(s\) does not contain any unique +Note that it is possible that for all \(i\in[0,n-1]\) we have +\(\Mup{i}=\bot\), which means that unit \(s\) does not contain any unique substring. In this case, the program reports nothing for the corresponding unit. The program was developed for designing whole genome tiling arrays. The corresponding publication is \cite{GRAE:NIE:KUR:HUY:BIR:STU:FLI:2007}. -\end{AboutUniquesub} - -\begin{AboutMatstat} -\Program computes the \textit{matching statistics} for each unit. That is, -for each position \(i\) in -each unit, say \(s\) of length \(n\), \(\MS{i}=(l,j)\) is computed. Here -\(l\) is the largest integer such that \(\Substring{s}{i}{i+l-1}\) matches -a substring represented by the index and \(j\) is a start position of the -matching substring in the index. We say that \(l\) is the length of \(\MS{i}\) -and \(j\) is the subject position of \(\MS{i}\). -\end{AboutMatstat} The following options are available in \Program: @@ -117,58 +80,29 @@ \Option{query}{$\Showoptionarg{files}$}{ Specify a white space separated list of query files containing the units. -At least one query file must be given. The files may be in +At least one query file must be given. The files may be in gzipped format, in which case they have to end with the suffix \texttt{.gz}. } -\begin{AboutUniquesub} \Option{min}{$\ell$}{ Specify the minimum length $\ell$ of the minimum unique prefixes. -That is, for each unit \(s\) and each positions \(i\) in \(s\), the program -reports the values \(i\) and \(\Mup{i}\) whenever \(\Mup{i}\geq\ell\). +That is, for each unit \(s\) and each positions \(i\) in \(s\), the program +reports the values \(i\) and \(\Mup{i}\) whenever \(\Mup{i}\geq\ell\). } \Option{max}{$\ell$}{ Specify the maximum length $\ell$ of the minimum unique prefixes. -That is, for each unit \(s\) and each positions \(i\) in \(s\), the program +That is, for each unit \(s\) and each positions \(i\) in \(s\), the program reports the values \(i\) and \(\Mup{i}\) whenever \(\Mup{i}\leq\ell\). } \Option{output}{(\Showoptionkey{querypos}$\mid$\Showoptionkey{sequence})}{ Specify what to output. At least one of the two keys words -$\Showoptionkey{querypos}$ and $\Showoptionkey{sequence}$ must be used. +$\Showoptionkey{querypos}$ and $\Showoptionkey{sequence}$ must be used. Using the keyword $\Showoptionkey{querypos}$ shows the query position. Using the keyword $\Showoptionkey{sequence}$ shows the sequence content of the match. } -\end{AboutUniquesub} - -\begin{AboutMatstat} -\Option{min}{$\ell$}{ -Specify the minimum value $\ell$ for the length of the matching statistics. -That is, for each unit \(s\) and each position \(i\) in \(s\), the program -reports all values \(i\) and \(\MS{i}\) if the -length of \(\MS{i}\) is at least \(\ell\). -} - -\Option{max}{$\ell$}{ -Specify the maximum length $\ell$ for the length of the matching statistics. -That is, for each unit \(s\) and each positions \(i\) in \(s\), the program -reports the values \(i\) and \(\MS{i}\) if the length of \(\MS{i}\) -is at most \(\ell\). -} - -\Option{output}{(\Showoptionkey{subjectpos}$\mid$\Showoptionkey{querypos}$\mid$\Showoptionkey{sequence})}{ -Specify what to output. At least one of the three keys words -$\Showoptionkey{subjectpos}$, -$\Showoptionkey{querypos}$, and -$\Showoptionkey{sequence}$ must be used. -Using the keyword $\Showoptionkey{subjectpos}$ shows the -subject position of the matching statistics. -Using the keyword $\Showoptionkey{querypos}$ shows the query position. -Using the keyword $\Showoptionkey{sequence}$ shows the sequence content -} -\end{AboutMatstat} \Helpoption @@ -189,7 +123,7 @@ \section{Examples} Suppose that in some directory, say \texttt{homo-sapiens}, we have 25 gzipped -fasta files containing all 24 human chromomsomes plus one file with +fasta files containing all 24 human chromomsomes plus one file with mitrochondrial sequences. These may have been downloaded from \url{ftp://ftp.ensembl.org/pub/current_fasta/homo_sapiens_47_36i/dna}. @@ -200,7 +134,7 @@ -indexname human-all -db homo-sapiens/*.gz \end{Output} -The program runs for almost two hours and delivers +The program runs for almost two hours and delivers an index \texttt{human-all} consisting of three files: \begin{Output} @@ -212,9 +146,8 @@ This is used in the following call to the program \Program: -\begin{AboutUniquesub} \begin{Output} -gt uniquesub -output querypos -min 20 -max 30 -query queryfile.fna +gt uniquesub -output querypos -min 20 -max 30 -query queryfile.fna -pck human-all unit 0 (Mus musculus, chr 1, complete sequence) 1007 20 @@ -227,7 +160,7 @@ For all units \(s\) in the multiple \Fasta file \texttt{queryfile.fna}, a line is shown, reporting the number of the unit and the original fasta -header. Also, all for positions \(i\) in \(s\) satisfying +header. Also, all for positions \(i\) in \(s\) satisfying \(20\leq \Mup{i}\leq 30\), \(i\) and \(\Mup{i}\) is reported. The first column is the relative position in the unit sequence (counting @@ -238,7 +171,7 @@ \Showoption{output}: \begin{Output} -gt uniquesub -output querypos sequence -min 20 -max 30 +gt uniquesub -output querypos sequence -min 20 -max 30 -query queryfile.fna -pck human-all unit 0 (Mus musculus, chr 1, complete sequence) 1007 20 ctgacagtttttttttttta @@ -248,27 +181,7 @@ 1013 21 gttttttttttttactttata ... \end{Output} -\end{AboutUniquesub} -\begin{AboutMatstat} -\begin{Output} -gt matstat -output subjectpos querypos sequence -min 20 -max 30 - -query queryfile.fna -pck human-all -unit 0 (Mus musculus, chr 1, complete sequence) -22 20 390765125 actgtatctcaaaatataaa -253 21 258488266 gggaataaacatgtcattgag -254 20 258488267 ggaataaacatgtcattgag -275 20 900483549 taattctatttttctttctt -480 20 1008274536 gcttgaagatcatgatccag -.. -\end{Output} -Here, the first column shows the relative positions in unit 0 for which the -length of the matching statistics is between 20 and 30. The second column is -the corresponding length value. The third column shows position of the -matching sequence in the index, and the fourth shows the sequence content. -\end{AboutMatstat} - -\begin{AboutUniquesub} %\bibliographystyle{plain} %\bibliography{defines,kurtz} \begin{thebibliography}{1} @@ -280,5 +193,5 @@ \newblock {\em {Bioinformatics}}, {23 ISMB/ECCB 2007}:{i195--i204}, 2007. \end{thebibliography} -\end{AboutUniquesub} + \end{document} debian/genometools-doc.doc-base0000664000000000000000000000100412116110454013653 0ustar Document: genometools-doc Title: GenomeTools manuals Author: GenomeTools Team Abstract: User manuals for GenomeTools The GenomeTools contains a collection of useful tools for biological sequence analysis and -presentation combined into a single binary. . The toolkit contains binaries for sequence and annotation handling, sequence compression, index structure generation and access, annotation visualization, and much more. Section: Science/Biology Format: PDF Files: /usr/share/doc/genometools-doc/*.pdf.gz debian/watch0000664000000000000000000000010412116110454010207 0ustar version=3 http://genometools.org/pub/genometools-([0-9.]+)\.tar\.gz debian/libgenometools0.postinst0000664000000000000000000000154512116110454014077 0ustar #!/bin/sh # postinst script for #PACKAGE# # # see: dh_installdeb(1) set -e # summary of how this script can be called: # * `configure' # * `abort-upgrade' # * `abort-remove' `in-favour' # # * `abort-remove' # * `abort-deconfigure' `in-favour' # `removing' # # for details, see http://www.debian.org/doc/debian-policy/ or # the debian-policy package case "$1" in configure) ldconfig ;; abort-upgrade|abort-remove|abort-deconfigure) ;; *) echo "postinst called with unknown argument \`$1'" >&2 exit 1 ;; esac #DEBHELPER# exit 0 debian/upstream0000664000000000000000000000056612116110454010755 0ustar Name: GenomeTools Bug-Database: http://genometools.lighthouseapp.com/tickets Bug-Submit: http://genometools.lighthouseapp.com/projects/17855-genometools/tickets/new Contact: Sascha Steinbiss Homepage: http://genometools.org Repository: git://genometools.org/genometools.git Watch: | http://genometools.org/pub/genometools-([0-9.]+)\.tar\.gz debian/libgenometools0-dev.links0000664000000000000000000000006612116110454014105 0ustar usr/lib/libgenometools.so.0 usr/lib/libgenometools.so debian/libgenometools0.install0000664000000000000000000000004012116110454013647 0ustar lib/libgenometools.so.0 usr/lib debian/control0000664000000000000000000001100712313343430010566 0ustar Source: genometools Maintainer: Ubuntu Developers XSBC-Original-Maintainer: Debian Med Packaging Team Uploaders: Sascha Steinbiss , Andreas Tille Section: science Priority: optional Build-Depends: debhelper (>= 9), liblua5.1-0-dev, lua-md5-dev, lua-filesystem-dev, lua-lpeg-dev, libcairo2-dev, zlib1g-dev, libbz2-dev, libexpat1-dev, libncurses5-dev, libsqlite3-dev, libbam-dev, libpango1.0-dev, texlive-latex-base, texlive-latex-extra, texlive-fonts-extra, latex-xcolor, texlive-fonts-recommended, python Standards-Version: 3.9.4 Vcs-Browser: http://anonscm.debian.org/viewvc/debian-med/trunk/packages/genometools/trunk/ Vcs-Svn: svn://anonscm.debian.org/debian-med/trunk/packages/genometools/trunk/ Homepage: http://genometools.org Package: genometools Architecture: any Depends: ${shlibs:Depends}, ${misc:Depends}, genometools-common Description: versatile genome analysis toolkit The GenomeTools contains a collection of useful tools for biological sequence analysis and -presentation combined into a single binary. . The toolkit contains binaries for sequence and annotation handling, sequence compression, index structure generation and access, annotation visualization, and much more. Package: genometools-common Architecture: all Depends: ${misc:Depends}, liblua5.1-0, libcairo2, zlib1g, libbz2-1.0, libexpat1, libpth20, libncurses5, libsqlite3-0, libpango1.0-0 Description: shared data files for GenomeTools This package contains configuration files such as alphabet transformations, style files, etc. required to use the GenomeTools executable and/or library. Package: libgenometools0 Architecture: any Depends: ${shlibs:Depends}, ${misc:Depends}, genometools-common Description: versatile genome analysis library This package contains the GenomeTools shared library and header files. It offers efficient sequence analysis components, available via an object-oriented interface. . Besides basic bioinformatics data structures, the library contains components for sequence and annotation handling, sequence compression, index structure generation and access, efficient matching, annotation visualization and much more. Package: libgenometools0-dev Architecture: any Section: libdevel Depends: ${shlibs:Depends}, ${misc:Depends}, libgenometools0 (= ${binary:Version}) Description: development files for GenomeTools This package contains the GenomeTools static library and necessary header files. . Besides basic bioinformatics data structures, the library contains components for sequence and annotation handling, sequence compression, index structure generation and access, efficient matching, annotation visualization and much more. Package: genometools-doc Architecture: all Section: doc Depends: ${misc:Depends} Description: documentation for GenomeTools This package contains API documentation and tool documentation for GenomeTools. The GenomeTools toolkit contains binaries for sequence and annotation handling, sequence compression, index structure generation and access, annotation visualization, and much more. Package: genometools-dbg Architecture: any Section: debug Priority: extra Depends: ${shlibs:Depends}, ${misc:Depends}, genometools (= ${binary:Version}) | libgenometools0 (= ${binary:Version}) Description: versatile genome analysis toolkit, with debug symbols This package contains debug information stripped from the GenomeTools. You may decide to install it to help identifying issues, typically to help communication with upstream developers. Package: python-genometools Architecture: any Section: python Depends: ${shlibs:Depends}, ${misc:Depends}, ${python:Depends}, python-ctypes, libgenometools0 Description: Python bindings for genometools Partial Python2 bindings for the GenomeTools library. Besides basic bioinformatics data structures, the library contains components for sequence and annotation handling, sequence compression, index structure generation and access, efficient matching, annotation visualization and much more. debian/source/0000775000000000000000000000000012116110454010463 5ustar debian/source/format0000664000000000000000000000001412116110454011671 0ustar 3.0 (quilt) debian/compat0000664000000000000000000000000212116110454010361 0ustar 9 debian/libgenometools0-dev.install0000664000000000000000000000001412116110454014424 0ustar usr/include debian/rules0000775000000000000000000000263712116110454010253 0ustar #!/usr/bin/make -f # -*- makefile -*- #export DH_VERBOSE=1 export DESTDIR=$(CURDIR)/debian/tmp export DH_ALWAYS_EXCLUDE=.gitignore BITS:=$(shell dpkg-architecture | grep DEB_BUILD_ARCH_BITS | cut -f 2 -d'=') ifeq ($(BITS),64) 64BIT:=yes else 64BIT:=no endif %: dh $@ --parallel --with python2 override_dh_auto_clean: $(MAKE) cleanup cd doc/manuals; make cleanup # should be deleted inside doc/manuals/Makefile rm -f doc/manuals/annotationsketch.out \ doc/manuals/api_reference.tex \ doc/manuals/gtscript_reference.tex find doc . -name "*.toc" -delete rm -f www/genometools.org/htdocs/images/callbacks.png \ www/genometools.org/htdocs/images/parsed.png \ www/genometools.org/htdocs/images/constructed.png \ doc/manuals/annotationsketch.pdf rm -f www/genometools.org/htdocs/docs.html \ www/genometools.org/htdocs/examples.html \ www/genometools.org/htdocs/libgenometools.html rm -rf gtpython/build override_dh_auto_build: dh_auto_build --parallel -- useshared=yes 64bit=$(64BIT) opt=no errorcheck=no docs manuals override_dh_auto_test: #dh_auto_test -- useshared=yes 64bit=$(64BIT) testthreads=5 override_dh_auto_install: dh_auto_install -- useshared=yes 64bit=$(64BIT) opt=no errorcheck=no prefix=$(DESTDIR)/usr dh_auto_install --sourcedirectory=gtpython --destdir=$(CURDIR)/debian/python-genometools override_dh_strip: dh_strip --dbg-package=genometools-dbg debian/genometools.docs0000664000000000000000000000003412116110454012365 0ustar README CONTRIBUTORS VERSION debian/libgenometools0.postrm0000664000000000000000000000153312116110454013535 0ustar #!/bin/sh # postrm script for #PACKAGE# # # see: dh_installdeb(1) set -e # summary of how this script can be called: # * `remove' # * `purge' # * `upgrade' # * `failed-upgrade' # * `abort-install' # * `abort-install' # * `abort-upgrade' # * `disappear' # # for details, see http://www.debian.org/doc/debian-policy/ or # the debian-policy package case "$1" in purge|upgrade|failed-upgrade|abort-install|abort-upgrade|disappear) ;; remove) ldconfig ;; *) echo "postrm called with unknown argument \`$1'" >&2 exit 1 ;; esac #DEBHELPER# exit 0