attoparsec-0.13.2.4/0000755000000000000000000000000007346545000012275 5ustar0000000000000000attoparsec-0.13.2.4/Data/0000755000000000000000000000000007346545000013146 5ustar0000000000000000attoparsec-0.13.2.4/Data/Attoparsec.hs0000644000000000000000000000113707346545000015611 0ustar0000000000000000-- | -- Module : Data.Attoparsec -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient combinator parsing for -- 'Data.ByteString.ByteString' strings, loosely based on the Parsec -- library. -- -- This module is deprecated. Use "Data.Attoparsec.ByteString" -- instead. module Data.Attoparsec {-# DEPRECATED "This module will be removed in the next major release." #-} ( module Data.Attoparsec.ByteString ) where import Data.Attoparsec.ByteString attoparsec-0.13.2.4/Data/Attoparsec/0000755000000000000000000000000007346545000015253 5ustar0000000000000000attoparsec-0.13.2.4/Data/Attoparsec/ByteString.hs0000644000000000000000000001651507346545000017711 0ustar0000000000000000{-# LANGUAGE CPP #-} #if __GLASGOW_HASKELL__ >= 702 {-# LANGUAGE Trustworthy #-} #endif -- | -- Module : Data.Attoparsec.ByteString -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient combinator parsing for 'B.ByteString' strings, -- loosely based on the Parsec library. module Data.Attoparsec.ByteString ( -- * Differences from Parsec -- $parsec -- * Incremental input -- $incremental -- * Performance considerations -- $performance -- * Parser types I.Parser , Result , T.IResult(..) , I.compareResults -- * Running parsers , parse , feed , I.parseOnly , parseWith , parseTest -- ** Result conversion , maybeResult , eitherResult -- * Parsing individual bytes , I.word8 , I.anyWord8 , I.notWord8 , I.satisfy , I.satisfyWith , I.skip -- ** Lookahead , I.peekWord8 , I.peekWord8' -- ** Byte classes , I.inClass , I.notInClass -- * Efficient string handling , I.string , I.skipWhile , I.take , I.scan , I.runScanner , I.takeWhile , I.takeWhile1 , I.takeTill -- ** Consume all remaining input , I.takeByteString , I.takeLazyByteString -- * Combinators , try , () , choice , count , option , many' , many1 , many1' , manyTill , manyTill' , sepBy , sepBy' , sepBy1 , sepBy1' , skipMany , skipMany1 , eitherP , I.match -- * State observation and manipulation functions , I.endOfInput , I.atEnd ) where import Data.Attoparsec.Combinator import Data.List (intercalate) import qualified Data.Attoparsec.ByteString.Internal as I import qualified Data.Attoparsec.Internal as I import qualified Data.ByteString as B import Data.Attoparsec.ByteString.Internal (Result, parse) import qualified Data.Attoparsec.Internal.Types as T -- $parsec -- -- Compared to Parsec 3, attoparsec makes several tradeoffs. It is -- not intended for, or ideal for, all possible uses. -- -- * While attoparsec can consume input incrementally, Parsec cannot. -- Incremental input is a huge deal for efficient and secure network -- and system programming, since it gives much more control to users -- of the library over matters such as resource usage and the I/O -- model to use. -- -- * Much of the performance advantage of attoparsec is gained via -- high-performance parsers such as 'I.takeWhile' and 'I.string'. -- If you use complicated combinators that return lists of bytes or -- characters, there is less performance difference between the two -- libraries. -- -- * Unlike Parsec 3, attoparsec does not support being used as a -- monad transformer. -- -- * attoparsec is specialised to deal only with strict 'B.ByteString' -- input. Efficiency concerns rule out both lists and lazy -- bytestrings. The usual use for lazy bytestrings would be to -- allow consumption of very large input without a large footprint. -- For this need, attoparsec's incremental input provides an -- excellent substitute, with much more control over when input -- takes place. If you must use lazy bytestrings, see the -- "Data.Attoparsec.ByteString.Lazy" module, which feeds lazy chunks -- to a regular parser. -- -- * Parsec parsers can produce more helpful error messages than -- attoparsec parsers. This is a matter of focus: attoparsec avoids -- the extra book-keeping in favour of higher performance. -- $incremental -- -- attoparsec supports incremental input, meaning that you can feed it -- a bytestring that represents only part of the expected total amount -- of data to parse. If your parser reaches the end of a fragment of -- input and could consume more input, it will suspend parsing and -- return a 'T.Partial' continuation. -- -- Supplying the 'T.Partial' continuation with a bytestring will -- resume parsing at the point where it was suspended, with the -- bytestring you supplied used as new input at the end of the -- existing input. You must be prepared for the result of the resumed -- parse to be another 'T.Partial' continuation. -- -- To indicate that you have no more input, supply the 'T.Partial' -- continuation with an empty bytestring. -- -- Remember that some parsing combinators will not return a result -- until they reach the end of input. They may thus cause 'T.Partial' -- results to be returned. -- -- If you do not need support for incremental input, consider using -- the 'I.parseOnly' function to run your parser. It will never -- prompt for more input. -- -- /Note/: incremental input does /not/ imply that attoparsec will -- release portions of its internal state for garbage collection as it -- proceeds. Its internal representation is equivalent to a single -- 'ByteString': if you feed incremental input to a parser, it will -- require memory proportional to the amount of input you supply. -- (This is necessary to support arbitrary backtracking.) -- $performance -- -- If you write an attoparsec-based parser carefully, it can be -- realistic to expect it to perform similarly to a hand-rolled C -- parser (measuring megabytes parsed per second). -- -- To actually achieve high performance, there are a few guidelines -- that it is useful to follow. -- -- Use the 'B.ByteString'-oriented parsers whenever possible, -- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyWord8'. There is -- about a factor of 100 difference in performance between the two -- kinds of parser. -- -- For very simple byte-testing predicates, write them by hand instead -- of using 'I.inClass' or 'I.notInClass'. For instance, both of -- these predicates test for an end-of-line byte, but the first is -- much faster than the second: -- -- >endOfLine_fast w = w == 13 || w == 10 -- >endOfLine_slow = inClass "\r\n" -- -- Make active use of benchmarking and profiling tools to measure, -- find the problems with, and improve the performance of your parser. -- | Run a parser and print its result to standard output. parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO () parseTest p s = print (parse p s) -- | Run a parser with an initial input string, and a monadic action -- that can supply more input if needed. parseWith :: Monad m => (m B.ByteString) -- ^ An action that will be executed to provide the parser -- with more input, if necessary. The action must return an -- 'B.empty' string when there is no more input available. -> I.Parser a -> B.ByteString -- ^ Initial input for the parser. -> m (Result a) parseWith refill p s = step $ parse p s where step (T.Partial k) = (step . k) =<< refill step r = return r {-# INLINE parseWith #-} -- | Convert a 'Result' value to a 'Maybe' value. A 'T.Partial' result -- is treated as failure. maybeResult :: Result r -> Maybe r maybeResult (T.Done _ r) = Just r maybeResult _ = Nothing -- | Convert a 'Result' value to an 'Either' value. A 'T.Partial' -- result is treated as failure. eitherResult :: Result r -> Either String r eitherResult (T.Done _ r) = Right r eitherResult (T.Fail _ [] msg) = Left msg eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg) eitherResult _ = Left "Result: incomplete input" attoparsec-0.13.2.4/Data/Attoparsec/ByteString/0000755000000000000000000000000007346545000017345 5ustar0000000000000000attoparsec-0.13.2.4/Data/Attoparsec/ByteString/Buffer.hs0000644000000000000000000001257307346545000021122 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} -- | -- Module : Data.Attoparsec.ByteString.Buffer -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : GHC -- -- An "immutable" buffer that supports cheap appends. -- -- A Buffer is divided into an immutable read-only zone, followed by a -- mutable area that we've preallocated, but not yet written to. -- -- We overallocate at the end of a Buffer so that we can cheaply -- append. Since a user of an existing Buffer cannot see past the end -- of its immutable zone into the data that will change during an -- append, this is safe. -- -- Once we run out of space at the end of a Buffer, we do the usual -- doubling of the buffer size. -- -- The fact of having a mutable buffer really helps with performance, -- but it does have a consequence: if someone misuses the Partial API -- that attoparsec uses by calling the same continuation repeatedly -- (which never makes sense in practice), they could overwrite data. -- -- Since the API *looks* pure, it should *act* pure, too, so we use -- two generation counters (one mutable, one immutable) to track the -- number of appends to a mutable buffer. If the counters ever get out -- of sync, someone is appending twice to a mutable buffer, so we -- duplicate the entire buffer in order to preserve the immutability -- of its older self. -- -- While we could go a step further and gain protection against API -- abuse on a multicore system, by use of an atomic increment -- instruction to bump the mutable generation counter, that would be -- very expensive, and feels like it would also be in the realm of the -- ridiculous. Clients should never call a continuation more than -- once; we lack a linear type system that could enforce this; and -- there's only so far we should go to accommodate broken uses. module Data.Attoparsec.ByteString.Buffer ( Buffer , buffer , unbuffer , pappend , length , unsafeIndex , substring , unsafeDrop ) where import Control.Exception (assert) import Data.ByteString.Internal (ByteString(..), memcpy, nullForeignPtr) import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO) import Data.List (foldl1') import Data.Monoid as Mon (Monoid(..)) import Data.Semigroup (Semigroup(..)) import Data.Word (Word8) import Foreign.ForeignPtr (ForeignPtr, withForeignPtr) import Foreign.Ptr (castPtr, plusPtr) import Foreign.Storable (peek, peekByteOff, poke, sizeOf) import GHC.ForeignPtr (mallocPlainForeignPtrBytes) import Prelude hiding (length) -- If _cap is zero, this buffer is empty. data Buffer = Buf { _fp :: {-# UNPACK #-} !(ForeignPtr Word8) , _off :: {-# UNPACK #-} !Int , _len :: {-# UNPACK #-} !Int , _cap :: {-# UNPACK #-} !Int , _gen :: {-# UNPACK #-} !Int } instance Show Buffer where showsPrec p = showsPrec p . unbuffer -- | The initial 'Buffer' has no mutable zone, so we can avoid all -- copies in the (hopefully) common case of no further input being fed -- to us. buffer :: ByteString -> Buffer buffer (PS fp off len) = Buf fp off len len 0 unbuffer :: Buffer -> ByteString unbuffer (Buf fp off len _ _) = PS fp off len instance Semigroup Buffer where (Buf _ _ _ 0 _) <> b = b a <> (Buf _ _ _ 0 _) = a buf <> (Buf fp off len _ _) = append buf fp off len instance Monoid Buffer where mempty = Buf nullForeignPtr 0 0 0 0 mappend = (<>) mconcat [] = Mon.mempty mconcat xs = foldl1' mappend xs pappend :: Buffer -> ByteString -> Buffer pappend (Buf _ _ _ 0 _) bs = buffer bs pappend buf (PS fp off len) = append buf fp off len append :: Buffer -> ForeignPtr a -> Int -> Int -> Buffer append (Buf fp0 off0 len0 cap0 gen0) !fp1 !off1 !len1 = inlinePerformIO . withForeignPtr fp0 $ \ptr0 -> withForeignPtr fp1 $ \ptr1 -> do let genSize = sizeOf (0::Int) newlen = len0 + len1 gen <- if gen0 == 0 then return 0 else peek (castPtr ptr0) if gen == gen0 && newlen <= cap0 then do let newgen = gen + 1 poke (castPtr ptr0) newgen memcpy (ptr0 `plusPtr` (off0+len0)) (ptr1 `plusPtr` off1) (fromIntegral len1) return (Buf fp0 off0 newlen cap0 newgen) else do let newcap = newlen * 2 fp <- mallocPlainForeignPtrBytes (newcap + genSize) withForeignPtr fp $ \ptr_ -> do let ptr = ptr_ `plusPtr` genSize newgen = 1 poke (castPtr ptr_) newgen memcpy ptr (ptr0 `plusPtr` off0) (fromIntegral len0) memcpy (ptr `plusPtr` len0) (ptr1 `plusPtr` off1) (fromIntegral len1) return (Buf fp genSize newlen newcap newgen) length :: Buffer -> Int length (Buf _ _ len _ _) = len {-# INLINE length #-} unsafeIndex :: Buffer -> Int -> Word8 unsafeIndex (Buf fp off len _ _) i = assert (i >= 0 && i < len) . inlinePerformIO . withForeignPtr fp $ flip peekByteOff (off+i) {-# INLINE unsafeIndex #-} substring :: Int -> Int -> Buffer -> ByteString substring s l (Buf fp off len _ _) = assert (s >= 0 && s <= len) . assert (l >= 0 && l <= len-s) $ PS fp (off+s) l {-# INLINE substring #-} unsafeDrop :: Int -> Buffer -> ByteString unsafeDrop s (Buf fp off len _ _) = assert (s >= 0 && s <= len) $ PS fp (off+s) (len-s) {-# INLINE unsafeDrop #-} attoparsec-0.13.2.4/Data/Attoparsec/ByteString/Char8.hs0000644000000000000000000004352507346545000020657 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeFamilies, TypeSynonymInstances, GADTs #-} #if __GLASGOW_HASKELL__ >= 702 {-# LANGUAGE Trustworthy #-} -- Imports internal modules #endif {-# OPTIONS_GHC -fno-warn-orphans -fno-warn-warnings-deprecations #-} -- | -- Module : Data.Attoparsec.ByteString.Char8 -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient, character-oriented combinator parsing for -- 'B.ByteString' strings, loosely based on the Parsec library. module Data.Attoparsec.ByteString.Char8 ( -- * Character encodings -- $encodings -- * Parser types Parser , A.Result , A.IResult(..) , I.compareResults -- * Running parsers , A.parse , A.feed , A.parseOnly , A.parseWith , A.parseTest -- ** Result conversion , A.maybeResult , A.eitherResult -- * Parsing individual characters , char , char8 , anyChar , notChar , satisfy -- ** Lookahead , peekChar , peekChar' -- ** Special character parsers , digit , letter_iso8859_15 , letter_ascii , space -- ** Fast predicates , isDigit , isDigit_w8 , isAlpha_iso8859_15 , isAlpha_ascii , isSpace , isSpace_w8 -- *** Character classes , inClass , notInClass -- * Efficient string handling , I.string , I.stringCI , skipSpace , skipWhile , I.take , scan , takeWhile , takeWhile1 , takeTill -- ** String combinators -- $specalt , (.*>) , (<*.) -- ** Consume all remaining input , I.takeByteString , I.takeLazyByteString -- * Text parsing , I.endOfLine , isEndOfLine , isHorizontalSpace -- * Numeric parsers , decimal , hexadecimal , signed , double , Number(..) , number , rational , scientific -- * Combinators , try , () , choice , count , option , many' , many1 , many1' , manyTill , manyTill' , sepBy , sepBy' , sepBy1 , sepBy1' , skipMany , skipMany1 , eitherP , I.match -- * State observation and manipulation functions , I.endOfInput , I.atEnd ) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative (pure, (*>), (<*), (<$>)) import Data.Word (Word) #endif import Control.Applicative ((<|>)) import Control.Monad (void, when) import Data.Attoparsec.ByteString.FastSet (charClass, memberChar) import Data.Attoparsec.ByteString.Internal (Parser) import Data.Attoparsec.Combinator import Data.Attoparsec.Number (Number(..)) import Data.Bits (Bits, (.|.), shiftL) import Data.ByteString.Internal (c2w, w2c) import Data.Int (Int8, Int16, Int32, Int64) import Data.String (IsString(..)) import Data.Scientific (Scientific) import qualified Data.Scientific as Sci import Data.Word (Word8, Word16, Word32, Word64) import Prelude hiding (takeWhile) import qualified Data.Attoparsec.ByteString as A import qualified Data.Attoparsec.ByteString.Internal as I import qualified Data.Attoparsec.Internal as I import qualified Data.ByteString as B8 import qualified Data.ByteString.Char8 as B instance (a ~ B.ByteString) => IsString (Parser a) where fromString = I.string . B.pack -- $encodings -- -- This module is intended for parsing text that is -- represented using an 8-bit character set, e.g. ASCII or -- ISO-8859-15. It /does not/ make any attempt to deal with character -- encodings, multibyte characters, or wide characters. In -- particular, all attempts to use characters above code point U+00FF -- will give wrong answers. -- -- Code points below U+0100 are simply translated to and from their -- numeric values, so e.g. the code point U+00A4 becomes the byte -- @0xA4@ (which is the Euro symbol in ISO-8859-15, but the generic -- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF -- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@. -- | Consume input as long as the predicate returns 'True', and return -- the consumed input. -- -- This parser requires the predicate to succeed on at least one byte -- of input: it will fail if the predicate never returns 'True' or if -- there is no input left. takeWhile1 :: (Char -> Bool) -> Parser B.ByteString takeWhile1 p = I.takeWhile1 (p . w2c) {-# INLINE takeWhile1 #-} -- | The parser @satisfy p@ succeeds for any byte for which the -- predicate @p@ returns 'True'. Returns the byte that is actually -- parsed. -- -- >digit = satisfy isDigit -- > where isDigit c = c >= '0' && c <= '9' satisfy :: (Char -> Bool) -> Parser Char satisfy = I.satisfyWith w2c {-# INLINE satisfy #-} -- | Match a letter, in the ISO-8859-15 encoding. letter_iso8859_15 :: Parser Char letter_iso8859_15 = satisfy isAlpha_iso8859_15 "letter_iso8859_15" {-# INLINE letter_iso8859_15 #-} -- | Match a letter, in the ASCII encoding. letter_ascii :: Parser Char letter_ascii = satisfy isAlpha_ascii "letter_ascii" {-# INLINE letter_ascii #-} -- | A fast alphabetic predicate for the ISO-8859-15 encoding -- -- /Note/: For all character encodings other than ISO-8859-15, and -- almost all Unicode code points above U+00A3, this predicate gives -- /wrong answers/. isAlpha_iso8859_15 :: Char -> Bool isAlpha_iso8859_15 c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') || (c >= '\166' && moby c) where moby = notInClass "\167\169\171-\179\182\183\185\187\191\215\247" {-# NOINLINE moby #-} {-# INLINE isAlpha_iso8859_15 #-} -- | A fast alphabetic predicate for the ASCII encoding -- -- /Note/: For all character encodings other than ASCII, and -- almost all Unicode code points above U+007F, this predicate gives -- /wrong answers/. isAlpha_ascii :: Char -> Bool isAlpha_ascii c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') {-# INLINE isAlpha_ascii #-} -- | Parse a single digit. digit :: Parser Char digit = satisfy isDigit "digit" {-# INLINE digit #-} -- | A fast digit predicate. isDigit :: Char -> Bool isDigit c = c >= '0' && c <= '9' {-# INLINE isDigit #-} -- | A fast digit predicate. isDigit_w8 :: Word8 -> Bool isDigit_w8 w = w - 48 <= 9 {-# INLINE isDigit_w8 #-} -- | Match any character. anyChar :: Parser Char anyChar = satisfy $ const True {-# INLINE anyChar #-} -- | Match any character, to perform lookahead. Returns 'Nothing' if -- end of input has been reached. Does not consume any input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'many', because such parsers loop until a -- failure occurs. Careless use will thus result in an infinite loop. peekChar :: Parser (Maybe Char) peekChar = (fmap w2c) `fmap` I.peekWord8 {-# INLINE peekChar #-} -- | Match any character, to perform lookahead. Does not consume any -- input, but will fail if end of input has been reached. peekChar' :: Parser Char peekChar' = w2c `fmap` I.peekWord8' {-# INLINE peekChar' #-} -- | Fast predicate for matching ASCII space characters. -- -- /Note/: This predicate only gives correct answers for the ASCII -- encoding. For instance, it does not recognise U+00A0 (non-breaking -- space) as a space character, even though it is a valid ISO-8859-15 -- byte. For a Unicode-aware and only slightly slower predicate, -- use 'Data.Char.isSpace' isSpace :: Char -> Bool isSpace c = (c == ' ') || ('\t' <= c && c <= '\r') {-# INLINE isSpace #-} -- | Fast 'Word8' predicate for matching ASCII space characters. isSpace_w8 :: Word8 -> Bool isSpace_w8 w = w == 32 || w - 9 <= 4 {-# INLINE isSpace_w8 #-} -- | Parse a space character. -- -- /Note/: This parser only gives correct answers for the ASCII -- encoding. For instance, it does not recognise U+00A0 (non-breaking -- space) as a space character, even though it is a valid ISO-8859-15 -- byte. space :: Parser Char space = satisfy isSpace "space" {-# INLINE space #-} -- | Match a specific character. char :: Char -> Parser Char char c = satisfy (== c) [c] {-# INLINE char #-} -- | Match a specific character, but return its 'Word8' value. char8 :: Char -> Parser Word8 char8 c = I.satisfy (== c2w c) [c] {-# INLINE char8 #-} -- | Match any character except the given one. notChar :: Char -> Parser Char notChar c = satisfy (/= c) "not " ++ [c] {-# INLINE notChar #-} -- | Match any character in a set. -- -- >vowel = inClass "aeiou" -- -- Range notation is supported. -- -- >halfAlphabet = inClass "a-nA-N" -- -- To add a literal \'-\' to a set, place it at the beginning or end -- of the string. inClass :: String -> Char -> Bool inClass s = (`memberChar` mySet) where mySet = charClass s {-# INLINE inClass #-} -- | Match any character not in a set. notInClass :: String -> Char -> Bool notInClass s = not . inClass s {-# INLINE notInClass #-} -- | Consume input as long as the predicate returns 'True', and return -- the consumed input. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'False' on the first byte of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'many', because such parsers loop until a -- failure occurs. Careless use will thus result in an infinite loop. takeWhile :: (Char -> Bool) -> Parser B.ByteString takeWhile p = I.takeWhile (p . w2c) {-# INLINE takeWhile #-} -- | A stateful scanner. The predicate consumes and transforms a -- state argument, and each transformed state is passed to successive -- invocations of the predicate on each byte of the input until one -- returns 'Nothing' or the input ends. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'Nothing' on the first byte of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'many', because such parsers loop until a -- failure occurs. Careless use will thus result in an infinite loop. scan :: s -> (s -> Char -> Maybe s) -> Parser B.ByteString scan s0 p = I.scan s0 (\s -> p s . w2c) {-# INLINE scan #-} -- | Consume input as long as the predicate returns 'False' -- (i.e. until it returns 'True'), and return the consumed input. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'True' on the first byte of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'many', because such parsers loop until a -- failure occurs. Careless use will thus result in an infinite loop. takeTill :: (Char -> Bool) -> Parser B.ByteString takeTill p = I.takeTill (p . w2c) {-# INLINE takeTill #-} -- | Skip past input for as long as the predicate returns 'True'. skipWhile :: (Char -> Bool) -> Parser () skipWhile p = I.skipWhile (p . w2c) {-# INLINE skipWhile #-} -- | Skip over white space. skipSpace :: Parser () skipSpace = I.skipWhile isSpace_w8 {-# INLINE skipSpace #-} -- $specalt -- -- If you enable the @OverloadedStrings@ language extension, you can -- use the '*>' and '<*' combinators to simplify the common task of -- matching a statically known string, then immediately parsing -- something else. -- -- Instead of writing something like this: -- -- @ --'I.string' \"foo\" '*>' wibble -- @ -- -- Using @OverloadedStrings@, you can omit the explicit use of -- 'I.string', and write a more compact version: -- -- @ -- \"foo\" '*>' wibble -- @ -- -- (Note: the '.*>' and '<*.' combinators that were originally -- provided for this purpose are obsolete and unnecessary, and will be -- removed in the next major version.) -- | /Obsolete/. A type-specialized version of '*>' for -- 'B.ByteString'. Use '*>' instead. (.*>) :: B.ByteString -> Parser a -> Parser a s .*> f = I.string s *> f {-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-} -- | /Obsolete/. A type-specialized version of '<*' for -- 'B.ByteString'. Use '<*' instead. (<*.) :: Parser a -> B.ByteString -> Parser a f <*. s = f <* I.string s {-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-} -- | A predicate that matches either a carriage return @\'\\r\'@ or -- newline @\'\\n\'@ character. isEndOfLine :: Word8 -> Bool isEndOfLine w = w == 13 || w == 10 {-# INLINE isEndOfLine #-} -- | A predicate that matches either a space @\' \'@ or horizontal tab -- @\'\\t\'@ character. isHorizontalSpace :: Word8 -> Bool isHorizontalSpace w = w == 32 || w == 9 {-# INLINE isHorizontalSpace #-} -- | Parse and decode an unsigned hexadecimal number. The hex digits -- @\'a\'@ through @\'f\'@ may be upper or lower case. -- -- This parser does not accept a leading @\"0x\"@ string. hexadecimal :: (Integral a, Bits a) => Parser a hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit where isHexDigit w = (w >= 48 && w <= 57) || (w >= 97 && w <= 102) || (w >= 65 && w <= 70) step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48) | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87) | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55) {-# SPECIALISE hexadecimal :: Parser Int #-} {-# SPECIALISE hexadecimal :: Parser Int8 #-} {-# SPECIALISE hexadecimal :: Parser Int16 #-} {-# SPECIALISE hexadecimal :: Parser Int32 #-} {-# SPECIALISE hexadecimal :: Parser Int64 #-} {-# SPECIALISE hexadecimal :: Parser Integer #-} {-# SPECIALISE hexadecimal :: Parser Word #-} {-# SPECIALISE hexadecimal :: Parser Word8 #-} {-# SPECIALISE hexadecimal :: Parser Word16 #-} {-# SPECIALISE hexadecimal :: Parser Word32 #-} {-# SPECIALISE hexadecimal :: Parser Word64 #-} -- | Parse and decode an unsigned decimal number. decimal :: Integral a => Parser a decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDigit_w8 where step a w = a * 10 + fromIntegral (w - 48) {-# SPECIALISE decimal :: Parser Int #-} {-# SPECIALISE decimal :: Parser Int8 #-} {-# SPECIALISE decimal :: Parser Int16 #-} {-# SPECIALISE decimal :: Parser Int32 #-} {-# SPECIALISE decimal :: Parser Int64 #-} {-# SPECIALISE decimal :: Parser Integer #-} {-# SPECIALISE decimal :: Parser Word #-} {-# SPECIALISE decimal :: Parser Word8 #-} {-# SPECIALISE decimal :: Parser Word16 #-} {-# SPECIALISE decimal :: Parser Word32 #-} {-# SPECIALISE decimal :: Parser Word64 #-} -- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign -- character. signed :: Num a => Parser a -> Parser a {-# SPECIALISE signed :: Parser Int -> Parser Int #-} {-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-} {-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-} {-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-} {-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-} {-# SPECIALISE signed :: Parser Integer -> Parser Integer #-} signed p = (negate <$> (char8 '-' *> p)) <|> (char8 '+' *> p) <|> p -- | Parse a rational number. -- -- The syntax accepted by this parser is the same as for 'double'. -- -- /Note/: this parser is not safe for use with inputs from untrusted -- sources. An input with a suitably large exponent such as -- @"1e1000000000"@ will cause a huge 'Integer' to be allocated, -- resulting in what is effectively a denial-of-service attack. -- -- In most cases, it is better to use 'double' or 'scientific' -- instead. rational :: Fractional a => Parser a {-# SPECIALIZE rational :: Parser Double #-} {-# SPECIALIZE rational :: Parser Float #-} {-# SPECIALIZE rational :: Parser Rational #-} {-# SPECIALIZE rational :: Parser Scientific #-} rational = scientifically realToFrac -- | Parse a rational number. -- -- This parser accepts an optional leading sign character, followed by -- at least one decimal digit. The syntax similar to that accepted by -- the 'read' function, with the exception that a trailing @\'.\'@ or -- @\'e\'@ /not/ followed by a number is not consumed. -- -- Examples with behaviour identical to 'read', if you feed an empty -- continuation to the first result: -- -- >rational "3" == Done 3.0 "" -- >rational "3.1" == Done 3.1 "" -- >rational "3e4" == Done 30000.0 "" -- >rational "3.1e4" == Done 31000.0, "" -- -- Examples with behaviour identical to 'read': -- -- >rational ".3" == Fail "input does not start with a digit" -- >rational "e3" == Fail "input does not start with a digit" -- -- Examples of differences from 'read': -- -- >rational "3.foo" == Done 3.0 ".foo" -- >rational "3e" == Done 3.0 "e" -- -- This function does not accept string representations of \"NaN\" or -- \"Infinity\". double :: Parser Double double = scientifically Sci.toRealFloat -- | Parse a number, attempting to preserve both speed and precision. -- -- The syntax accepted by this parser is the same as for 'double'. number :: Parser Number number = scientifically $ \s -> let e = Sci.base10Exponent s c = Sci.coefficient s in if e >= 0 then I (c * 10 ^ e) else D (Sci.toRealFloat s) {-# DEPRECATED number "Use 'scientific' instead." #-} -- | Parse a scientific number. -- -- The syntax accepted by this parser is the same as for 'double'. scientific :: Parser Scientific scientific = scientifically id -- A strict pair data SP = SP !Integer {-# UNPACK #-}!Int {-# INLINE scientifically #-} scientifically :: (Scientific -> a) -> Parser a scientifically h = do let minus = 45 plus = 43 sign <- I.peekWord8' let !positive = sign == plus || sign /= minus when (sign == plus || sign == minus) $ void $ I.anyWord8 n <- decimal let f fracDigits = SP (B8.foldl' step n fracDigits) (negate $ B8.length fracDigits) step a w = a * 10 + fromIntegral (w - 48) dotty <- I.peekWord8 -- '.' -> ascii 46 SP c e <- case dotty of Just 46 -> I.anyWord8 *> (f <$> I.takeWhile isDigit_w8) _ -> pure (SP n 0) let !signedCoeff | positive = c | otherwise = -c let littleE = 101 bigE = 69 (I.satisfy (\ex -> ex == littleE || ex == bigE) *> fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|> return (h $ Sci.scientific signedCoeff e) attoparsec-0.13.2.4/Data/Attoparsec/ByteString/FastSet.hs0000644000000000000000000000716707346545000021265 0ustar0000000000000000{-# LANGUAGE BangPatterns, MagicHash #-} ----------------------------------------------------------------------------- -- | -- Module : Data.Attoparsec.ByteString.FastSet -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Fast set membership tests for 'Word8' and 8-bit 'Char' values. The -- set representation is unboxed for efficiency. For small sets, we -- test for membership using a binary search. For larger sets, we use -- a lookup table. -- ----------------------------------------------------------------------------- module Data.Attoparsec.ByteString.FastSet ( -- * Data type FastSet -- * Construction , fromList , set -- * Lookup , memberChar , memberWord8 -- * Debugging , fromSet -- * Handy interface , charClass ) where import Data.Bits ((.&.), (.|.)) import Foreign.Storable (peekByteOff, pokeByteOff) import GHC.Exts (Int(I#), iShiftRA#, narrow8Word#, shiftL#) import GHC.Word (Word8(W8#)) import qualified Data.ByteString as B import qualified Data.ByteString.Char8 as B8 import qualified Data.ByteString.Internal as I import qualified Data.ByteString.Unsafe as U data FastSet = Sorted { fromSet :: !B.ByteString } | Table { fromSet :: !B.ByteString } deriving (Eq, Ord) instance Show FastSet where show (Sorted s) = "FastSet Sorted " ++ show (B8.unpack s) show (Table _) = "FastSet Table" -- | The lower bound on the size of a lookup table. We choose this to -- balance table density against performance. tableCutoff :: Int tableCutoff = 8 -- | Create a set. set :: B.ByteString -> FastSet set s | B.length s < tableCutoff = Sorted . B.sort $ s | otherwise = Table . mkTable $ s fromList :: [Word8] -> FastSet fromList = set . B.pack data I = I {-# UNPACK #-} !Int {-# UNPACK #-} !Word8 shiftR :: Int -> Int -> Int shiftR (I# x#) (I# i#) = I# (x# `iShiftRA#` i#) shiftL :: Word8 -> Int -> Word8 shiftL (W8# x#) (I# i#) = W8# (narrow8Word# (x# `shiftL#` i#)) index :: Int -> I index i = I (i `shiftR` 3) (1 `shiftL` (i .&. 7)) {-# INLINE index #-} -- | Check the set for membership. memberWord8 :: Word8 -> FastSet -> Bool memberWord8 w (Table t) = let I byte bit = index (fromIntegral w) in U.unsafeIndex t byte .&. bit /= 0 memberWord8 w (Sorted s) = search 0 (B.length s - 1) where search lo hi | hi < lo = False | otherwise = let mid = (lo + hi) `quot` 2 in case compare w (U.unsafeIndex s mid) of GT -> search (mid + 1) hi LT -> search lo (mid - 1) _ -> True -- | Check the set for membership. Only works with 8-bit characters: -- characters above code point 255 will give wrong answers. memberChar :: Char -> FastSet -> Bool memberChar c = memberWord8 (I.c2w c) {-# INLINE memberChar #-} mkTable :: B.ByteString -> B.ByteString mkTable s = I.unsafeCreate 32 $ \t -> do _ <- I.memset t 0 32 U.unsafeUseAsCStringLen s $ \(p, l) -> let loop n | n == l = return () | otherwise = do c <- peekByteOff p n :: IO Word8 let I byte bit = index (fromIntegral c) prev <- peekByteOff t byte :: IO Word8 pokeByteOff t byte (prev .|. bit) loop (n + 1) in loop 0 charClass :: String -> FastSet charClass = set . B8.pack . go where go (a:'-':b:xs) = [a..b] ++ go xs go (x:xs) = x : go xs go _ = "" attoparsec-0.13.2.4/Data/Attoparsec/ByteString/Internal.hs0000644000000000000000000004251507346545000021464 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, GADTs, OverloadedStrings, RankNTypes, RecordWildCards #-} -- | -- Module : Data.Attoparsec.ByteString.Internal -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient parser combinators for 'ByteString' strings, -- loosely based on the Parsec library. module Data.Attoparsec.ByteString.Internal ( -- * Parser types Parser , Result -- * Running parsers , parse , parseOnly -- * Combinators , module Data.Attoparsec.Combinator -- * Parsing individual bytes , satisfy , satisfyWith , anyWord8 , skip , word8 , notWord8 -- ** Lookahead , peekWord8 , peekWord8' -- ** Byte classes , inClass , notInClass -- * Parsing more complicated structures , storable -- * Efficient string handling , skipWhile , string , stringCI , take , scan , runScanner , takeWhile , takeWhile1 , takeTill -- ** Consume all remaining input , takeByteString , takeLazyByteString -- * Utilities , endOfLine , endOfInput , match , atEnd ) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<$>)) #endif import Control.Applicative ((<|>)) import Control.Monad (when) import Data.Attoparsec.ByteString.Buffer (Buffer, buffer) import Data.Attoparsec.ByteString.FastSet (charClass, memberWord8) import Data.Attoparsec.Combinator (()) import Data.Attoparsec.Internal import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO) import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success) import Data.ByteString (ByteString) import Data.List (intercalate) import Data.Word (Word8) import Foreign.ForeignPtr (withForeignPtr) import Foreign.Ptr (castPtr, minusPtr, plusPtr) import Foreign.Storable (Storable(peek, sizeOf)) import Prelude hiding (getChar, succ, take, takeWhile) import qualified Data.Attoparsec.ByteString.Buffer as Buf import qualified Data.Attoparsec.Internal.Types as T import qualified Data.ByteString as B8 import qualified Data.ByteString.Char8 as B import qualified Data.ByteString.Internal as B import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Unsafe as B type Parser = T.Parser ByteString type Result = IResult ByteString type Failure r = T.Failure ByteString Buffer r type Success a r = T.Success ByteString Buffer a r -- | The parser @satisfy p@ succeeds for any byte for which the -- predicate @p@ returns 'True'. Returns the byte that is actually -- parsed. -- -- >digit = satisfy isDigit -- > where isDigit w = w >= 48 && w <= 57 satisfy :: (Word8 -> Bool) -> Parser Word8 satisfy p = do h <- peekWord8' if p h then advance 1 >> return h else fail "satisfy" {-# INLINE satisfy #-} -- | The parser @skip p@ succeeds for any byte for which the predicate -- @p@ returns 'True'. -- -- >skipDigit = skip isDigit -- > where isDigit w = w >= 48 && w <= 57 skip :: (Word8 -> Bool) -> Parser () skip p = do h <- peekWord8' if p h then advance 1 else fail "skip" -- | The parser @satisfyWith f p@ transforms a byte, and succeeds if -- the predicate @p@ returns 'True' on the transformed value. The -- parser returns the transformed byte that was parsed. satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a satisfyWith f p = do h <- peekWord8' let c = f h if p c then advance 1 >> return c else fail "satisfyWith" {-# INLINE satisfyWith #-} storable :: Storable a => Parser a storable = hack undefined where hack :: Storable b => b -> Parser b hack dummy = do (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy) return . inlinePerformIO . withForeignPtr fp $ \p -> peek (castPtr $ p `plusPtr` o) -- | Consume exactly @n@ bytes of input. take :: Int -> Parser ByteString take n0 = do let n = max n0 0 s <- ensure n advance n >> return s {-# INLINE take #-} -- | @string s@ parses a sequence of bytes that identically match -- @s@. Returns the parsed string (i.e. @s@). This parser consumes no -- input if it fails (even if a partial match). -- -- /Note/: The behaviour of this parser is different to that of the -- similarly-named parser in Parsec, as this one is all-or-nothing. -- To illustrate the difference, the following parser will fail under -- Parsec given an input of @\"for\"@: -- -- >string "foo" <|> string "for" -- -- The reason for its failure is that the first branch is a -- partial match, and will consume the letters @\'f\'@ and @\'o\'@ -- before failing. In attoparsec, the above parser will /succeed/ on -- that input, because the failed first branch will consume nothing. string :: ByteString -> Parser ByteString string s = string_ (stringSuspended id) id s {-# INLINE string #-} -- ASCII-specific but fast, oh yes. toLower :: Word8 -> Word8 toLower w | w >= 65 && w <= 90 = w + 32 | otherwise = w -- | Satisfy a literal string, ignoring case. stringCI :: ByteString -> Parser ByteString stringCI s = string_ (stringSuspended lower) lower s where lower = B8.map toLower {-# INLINE stringCI #-} string_ :: (forall r. ByteString -> ByteString -> Buffer -> Pos -> More -> Failure r -> Success ByteString r -> Result r) -> (ByteString -> ByteString) -> ByteString -> Parser ByteString string_ suspended f s0 = T.Parser $ \t pos more lose succ -> let n = B.length s s = f s0 in if lengthAtLeast pos n t then let t' = substring pos (Pos n) t in if s == f t' then succ t (pos + Pos n) more t' else lose t pos more [] "string" else let t' = Buf.unsafeDrop (fromPos pos) t in if f t' `B.isPrefixOf` s then suspended s (B.drop (B.length t') s) t pos more lose succ else lose t pos more [] "string" {-# INLINE string_ #-} stringSuspended :: (ByteString -> ByteString) -> ByteString -> ByteString -> Buffer -> Pos -> More -> Failure r -> Success ByteString r -> Result r stringSuspended f s0 s t pos more lose succ = runParser (demandInput_ >>= go) t pos more lose succ where go s'0 = T.Parser $ \t' pos' more' lose' succ' -> let m = B.length s s' = f s'0 n = B.length s' in if n >= m then if B.unsafeTake m s' == s then let o = Pos (B.length s0) in succ' t' (pos' + o) more' (substring pos' o t') else lose' t' pos' more' [] "string" else if s' == B.unsafeTake n s then stringSuspended f s0 (B.unsafeDrop n s) t' pos' more' lose' succ' else lose' t' pos' more' [] "string" -- | Skip past input for as long as the predicate returns 'True'. skipWhile :: (Word8 -> Bool) -> Parser () skipWhile p = go where go = do t <- B8.takeWhile p <$> get continue <- inputSpansChunks (B.length t) when continue go {-# INLINE skipWhile #-} -- | Consume input as long as the predicate returns 'False' -- (i.e. until it returns 'True'), and return the consumed input. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'True' on the first byte of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'Control.Applicative.many', because such -- parsers loop until a failure occurs. Careless use will thus result -- in an infinite loop. takeTill :: (Word8 -> Bool) -> Parser ByteString takeTill p = takeWhile (not . p) {-# INLINE takeTill #-} -- | Consume input as long as the predicate returns 'True', and return -- the consumed input. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'False' on the first byte of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'Control.Applicative.many', because such -- parsers loop until a failure occurs. Careless use will thus result -- in an infinite loop. takeWhile :: (Word8 -> Bool) -> Parser ByteString takeWhile p = do s <- B8.takeWhile p <$> get continue <- inputSpansChunks (B.length s) if continue then takeWhileAcc p [s] else return s {-# INLINE takeWhile #-} takeWhileAcc :: (Word8 -> Bool) -> [ByteString] -> Parser ByteString takeWhileAcc p = go where go acc = do s <- B8.takeWhile p <$> get continue <- inputSpansChunks (B.length s) if continue then go (s:acc) else return $ concatReverse (s:acc) {-# INLINE takeWhileAcc #-} takeRest :: Parser [ByteString] takeRest = go [] where go acc = do input <- wantInput if input then do s <- get advance (B.length s) go (s:acc) else return (reverse acc) -- | Consume all remaining input and return it as a single string. takeByteString :: Parser ByteString takeByteString = B.concat `fmap` takeRest -- | Consume all remaining input and return it as a single string. takeLazyByteString :: Parser L.ByteString takeLazyByteString = L.fromChunks `fmap` takeRest data T s = T {-# UNPACK #-} !Int s scan_ :: (s -> [ByteString] -> Parser r) -> s -> (s -> Word8 -> Maybe s) -> Parser r scan_ f s0 p = go [] s0 where go acc s1 = do let scanner (B.PS fp off len) = withForeignPtr fp $ \ptr0 -> do let start = ptr0 `plusPtr` off end = start `plusPtr` len inner ptr !s | ptr < end = do w <- peek ptr case p s w of Just s' -> inner (ptr `plusPtr` 1) s' _ -> done (ptr `minusPtr` start) s | otherwise = done (ptr `minusPtr` start) s done !i !s = return (T i s) inner start s1 bs <- get let T i s' = inlinePerformIO $ scanner bs !h = B.unsafeTake i bs continue <- inputSpansChunks i if continue then go (h:acc) s' else f s' (h:acc) {-# INLINE scan_ #-} -- | A stateful scanner. The predicate consumes and transforms a -- state argument, and each transformed state is passed to successive -- invocations of the predicate on each byte of the input until one -- returns 'Nothing' or the input ends. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'Nothing' on the first byte of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'Control.Applicative.many', because such -- parsers loop until a failure occurs. Careless use will thus result -- in an infinite loop. scan :: s -> (s -> Word8 -> Maybe s) -> Parser ByteString scan = scan_ $ \_ chunks -> return $! concatReverse chunks {-# INLINE scan #-} -- | Like 'scan', but generalized to return the final state of the -- scanner. runScanner :: s -> (s -> Word8 -> Maybe s) -> Parser (ByteString, s) runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s) {-# INLINE runScanner #-} -- | Consume input as long as the predicate returns 'True', and return -- the consumed input. -- -- This parser requires the predicate to succeed on at least one byte -- of input: it will fail if the predicate never returns 'True' or if -- there is no input left. takeWhile1 :: (Word8 -> Bool) -> Parser ByteString takeWhile1 p = do (`when` demandInput) =<< endOfChunk s <- B8.takeWhile p <$> get let len = B.length s if len == 0 then fail "takeWhile1" else do advance len eoc <- endOfChunk if eoc then takeWhileAcc p [s] else return s {-# INLINE takeWhile1 #-} -- | Match any byte in a set. -- -- >vowel = inClass "aeiou" -- -- Range notation is supported. -- -- >halfAlphabet = inClass "a-nA-N" -- -- To add a literal @\'-\'@ to a set, place it at the beginning or end -- of the string. inClass :: String -> Word8 -> Bool inClass s = (`memberWord8` mySet) where mySet = charClass s {-# NOINLINE mySet #-} {-# INLINE inClass #-} -- | Match any byte not in a set. notInClass :: String -> Word8 -> Bool notInClass s = not . inClass s {-# INLINE notInClass #-} -- | Match any byte. anyWord8 :: Parser Word8 anyWord8 = satisfy $ const True {-# INLINE anyWord8 #-} -- | Match a specific byte. word8 :: Word8 -> Parser Word8 word8 c = satisfy (== c) show c {-# INLINE word8 #-} -- | Match any byte except the given one. notWord8 :: Word8 -> Parser Word8 notWord8 c = satisfy (/= c) "not " ++ show c {-# INLINE notWord8 #-} -- | Match any byte, to perform lookahead. Returns 'Nothing' if end of -- input has been reached. Does not consume any input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'Control.Applicative.many', because such -- parsers loop until a failure occurs. Careless use will thus result -- in an infinite loop. peekWord8 :: Parser (Maybe Word8) peekWord8 = T.Parser $ \t pos@(Pos pos_) more _lose succ -> case () of _| pos_ < Buf.length t -> let !w = Buf.unsafeIndex t pos_ in succ t pos more (Just w) | more == Complete -> succ t pos more Nothing | otherwise -> let succ' t' pos' more' = let !w = Buf.unsafeIndex t' pos_ in succ t' pos' more' (Just w) lose' t' pos' more' = succ t' pos' more' Nothing in prompt t pos more lose' succ' {-# INLINE peekWord8 #-} -- | Match any byte, to perform lookahead. Does not consume any -- input, but will fail if end of input has been reached. peekWord8' :: Parser Word8 peekWord8' = T.Parser $ \t pos more lose succ -> if lengthAtLeast pos 1 t then succ t pos more (Buf.unsafeIndex t (fromPos pos)) else let succ' t' pos' more' bs' = succ t' pos' more' $! B.unsafeHead bs' in ensureSuspended 1 t pos more lose succ' {-# INLINE peekWord8' #-} -- | Match either a single newline character @\'\\n\'@, or a carriage -- return followed by a newline character @\"\\r\\n\"@. endOfLine :: Parser () endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ()) -- | Terminal failure continuation. failK :: Failure a failK t (Pos pos) _more stack msg = Fail (Buf.unsafeDrop pos t) stack msg {-# INLINE failK #-} -- | Terminal success continuation. successK :: Success a a successK t (Pos pos) _more a = Done (Buf.unsafeDrop pos t) a {-# INLINE successK #-} -- | Run a parser. parse :: Parser a -> ByteString -> Result a parse m s = T.runParser m (buffer s) (Pos 0) Incomplete failK successK {-# INLINE parse #-} -- | Run a parser that cannot be resupplied via a 'Partial' result. -- -- This function does not force a parser to consume all of its input. -- Instead, any residual input will be discarded. To force a parser -- to consume all of its input, use something like this: -- -- @ --'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput') -- @ parseOnly :: Parser a -> ByteString -> Either String a parseOnly m s = case T.runParser m (buffer s) (Pos 0) Complete failK successK of Fail _ [] err -> Left err Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err) Done _ a -> Right a _ -> error "parseOnly: impossible error!" {-# INLINE parseOnly #-} get :: Parser ByteString get = T.Parser $ \t pos more _lose succ -> succ t pos more (Buf.unsafeDrop (fromPos pos) t) {-# INLINE get #-} endOfChunk :: Parser Bool endOfChunk = T.Parser $ \t pos more _lose succ -> succ t pos more (fromPos pos == Buf.length t) {-# INLINE endOfChunk #-} inputSpansChunks :: Int -> Parser Bool inputSpansChunks i = T.Parser $ \t pos_ more _lose succ -> let pos = pos_ + Pos i in if fromPos pos < Buf.length t || more == Complete then succ t pos more False else let lose' t' pos' more' = succ t' pos' more' False succ' t' pos' more' = succ t' pos' more' True in prompt t pos more lose' succ' {-# INLINE inputSpansChunks #-} advance :: Int -> Parser () advance n = T.Parser $ \t pos more _lose succ -> succ t (pos + Pos n) more () {-# INLINE advance #-} ensureSuspended :: Int -> Buffer -> Pos -> More -> Failure r -> Success ByteString r -> Result r ensureSuspended n t pos more lose succ = runParser (demandInput >> go) t pos more lose succ where go = T.Parser $ \t' pos' more' lose' succ' -> if lengthAtLeast pos' n t' then succ' t' pos' more' (substring pos (Pos n) t') else runParser (demandInput >> go) t' pos' more' lose' succ' -- | If at least @n@ elements of input are available, return the -- current input, otherwise fail. ensure :: Int -> Parser ByteString ensure n = T.Parser $ \t pos more lose succ -> if lengthAtLeast pos n t then succ t pos more (substring pos (Pos n) t) -- The uncommon case is kept out-of-line to reduce code size: else ensureSuspended n t pos more lose succ {-# INLINE ensure #-} -- | Return both the result of a parse and the portion of the input -- that was consumed while it was being parsed. match :: Parser a -> Parser (ByteString, a) match p = T.Parser $ \t pos more lose succ -> let succ' t' pos' more' a = succ t' pos' more' (substring pos (pos'-pos) t', a) in runParser p t pos more lose succ' lengthAtLeast :: Pos -> Int -> Buffer -> Bool lengthAtLeast (Pos pos) n bs = Buf.length bs >= pos + n {-# INLINE lengthAtLeast #-} substring :: Pos -> Pos -> Buffer -> ByteString substring (Pos pos) (Pos n) = Buf.substring pos n {-# INLINE substring #-} attoparsec-0.13.2.4/Data/Attoparsec/ByteString/Lazy.hs0000644000000000000000000000767207346545000020634 0ustar0000000000000000{-# LANGUAGE CPP #-} #if __GLASGOW_HASKELL__ >= 702 {-# LANGUAGE Trustworthy #-} -- Imports internal modules #endif -- | -- Module : Data.Attoparsec.ByteString.Lazy -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient combinator parsing that can consume lazy -- 'ByteString' strings, loosely based on the Parsec library. -- -- This is essentially the same code as in the 'Data.Attoparsec' -- module, only with a 'parse' function that can consume a lazy -- 'ByteString' incrementally, and a 'Result' type that does not allow -- more input to be fed in. Think of this as suitable for use with a -- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'. -- -- /Note:/ The various parser functions and combinators such as -- 'string' still expect /strict/ 'B.ByteString' parameters, and -- return strict 'B.ByteString' results. Behind the scenes, strict -- 'B.ByteString' values are still used internally to store parser -- input and manipulate it efficiently. module Data.Attoparsec.ByteString.Lazy ( Result(..) , module Data.Attoparsec.ByteString -- * Running parsers , parse , parseTest -- ** Result conversion , maybeResult , eitherResult ) where import Control.DeepSeq (NFData(rnf)) import Data.ByteString.Lazy.Internal (ByteString(..), chunk) import Data.List (intercalate) import qualified Data.ByteString as B import qualified Data.Attoparsec.ByteString as A import qualified Data.Attoparsec.Internal.Types as T import Data.Attoparsec.ByteString hiding (IResult(..), Result, eitherResult, maybeResult, parse, parseWith, parseTest) -- | The result of a parse. data Result r = Fail ByteString [String] String -- ^ The parse failed. The 'ByteString' is the input -- that had not yet been consumed when the failure -- occurred. The @[@'String'@]@ is a list of contexts -- in which the error occurred. The 'String' is the -- message describing the error, if any. | Done ByteString r -- ^ The parse succeeded. The 'ByteString' is the -- input that had not yet been consumed (if any) when -- the parse succeeded. instance NFData r => NFData (Result r) where rnf (Fail bs ctxs msg) = rnfBS bs `seq` rnf ctxs `seq` rnf msg rnf (Done bs r) = rnfBS bs `seq` rnf r {-# INLINE rnf #-} rnfBS :: ByteString -> () rnfBS (Chunk _ xs) = rnfBS xs rnfBS Empty = () {-# INLINE rnfBS #-} instance Show r => Show (Result r) where show (Fail bs stk msg) = "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg show (Done bs r) = "Done " ++ show bs ++ " " ++ show r fmapR :: (a -> b) -> Result a -> Result b fmapR _ (Fail st stk msg) = Fail st stk msg fmapR f (Done bs r) = Done bs (f r) instance Functor Result where fmap = fmapR -- | Run a parser and return its result. parse :: A.Parser a -> ByteString -> Result a parse p s = case s of Chunk x xs -> go (A.parse p x) xs empty -> go (A.parse p B.empty) empty where go (T.Fail x stk msg) ys = Fail (chunk x ys) stk msg go (T.Done x r) ys = Done (chunk x ys) r go (T.Partial k) (Chunk y ys) = go (k y) ys go (T.Partial k) empty = go (k B.empty) empty -- | Run a parser and print its result to standard output. parseTest :: (Show a) => A.Parser a -> ByteString -> IO () parseTest p s = print (parse p s) -- | Convert a 'Result' value to a 'Maybe' value. maybeResult :: Result r -> Maybe r maybeResult (Done _ r) = Just r maybeResult _ = Nothing -- | Convert a 'Result' value to an 'Either' value. eitherResult :: Result r -> Either String r eitherResult (Done _ r) = Right r eitherResult (Fail _ [] msg) = Left msg eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg) attoparsec-0.13.2.4/Data/Attoparsec/Char8.hs0000644000000000000000000000122107346545000016550 0ustar0000000000000000-- | -- Module : Data.Attoparsec.Char8 -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient, character-oriented combinator parsing for -- 'Data.ByteString.ByteString' strings, loosely based on the Parsec -- library. -- -- This module is deprecated. Use "Data.Attoparsec.ByteString.Char8" -- instead. module Data.Attoparsec.Char8 {-# DEPRECATED "This module will be removed in the next major release." #-} ( module Data.Attoparsec.ByteString.Char8 ) where import Data.Attoparsec.ByteString.Char8 attoparsec-0.13.2.4/Data/Attoparsec/Combinator.hs0000644000000000000000000002253707346545000017715 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP #-} #if __GLASGOW_HASKELL__ >= 702 {-# LANGUAGE Trustworthy #-} -- Imports internal modules #endif -- | -- Module : Data.Attoparsec.Combinator -- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : portable -- -- Useful parser combinators, similar to those provided by Parsec. module Data.Attoparsec.Combinator ( -- * Combinators try , () , choice , count , option , many' , many1 , many1' , manyTill , manyTill' , sepBy , sepBy' , sepBy1 , sepBy1' , skipMany , skipMany1 , eitherP , feed , satisfyElem , endOfInput , atEnd , lookAhead ) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative (Applicative(..), (<$>)) import Data.Monoid (Monoid(mappend)) #endif import Control.Applicative (Alternative(..), empty, liftA2, many, (<|>)) import Control.Monad (MonadPlus(..)) import Data.Attoparsec.Internal.Types (Parser(..), IResult(..)) import Data.Attoparsec.Internal (endOfInput, atEnd, satisfyElem) import Data.ByteString (ByteString) import Data.Text (Text) import qualified Data.Attoparsec.Zepto as Z import Prelude hiding (succ) -- | Attempt a parse, and if it fails, rewind the input so that no -- input appears to have been consumed. -- -- This combinator is provided for compatibility with Parsec. -- attoparsec parsers always backtrack on failure. try :: Parser i a -> Parser i a try p = p {-# INLINE try #-} -- | Name the parser, in case failure occurs. () :: Parser i a -> String -- ^ the name to use if parsing fails -> Parser i a p msg0 = Parser $ \t pos more lose succ -> let lose' t' pos' more' strs msg = lose t' pos' more' (msg0:strs) msg in runParser p t pos more lose' succ {-# INLINE () #-} infix 0 -- | @choice ps@ tries to apply the actions in the list @ps@ in order, -- until one of them succeeds. Returns the value of the succeeding -- action. choice :: Alternative f => [f a] -> f a choice = foldr (<|>) empty {-# SPECIALIZE choice :: [Parser ByteString a] -> Parser ByteString a #-} {-# SPECIALIZE choice :: [Parser Text a] -> Parser Text a #-} {-# SPECIALIZE choice :: [Z.Parser a] -> Z.Parser a #-} -- | @option x p@ tries to apply action @p@. If @p@ fails without -- consuming input, it returns the value @x@, otherwise the value -- returned by @p@. -- -- > priority = option 0 (digitToInt <$> digit) option :: Alternative f => a -> f a -> f a option x p = p <|> pure x {-# SPECIALIZE option :: a -> Parser ByteString a -> Parser ByteString a #-} {-# SPECIALIZE option :: a -> Parser Text a -> Parser Text a #-} {-# SPECIALIZE option :: a -> Z.Parser a -> Z.Parser a #-} -- | A version of 'liftM2' that is strict in the result of its first -- action. liftM2' :: (Monad m) => (a -> b -> c) -> m a -> m b -> m c liftM2' f a b = do !x <- a y <- b return (f x y) {-# INLINE liftM2' #-} -- | @many' p@ applies the action @p@ /zero/ or more times. Returns a -- list of the returned values of @p@. The value returned by @p@ is -- forced to WHNF. -- -- > word = many' letter many' :: (MonadPlus m) => m a -> m [a] many' p = many_p where many_p = some_p `mplus` return [] some_p = liftM2' (:) p many_p {-# INLINE many' #-} -- | @many1 p@ applies the action @p@ /one/ or more times. Returns a -- list of the returned values of @p@. -- -- > word = many1 letter many1 :: Alternative f => f a -> f [a] many1 p = liftA2 (:) p (many p) {-# INLINE many1 #-} -- | @many1' p@ applies the action @p@ /one/ or more times. Returns a -- list of the returned values of @p@. The value returned by @p@ is -- forced to WHNF. -- -- > word = many1' letter many1' :: (MonadPlus m) => m a -> m [a] many1' p = liftM2' (:) p (many' p) {-# INLINE many1' #-} -- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated -- by @sep@. Returns a list of the values returned by @p@. -- -- > commaSep p = p `sepBy` (char ',') sepBy :: Alternative f => f a -> f s -> f [a] sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure [] {-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s -> Parser ByteString [a] #-} {-# SPECIALIZE sepBy :: Parser Text a -> Parser Text s -> Parser Text [a] #-} {-# SPECIALIZE sepBy :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-} -- | @sepBy' p sep@ applies /zero/ or more occurrences of @p@, separated -- by @sep@. Returns a list of the values returned by @p@. The value -- returned by @p@ is forced to WHNF. -- -- > commaSep p = p `sepBy'` (char ',') sepBy' :: (MonadPlus m) => m a -> m s -> m [a] sepBy' p s = scan `mplus` return [] where scan = liftM2' (:) p ((s >> sepBy1' p s) `mplus` return []) {-# SPECIALIZE sepBy' :: Parser ByteString a -> Parser ByteString s -> Parser ByteString [a] #-} {-# SPECIALIZE sepBy' :: Parser Text a -> Parser Text s -> Parser Text [a] #-} {-# SPECIALIZE sepBy' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-} -- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated -- by @sep@. Returns a list of the values returned by @p@. -- -- > commaSep p = p `sepBy1` (char ',') sepBy1 :: Alternative f => f a -> f s -> f [a] sepBy1 p s = scan where scan = liftA2 (:) p ((s *> scan) <|> pure []) {-# SPECIALIZE sepBy1 :: Parser ByteString a -> Parser ByteString s -> Parser ByteString [a] #-} {-# SPECIALIZE sepBy1 :: Parser Text a -> Parser Text s -> Parser Text [a] #-} {-# SPECIALIZE sepBy1 :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-} -- | @sepBy1' p sep@ applies /one/ or more occurrences of @p@, separated -- by @sep@. Returns a list of the values returned by @p@. The value -- returned by @p@ is forced to WHNF. -- -- > commaSep p = p `sepBy1'` (char ',') sepBy1' :: (MonadPlus m) => m a -> m s -> m [a] sepBy1' p s = scan where scan = liftM2' (:) p ((s >> scan) `mplus` return []) {-# SPECIALIZE sepBy1' :: Parser ByteString a -> Parser ByteString s -> Parser ByteString [a] #-} {-# SPECIALIZE sepBy1' :: Parser Text a -> Parser Text s -> Parser Text [a] #-} {-# SPECIALIZE sepBy1' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-} -- | @manyTill p end@ applies action @p@ /zero/ or more times until -- action @end@ succeeds, and returns the list of values returned by -- @p@. This can be used to scan comments: -- -- > simpleComment = string "") -- -- (Note the overlapping parsers @anyChar@ and @string \"-->\"@. -- While this will work, it is not very efficient, as it will cause a -- lot of backtracking.) manyTill :: Alternative f => f a -> f b -> f [a] manyTill p end = scan where scan = (end *> pure []) <|> liftA2 (:) p scan {-# SPECIALIZE manyTill :: Parser ByteString a -> Parser ByteString b -> Parser ByteString [a] #-} {-# SPECIALIZE manyTill :: Parser Text a -> Parser Text b -> Parser Text [a] #-} {-# SPECIALIZE manyTill :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-} -- | @manyTill' p end@ applies action @p@ /zero/ or more times until -- action @end@ succeeds, and returns the list of values returned by -- @p@. This can be used to scan comments: -- -- > simpleComment = string "") -- -- (Note the overlapping parsers @anyChar@ and @string \"-->\"@. -- While this will work, it is not very efficient, as it will cause a -- lot of backtracking.) -- -- The value returned by @p@ is forced to WHNF. manyTill' :: (MonadPlus m) => m a -> m b -> m [a] manyTill' p end = scan where scan = (end >> return []) `mplus` liftM2' (:) p scan {-# SPECIALIZE manyTill' :: Parser ByteString a -> Parser ByteString b -> Parser ByteString [a] #-} {-# SPECIALIZE manyTill' :: Parser Text a -> Parser Text b -> Parser Text [a] #-} {-# SPECIALIZE manyTill' :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-} -- | Skip zero or more instances of an action. skipMany :: Alternative f => f a -> f () skipMany p = scan where scan = (p *> scan) <|> pure () {-# SPECIALIZE skipMany :: Parser ByteString a -> Parser ByteString () #-} {-# SPECIALIZE skipMany :: Parser Text a -> Parser Text () #-} {-# SPECIALIZE skipMany :: Z.Parser a -> Z.Parser () #-} -- | Skip one or more instances of an action. skipMany1 :: Alternative f => f a -> f () skipMany1 p = p *> skipMany p {-# SPECIALIZE skipMany1 :: Parser ByteString a -> Parser ByteString () #-} {-# SPECIALIZE skipMany1 :: Parser Text a -> Parser Text () #-} {-# SPECIALIZE skipMany1 :: Z.Parser a -> Z.Parser () #-} -- | Apply the given action repeatedly, returning every result. count :: Monad m => Int -> m a -> m [a] count n p = sequence (replicate n p) {-# INLINE count #-} -- | Combine two alternatives. eitherP :: (Alternative f) => f a -> f b -> f (Either a b) eitherP a b = (Left <$> a) <|> (Right <$> b) {-# INLINE eitherP #-} -- | If a parser has returned a 'T.Partial' result, supply it with more -- input. feed :: Monoid i => IResult i r -> i -> IResult i r feed (Fail t ctxs msg) d = Fail (mappend t d) ctxs msg feed (Partial k) d = k d feed (Done t r) d = Done (mappend t d) r {-# INLINE feed #-} -- | Apply a parser without consuming any input. lookAhead :: Parser i a -> Parser i a lookAhead p = Parser $ \t pos more lose succ -> let succ' t' _pos' more' = succ t' pos more' in runParser p t pos more lose succ' {-# INLINE lookAhead #-} attoparsec-0.13.2.4/Data/Attoparsec/Internal.hs0000644000000000000000000001570107346545000017367 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, ScopedTypeVariables #-} -- | -- Module : Data.Attoparsec.Internal -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient parser combinators, loosely based on the Parsec -- library. module Data.Attoparsec.Internal ( compareResults , prompt , demandInput , demandInput_ , wantInput , endOfInput , atEnd , satisfyElem , concatReverse ) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<$>)) import Data.Monoid (Monoid, mconcat) #endif import Data.Attoparsec.Internal.Types import Data.ByteString (ByteString) import Data.Text (Text) import Prelude hiding (succ) -- | Compare two 'IResult' values for equality. -- -- If both 'IResult's are 'Partial', the result will be 'Nothing', as -- they are incomplete and hence their equality cannot be known. -- (This is why there is no 'Eq' instance for 'IResult'.) compareResults :: (Eq i, Eq r) => IResult i r -> IResult i r -> Maybe Bool compareResults (Fail t0 ctxs0 msg0) (Fail t1 ctxs1 msg1) = Just (t0 == t1 && ctxs0 == ctxs1 && msg0 == msg1) compareResults (Done t0 r0) (Done t1 r1) = Just (t0 == t1 && r0 == r1) compareResults (Partial _) (Partial _) = Nothing compareResults _ _ = Just False -- | Ask for input. If we receive any, pass the augmented input to a -- success continuation, otherwise to a failure continuation. prompt :: Chunk t => State t -> Pos -> More -> (State t -> Pos -> More -> IResult t r) -> (State t -> Pos -> More -> IResult t r) -> IResult t r prompt t pos _more lose succ = Partial $ \s -> if nullChunk s then lose t pos Complete else succ (pappendChunk t s) pos Incomplete {-# SPECIALIZE prompt :: State ByteString -> Pos -> More -> (State ByteString -> Pos -> More -> IResult ByteString r) -> (State ByteString -> Pos -> More -> IResult ByteString r) -> IResult ByteString r #-} {-# SPECIALIZE prompt :: State Text -> Pos -> More -> (State Text -> Pos -> More -> IResult Text r) -> (State Text -> Pos -> More -> IResult Text r) -> IResult Text r #-} -- | Immediately demand more input via a 'Partial' continuation -- result. demandInput :: Chunk t => Parser t () demandInput = Parser $ \t pos more lose succ -> case more of Complete -> lose t pos more [] "not enough input" _ -> let lose' _ pos' more' = lose t pos' more' [] "not enough input" succ' t' pos' more' = succ t' pos' more' () in prompt t pos more lose' succ' {-# SPECIALIZE demandInput :: Parser ByteString () #-} {-# SPECIALIZE demandInput :: Parser Text () #-} -- | Immediately demand more input via a 'Partial' continuation -- result. Return the new input. demandInput_ :: Chunk t => Parser t t demandInput_ = Parser $ \t pos more lose succ -> case more of Complete -> lose t pos more [] "not enough input" _ -> Partial $ \s -> if nullChunk s then lose t pos Complete [] "not enough input" else succ (pappendChunk t s) pos more s {-# SPECIALIZE demandInput_ :: Parser ByteString ByteString #-} {-# SPECIALIZE demandInput_ :: Parser Text Text #-} -- | This parser always succeeds. It returns 'True' if any input is -- available either immediately or on demand, and 'False' if the end -- of all input has been reached. wantInput :: forall t . Chunk t => Parser t Bool wantInput = Parser $ \t pos more _lose succ -> case () of _ | pos < atBufferEnd (undefined :: t) t -> succ t pos more True | more == Complete -> succ t pos more False | otherwise -> let lose' t' pos' more' = succ t' pos' more' False succ' t' pos' more' = succ t' pos' more' True in prompt t pos more lose' succ' {-# INLINE wantInput #-} -- | Match only if all input has been consumed. endOfInput :: forall t . Chunk t => Parser t () endOfInput = Parser $ \t pos more lose succ -> case () of _| pos < atBufferEnd (undefined :: t) t -> lose t pos more [] "endOfInput" | more == Complete -> succ t pos more () | otherwise -> let lose' t' pos' more' _ctx _msg = succ t' pos' more' () succ' t' pos' more' _a = lose t' pos' more' [] "endOfInput" in runParser demandInput t pos more lose' succ' {-# SPECIALIZE endOfInput :: Parser ByteString () #-} {-# SPECIALIZE endOfInput :: Parser Text () #-} -- | Return an indication of whether the end of input has been -- reached. atEnd :: Chunk t => Parser t Bool atEnd = not <$> wantInput {-# INLINE atEnd #-} satisfySuspended :: forall t r . Chunk t => (ChunkElem t -> Bool) -> State t -> Pos -> More -> Failure t (State t) r -> Success t (State t) (ChunkElem t) r -> IResult t r satisfySuspended p t pos more lose succ = runParser (demandInput >> go) t pos more lose succ where go = Parser $ \t' pos' more' lose' succ' -> case bufferElemAt (undefined :: t) pos' t' of Just (e, l) | p e -> succ' t' (pos' + Pos l) more' e | otherwise -> lose' t' pos' more' [] "satisfyElem" Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ' {-# SPECIALIZE satisfySuspended :: (ChunkElem ByteString -> Bool) -> State ByteString -> Pos -> More -> Failure ByteString (State ByteString) r -> Success ByteString (State ByteString) (ChunkElem ByteString) r -> IResult ByteString r #-} {-# SPECIALIZE satisfySuspended :: (ChunkElem Text -> Bool) -> State Text -> Pos -> More -> Failure Text (State Text) r -> Success Text (State Text) (ChunkElem Text) r -> IResult Text r #-} -- | The parser @satisfyElem p@ succeeds for any chunk element for which the -- predicate @p@ returns 'True'. Returns the element that is -- actually parsed. satisfyElem :: forall t . Chunk t => (ChunkElem t -> Bool) -> Parser t (ChunkElem t) satisfyElem p = Parser $ \t pos more lose succ -> case bufferElemAt (undefined :: t) pos t of Just (e, l) | p e -> succ t (pos + Pos l) more e | otherwise -> lose t pos more [] "satisfyElem" Nothing -> satisfySuspended p t pos more lose succ {-# INLINE satisfyElem #-} -- | Concatenate a monoid after reversing its elements. Used to -- glue together a series of textual chunks that have been accumulated -- \"backwards\". concatReverse :: Monoid m => [m] -> m concatReverse [x] = x concatReverse xs = mconcat (reverse xs) {-# INLINE concatReverse #-} attoparsec-0.13.2.4/Data/Attoparsec/Internal/0000755000000000000000000000000007346545000017027 5ustar0000000000000000attoparsec-0.13.2.4/Data/Attoparsec/Internal/Fhthagn.hs0000644000000000000000000000117407346545000020745 0ustar0000000000000000{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards, MagicHash, UnboxedTuples #-} module Data.Attoparsec.Internal.Fhthagn ( inlinePerformIO ) where import GHC.Exts (realWorld#) import GHC.IO (IO(IO)) -- | Just like unsafePerformIO, but we inline it. Big performance gains as -- it exposes lots of things to further inlining. /Very unsafe/. In -- particular, you should do no memory allocation inside an -- 'inlinePerformIO' block. On Hugs this is just @unsafePerformIO@. inlinePerformIO :: IO a -> a inlinePerformIO (IO m) = case m realWorld# of (# _, r #) -> r {-# INLINE inlinePerformIO #-} attoparsec-0.13.2.4/Data/Attoparsec/Internal/Types.hs0000644000000000000000000002005107346545000020465 0ustar0000000000000000{-# LANGUAGE CPP, BangPatterns, GeneralizedNewtypeDeriving, OverloadedStrings, Rank2Types, RecordWildCards, TypeFamilies #-} -- | -- Module : Data.Attoparsec.Internal.Types -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient parser combinators, loosely based on the Parsec -- library. module Data.Attoparsec.Internal.Types ( Parser(..) , State , Failure , Success , Pos(..) , IResult(..) , More(..) , (<>) , Chunk(..) ) where import Control.Applicative as App (Applicative(..), (<$>)) import Control.Applicative (Alternative(..)) import Control.DeepSeq (NFData(rnf)) import Control.Monad (MonadPlus(..)) import qualified Control.Monad.Fail as Fail (MonadFail(..)) import Data.Monoid as Mon (Monoid(..)) import Data.Semigroup (Semigroup(..)) import Data.Word (Word8) import Data.ByteString (ByteString) import qualified Data.ByteString as BS import Data.ByteString.Internal (w2c) import Data.Text (Text) import qualified Data.Text as Text import Data.Text.Unsafe (Iter(..)) import Prelude hiding (succ) import qualified Data.Attoparsec.ByteString.Buffer as B import qualified Data.Attoparsec.Text.Buffer as T newtype Pos = Pos { fromPos :: Int } deriving (Eq, Ord, Show, Num) -- | The result of a parse. This is parameterised over the type @i@ -- of string that was processed. -- -- This type is an instance of 'Functor', where 'fmap' transforms the -- value in a 'Done' result. data IResult i r = Fail i [String] String -- ^ The parse failed. The @i@ parameter is the input that had -- not yet been consumed when the failure occurred. The -- @[@'String'@]@ is a list of contexts in which the error -- occurred. The 'String' is the message describing the error, if -- any. | Partial (i -> IResult i r) -- ^ Supply this continuation with more input so that the parser -- can resume. To indicate that no more input is available, pass -- an empty string to the continuation. -- -- __Note__: if you get a 'Partial' result, do not call its -- continuation more than once. | Done i r -- ^ The parse succeeded. The @i@ parameter is the input that had -- not yet been consumed (if any) when the parse succeeded. instance (Show i, Show r) => Show (IResult i r) where showsPrec d ir = showParen (d > 10) $ case ir of (Fail t stk msg) -> showString "Fail" . f t . f stk . f msg (Partial _) -> showString "Partial _" (Done t r) -> showString "Done" . f t . f r where f :: Show a => a -> ShowS f x = showChar ' ' . showsPrec 11 x instance (NFData i, NFData r) => NFData (IResult i r) where rnf (Fail t stk msg) = rnf t `seq` rnf stk `seq` rnf msg rnf (Partial _) = () rnf (Done t r) = rnf t `seq` rnf r {-# INLINE rnf #-} instance Functor (IResult i) where fmap _ (Fail t stk msg) = Fail t stk msg fmap f (Partial k) = Partial (fmap f . k) fmap f (Done t r) = Done t (f r) -- | The core parser type. This is parameterised over the type @i@ -- of string being processed. -- -- This type is an instance of the following classes: -- -- * 'Monad', where 'fail' throws an exception (i.e. fails) with an -- error message. -- -- * 'Functor' and 'Applicative', which follow the usual definitions. -- -- * 'MonadPlus', where 'mzero' fails (with no error message) and -- 'mplus' executes the right-hand parser if the left-hand one -- fails. When the parser on the right executes, the input is reset -- to the same state as the parser on the left started with. (In -- other words, attoparsec is a backtracking parser that supports -- arbitrary lookahead.) -- -- * 'Alternative', which follows 'MonadPlus'. newtype Parser i a = Parser { runParser :: forall r. State i -> Pos -> More -> Failure i (State i) r -> Success i (State i) a r -> IResult i r } type family State i type instance State ByteString = B.Buffer type instance State Text = T.Buffer type Failure i t r = t -> Pos -> More -> [String] -> String -> IResult i r type Success i t a r = t -> Pos -> More -> a -> IResult i r -- | Have we read all available input? data More = Complete | Incomplete deriving (Eq, Show) instance Semigroup More where c@Complete <> _ = c _ <> m = m instance Mon.Monoid More where mappend = (<>) mempty = Incomplete instance Monad (Parser i) where #if !(MIN_VERSION_base(4,13,0)) fail = Fail.fail {-# INLINE fail #-} #endif return = App.pure {-# INLINE return #-} m >>= k = Parser $ \t !pos more lose succ -> let succ' t' !pos' more' a = runParser (k a) t' pos' more' lose succ in runParser m t pos more lose succ' {-# INLINE (>>=) #-} (>>) = (*>) {-# INLINE (>>) #-} instance Fail.MonadFail (Parser i) where fail err = Parser $ \t pos more lose _succ -> lose t pos more [] msg where msg = "Failed reading: " ++ err {-# INLINE fail #-} plus :: Parser i a -> Parser i a -> Parser i a plus f g = Parser $ \t pos more lose succ -> let lose' t' _pos' more' _ctx _msg = runParser g t' pos more' lose succ in runParser f t pos more lose' succ instance MonadPlus (Parser i) where mzero = fail "mzero" {-# INLINE mzero #-} mplus = plus instance Functor (Parser i) where fmap f p = Parser $ \t pos more lose succ -> let succ' t' pos' more' a = succ t' pos' more' (f a) in runParser p t pos more lose succ' {-# INLINE fmap #-} apP :: Parser i (a -> b) -> Parser i a -> Parser i b apP d e = do b <- d a <- e return (b a) {-# INLINE apP #-} instance Applicative (Parser i) where pure v = Parser $ \t !pos more _lose succ -> succ t pos more v {-# INLINE pure #-} (<*>) = apP {-# INLINE (<*>) #-} m *> k = m >>= \_ -> k {-# INLINE (*>) #-} x <* y = x >>= \a -> y >> pure a {-# INLINE (<*) #-} instance Semigroup (Parser i a) where (<>) = plus {-# INLINE (<>) #-} instance Monoid (Parser i a) where mempty = fail "mempty" {-# INLINE mempty #-} mappend = (<>) {-# INLINE mappend #-} instance Alternative (Parser i) where empty = fail "empty" {-# INLINE empty #-} (<|>) = plus {-# INLINE (<|>) #-} many v = many_v where many_v = some_v <|> pure [] some_v = (:) <$> v <*> many_v {-# INLINE many #-} some v = some_v where many_v = some_v <|> pure [] some_v = (:) <$> v <*> many_v {-# INLINE some #-} -- | A common interface for input chunks. class Monoid c => Chunk c where type ChunkElem c -- | Test if the chunk is empty. nullChunk :: c -> Bool -- | Append chunk to a buffer. pappendChunk :: State c -> c -> State c -- | Position at the end of a buffer. The first argument is ignored. atBufferEnd :: c -> State c -> Pos -- | Return the buffer element at the given position along with its length. bufferElemAt :: c -> Pos -> State c -> Maybe (ChunkElem c, Int) -- | Map an element to the corresponding character. -- The first argument is ignored. chunkElemToChar :: c -> ChunkElem c -> Char instance Chunk ByteString where type ChunkElem ByteString = Word8 nullChunk = BS.null {-# INLINE nullChunk #-} pappendChunk = B.pappend {-# INLINE pappendChunk #-} atBufferEnd _ = Pos . B.length {-# INLINE atBufferEnd #-} bufferElemAt _ (Pos i) buf | i < B.length buf = Just (B.unsafeIndex buf i, 1) | otherwise = Nothing {-# INLINE bufferElemAt #-} chunkElemToChar _ = w2c {-# INLINE chunkElemToChar #-} instance Chunk Text where type ChunkElem Text = Char nullChunk = Text.null {-# INLINE nullChunk #-} pappendChunk = T.pappend {-# INLINE pappendChunk #-} atBufferEnd _ = Pos . T.length {-# INLINE atBufferEnd #-} bufferElemAt _ (Pos i) buf | i < T.length buf = let Iter c l = T.iter buf i in Just (c, l) | otherwise = Nothing {-# INLINE bufferElemAt #-} chunkElemToChar _ = id {-# INLINE chunkElemToChar #-} attoparsec-0.13.2.4/Data/Attoparsec/Lazy.hs0000644000000000000000000000177707346545000016542 0ustar0000000000000000-- | -- Module : Data.Attoparsec.Lazy -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient combinator parsing for lazy 'ByteString' -- strings, loosely based on the Parsec library. -- -- This is essentially the same code as in the 'Data.Attoparsec' -- module, only with a 'parse' function that can consume a lazy -- 'ByteString' incrementally, and a 'Result' type that does not allow -- more input to be fed in. Think of this as suitable for use with a -- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'. -- -- Behind the scenes, strict 'B.ByteString' values are still used -- internally to store parser input and manipulate it efficiently. -- High-performance parsers such as 'string' still expect strict -- 'B.ByteString' parameters. module Data.Attoparsec.Lazy ( module Data.Attoparsec.ByteString.Lazy ) where import Data.Attoparsec.ByteString.Lazy attoparsec-0.13.2.4/Data/Attoparsec/Number.hs0000644000000000000000000000724107346545000017043 0ustar0000000000000000{-# LANGUAGE DeriveDataTypeable #-} -- | -- Module : Data.Attoparsec.Number -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- This module is deprecated, and both the module and 'Number' type -- will be removed in the next major release. Use the -- package -- and the 'Data.Scientific.Scientific' type instead. -- -- A simple number type, useful for parsing both exact and inexact -- quantities without losing much precision. module Data.Attoparsec.Number {-# DEPRECATED "This module will be removed in the next major release." #-} ( Number(..) ) where import Control.DeepSeq (NFData(rnf)) import Data.Data (Data) import Data.Function (on) import Data.Typeable (Typeable) -- | A numeric type that can represent integers accurately, and -- floating point numbers to the precision of a 'Double'. -- -- /Note/: this type is deprecated, and will be removed in the next -- major release. Use the 'Data.Scientific.Scientific' type instead. data Number = I !Integer | D {-# UNPACK #-} !Double deriving (Typeable, Data) {-# DEPRECATED Number "Use Scientific instead." #-} instance Show Number where show (I a) = show a show (D a) = show a instance NFData Number where rnf (I _) = () rnf (D _) = () {-# INLINE rnf #-} binop :: (Integer -> Integer -> a) -> (Double -> Double -> a) -> Number -> Number -> a binop _ d (D a) (D b) = d a b binop i _ (I a) (I b) = i a b binop _ d (D a) (I b) = d a (fromIntegral b) binop _ d (I a) (D b) = d (fromIntegral a) b {-# INLINE binop #-} instance Eq Number where (==) = binop (==) (==) {-# INLINE (==) #-} (/=) = binop (/=) (/=) {-# INLINE (/=) #-} instance Ord Number where (<) = binop (<) (<) {-# INLINE (<) #-} (<=) = binop (<=) (<=) {-# INLINE (<=) #-} (>) = binop (>) (>) {-# INLINE (>) #-} (>=) = binop (>=) (>=) {-# INLINE (>=) #-} compare = binop compare compare {-# INLINE compare #-} instance Num Number where (+) = binop (((I$!).) . (+)) (((D$!).) . (+)) {-# INLINE (+) #-} (-) = binop (((I$!).) . (-)) (((D$!).) . (-)) {-# INLINE (-) #-} (*) = binop (((I$!).) . (*)) (((D$!).) . (*)) {-# INLINE (*) #-} abs (I a) = I $! abs a abs (D a) = D $! abs a {-# INLINE abs #-} negate (I a) = I $! negate a negate (D a) = D $! negate a {-# INLINE negate #-} signum (I a) = I $! signum a signum (D a) = D $! signum a {-# INLINE signum #-} fromInteger = (I$!) . fromInteger {-# INLINE fromInteger #-} instance Real Number where toRational (I a) = fromIntegral a toRational (D a) = toRational a {-# INLINE toRational #-} instance Fractional Number where fromRational = (D$!) . fromRational {-# INLINE fromRational #-} (/) = binop (((D$!).) . (/) `on` fromIntegral) (((D$!).) . (/)) {-# INLINE (/) #-} recip (I a) = D $! recip (fromIntegral a) recip (D a) = D $! recip a {-# INLINE recip #-} instance RealFrac Number where properFraction (I a) = (fromIntegral a,0) properFraction (D a) = case properFraction a of (i,d) -> (i,D d) {-# INLINE properFraction #-} truncate (I a) = fromIntegral a truncate (D a) = truncate a {-# INLINE truncate #-} round (I a) = fromIntegral a round (D a) = round a {-# INLINE round #-} ceiling (I a) = fromIntegral a ceiling (D a) = ceiling a {-# INLINE ceiling #-} floor (I a) = fromIntegral a floor (D a) = floor a {-# INLINE floor #-} attoparsec-0.13.2.4/Data/Attoparsec/Text.hs0000644000000000000000000003744507346545000016550 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeSynonymInstances #-} #if __GLASGOW_HASKELL__ >= 702 {-# LANGUAGE Trustworthy #-} -- Imports internal modules #endif {-# OPTIONS_GHC -fno-warn-warnings-deprecations #-} -- | -- Module : Data.Attoparsec.Text -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient combinator parsing for 'Text' strings, -- loosely based on the Parsec library. module Data.Attoparsec.Text ( -- * Differences from Parsec -- $parsec -- * Incremental input -- $incremental -- * Performance considerations -- $performance -- * Parser types Parser , Result , T.IResult(..) , I.compareResults -- * Running parsers , parse , feed , I.parseOnly , parseWith , parseTest -- ** Result conversion , maybeResult , eitherResult -- * Parsing individual characters , I.char , I.anyChar , I.notChar , I.satisfy , I.satisfyWith , I.skip -- ** Lookahead , I.peekChar , I.peekChar' -- ** Special character parsers , digit , letter , space -- ** Character classes , I.inClass , I.notInClass -- * Efficient string handling , I.string , I.stringCI , I.asciiCI , skipSpace , I.skipWhile , I.scan , I.runScanner , I.take , I.takeWhile , I.takeWhile1 , I.takeTill -- ** String combinators -- $specalt , (.*>) , (<*.) -- ** Consume all remaining input , I.takeText , I.takeLazyText -- * Text parsing , I.endOfLine , isEndOfLine , isHorizontalSpace -- * Numeric parsers , decimal , hexadecimal , signed , double , Number(..) , number , rational , scientific -- * Combinators , try , () , choice , count , option , many' , many1 , many1' , manyTill , manyTill' , sepBy , sepBy' , sepBy1 , sepBy1' , skipMany , skipMany1 , eitherP , I.match -- * State observation and manipulation functions , I.endOfInput , I.atEnd ) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative (pure, (*>), (<*), (<$>)) import Data.Word (Word) #endif import Control.Applicative ((<|>)) import Data.Attoparsec.Combinator import Data.Attoparsec.Number (Number(..)) import Data.Scientific (Scientific) import qualified Data.Scientific as Sci import Data.Attoparsec.Text.Internal (Parser, Result, parse, takeWhile1) import Data.Bits (Bits, (.|.), shiftL) import Data.Char (isAlpha, isDigit, isSpace, ord) import Data.Int (Int8, Int16, Int32, Int64) import Data.List (intercalate) import Data.Text (Text) import Data.Word (Word8, Word16, Word32, Word64) import qualified Data.Attoparsec.Internal as I import qualified Data.Attoparsec.Internal.Types as T import qualified Data.Attoparsec.Text.Internal as I import qualified Data.Text as T -- $parsec -- -- Compared to Parsec 3, attoparsec makes several tradeoffs. It is -- not intended for, or ideal for, all possible uses. -- -- * While attoparsec can consume input incrementally, Parsec cannot. -- Incremental input is a huge deal for efficient and secure network -- and system programming, since it gives much more control to users -- of the library over matters such as resource usage and the I/O -- model to use. -- -- * Much of the performance advantage of attoparsec is gained via -- high-performance parsers such as 'I.takeWhile' and 'I.string'. -- If you use complicated combinators that return lists of -- characters, there is less performance difference between the two -- libraries. -- -- * Unlike Parsec 3, attoparsec does not support being used as a -- monad transformer. -- -- * attoparsec is specialised to deal only with strict 'Text' -- input. Efficiency concerns rule out both lists and lazy text. -- The usual use for lazy text would be to allow consumption of very -- large input without a large footprint. For this need, -- attoparsec's incremental input provides an excellent substitute, -- with much more control over when input takes place. If you must -- use lazy text, see the 'Lazy' module, which feeds lazy chunks to -- a regular parser. -- -- * Parsec parsers can produce more helpful error messages than -- attoparsec parsers. This is a matter of focus: attoparsec avoids -- the extra book-keeping in favour of higher performance. -- $incremental -- -- attoparsec supports incremental input, meaning that you can feed it -- a 'Text' that represents only part of the expected total amount -- of data to parse. If your parser reaches the end of a fragment of -- input and could consume more input, it will suspend parsing and -- return a 'T.Partial' continuation. -- -- Supplying the 'T.Partial' continuation with another string will -- resume parsing at the point where it was suspended, with the string -- you supplied used as new input at the end of the existing -- input. You must be prepared for the result of the resumed parse to -- be another 'Partial' continuation. -- -- To indicate that you have no more input, supply the 'Partial' -- continuation with an 'T.empty' 'Text'. -- -- Remember that some parsing combinators will not return a result -- until they reach the end of input. They may thus cause 'T.Partial' -- results to be returned. -- -- If you do not need support for incremental input, consider using -- the 'I.parseOnly' function to run your parser. It will never -- prompt for more input. -- -- /Note/: incremental input does /not/ imply that attoparsec will -- release portions of its internal state for garbage collection as it -- proceeds. Its internal representation is equivalent to a single -- 'Text': if you feed incremental input to an a parser, it will -- require memory proportional to the amount of input you supply. -- (This is necessary to support arbitrary backtracking.) -- $performance -- -- If you write an attoparsec-based parser carefully, it can be -- realistic to expect it to perform similarly to a hand-rolled C -- parser (measuring megabytes parsed per second). -- -- To actually achieve high performance, there are a few guidelines -- that it is useful to follow. -- -- Use the 'Text'-oriented parsers whenever possible, -- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyChar'. There is -- about a factor of 100 difference in performance between the two -- kinds of parser. -- -- For very simple character-testing predicates, write them by hand -- instead of using 'I.inClass' or 'I.notInClass'. For instance, both -- of these predicates test for an end-of-line character, but the -- first is much faster than the second: -- -- >endOfLine_fast c = c == '\r' || c == '\n' -- >endOfLine_slow = inClass "\r\n" -- -- Make active use of benchmarking and profiling tools to measure, -- find the problems with, and improve the performance of your parser. -- | Run a parser and print its result to standard output. parseTest :: (Show a) => I.Parser a -> Text -> IO () parseTest p s = print (parse p s) -- | Run a parser with an initial input string, and a monadic action -- that can supply more input if needed. parseWith :: Monad m => (m Text) -- ^ An action that will be executed to provide the parser -- with more input, if necessary. The action must return an -- 'T.empty' string when there is no more input available. -> I.Parser a -> Text -- ^ Initial input for the parser. -> m (Result a) parseWith refill p s = step $ parse p s where step (T.Partial k) = (step . k) =<< refill step r = return r {-# INLINE parseWith #-} -- | Convert a 'Result' value to a 'Maybe' value. A 'Partial' result -- is treated as failure. maybeResult :: Result r -> Maybe r maybeResult (T.Done _ r) = Just r maybeResult _ = Nothing -- | Convert a 'Result' value to an 'Either' value. A 'Partial' result -- is treated as failure. eitherResult :: Result r -> Either String r eitherResult (T.Done _ r) = Right r eitherResult (T.Fail _ [] msg) = Left msg eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg) eitherResult _ = Left "Result: incomplete input" -- | A predicate that matches either a carriage return @\'\\r\'@ or -- newline @\'\\n\'@ character. isEndOfLine :: Char -> Bool isEndOfLine c = c == '\n' || c == '\r' {-# INLINE isEndOfLine #-} -- | A predicate that matches either a space @\' \'@ or horizontal tab -- @\'\\t\'@ character. isHorizontalSpace :: Char -> Bool isHorizontalSpace c = c == ' ' || c == '\t' {-# INLINE isHorizontalSpace #-} -- | Parse and decode an unsigned hexadecimal number. The hex digits -- @\'a\'@ through @\'f\'@ may be upper or lower case. -- -- This parser does not accept a leading @\"0x\"@ string. hexadecimal :: (Integral a, Bits a) => Parser a hexadecimal = T.foldl' step 0 `fmap` takeWhile1 isHexDigit where isHexDigit c = (c >= '0' && c <= '9') || (c >= 'a' && c <= 'f') || (c >= 'A' && c <= 'F') step a c | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48) | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87) | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55) where w = ord c {-# SPECIALISE hexadecimal :: Parser Int #-} {-# SPECIALISE hexadecimal :: Parser Int8 #-} {-# SPECIALISE hexadecimal :: Parser Int16 #-} {-# SPECIALISE hexadecimal :: Parser Int32 #-} {-# SPECIALISE hexadecimal :: Parser Int64 #-} {-# SPECIALISE hexadecimal :: Parser Integer #-} {-# SPECIALISE hexadecimal :: Parser Word #-} {-# SPECIALISE hexadecimal :: Parser Word8 #-} {-# SPECIALISE hexadecimal :: Parser Word16 #-} {-# SPECIALISE hexadecimal :: Parser Word32 #-} {-# SPECIALISE hexadecimal :: Parser Word64 #-} -- | Parse and decode an unsigned decimal number. decimal :: Integral a => Parser a decimal = T.foldl' step 0 `fmap` takeWhile1 isDecimal where step a c = a * 10 + fromIntegral (ord c - 48) {-# SPECIALISE decimal :: Parser Int #-} {-# SPECIALISE decimal :: Parser Int8 #-} {-# SPECIALISE decimal :: Parser Int16 #-} {-# SPECIALISE decimal :: Parser Int32 #-} {-# SPECIALISE decimal :: Parser Int64 #-} {-# SPECIALISE decimal :: Parser Integer #-} {-# SPECIALISE decimal :: Parser Word #-} {-# SPECIALISE decimal :: Parser Word8 #-} {-# SPECIALISE decimal :: Parser Word16 #-} {-# SPECIALISE decimal :: Parser Word32 #-} {-# SPECIALISE decimal :: Parser Word64 #-} isDecimal :: Char -> Bool isDecimal c = c >= '0' && c <= '9' {-# INLINE isDecimal #-} -- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign -- character. signed :: Num a => Parser a -> Parser a {-# SPECIALISE signed :: Parser Int -> Parser Int #-} {-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-} {-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-} {-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-} {-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-} {-# SPECIALISE signed :: Parser Integer -> Parser Integer #-} signed p = (negate <$> (I.char '-' *> p)) <|> (I.char '+' *> p) <|> p -- | Parse a rational number. -- -- The syntax accepted by this parser is the same as for 'double'. -- -- /Note/: this parser is not safe for use with inputs from untrusted -- sources. An input with a suitably large exponent such as -- @"1e1000000000"@ will cause a huge 'Integer' to be allocated, -- resulting in what is effectively a denial-of-service attack. -- -- In most cases, it is better to use 'double' or 'scientific' -- instead. rational :: Fractional a => Parser a {-# SPECIALIZE rational :: Parser Double #-} {-# SPECIALIZE rational :: Parser Float #-} {-# SPECIALIZE rational :: Parser Rational #-} {-# SPECIALIZE rational :: Parser Scientific #-} rational = scientifically realToFrac -- | Parse a rational number. -- -- This parser accepts an optional leading sign character, followed by -- at least one decimal digit. The syntax similar to that accepted by -- the 'read' function, with the exception that a trailing @\'.\'@ or -- @\'e\'@ /not/ followed by a number is not consumed. -- -- Examples with behaviour identical to 'read', if you feed an empty -- continuation to the first result: -- -- >rational "3" == Done 3.0 "" -- >rational "3.1" == Done 3.1 "" -- >rational "3e4" == Done 30000.0 "" -- >rational "3.1e4" == Done 31000.0, "" -- -- Examples with behaviour identical to 'read': -- -- >rational ".3" == Fail "input does not start with a digit" -- >rational "e3" == Fail "input does not start with a digit" -- -- Examples of differences from 'read': -- -- >rational "3.foo" == Done 3.0 ".foo" -- >rational "3e" == Done 3.0 "e" -- -- This function does not accept string representations of \"NaN\" or -- \"Infinity\". double :: Parser Double double = scientifically Sci.toRealFloat -- | Parse a number, attempting to preserve both speed and precision. -- -- The syntax accepted by this parser is the same as for 'double'. -- -- This function does not accept string representations of \"NaN\" or -- \"Infinity\". number :: Parser Number number = scientifically $ \s -> let e = Sci.base10Exponent s c = Sci.coefficient s in if e >= 0 then I (c * 10 ^ e) else D (Sci.toRealFloat s) {-# DEPRECATED number "Use 'scientific' instead." #-} -- | Parse a scientific number. -- -- The syntax accepted by this parser is the same as for 'double'. scientific :: Parser Scientific scientific = scientifically id -- A strict pair data SP = SP !Integer {-# UNPACK #-}!Int {-# INLINE scientifically #-} scientifically :: (Scientific -> a) -> Parser a scientifically h = do !positive <- ((== '+') <$> I.satisfy (\c -> c == '-' || c == '+')) <|> pure True n <- decimal let f fracDigits = SP (T.foldl' step n fracDigits) (negate $ T.length fracDigits) step a c = a * 10 + fromIntegral (ord c - 48) SP c e <- (I.satisfy (=='.') *> (f <$> I.takeWhile isDigit)) <|> pure (SP n 0) let !signedCoeff | positive = c | otherwise = -c (I.satisfy (\w -> w == 'e' || w == 'E') *> fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|> return (h $ Sci.scientific signedCoeff e) -- | Parse a single digit, as recognised by 'isDigit'. digit :: Parser Char digit = I.satisfy isDigit "digit" {-# INLINE digit #-} -- | Parse a letter, as recognised by 'isAlpha'. letter :: Parser Char letter = I.satisfy isAlpha "letter" {-# INLINE letter #-} -- | Parse a space character, as recognised by 'isSpace'. space :: Parser Char space = I.satisfy isSpace "space" {-# INLINE space #-} -- | Skip over white space. skipSpace :: Parser () skipSpace = I.skipWhile isSpace {-# INLINE skipSpace #-} -- $specalt -- -- If you enable the @OverloadedStrings@ language extension, you can -- use the '*>' and '<*' combinators to simplify the common task of -- matching a statically known string, then immediately parsing -- something else. -- -- Instead of writing something like this: -- -- @ --'I.string' \"foo\" '*>' wibble -- @ -- -- Using @OverloadedStrings@, you can omit the explicit use of -- 'I.string', and write a more compact version: -- -- @ -- \"foo\" '*>' wibble -- @ -- -- (Note: the '.*>' and '<*.' combinators that were originally -- provided for this purpose are obsolete and unnecessary, and will be -- removed in the next major version.) -- | /Obsolete/. A type-specialized version of '*>' for 'Text'. Use -- '*>' instead. (.*>) :: Text -> Parser a -> Parser a s .*> f = I.string s *> f {-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-} -- | /Obsolete/. A type-specialized version of '<*' for 'Text'. Use -- '*>' instead. (<*.) :: Parser a -> Text -> Parser a f <*. s = f <* I.string s {-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-} attoparsec-0.13.2.4/Data/Attoparsec/Text/0000755000000000000000000000000007346545000016177 5ustar0000000000000000attoparsec-0.13.2.4/Data/Attoparsec/Text/Buffer.hs0000644000000000000000000001225707346545000017753 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, MagicHash, RankNTypes, RecordWildCards, UnboxedTuples #-} -- | -- Module : Data.Attoparsec.Text.Buffer -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : GHC -- -- An immutable buffer that supports cheap appends. -- A Buffer is divided into an immutable read-only zone, followed by a -- mutable area that we've preallocated, but not yet written to. -- -- We overallocate at the end of a Buffer so that we can cheaply -- append. Since a user of an existing Buffer cannot see past the end -- of its immutable zone into the data that will change during an -- append, this is safe. -- -- Once we run out of space at the end of a Buffer, we do the usual -- doubling of the buffer size. module Data.Attoparsec.Text.Buffer ( Buffer , buffer , unbuffer , unbufferAt , length , pappend , iter , iter_ , substring , dropWord16 ) where import Control.Exception (assert) import Data.Bits (shiftR) import Data.List (foldl1') import Data.Monoid as Mon (Monoid(..)) import Data.Semigroup (Semigroup(..)) import Data.Text () import Data.Text.Internal (Text(..)) import Data.Text.Internal.Encoding.Utf16 (chr2) import Data.Text.Internal.Unsafe.Char (unsafeChr) import Data.Text.Unsafe (Iter(..)) import Foreign.Storable (sizeOf) import GHC.Exts (Int(..), indexIntArray#, unsafeCoerce#, writeIntArray#) import GHC.ST (ST(..), runST) import Prelude hiding (length) import qualified Data.Text.Array as A -- If _cap is zero, this buffer is empty. data Buffer = Buf { _arr :: {-# UNPACK #-} !A.Array , _off :: {-# UNPACK #-} !Int , _len :: {-# UNPACK #-} !Int , _cap :: {-# UNPACK #-} !Int , _gen :: {-# UNPACK #-} !Int } instance Show Buffer where showsPrec p = showsPrec p . unbuffer -- | The initial 'Buffer' has no mutable zone, so we can avoid all -- copies in the (hopefully) common case of no further input being fed -- to us. buffer :: Text -> Buffer buffer (Text arr off len) = Buf arr off len len 0 unbuffer :: Buffer -> Text unbuffer (Buf arr off len _ _) = Text arr off len unbufferAt :: Int -> Buffer -> Text unbufferAt s (Buf arr off len _ _) = assert (s >= 0 && s <= len) $ Text arr (off+s) (len-s) instance Semigroup Buffer where (Buf _ _ _ 0 _) <> b = b a <> (Buf _ _ _ 0 _) = a buf <> (Buf arr off len _ _) = append buf arr off len {-# INLINE (<>) #-} instance Monoid Buffer where mempty = Buf A.empty 0 0 0 0 {-# INLINE mempty #-} mappend = (<>) mconcat [] = Mon.mempty mconcat xs = foldl1' (<>) xs pappend :: Buffer -> Text -> Buffer pappend (Buf _ _ _ 0 _) t = buffer t pappend buf (Text arr off len) = append buf arr off len append :: Buffer -> A.Array -> Int -> Int -> Buffer append (Buf arr0 off0 len0 cap0 gen0) !arr1 !off1 !len1 = runST $ do let woff = sizeOf (0::Int) `shiftR` 1 newlen = len0 + len1 !gen = if gen0 == 0 then 0 else readGen arr0 if gen == gen0 && newlen <= cap0 then do let newgen = gen + 1 marr <- unsafeThaw arr0 writeGen marr newgen A.copyI marr (off0+len0) arr1 off1 (off0+newlen) arr2 <- A.unsafeFreeze marr return (Buf arr2 off0 newlen cap0 newgen) else do let newcap = newlen * 2 newgen = 1 marr <- A.new (newcap + woff) writeGen marr newgen A.copyI marr woff arr0 off0 (woff+len0) A.copyI marr (woff+len0) arr1 off1 (woff+newlen) arr2 <- A.unsafeFreeze marr return (Buf arr2 woff newlen newcap newgen) length :: Buffer -> Int length (Buf _ _ len _ _) = len {-# INLINE length #-} substring :: Int -> Int -> Buffer -> Text substring s l (Buf arr off len _ _) = assert (s >= 0 && s <= len) . assert (l >= 0 && l <= len-s) $ Text arr (off+s) l {-# INLINE substring #-} dropWord16 :: Int -> Buffer -> Text dropWord16 s (Buf arr off len _ _) = assert (s >= 0 && s <= len) $ Text arr (off+s) (len-s) {-# INLINE dropWord16 #-} -- | /O(1)/ Iterate (unsafely) one step forwards through a UTF-16 -- array, returning the current character and the delta to add to give -- the next offset to iterate at. iter :: Buffer -> Int -> Iter iter (Buf arr off _ _ _) i | m < 0xD800 || m > 0xDBFF = Iter (unsafeChr m) 1 | otherwise = Iter (chr2 m n) 2 where m = A.unsafeIndex arr j n = A.unsafeIndex arr k j = off + i k = j + 1 {-# INLINE iter #-} -- | /O(1)/ Iterate one step through a UTF-16 array, returning the -- delta to add to give the next offset to iterate at. iter_ :: Buffer -> Int -> Int iter_ (Buf arr off _ _ _) i | m < 0xD800 || m > 0xDBFF = 1 | otherwise = 2 where m = A.unsafeIndex arr (off+i) {-# INLINE iter_ #-} unsafeThaw :: A.Array -> ST s (A.MArray s) unsafeThaw A.Array{..} = ST $ \s# -> (# s#, A.MArray (unsafeCoerce# aBA) #) readGen :: A.Array -> Int readGen a = case indexIntArray# (A.aBA a) 0# of r# -> I# r# writeGen :: A.MArray s -> Int -> ST s () writeGen a (I# gen#) = ST $ \s0# -> case writeIntArray# (A.maBA a) 0# gen# s0# of s1# -> (# s1#, () #) attoparsec-0.13.2.4/Data/Attoparsec/Text/FastSet.hs0000644000000000000000000000740307346545000020110 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} ------------------------------------------------------------------------------ -- | -- Module : Data.Attoparsec.FastSet -- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : felipe.lessa@gmail.com -- Stability : experimental -- Portability : unknown -- -- Fast set membership tests for 'Char' values. We test for -- membership using a hashtable implemented with Robin Hood -- collision resolution. The set representation is unboxed, -- and the characters and hashes interleaved, for efficiency. -- -- ----------------------------------------------------------------------------- module Data.Attoparsec.Text.FastSet ( -- * Data type FastSet -- * Construction , fromList , set -- * Lookup , member -- * Handy interface , charClass ) where import Data.Bits ((.|.), (.&.), shiftR) import Data.Function (on) import Data.List (sort, sortBy) import qualified Data.Array.Base as AB import qualified Data.Array.Unboxed as A import qualified Data.Text as T data FastSet = FastSet { table :: {-# UNPACK #-} !(A.UArray Int Int) , mask :: {-# UNPACK #-} !Int } data Entry = Entry { key :: {-# UNPACK #-} !Char , initialIndex :: {-# UNPACK #-} !Int , index :: {-# UNPACK #-} !Int } offset :: Entry -> Int offset e = index e - initialIndex e resolveCollisions :: [Entry] -> [Entry] resolveCollisions [] = [] resolveCollisions [e] = [e] resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries) where (a', b') | index a < index b = (a, b) | offset a < offset b = (b { index=index a }, a { index=index a + 1 }) | otherwise = (a, b { index=index a + 1 }) pad :: Int -> [Entry] -> [Entry] pad = go 0 where -- ensure that we pad enough so that lookups beyond the -- last hash in the table fall within the array go !_ !m [] = replicate (max 1 m + 1) empty go k m (e:entries) = map (const empty) [k..i - 1] ++ e : go (i + 1) (m + i - k - 1) entries where i = index e empty = Entry '\0' maxBound 0 nextPowerOf2 :: Int -> Int nextPowerOf2 0 = 1 nextPowerOf2 x = go (x - 1) 1 where go y 32 = y + 1 go y k = go (y .|. (y `shiftR` k)) $ k * 2 fastHash :: Char -> Int fastHash = fromEnum fromList :: String -> FastSet fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved) mask' where s' = ordNub (sort s) l = length s' mask' = nextPowerOf2 ((5 * l) `div` 4) - 1 entries = pad mask' . resolveCollisions . sortBy (compare `on` initialIndex) . zipWith (\c i -> Entry c i i) s' . map ((.&. mask') . fastHash) $ s' interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e]) entries ordNub :: Eq a => [a] -> [a] ordNub [] = [] ordNub (y:ys) = go y ys where go x (z:zs) | x == z = go x zs | otherwise = x : go z zs go x [] = [x] set :: T.Text -> FastSet set = fromList . T.unpack -- | Check the set for membership. member :: Char -> FastSet -> Bool member c a = go (2 * i) where i = fastHash c .&. mask a lookupAt j b = (i' <= i) && (c == c' || b) where c' = toEnum $ AB.unsafeAt (table a) j i' = AB.unsafeAt (table a) $ j + 1 go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) . lookupAt (j + 6) . go $ j + 8 charClass :: String -> FastSet charClass = fromList . go where go (a:'-':b:xs) = [a..b] ++ go xs go (x:xs) = x : go xs go _ = "" attoparsec-0.13.2.4/Data/Attoparsec/Text/Internal.hs0000644000000000000000000004335207346545000020316 0ustar0000000000000000{-# LANGUAGE BangPatterns, FlexibleInstances, GADTs, OverloadedStrings, Rank2Types, RecordWildCards, TypeFamilies, TypeSynonymInstances #-} {-# OPTIONS_GHC -fno-warn-orphans #-} -- | -- Module : Data.Attoparsec.Text.Internal -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient parser combinators for 'Text' strings, loosely -- based on the Parsec library. module Data.Attoparsec.Text.Internal ( -- * Parser types Parser , Result -- * Running parsers , parse , parseOnly -- * Combinators , module Data.Attoparsec.Combinator -- * Parsing individual characters , satisfy , satisfyWith , anyChar , skip , char , notChar -- ** Lookahead , peekChar , peekChar' -- ** Character classes , inClass , notInClass -- * Efficient string handling , skipWhile , string , stringCI , asciiCI , take , scan , runScanner , takeWhile , takeWhile1 , takeTill -- ** Consume all remaining input , takeText , takeLazyText -- * Utilities , endOfLine , endOfInput , match , atEnd ) where import Control.Applicative ((<|>), (<$>), pure, (*>)) import Control.Monad (when) import Data.Attoparsec.Combinator (()) import Data.Attoparsec.Internal import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success) import qualified Data.Attoparsec.Text.Buffer as Buf import Data.Attoparsec.Text.Buffer (Buffer, buffer) import Data.Char (isAsciiUpper, isAsciiLower, toUpper, toLower) import Data.List (intercalate) import Data.String (IsString(..)) import Data.Text.Internal (Text(..)) import Prelude hiding (getChar, succ, take, takeWhile) import qualified Data.Attoparsec.Internal.Types as T import qualified Data.Attoparsec.Text.FastSet as Set import qualified Data.Text as T import qualified Data.Text.Lazy as L import qualified Data.Text.Unsafe as T type Parser = T.Parser Text type Result = IResult Text type Failure r = T.Failure Text Buffer r type Success a r = T.Success Text Buffer a r instance (a ~ Text) => IsString (Parser a) where fromString = string . T.pack -- | The parser @satisfy p@ succeeds for any character for which the -- predicate @p@ returns 'True'. Returns the character that is -- actually parsed. -- -- >digit = satisfy isDigit -- > where isDigit c = c >= '0' && c <= '9' satisfy :: (Char -> Bool) -> Parser Char satisfy p = do (k,c) <- ensure 1 let !h = T.unsafeHead c if p h then advance k >> return h else fail "satisfy" {-# INLINE satisfy #-} -- | The parser @skip p@ succeeds for any character for which the -- predicate @p@ returns 'True'. -- -- >skipDigit = skip isDigit -- > where isDigit c = c >= '0' && c <= '9' skip :: (Char -> Bool) -> Parser () skip p = do (k,s) <- ensure 1 if p (T.unsafeHead s) then advance k else fail "skip" -- | The parser @satisfyWith f p@ transforms a character, and succeeds -- if the predicate @p@ returns 'True' on the transformed value. The -- parser returns the transformed character that was parsed. satisfyWith :: (Char -> a) -> (a -> Bool) -> Parser a satisfyWith f p = do (k,s) <- ensure 1 let c = f $! T.unsafeHead s if p c then advance k >> return c else fail "satisfyWith" {-# INLINE satisfyWith #-} -- | Consume @n@ characters of input, but succeed only if the -- predicate returns 'True'. takeWith :: Int -> (Text -> Bool) -> Parser Text takeWith n p = do (k,s) <- ensure n if p s then advance k >> return s else fail "takeWith" -- | Consume exactly @n@ characters of input. take :: Int -> Parser Text take n = takeWith (max n 0) (const True) {-# INLINE take #-} -- | @string s@ parses a sequence of characters that identically match -- @s@. Returns the parsed string (i.e. @s@). This parser consumes no -- input if it fails (even if a partial match). -- -- /Note/: The behaviour of this parser is different to that of the -- similarly-named parser in Parsec, as this one is all-or-nothing. -- To illustrate the difference, the following parser will fail under -- Parsec given an input of @\"for\"@: -- -- >string "foo" <|> string "for" -- -- The reason for its failure is that the first branch is a -- partial match, and will consume the letters @\'f\'@ and @\'o\'@ -- before failing. In attoparsec, the above parser will /succeed/ on -- that input, because the failed first branch will consume nothing. string :: Text -> Parser Text string s = string_ (stringSuspended id) id s {-# INLINE string #-} string_ :: (forall r. Text -> Text -> Buffer -> Pos -> More -> Failure r -> Success Text r -> Result r) -> (Text -> Text) -> Text -> Parser Text string_ suspended f s0 = T.Parser $ \t pos more lose succ -> let s = f s0 ft = f (Buf.unbufferAt (fromPos pos) t) in case T.commonPrefixes s ft of Nothing | T.null s -> succ t pos more T.empty | T.null ft -> suspended s s t pos more lose succ | otherwise -> lose t pos more [] "string" Just (pfx,ssfx,tsfx) | T.null ssfx -> let l = Pos (T.lengthWord16 pfx) in succ t (pos + l) more (substring pos l t) | not (T.null tsfx) -> lose t pos more [] "string" | otherwise -> suspended s ssfx t pos more lose succ {-# INLINE string_ #-} stringSuspended :: (Text -> Text) -> Text -> Text -> Buffer -> Pos -> More -> Failure r -> Success Text r -> Result r stringSuspended f s000 s0 t0 pos0 more0 lose0 succ0 = runParser (demandInput_ >>= go) t0 pos0 more0 lose0 succ0 where go s' = T.Parser $ \t pos more lose succ -> let s = f s' in case T.commonPrefixes s0 s of Nothing -> lose t pos more [] "string" Just (_pfx,ssfx,tsfx) | T.null ssfx -> let l = Pos (T.lengthWord16 s000) in succ t (pos + l) more (substring pos l t) | T.null tsfx -> stringSuspended f s000 ssfx t pos more lose succ | otherwise -> lose t pos more [] "string" -- | Satisfy a literal string, ignoring case. -- -- Note: this function is currently quite inefficient. Unicode case -- folding can change the length of a string (\"ß\" becomes -- "ss"), which makes a simple, efficient implementation tricky. We -- have (for now) chosen simplicity over efficiency. stringCI :: Text -> Parser Text stringCI s = go 0 where go !n | n > T.length fs = fail "stringCI" | otherwise = do (k,t) <- ensure n if T.toCaseFold t == fs then advance k >> return t else go (n+1) fs = T.toCaseFold s {-# INLINE stringCI #-} {-# DEPRECATED stringCI "this is very inefficient, use asciiCI instead" #-} -- | Satisfy a literal string, ignoring case for characters in the ASCII range. asciiCI :: Text -> Parser Text asciiCI s = fmap fst $ match $ T.foldr ((*>) . asciiCharCI) (pure ()) s {-# INLINE asciiCI #-} asciiCharCI :: Char -> Parser Char asciiCharCI c | isAsciiUpper c = char c <|> char (toLower c) | isAsciiLower c = char c <|> char (toUpper c) | otherwise = char c {-# INLINE asciiCharCI #-} -- | Skip past input for as long as the predicate returns 'True'. skipWhile :: (Char -> Bool) -> Parser () skipWhile p = go where go = do t <- T.takeWhile p <$> get continue <- inputSpansChunks (size t) when continue go {-# INLINE skipWhile #-} -- | Consume input as long as the predicate returns 'False' -- (i.e. until it returns 'True'), and return the consumed input. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'True' on the first character of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'Control.Applicative.many', because such -- parsers loop until a failure occurs. Careless use will thus result -- in an infinite loop. takeTill :: (Char -> Bool) -> Parser Text takeTill p = takeWhile (not . p) {-# INLINE takeTill #-} -- | Consume input as long as the predicate returns 'True', and return -- the consumed input. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'False' on the first character of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'Control.Applicative.many', because such -- parsers loop until a failure occurs. Careless use will thus result -- in an infinite loop. takeWhile :: (Char -> Bool) -> Parser Text takeWhile p = do h <- T.takeWhile p <$> get continue <- inputSpansChunks (size h) -- only use slow concat path if necessary if continue then takeWhileAcc p [h] else return h {-# INLINE takeWhile #-} takeWhileAcc :: (Char -> Bool) -> [Text] -> Parser Text takeWhileAcc p = go where go acc = do h <- T.takeWhile p <$> get continue <- inputSpansChunks (size h) if continue then go (h:acc) else return $ concatReverse (h:acc) {-# INLINE takeWhileAcc #-} takeRest :: Parser [Text] takeRest = go [] where go acc = do input <- wantInput if input then do s <- get advance (size s) go (s:acc) else return (reverse acc) -- | Consume all remaining input and return it as a single string. takeText :: Parser Text takeText = T.concat `fmap` takeRest -- | Consume all remaining input and return it as a single string. takeLazyText :: Parser L.Text takeLazyText = L.fromChunks `fmap` takeRest data Scan s = Continue s | Finished s {-# UNPACK #-} !Int Text scan_ :: (s -> [Text] -> Parser r) -> s -> (s -> Char -> Maybe s) -> Parser r scan_ f s0 p = go [] s0 where scanner s !n t = case T.uncons t of Just (c,t') -> case p s c of Just s' -> scanner s' (n+1) t' Nothing -> Finished s n t Nothing -> Continue s go acc s = do input <- get case scanner s 0 input of Continue s' -> do continue <- inputSpansChunks (size input) if continue then go (input : acc) s' else f s' (input : acc) Finished s' n t -> do advance (size input - size t) f s' (T.take n input : acc) {-# INLINE scan_ #-} -- | A stateful scanner. The predicate consumes and transforms a -- state argument, and each transformed state is passed to successive -- invocations of the predicate on each character of the input until one -- returns 'Nothing' or the input ends. -- -- This parser does not fail. It will return an empty string if the -- predicate returns 'Nothing' on the first character of input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'Control.Applicative.many', because such -- parsers loop until a failure occurs. Careless use will thus result -- in an infinite loop. scan :: s -> (s -> Char -> Maybe s) -> Parser Text scan = scan_ $ \_ chunks -> return $! concatReverse chunks {-# INLINE scan #-} -- | Like 'scan', but generalized to return the final state of the -- scanner. runScanner :: s -> (s -> Char -> Maybe s) -> Parser (Text, s) runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s) {-# INLINE runScanner #-} -- | Consume input as long as the predicate returns 'True', and return -- the consumed input. -- -- This parser requires the predicate to succeed on at least one -- character of input: it will fail if the predicate never returns -- 'True' or if there is no input left. takeWhile1 :: (Char -> Bool) -> Parser Text takeWhile1 p = do (`when` demandInput) =<< endOfChunk h <- T.takeWhile p <$> get let size' = size h when (size' == 0) $ fail "takeWhile1" advance size' eoc <- endOfChunk if eoc then takeWhileAcc p [h] else return h {-# INLINE takeWhile1 #-} -- | Match any character in a set. -- -- >vowel = inClass "aeiou" -- -- Range notation is supported. -- -- >halfAlphabet = inClass "a-nA-N" -- -- To add a literal @\'-\'@ to a set, place it at the beginning or end -- of the string. inClass :: String -> Char -> Bool inClass s = (`Set.member` mySet) where mySet = Set.charClass s {-# NOINLINE mySet #-} {-# INLINE inClass #-} -- | Match any character not in a set. notInClass :: String -> Char -> Bool notInClass s = not . inClass s {-# INLINE notInClass #-} -- | Match any character. anyChar :: Parser Char anyChar = satisfy $ const True {-# INLINE anyChar #-} -- | Match a specific character. char :: Char -> Parser Char char c = satisfy (== c) show c {-# INLINE char #-} -- | Match any character except the given one. notChar :: Char -> Parser Char notChar c = satisfy (/= c) "not " ++ show c {-# INLINE notChar #-} -- | Match any character, to perform lookahead. Returns 'Nothing' if -- end of input has been reached. Does not consume any input. -- -- /Note/: Because this parser does not fail, do not use it with -- combinators such as 'Control.Applicative.many', because such -- parsers loop until a failure occurs. Careless use will thus result -- in an infinite loop. peekChar :: Parser (Maybe Char) peekChar = T.Parser $ \t pos more _lose succ -> case () of _| pos < lengthOf t -> let T.Iter !c _ = Buf.iter t (fromPos pos) in succ t pos more (Just c) | more == Complete -> succ t pos more Nothing | otherwise -> let succ' t' pos' more' = let T.Iter !c _ = Buf.iter t' (fromPos pos') in succ t' pos' more' (Just c) lose' t' pos' more' = succ t' pos' more' Nothing in prompt t pos more lose' succ' {-# INLINE peekChar #-} -- | Match any character, to perform lookahead. Does not consume any -- input, but will fail if end of input has been reached. peekChar' :: Parser Char peekChar' = do (_,s) <- ensure 1 return $! T.unsafeHead s {-# INLINE peekChar' #-} -- | Match either a single newline character @\'\\n\'@, or a carriage -- return followed by a newline character @\"\\r\\n\"@. endOfLine :: Parser () endOfLine = (char '\n' >> return ()) <|> (string "\r\n" >> return ()) -- | Terminal failure continuation. failK :: Failure a failK t (Pos pos) _more stack msg = Fail (Buf.dropWord16 pos t) stack msg {-# INLINE failK #-} -- | Terminal success continuation. successK :: Success a a successK t (Pos pos) _more a = Done (Buf.dropWord16 pos t) a {-# INLINE successK #-} -- | Run a parser. parse :: Parser a -> Text -> Result a parse m s = runParser m (buffer s) 0 Incomplete failK successK {-# INLINE parse #-} -- | Run a parser that cannot be resupplied via a 'Partial' result. -- -- This function does not force a parser to consume all of its input. -- Instead, any residual input will be discarded. To force a parser -- to consume all of its input, use something like this: -- -- @ --'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput') -- @ parseOnly :: Parser a -> Text -> Either String a parseOnly m s = case runParser m (buffer s) 0 Complete failK successK of Fail _ [] err -> Left err Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err) Done _ a -> Right a _ -> error "parseOnly: impossible error!" {-# INLINE parseOnly #-} get :: Parser Text get = T.Parser $ \t pos more _lose succ -> succ t pos more (Buf.dropWord16 (fromPos pos) t) {-# INLINE get #-} endOfChunk :: Parser Bool endOfChunk = T.Parser $ \t pos more _lose succ -> succ t pos more (pos == lengthOf t) {-# INLINE endOfChunk #-} inputSpansChunks :: Pos -> Parser Bool inputSpansChunks i = T.Parser $ \t pos_ more _lose succ -> let pos = pos_ + i in if pos < lengthOf t || more == Complete then succ t pos more False else let lose' t' pos' more' = succ t' pos' more' False succ' t' pos' more' = succ t' pos' more' True in prompt t pos more lose' succ' {-# INLINE inputSpansChunks #-} advance :: Pos -> Parser () advance n = T.Parser $ \t pos more _lose succ -> succ t (pos+n) more () {-# INLINE advance #-} ensureSuspended :: Int -> Buffer -> Pos -> More -> Failure r -> Success (Pos, Text) r -> Result r ensureSuspended n t pos more lose succ = runParser (demandInput >> go) t pos more lose succ where go = T.Parser $ \t' pos' more' lose' succ' -> case lengthAtLeast pos' n t' of Just n' -> succ' t' pos' more' (n', substring pos n' t') Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ' -- | If at least @n@ elements of input are available, return the -- current input, otherwise fail. ensure :: Int -> Parser (Pos, Text) ensure n = T.Parser $ \t pos more lose succ -> case lengthAtLeast pos n t of Just n' -> succ t pos more (n', substring pos n' t) -- The uncommon case is kept out-of-line to reduce code size: Nothing -> ensureSuspended n t pos more lose succ {-# INLINE ensure #-} -- | Return both the result of a parse and the portion of the input -- that was consumed while it was being parsed. match :: Parser a -> Parser (Text, a) match p = T.Parser $ \t pos more lose succ -> let succ' t' pos' more' a = succ t' pos' more' (substring pos (pos'-pos) t', a) in runParser p t pos more lose succ' -- | Ensure that at least @n@ code points of input are available. -- Returns the number of words consumed while traversing. lengthAtLeast :: Pos -> Int -> Buffer -> Maybe Pos lengthAtLeast pos n t = go 0 (fromPos pos) where go i !p | i == n = Just (Pos p - pos) | p == len = Nothing | otherwise = go (i+1) (p + Buf.iter_ t p) Pos len = lengthOf t {-# INLINE lengthAtLeast #-} substring :: Pos -> Pos -> Buffer -> Text substring (Pos pos) (Pos n) = Buf.substring pos n {-# INLINE substring #-} lengthOf :: Buffer -> Pos lengthOf = Pos . Buf.length size :: Text -> Pos size (Text _ _ l) = Pos l attoparsec-0.13.2.4/Data/Attoparsec/Text/Lazy.hs0000644000000000000000000000716607346545000017464 0ustar0000000000000000{-# LANGUAGE CPP #-} #if __GLASGOW_HASKELL__ >= 702 {-# LANGUAGE Trustworthy #-} -- Imports internal modules #endif {-# OPTIONS_GHC -fno-warn-warnings-deprecations #-} -- | -- Module : Data.Attoparsec.Text.Lazy -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient combinator parsing that can consume lazy 'Text' -- strings, loosely based on the Parsec library. -- -- This is essentially the same code as in the 'Data.Attoparsec.Text' -- module, only with a 'parse' function that can consume a lazy -- 'Text' incrementally, and a 'Result' type that does not allow -- more input to be fed in. Think of this as suitable for use with a -- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'. -- -- /Note:/ The various parser functions and combinators such as -- 'string' still expect /strict/ 'T.Text' parameters, and return -- strict 'T.Text' results. Behind the scenes, strict 'T.Text' values -- are still used internally to store parser input and manipulate it -- efficiently. module Data.Attoparsec.Text.Lazy ( Result(..) , module Data.Attoparsec.Text -- * Running parsers , parse , parseTest -- ** Result conversion , maybeResult , eitherResult ) where import Control.DeepSeq (NFData(rnf)) import Data.List (intercalate) import Data.Text.Lazy.Internal (Text(..), chunk) import qualified Data.Attoparsec.Internal.Types as T import qualified Data.Attoparsec.Text as A import qualified Data.Text as T import Data.Attoparsec.Text hiding (IResult(..), Result, eitherResult, maybeResult, parse, parseWith, parseTest) -- | The result of a parse. data Result r = Fail Text [String] String -- ^ The parse failed. The 'Text' is the input -- that had not yet been consumed when the failure -- occurred. The @[@'String'@]@ is a list of contexts -- in which the error occurred. The 'String' is the -- message describing the error, if any. | Done Text r -- ^ The parse succeeded. The 'Text' is the -- input that had not yet been consumed (if any) when -- the parse succeeded. deriving (Show) instance NFData r => NFData (Result r) where rnf (Fail bs ctxs msg) = rnf bs `seq` rnf ctxs `seq` rnf msg rnf (Done bs r) = rnf bs `seq` rnf r {-# INLINE rnf #-} fmapR :: (a -> b) -> Result a -> Result b fmapR _ (Fail st stk msg) = Fail st stk msg fmapR f (Done bs r) = Done bs (f r) instance Functor Result where fmap = fmapR -- | Run a parser and return its result. parse :: A.Parser a -> Text -> Result a parse p s = case s of Chunk x xs -> go (A.parse p x) xs empty -> go (A.parse p T.empty) empty where go (T.Fail x stk msg) ys = Fail (chunk x ys) stk msg go (T.Done x r) ys = Done (chunk x ys) r go (T.Partial k) (Chunk y ys) = go (k y) ys go (T.Partial k) empty = go (k T.empty) empty -- | Run a parser and print its result to standard output. parseTest :: (Show a) => A.Parser a -> Text -> IO () parseTest p s = print (parse p s) -- | Convert a 'Result' value to a 'Maybe' value. maybeResult :: Result r -> Maybe r maybeResult (Done _ r) = Just r maybeResult _ = Nothing -- | Convert a 'Result' value to an 'Either' value. eitherResult :: Result r -> Either String r eitherResult (Done _ r) = Right r eitherResult (Fail _ [] msg) = Left msg eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg) attoparsec-0.13.2.4/Data/Attoparsec/Types.hs0000644000000000000000000000075207346545000016717 0ustar0000000000000000-- | -- Module : Data.Attoparsec.Types -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient parser combinators for strings, loosely based on -- the Parsec library. module Data.Attoparsec.Types ( Parser , IResult(..) , Chunk(chunkElemToChar) ) where import Data.Attoparsec.Internal.Types (Parser(..), IResult(..), Chunk(..)) attoparsec-0.13.2.4/Data/Attoparsec/Zepto.hs0000644000000000000000000001207407346545000016714 0ustar0000000000000000{-# LANGUAGE CPP #-} #if __GLASGOW_HASKELL__ >= 702 {-# LANGUAGE Trustworthy #-} -- Data.ByteString.Unsafe #endif {-# LANGUAGE BangPatterns #-} -- | -- Module : Data.Attoparsec.Zepto -- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- A tiny, highly specialized combinator parser for 'B.ByteString' -- strings. -- -- While the main attoparsec module generally performs well, this -- module is particularly fast for simple non-recursive loops that -- should not normally result in failed parses. -- -- /Warning/: on more complex inputs involving recursion or failure, -- parsers based on this module may be as much as /ten times slower/ -- than regular attoparsec! You should /only/ use this module when you -- have benchmarks that prove that its use speeds your code up. module Data.Attoparsec.Zepto ( Parser , ZeptoT , parse , parseT , atEnd , string , take , takeWhile ) where import Control.Applicative import Control.Monad (MonadPlus(..), ap) import qualified Control.Monad.Fail as Fail import Control.Monad.IO.Class (MonadIO(..)) import Data.ByteString (ByteString) import Data.Functor.Identity (Identity(runIdentity)) import Data.Monoid as Mon (Monoid(..)) import Data.Semigroup (Semigroup(..)) import Data.Word (Word8) import Prelude hiding (take, takeWhile) import qualified Data.ByteString as B import qualified Data.ByteString.Unsafe as B newtype S = S { input :: ByteString } data Result a = Fail String | OK !a S -- | A simple parser. -- -- This monad is strict in its state, and the monadic bind operator -- ('>>=') evaluates each result to weak head normal form before -- passing it along. newtype ZeptoT m a = Parser { runParser :: S -> m (Result a) } type Parser a = ZeptoT Identity a instance Monad m => Functor (ZeptoT m) where fmap f m = Parser $ \s -> do result <- runParser m s case result of OK a s' -> return (OK (f a) s') Fail err -> return (Fail err) {-# INLINE fmap #-} instance MonadIO m => MonadIO (ZeptoT m) where liftIO act = Parser $ \s -> do result <- liftIO act return (OK result s) {-# INLINE liftIO #-} instance Monad m => Monad (ZeptoT m) where return = pure {-# INLINE return #-} m >>= k = Parser $ \s -> do result <- runParser m s case result of OK a s' -> runParser (k a) s' Fail err -> return (Fail err) {-# INLINE (>>=) #-} #if !(MIN_VERSION_base(4,13,0)) fail = Fail.fail {-# INLINE fail #-} #endif instance Monad m => Fail.MonadFail (ZeptoT m) where fail msg = Parser $ \_ -> return (Fail msg) {-# INLINE fail #-} instance Monad m => MonadPlus (ZeptoT m) where mzero = fail "mzero" {-# INLINE mzero #-} mplus a b = Parser $ \s -> do result <- runParser a s case result of ok@(OK _ _) -> return ok _ -> runParser b s {-# INLINE mplus #-} instance (Monad m) => Applicative (ZeptoT m) where pure a = Parser $ \s -> return (OK a s) {-# INLINE pure #-} (<*>) = ap {-# INLINE (<*>) #-} gets :: Monad m => (S -> a) -> ZeptoT m a gets f = Parser $ \s -> return (OK (f s) s) {-# INLINE gets #-} put :: Monad m => S -> ZeptoT m () put s = Parser $ \_ -> return (OK () s) {-# INLINE put #-} -- | Run a parser. parse :: Parser a -> ByteString -> Either String a parse p bs = case runIdentity (runParser p (S bs)) of (OK a _) -> Right a (Fail err) -> Left err {-# INLINE parse #-} -- | Run a parser on top of the given base monad. parseT :: Monad m => ZeptoT m a -> ByteString -> m (Either String a) parseT p bs = do result <- runParser p (S bs) case result of OK a _ -> return (Right a) Fail err -> return (Left err) {-# INLINE parseT #-} instance Monad m => Semigroup (ZeptoT m a) where (<>) = mplus {-# INLINE (<>) #-} instance Monad m => Mon.Monoid (ZeptoT m a) where mempty = fail "mempty" {-# INLINE mempty #-} mappend = (<>) {-# INLINE mappend #-} instance Monad m => Alternative (ZeptoT m) where empty = fail "empty" {-# INLINE empty #-} (<|>) = mplus {-# INLINE (<|>) #-} -- | Consume input while the predicate returns 'True'. takeWhile :: Monad m => (Word8 -> Bool) -> ZeptoT m ByteString takeWhile p = do (h,t) <- gets (B.span p . input) put (S t) return h {-# INLINE takeWhile #-} -- | Consume @n@ bytes of input. take :: Monad m => Int -> ZeptoT m ByteString take !n = do s <- gets input if B.length s >= n then put (S (B.unsafeDrop n s)) >> return (B.unsafeTake n s) else fail "insufficient input" {-# INLINE take #-} -- | Match a string exactly. string :: Monad m => ByteString -> ZeptoT m () string s = do i <- gets input if s `B.isPrefixOf` i then put (S (B.unsafeDrop (B.length s) i)) >> return () else fail "string" {-# INLINE string #-} -- | Indicate whether the end of the input has been reached. atEnd :: Monad m => ZeptoT m Bool atEnd = do i <- gets input return $! B.null i {-# INLINE atEnd #-} attoparsec-0.13.2.4/LICENSE0000644000000000000000000000266307346545000013311 0ustar0000000000000000Copyright (c) Lennart Kolmodin All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: 1. Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. 2. Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. 3. Neither the name of the author nor the names of his contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE CONTRIBUTORS ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHORS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. attoparsec-0.13.2.4/README.markdown0000755000000000000000000000113007346545000014774 0ustar0000000000000000# Welcome to attoparsec attoparsec is a fast Haskell parser combinator library, aimed particularly at dealing efficiently with network protocols and complicated text/binary file formats. # Join in! I'm happy to receive bug reports, fixes, documentation enhancements, and other improvements. Please report bugs via the [github issue tracker](https://github.com/bos/attoparsec/issues). Master [git repository](https://github.com/bos/attoparsec): * `git clone git://github.com/bos/attoparsec.git` Authors ------- This library is written and maintained by Bryan O'Sullivan, . attoparsec-0.13.2.4/Setup.lhs0000644000000000000000000000011407346545000014101 0ustar0000000000000000#!/usr/bin/env runhaskell > import Distribution.Simple > main = defaultMain attoparsec-0.13.2.4/attoparsec.cabal0000644000000000000000000001314707346545000015434 0ustar0000000000000000name: attoparsec version: 0.13.2.4 license: BSD3 license-file: LICENSE category: Text, Parsing author: Bryan O'Sullivan maintainer: Bryan O'Sullivan , Ben Gamari stability: experimental tested-with: GHC == 7.0.4, GHC == 7.2.2, GHC == 7.4.2, GHC ==7.6.3, GHC ==7.8.4, GHC ==7.10.3, GHC ==8.0.2, GHC ==8.2.2, GHC==8.4.4, GHC==8.6.5, GHC==8.8.1, GHC==8.10.1 synopsis: Fast combinator parsing for bytestrings and text cabal-version: >= 1.8 homepage: https://github.com/bos/attoparsec bug-reports: https://github.com/bos/attoparsec/issues build-type: Simple description: A fast parser combinator library, aimed particularly at dealing efficiently with network protocols and complicated text/binary file formats. extra-source-files: README.markdown benchmarks/*.cabal benchmarks/*.hs benchmarks/*.txt benchmarks/json-data/*.json benchmarks/Makefile benchmarks/med.txt.bz2 changelog.md examples/*.c examples/*.hs examples/Makefile tests/*.hs tests/QC/*.hs tests/QC/IPv6/*.hs Flag developer Description: Whether to build the library in development mode Default: False Manual: True library build-depends: array, base >= 4.3 && < 5, bytestring, containers, deepseq, scientific >= 0.3.1 && < 0.4, transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6, text >= 1.1.1.3 if impl(ghc < 7.4) build-depends: bytestring < 0.10.4.0 if !impl(ghc >= 8.0) -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+ build-depends: fail == 4.9.*, semigroups >=0.16.1 && <0.20 exposed-modules: Data.Attoparsec Data.Attoparsec.ByteString Data.Attoparsec.ByteString.Char8 Data.Attoparsec.ByteString.Lazy Data.Attoparsec.Char8 Data.Attoparsec.Combinator Data.Attoparsec.Internal Data.Attoparsec.Internal.Types Data.Attoparsec.Lazy Data.Attoparsec.Number Data.Attoparsec.Text Data.Attoparsec.Text.Lazy Data.Attoparsec.Types Data.Attoparsec.Zepto other-modules: Data.Attoparsec.ByteString.Buffer Data.Attoparsec.ByteString.FastSet Data.Attoparsec.ByteString.Internal Data.Attoparsec.Internal.Fhthagn Data.Attoparsec.Text.Buffer Data.Attoparsec.Text.FastSet Data.Attoparsec.Text.Internal ghc-options: -O2 -Wall if flag(developer) ghc-prof-options: -auto-all ghc-options: -Werror test-suite tests type: exitcode-stdio-1.0 hs-source-dirs: tests . main-is: QC.hs other-modules: QC.Buffer QC.ByteString QC.Combinator QC.Common QC.IPv6.Internal QC.IPv6.Types QC.Rechunked QC.Simple QC.Text QC.Text.FastSet QC.Text.Regressions other-modules: Data.Attoparsec.ByteString Data.Attoparsec.ByteString.Buffer Data.Attoparsec.ByteString.Char8 Data.Attoparsec.ByteString.FastSet Data.Attoparsec.ByteString.Internal Data.Attoparsec.ByteString.Lazy Data.Attoparsec.Combinator Data.Attoparsec.Internal Data.Attoparsec.Internal.Fhthagn Data.Attoparsec.Internal.Types Data.Attoparsec.Number Data.Attoparsec.Text Data.Attoparsec.Text.Buffer Data.Attoparsec.Text.FastSet Data.Attoparsec.Text.Internal Data.Attoparsec.Text.Lazy Data.Attoparsec.Zepto ghc-options: -Wall -threaded -rtsopts if flag(developer) ghc-options: -Werror build-depends: array, base, bytestring, deepseq >= 1.1, QuickCheck >= 2.13.2 && < 2.14, quickcheck-unicode, scientific, tasty >= 0.11, tasty-quickcheck >= 0.8, text, transformers, vector if !impl(ghc >= 8.0) -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+ build-depends: fail == 4.9.*, semigroups >=0.16.1 && <0.19 benchmark benchmarks type: exitcode-stdio-1.0 hs-source-dirs: benchmarks benchmarks/warp-3.0.1.1 . ghc-options: -O2 -Wall -rtsopts main-is: Benchmarks.hs other-modules: Common HeadersByteString HeadersByteString.Atto HeadersText Links Network.Wai.Handler.Warp.ReadInt Network.Wai.Handler.Warp.RequestHeader Numbers Sets TextFastSet Warp ghc-options: -O2 -Wall if flag(developer) ghc-options: -Werror build-depends: array, base == 4.*, bytestring >= 0.10.4.0, case-insensitive, containers, criterion >= 1.0, deepseq >= 1.1, directory, filepath, ghc-prim, http-types, parsec >= 3.1.2, scientific, text >= 1.1.1.0, transformers, unordered-containers, vector if !impl(ghc >= 8.0) -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+ build-depends: fail == 4.9.*, semigroups >=0.16.1 && <0.19 source-repository head type: git location: https://github.com/bos/attoparsec attoparsec-0.13.2.4/benchmarks/0000755000000000000000000000000007346545000014412 5ustar0000000000000000attoparsec-0.13.2.4/benchmarks/Aeson.hs0000755000000000000000000002662707346545000016033 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-} {-# OPTIONS_GHC -fno-warn-unused-binds #-} module Aeson ( aeson , value' ) where import Data.ByteString.Builder (Builder, byteString, toLazyByteString, charUtf8, word8) #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((*>), (<$>), (<*), pure) import Data.Monoid (mappend, mempty) #endif import Common (pathTo) import Control.Applicative (liftA2) import Control.DeepSeq (NFData(..)) import Control.Monad (forM) import Data.Attoparsec.ByteString.Char8 (Parser, char, endOfInput, scientific, skipSpace, string) import Data.Bits ((.|.), shiftL) import Data.ByteString (ByteString) import Data.Char (chr) import Data.List (sort) import Data.Scientific (Scientific) import Data.Text (Text) import Data.Text.Encoding (decodeUtf8') import Data.Vector as Vector (Vector, foldl', fromList) import Data.Word (Word8) import System.Directory (getDirectoryContents) import System.FilePath ((), dropExtension) import qualified Data.Attoparsec.ByteString as A import qualified Data.Attoparsec.Lazy as L import qualified Data.Attoparsec.Zepto as Z import qualified Data.ByteString as B import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Unsafe as B import qualified Data.HashMap.Strict as H import Criterion.Main #define BACKSLASH 92 #define CLOSE_CURLY 125 #define CLOSE_SQUARE 93 #define COMMA 44 #define DOUBLE_QUOTE 34 #define OPEN_CURLY 123 #define OPEN_SQUARE 91 #define C_0 48 #define C_9 57 #define C_A 65 #define C_F 70 #define C_a 97 #define C_f 102 #define C_n 110 #define C_t 116 data Result a = Error String | Success a deriving (Eq, Show) -- | A JSON \"object\" (key\/value map). type Object = H.HashMap Text Value -- | A JSON \"array\" (sequence). type Array = Vector Value -- | A JSON value represented as a Haskell value. data Value = Object !Object | Array !Array | String !Text | Number !Scientific | Bool !Bool | Null deriving (Eq, Show) instance NFData Value where rnf (Object o) = rnf o rnf (Array a) = Vector.foldl' (\x y -> rnf y `seq` x) () a rnf (String s) = rnf s rnf (Number n) = rnf n rnf (Bool b) = rnf b rnf Null = () -- | Parse a top-level JSON value. This must be either an object or -- an array, per RFC 4627. -- -- The conversion of a parsed value to a Haskell value is deferred -- until the Haskell value is needed. This may improve performance if -- only a subset of the results of conversions are needed, but at a -- cost in thunk allocation. json :: Parser Value json = json_ object_ array_ -- | Parse a top-level JSON value. This must be either an object or -- an array, per RFC 4627. -- -- This is a strict version of 'json' which avoids building up thunks -- during parsing; it performs all conversions immediately. Prefer -- this version if most of the JSON data needs to be accessed. json' :: Parser Value json' = json_ object_' array_' json_ :: Parser Value -> Parser Value -> Parser Value json_ obj ary = do w <- skipSpace *> A.satisfy (\w -> w == OPEN_CURLY || w == OPEN_SQUARE) if w == OPEN_CURLY then obj else ary {-# INLINE json_ #-} object_ :: Parser Value object_ = {-# SCC "object_" #-} Object <$> objectValues jstring value object_' :: Parser Value object_' = {-# SCC "object_'" #-} do !vals <- objectValues jstring' value' return (Object vals) where jstring' = do !s <- jstring return s objectValues :: Parser Text -> Parser Value -> Parser (H.HashMap Text Value) objectValues str val = do skipSpace let pair = liftA2 (,) (str <* skipSpace) (char ':' *> skipSpace *> val) H.fromList <$> commaSeparated pair CLOSE_CURLY {-# INLINE objectValues #-} array_ :: Parser Value array_ = {-# SCC "array_" #-} Array <$> arrayValues value array_' :: Parser Value array_' = {-# SCC "array_'" #-} do !vals <- arrayValues value' return (Array vals) commaSeparated :: Parser a -> Word8 -> Parser [a] commaSeparated item endByte = do w <- A.peekWord8' if w == endByte then A.anyWord8 >> return [] else loop where loop = do v <- item <* skipSpace ch <- A.satisfy $ \w -> w == COMMA || w == endByte if ch == COMMA then skipSpace >> (v:) <$> loop else return [v] {-# INLINE commaSeparated #-} arrayValues :: Parser Value -> Parser (Vector Value) arrayValues val = do skipSpace Vector.fromList <$> commaSeparated val CLOSE_SQUARE {-# INLINE arrayValues #-} -- | Parse any JSON value. You should usually 'json' in preference to -- this function, as this function relaxes the object-or-array -- requirement of RFC 4627. -- -- In particular, be careful in using this function if you think your -- code might interoperate with Javascript. A naïve Javascript -- library that parses JSON data using @eval@ is vulnerable to attack -- unless the encoded data represents an object or an array. JSON -- implementations in other languages conform to that same restriction -- to preserve interoperability and security. value :: Parser Value value = do w <- A.peekWord8' case w of DOUBLE_QUOTE -> A.anyWord8 *> (String <$> jstring_) OPEN_CURLY -> A.anyWord8 *> object_ OPEN_SQUARE -> A.anyWord8 *> array_ C_f -> string "false" *> pure (Bool False) C_t -> string "true" *> pure (Bool True) C_n -> string "null" *> pure Null _ | w >= 48 && w <= 57 || w == 45 -> Number <$> scientific | otherwise -> fail "not a valid json value" -- | Strict version of 'value'. See also 'json''. value' :: Parser Value value' = do w <- A.peekWord8' case w of DOUBLE_QUOTE -> do !s <- A.anyWord8 *> jstring_ return (String s) OPEN_CURLY -> A.anyWord8 *> object_' OPEN_SQUARE -> A.anyWord8 *> array_' C_f -> string "false" *> pure (Bool False) C_t -> string "true" *> pure (Bool True) C_n -> string "null" *> pure Null _ | w >= 48 && w <= 57 || w == 45 -> do !n <- scientific return (Number n) | otherwise -> fail "not a valid json value" -- | Parse a quoted JSON string. jstring :: Parser Text jstring = A.word8 DOUBLE_QUOTE *> jstring_ -- | Parse a string without a leading quote. jstring_ :: Parser Text jstring_ = {-# SCC "jstring_" #-} do s <- A.scan False $ \s c -> if s then Just False else if c == DOUBLE_QUOTE then Nothing else Just (c == BACKSLASH) _ <- A.word8 DOUBLE_QUOTE s1 <- if BACKSLASH `B.elem` s then case Z.parse unescape s of Right r -> return r Left err -> fail err else return s case decodeUtf8' s1 of Right r -> return r Left err -> fail $ show err {-# INLINE jstring_ #-} unescape :: Z.Parser ByteString unescape = toByteString <$> go mempty where go acc = do h <- Z.takeWhile (/=BACKSLASH) let rest = do start <- Z.take 2 let !slash = B.unsafeHead start !t = B.unsafeIndex start 1 escape = case B.findIndex (==t) "\"\\/ntbrfu" of Just i -> i _ -> 255 if slash /= BACKSLASH || escape == 255 then fail "invalid JSON escape sequence" else do let cont m = go (acc `mappend` byteString h `mappend` m) {-# INLINE cont #-} if t /= 117 -- 'u' then cont (word8 (B.unsafeIndex mapping escape)) else do a <- hexQuad if a < 0xd800 || a > 0xdfff then cont (charUtf8 (chr a)) else do b <- Z.string "\\u" *> hexQuad if a <= 0xdbff && b >= 0xdc00 && b <= 0xdfff then let !c = ((a - 0xd800) `shiftL` 10) + (b - 0xdc00) + 0x10000 in cont (charUtf8 (chr c)) else fail "invalid UTF-16 surrogates" done <- Z.atEnd if done then return (acc `mappend` byteString h) else rest mapping = "\"\\/\n\t\b\r\f" hexQuad :: Z.Parser Int hexQuad = do s <- Z.take 4 let hex n | w >= C_0 && w <= C_9 = w - C_0 | w >= C_a && w <= C_f = w - 87 | w >= C_A && w <= C_F = w - 55 | otherwise = 255 where w = fromIntegral $ B.unsafeIndex s n a = hex 0; b = hex 1; c = hex 2; d = hex 3 if (a .|. b .|. c .|. d) /= 255 then return $! d .|. (c `shiftL` 4) .|. (b `shiftL` 8) .|. (a `shiftL` 12) else fail "invalid hex escape" decodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString -> Maybe a decodeWith p to s = case L.parse p s of L.Done _ v -> case to v of Success a -> Just a _ -> Nothing _ -> Nothing {-# INLINE decodeWith #-} decodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString -> Maybe a decodeStrictWith p to s = case either Error to (A.parseOnly p s) of Success a -> Just a Error _ -> Nothing {-# INLINE decodeStrictWith #-} eitherDecodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString -> Either String a eitherDecodeWith p to s = case L.parse p s of L.Done _ v -> case to v of Success a -> Right a Error msg -> Left msg L.Fail _ _ msg -> Left msg {-# INLINE eitherDecodeWith #-} eitherDecodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString -> Either String a eitherDecodeStrictWith p to s = case either Error to (A.parseOnly p s) of Success a -> Right a Error msg -> Left msg {-# INLINE eitherDecodeStrictWith #-} -- $lazy -- -- The 'json' and 'value' parsers decouple identification from -- conversion. Identification occurs immediately (so that an invalid -- JSON document can be rejected as early as possible), but conversion -- to a Haskell value is deferred until that value is needed. -- -- This decoupling can be time-efficient if only a smallish subset of -- elements in a JSON value need to be inspected, since the cost of -- conversion is zero for uninspected elements. The trade off is an -- increase in memory usage, due to allocation of thunks for values -- that have not yet been converted. -- $strict -- -- The 'json'' and 'value'' parsers combine identification with -- conversion. They consume more CPU cycles up front, but have a -- smaller memory footprint. -- | Parse a top-level JSON value followed by optional whitespace and -- end-of-input. See also: 'json'. jsonEOF :: Parser Value jsonEOF = json <* skipSpace <* endOfInput -- | Parse a top-level JSON value followed by optional whitespace and -- end-of-input. See also: 'json''. jsonEOF' :: Parser Value jsonEOF' = json' <* skipSpace <* endOfInput toByteString :: Builder -> ByteString toByteString = L.toStrict . toLazyByteString {-# INLINE toByteString #-} aeson :: IO Benchmark aeson = do path <- pathTo "json-data" names <- sort . filter (`notElem` [".", ".."]) <$> getDirectoryContents path benches <- forM names $ \name -> do bs <- B.readFile (path name) return . bench (dropExtension name) $ nf (A.parseOnly jsonEOF') bs return $ bgroup "aeson" benches attoparsec-0.13.2.4/benchmarks/Alternative.hs0000755000000000000000000000127207346545000017231 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} -- This benchmark reveals a huge performance regression that showed up -- under GHC 7.8.1 (https://github.com/bos/attoparsec/issues/56). -- -- With GHC 7.6.3 and older, this program runs in 0.04 seconds. Under -- GHC 7.8.1 with (<|>) inlined, time jumps to 12 seconds! import Control.Applicative import Data.Text (Text) import qualified Data.Attoparsec.Text as A import qualified Data.Text as T testParser :: Text -> Either String Int testParser f = fmap length -- avoid printing out the entire matched list . A.parseOnly (many ((() <$ A.string "b") <|> (() <$ A.anyChar))) $ f main :: IO () main = print . testParser $ T.replicate 50000 "a" attoparsec-0.13.2.4/benchmarks/Benchmarks.hs0000644000000000000000000001071007346545000017022 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP #-} import Common () import Control.Applicative (many) import Criterion.Main (bench, bgroup, defaultMain, nf) import Data.Bits import Data.Char (isAlpha) import Data.Word (Word32) import Data.Word (Word8) import Numbers (numbers) import Common (chunksOf) import Text.Parsec.Text () import Text.Parsec.Text.Lazy () import qualified Warp import qualified Aeson import qualified Genome import qualified Data.Attoparsec.ByteString as AB import qualified Data.Attoparsec.ByteString.Char8 as AC import qualified Data.Attoparsec.ByteString.Lazy as ABL import qualified Data.Attoparsec.Text as AT import qualified Data.Attoparsec.Text.Lazy as ATL import qualified Data.ByteString as B import qualified Data.ByteString.Char8 as BC import qualified Data.ByteString.Lazy as BL import qualified Data.Text as T import qualified Data.Text.Lazy as TL import qualified HeadersByteString import qualified HeadersText import qualified Links import qualified Text.Parsec as P import qualified Sets main :: IO () main = do let s = take 1024 . cycle $ ['a'..'z'] ++ ['A'..'Z'] !b = BC.pack s !bl = BL.fromChunks . map BC.pack . chunksOf 4 $ s !t = T.pack s !tl = TL.fromChunks . map T.pack . chunksOf 4 $ s aeson <- Aeson.aeson headersBS <- HeadersByteString.headers headersT <- HeadersText.headers defaultMain [ bgroup "many" [ bgroup "attoparsec" [ bench "B" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b , bench "BL" $ nf (ABL.parse (many (AC.satisfy AC.isAlpha_ascii))) bl , bench "T" $ nf (AT.parse (many (AT.satisfy AC.isAlpha_ascii))) t , bench "TL" $ nf (ATL.parse (many (AT.satisfy AC.isAlpha_ascii))) tl ] , bgroup "parsec" [ bench "S" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") s , bench "B" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") b , bench "BL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") bl , bench "T" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") t , bench "TL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") tl ] ] , bgroup "comparison" [ bgroup "many-vs-takeWhile" [ bench "many" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b , bench "takeWhile" $ nf (AB.parse (AC.takeWhile AC.isAlpha_ascii)) b ] , bgroup "letter-vs-isAlpha" [ bench "letter" $ nf (AB.parse (many AC.letter_ascii)) b , bench "isAlpha" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b ] ] , bgroup "takeWhile" [ bench "isAlpha" $ nf (ABL.parse (AC.takeWhile isAlpha)) bl , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_ascii)) bl , bench "isAlpha_iso8859_15" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_iso8859_15)) bl , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile isAlpha)) t , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile isAlpha)) tl ] , bgroup "takeWhile1" [ bench "isAlpha" $ nf (ABL.parse (AC.takeWhile1 isAlpha)) bl , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile1 AC.isAlpha_ascii)) bl , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile1 isAlpha)) t , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile1 isAlpha)) tl ] , bench "word32LE" $ nf (AB.parse word32LE) b , bgroup "scan" [ bench "short" $ nf (AB.parse quotedString) (BC.pack "abcdefghijk\"") , bench "long" $ nf (AB.parse quotedString) b ] , aeson , Genome.genome , headersBS , headersT , Links.links , numbers , Sets.benchmarks , Warp.benchmarks ] -- Benchmarks bind and (potential) bounds-check merging. word32LE :: AB.Parser Word32 word32LE = do w1 <- AB.anyWord8 w2 <- AB.anyWord8 w3 <- AB.anyWord8 w4 <- AB.anyWord8 return $! (fromIntegral w1 :: Word32) + fromIntegral w2 `unsafeShiftL` 8 + fromIntegral w3 `unsafeShiftL` 16 + fromIntegral w4 `unsafeShiftL` 32 doubleQuote, backslash :: Word8 doubleQuote = 34 backslash = 92 {-# INLINE backslash #-} {-# INLINE doubleQuote #-} -- | Parse a string without a leading quote. quotedString :: AB.Parser B.ByteString quotedString = AB.scan False $ \s c -> if s then Just False else if c == doubleQuote then Nothing else Just (c == backslash) #if !MIN_VERSION_base(4,5,0) unsafeShiftL :: Bits a => a -> Int -> a unsafeShiftL = shiftL #endif attoparsec-0.13.2.4/benchmarks/Benchmarks.hs0000755000000000000000000001071007346545000017025 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP #-} import Common () import Control.Applicative (many) import Criterion.Main (bench, bgroup, defaultMain, nf) import Data.Bits import Data.Char (isAlpha) import Data.Word (Word32) import Data.Word (Word8) import Numbers (numbers) import Common (chunksOf) import Text.Parsec.Text () import Text.Parsec.Text.Lazy () import qualified Warp import qualified Aeson import qualified Genome import qualified Data.Attoparsec.ByteString as AB import qualified Data.Attoparsec.ByteString.Char8 as AC import qualified Data.Attoparsec.ByteString.Lazy as ABL import qualified Data.Attoparsec.Text as AT import qualified Data.Attoparsec.Text.Lazy as ATL import qualified Data.ByteString as B import qualified Data.ByteString.Char8 as BC import qualified Data.ByteString.Lazy as BL import qualified Data.Text as T import qualified Data.Text.Lazy as TL import qualified HeadersByteString import qualified HeadersText import qualified Links import qualified Text.Parsec as P import qualified Sets main :: IO () main = do let s = take 1024 . cycle $ ['a'..'z'] ++ ['A'..'Z'] !b = BC.pack s !bl = BL.fromChunks . map BC.pack . chunksOf 4 $ s !t = T.pack s !tl = TL.fromChunks . map T.pack . chunksOf 4 $ s aeson <- Aeson.aeson headersBS <- HeadersByteString.headers headersT <- HeadersText.headers defaultMain [ bgroup "many" [ bgroup "attoparsec" [ bench "B" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b , bench "BL" $ nf (ABL.parse (many (AC.satisfy AC.isAlpha_ascii))) bl , bench "T" $ nf (AT.parse (many (AT.satisfy AC.isAlpha_ascii))) t , bench "TL" $ nf (ATL.parse (many (AT.satisfy AC.isAlpha_ascii))) tl ] , bgroup "parsec" [ bench "S" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") s , bench "B" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") b , bench "BL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") bl , bench "T" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") t , bench "TL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") tl ] ] , bgroup "comparison" [ bgroup "many-vs-takeWhile" [ bench "many" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b , bench "takeWhile" $ nf (AB.parse (AC.takeWhile AC.isAlpha_ascii)) b ] , bgroup "letter-vs-isAlpha" [ bench "letter" $ nf (AB.parse (many AC.letter_ascii)) b , bench "isAlpha" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b ] ] , bgroup "takeWhile" [ bench "isAlpha" $ nf (ABL.parse (AC.takeWhile isAlpha)) bl , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_ascii)) bl , bench "isAlpha_iso8859_15" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_iso8859_15)) bl , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile isAlpha)) t , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile isAlpha)) tl ] , bgroup "takeWhile1" [ bench "isAlpha" $ nf (ABL.parse (AC.takeWhile1 isAlpha)) bl , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile1 AC.isAlpha_ascii)) bl , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile1 isAlpha)) t , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile1 isAlpha)) tl ] , bench "word32LE" $ nf (AB.parse word32LE) b , bgroup "scan" [ bench "short" $ nf (AB.parse quotedString) (BC.pack "abcdefghijk\"") , bench "long" $ nf (AB.parse quotedString) b ] , aeson , Genome.genome , headersBS , headersT , Links.links , numbers , Sets.benchmarks , Warp.benchmarks ] -- Benchmarks bind and (potential) bounds-check merging. word32LE :: AB.Parser Word32 word32LE = do w1 <- AB.anyWord8 w2 <- AB.anyWord8 w3 <- AB.anyWord8 w4 <- AB.anyWord8 return $! (fromIntegral w1 :: Word32) + fromIntegral w2 `unsafeShiftL` 8 + fromIntegral w3 `unsafeShiftL` 16 + fromIntegral w4 `unsafeShiftL` 32 doubleQuote, backslash :: Word8 doubleQuote = 34 backslash = 92 {-# INLINE backslash #-} {-# INLINE doubleQuote #-} -- | Parse a string without a leading quote. quotedString :: AB.Parser B.ByteString quotedString = AB.scan False $ \s c -> if s then Just False else if c == doubleQuote then Nothing else Just (c == backslash) #if !MIN_VERSION_base(4,5,0) unsafeShiftL :: Bits a => a -> Int -> a unsafeShiftL = shiftL #endif attoparsec-0.13.2.4/benchmarks/Common.hs0000644000000000000000000000225507346545000016202 0ustar0000000000000000{-# LANGUAGE CPP #-} {-# OPTIONS_GHC -fno-warn-orphans #-} module Common ( chunksOf , pathTo , rechunkBS , rechunkT ) where import Control.DeepSeq (NFData(rnf)) import System.Directory (doesDirectoryExist) import System.FilePath (()) import Text.Parsec (ParseError) import qualified Data.ByteString as B import qualified Data.ByteString.Lazy as BL import qualified Data.Text as T import qualified Data.Text.Lazy as TL #if !MIN_VERSION_bytestring(0,10,0) import Data.ByteString.Internal (ByteString(..)) instance NFData ByteString where rnf (PS _ _ _) = () #endif instance NFData ParseError where rnf = rnf . show chunksOf :: Int -> [a] -> [[a]] chunksOf k = go where go xs = case splitAt k xs of ([],_) -> [] (y, ys) -> y : go ys rechunkBS :: Int -> B.ByteString -> BL.ByteString rechunkBS n = BL.fromChunks . map B.pack . chunksOf n . B.unpack rechunkT :: Int -> T.Text -> TL.Text rechunkT n = TL.fromChunks . map T.pack . chunksOf n . T.unpack pathTo :: String -> IO FilePath pathTo wat = do exists <- doesDirectoryExist "benchmarks" return $ if exists then "benchmarks" wat else wat attoparsec-0.13.2.4/benchmarks/Common.hs0000755000000000000000000000225507346545000016205 0ustar0000000000000000{-# LANGUAGE CPP #-} {-# OPTIONS_GHC -fno-warn-orphans #-} module Common ( chunksOf , pathTo , rechunkBS , rechunkT ) where import Control.DeepSeq (NFData(rnf)) import System.Directory (doesDirectoryExist) import System.FilePath (()) import Text.Parsec (ParseError) import qualified Data.ByteString as B import qualified Data.ByteString.Lazy as BL import qualified Data.Text as T import qualified Data.Text.Lazy as TL #if !MIN_VERSION_bytestring(0,10,0) import Data.ByteString.Internal (ByteString(..)) instance NFData ByteString where rnf (PS _ _ _) = () #endif instance NFData ParseError where rnf = rnf . show chunksOf :: Int -> [a] -> [[a]] chunksOf k = go where go xs = case splitAt k xs of ([],_) -> [] (y, ys) -> y : go ys rechunkBS :: Int -> B.ByteString -> BL.ByteString rechunkBS n = BL.fromChunks . map B.pack . chunksOf n . B.unpack rechunkT :: Int -> T.Text -> TL.Text rechunkT n = TL.fromChunks . map T.pack . chunksOf n . T.unpack pathTo :: String -> IO FilePath pathTo wat = do exists <- doesDirectoryExist "benchmarks" return $ if exists then "benchmarks" wat else wat attoparsec-0.13.2.4/benchmarks/Genome.hs0000755000000000000000000000547707346545000016200 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} module Genome ( genome ) where import Control.Applicative import Criterion.Main import Data.ByteString (ByteString) import qualified Data.ByteString.Char8 as B8 import qualified Data.ByteString.Lazy.Char8 as L8 import Data.Attoparsec.ByteString.Char8 as B import qualified Data.Attoparsec.ByteString.Lazy as BL import Data.Text (Text) import qualified Data.Text as T import qualified Data.Text.Lazy as TL import Data.Attoparsec.Text as T import qualified Data.Attoparsec.Text.Lazy as TL import Common (rechunkBS, rechunkT) genome :: Benchmark genome = bgroup "genome" [ bgroup "bytestring" [ bench "s" $ nf (map (B.parse searchBS)) (B8.tails geneB) , bench "l" $ nf (map (BL.parse searchBS)) (L8.tails geneBL) , bgroup "CI" [ bench "s" $ nf (map (B.parse searchBSCI)) (B8.tails geneB) , bench "l" $ nf (map (BL.parse searchBSCI)) (L8.tails geneBL) ] ] , bgroup "text" [ bench "s" $ nf (map (T.parse searchT)) (T.tails geneT) , bench "l" $ nf (map (TL.parse searchT)) (TL.tails geneTL) , bgroup "CI" [ bench "s" $ nf (map (T.parse searchTCI)) (T.tails geneT) , bench "l" $ nf (map (TL.parse searchTCI)) (TL.tails geneTL) ] ] ] where geneB = B8.pack gene geneBL = rechunkBS 4 geneB geneT = T.pack gene geneTL = rechunkT 4 geneT searchBS :: B.Parser ByteString searchBS = "caac" *> ("aaca" <|> "aact") searchBSCI :: B.Parser ByteString searchBSCI = B.stringCI "CAAC" *> (B.stringCI "AACA" <|> B.stringCI "AACT") searchT :: T.Parser Text searchT = "caac" *> ("aaca" <|> "aact") searchTCI :: T.Parser Text searchTCI = T.asciiCI "CAAC" *> (T.asciiCI "AACA" <|> T.asciiCI "AACT") -- Dictyostelium discoideum developmental protein DG1094 (gacT) gene, -- partial cds. http://www.ncbi.nlm.nih.gov/nuccore/AF081586.1 gene :: String gene = "atcgatttagaaagatacaaagatagaaccatcaataataaacaagagaagagagcaagt\ \agagatattaataaagagattgaaagagagattgaaaagaagagattatcaccaagagaa\ \agattaaatttatttggtctttcttcctcatcttcatcagtgaattcaacattaacaaga\ \tctacagcaaatattatctctacaatagacggtagtggaggtagtaatcgtaatagtaaa\ \aattatggtaatggctcatcctcctcctcaaatagaagatatagtaatactattaatcaa\ \caattacaaatgcaattacaacaacttcaaatccaacaacaacaatatcaacaaactcaa\ \caatctcaaataccattacaatatcaacaacaacaacagcaacaacaacaacaaaccact\ \acaactacaactacatcaagtggtagtaatagattctcttcaaatagatataaaccagtt\ \gatcttacacaatcatcttcaaactttcgttattcacgtgaaatttatgatgatgattat\ \tattcaaataataatttaatgatgtttggtaatgagcaaccaaatcaaacaccaatttct\ \gtatcatcttcatctgcattcacacgtcaaagatctcaaagttgctttgaaccagagaat\ \cttgtattgctacaacaacaatatcaacaatatcaacaacaacaacaacaacaacaacaa\ \attccattccaagcaaatccacaatatagtaatgctgttattgaacaaaaattggatcaa\ \attagagataccattaataatttacatagagataaccgagtctctaga" attoparsec-0.13.2.4/benchmarks/HeadersByteString.hs0000644000000000000000000000270207346545000020335 0ustar0000000000000000module HeadersByteString (headers) where import Common (pathTo, rechunkBS) import Criterion.Main (bench, bgroup, nf, nfIO) import Criterion.Types (Benchmark) import HeadersByteString.Atto (request, response) import Network.Wai.Handler.Warp.RequestHeader (parseHeaderLines) import qualified Data.Attoparsec.ByteString.Char8 as B import qualified Data.Attoparsec.ByteString.Lazy as BL import qualified Data.ByteString.Char8 as B -- Note: In the benchmarks for parsing an http request -- from a strict bytestring, we consider warp's implementation, -- which has highly optimized code for handling the first -- line in particular. It's treatment of the headers -- is more relaxed from the treatment they are given by the -- attoparsec parser benchmarked here. Consequently, it -- is should not be possible to match its performance since -- it accepts header names with disallowed characters. headers :: IO Benchmark headers = do req <- B.readFile =<< pathTo "http-request.txt" resp <- B.readFile =<< pathTo "http-response.txt" let reql = rechunkBS 4 req respl = rechunkBS 4 resp return $ bgroup "headers" [ bgroup "B" [ bench "request" $ nf (B.parseOnly request) req , bench "warp" $ nfIO (parseHeaderLines (B.split '\n' req)) , bench "response" $ nf (B.parseOnly response) resp ] , bgroup "BL" [ bench "request" $ nf (BL.parse request) reql , bench "response" $ nf (BL.parse response) respl ] ] attoparsec-0.13.2.4/benchmarks/HeadersByteString.hs0000755000000000000000000000270207346545000020340 0ustar0000000000000000module HeadersByteString (headers) where import Common (pathTo, rechunkBS) import Criterion.Main (bench, bgroup, nf, nfIO) import Criterion.Types (Benchmark) import HeadersByteString.Atto (request, response) import Network.Wai.Handler.Warp.RequestHeader (parseHeaderLines) import qualified Data.Attoparsec.ByteString.Char8 as B import qualified Data.Attoparsec.ByteString.Lazy as BL import qualified Data.ByteString.Char8 as B -- Note: In the benchmarks for parsing an http request -- from a strict bytestring, we consider warp's implementation, -- which has highly optimized code for handling the first -- line in particular. It's treatment of the headers -- is more relaxed from the treatment they are given by the -- attoparsec parser benchmarked here. Consequently, it -- is should not be possible to match its performance since -- it accepts header names with disallowed characters. headers :: IO Benchmark headers = do req <- B.readFile =<< pathTo "http-request.txt" resp <- B.readFile =<< pathTo "http-response.txt" let reql = rechunkBS 4 req respl = rechunkBS 4 resp return $ bgroup "headers" [ bgroup "B" [ bench "request" $ nf (B.parseOnly request) req , bench "warp" $ nfIO (parseHeaderLines (B.split '\n' req)) , bench "response" $ nf (B.parseOnly response) resp ] , bgroup "BL" [ bench "request" $ nf (BL.parse request) reql , bench "response" $ nf (BL.parse response) respl ] ] attoparsec-0.13.2.4/benchmarks/HeadersByteString/0000755000000000000000000000000007346545000020000 5ustar0000000000000000attoparsec-0.13.2.4/benchmarks/HeadersByteString/Atto.hs0000644000000000000000000000261707346545000021251 0ustar0000000000000000{-# LANGUAGE BangPatterns, OverloadedStrings #-} {-# OPTIONS_GHC -fno-warn-missing-signatures -fno-warn-orphans #-} module HeadersByteString.Atto ( request , response ) where import Control.Applicative import Control.DeepSeq (NFData(..)) import Network.HTTP.Types.Version (HttpVersion, http11) import qualified Data.Attoparsec.ByteString.Char8 as B import qualified Data.ByteString.Char8 as B instance NFData HttpVersion where rnf !_ = () isHeaderChar :: Char -> Bool isHeaderChar c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') || (c >= '0' && c <= '9') || (c == '_') || (c == '-') header = do name <- B.takeWhile1 isHeaderChar <* B.char ':' <* B.skipSpace body <- bodyLine return (name, body) bodyLine = B.takeTill (\c -> c == '\r' || c == '\n') <* B.endOfLine requestLine = do m <- (B.takeTill B.isSpace <* B.char ' ') (p,q) <- B.break (=='?') <$> (B.takeTill B.isSpace <* B.char ' ') v <- httpVersion return (m,p,q,v) httpVersion = http11 <$ "HTTP/1.1" responseLine = (,,) <$> (httpVersion <* B.skipSpace) <*> (int <* B.skipSpace) <*> bodyLine int :: B.Parser Int int = B.decimal request = (,) <$> (requestLine <* B.endOfLine) <*> manyheader response = (,) <$> responseLine <*> many header manyheader = do c <- B.peekChar' if c == '\r' || c == '\n' then return [] else (:) <$> header <*> manyheader attoparsec-0.13.2.4/benchmarks/HeadersText.hs0000644000000000000000000000322507346545000017170 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} {-# OPTIONS_GHC -fno-warn-missing-signatures #-} module HeadersText (headers) where import Common (pathTo, rechunkT) import Control.Applicative import Criterion.Main (bench, bgroup, nf) import Criterion.Types (Benchmark) import Data.Char (isSpace) import qualified Data.Attoparsec.Text as T import qualified Data.Attoparsec.Text.Lazy as TL import qualified Data.Text.IO as T header = do name <- T.takeWhile1 (T.inClass "a-zA-Z0-9_-") <* T.char ':' <* T.skipSpace body <- (:) <$> bodyLine <*> many (T.takeWhile1 isSpace *> bodyLine) return (name, body) bodyLine = T.takeTill (\c -> c == '\r' || c == '\n') <* T.endOfLine requestLine = (,,) <$> (method <* T.skipSpace) <*> (T.takeTill isSpace <* T.skipSpace) <*> httpVersion where method = "GET" <|> "POST" httpVersion = "HTTP/" *> ((,) <$> (int <* T.char '.') <*> int) responseLine = (,,) <$> (httpVersion <* T.skipSpace) <*> (int <* T.skipSpace) <*> bodyLine int :: T.Parser Int int = T.decimal request = (,) <$> (requestLine <* T.endOfLine) <*> many header response = (,) <$> responseLine <*> many header headers :: IO Benchmark headers = do req <- T.readFile =<< pathTo "http-request.txt" resp <- T.readFile =<< pathTo "http-response.txt" let reql = rechunkT 4 req respl = rechunkT 4 resp return $ bgroup "headers" [ bgroup "T" [ bench "request" $ nf (T.parseOnly request) req , bench "response" $ nf (T.parseOnly response) resp ] , bgroup "TL" [ bench "request" $ nf (TL.parse request) reql , bench "response" $ nf (TL.parse response) respl ] ] attoparsec-0.13.2.4/benchmarks/HeadersText.hs0000755000000000000000000000322507346545000017173 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} {-# OPTIONS_GHC -fno-warn-missing-signatures #-} module HeadersText (headers) where import Common (pathTo, rechunkT) import Control.Applicative import Criterion.Main (bench, bgroup, nf) import Criterion.Types (Benchmark) import Data.Char (isSpace) import qualified Data.Attoparsec.Text as T import qualified Data.Attoparsec.Text.Lazy as TL import qualified Data.Text.IO as T header = do name <- T.takeWhile1 (T.inClass "a-zA-Z0-9_-") <* T.char ':' <* T.skipSpace body <- (:) <$> bodyLine <*> many (T.takeWhile1 isSpace *> bodyLine) return (name, body) bodyLine = T.takeTill (\c -> c == '\r' || c == '\n') <* T.endOfLine requestLine = (,,) <$> (method <* T.skipSpace) <*> (T.takeTill isSpace <* T.skipSpace) <*> httpVersion where method = "GET" <|> "POST" httpVersion = "HTTP/" *> ((,) <$> (int <* T.char '.') <*> int) responseLine = (,,) <$> (httpVersion <* T.skipSpace) <*> (int <* T.skipSpace) <*> bodyLine int :: T.Parser Int int = T.decimal request = (,) <$> (requestLine <* T.endOfLine) <*> many header response = (,) <$> responseLine <*> many header headers :: IO Benchmark headers = do req <- T.readFile =<< pathTo "http-request.txt" resp <- T.readFile =<< pathTo "http-response.txt" let reql = rechunkT 4 req respl = rechunkT 4 resp return $ bgroup "headers" [ bgroup "T" [ bench "request" $ nf (T.parseOnly request) req , bench "response" $ nf (T.parseOnly response) resp ] , bgroup "TL" [ bench "request" $ nf (TL.parse request) reql , bench "response" $ nf (TL.parse response) respl ] ] attoparsec-0.13.2.4/benchmarks/IsSpace.hs0000755000000000000000000001100107346545000016271 0ustar0000000000000000{-# OPTIONS_GHC -Wall -fwarn-tabs #-} {-# LANGUAGE ForeignFunctionInterface #-} ---------------------------------------------------------------- -- 2010.10.09 -- | -- Module : IsSpace -- Copyright : Copyright (c) 2010 wren ng thornton -- License : BSD -- Maintainer : wren@community.haskell.org -- Stability : experimental -- Portability : portable (FFI) -- -- A benchmark for comparing different definitions of predicates -- for detecting whitespace. As of the last run the results are: -- -- * Data.Char.isSpace : 14.44786 us +/- 258.0377 ns -- * isSpace_DataChar : 43.25154 us +/- 655.7037 ns -- * isSpace_Char : 29.26598 us +/- 454.1445 ns -- * isPerlSpace : -- * Data.Attoparsec.Char8.isSpace : 81.87335 us +/- 1.195903 us -- * isSpace_Char8 : 11.84677 us +/- 178.9795 ns -- * isSpace_w8 : 11.55470 us +/- 133.7644 ns ---------------------------------------------------------------- module IsSpace (main) where import qualified Data.Char as C import Data.Word (Word8) import qualified Data.ByteString as B import qualified Data.ByteString.Char8 as B8 import Foreign.C.Types (CInt) import Criterion (bench, nf) import Criterion.Main (defaultMain) ---------------------------------------------------------------- ----- Character predicates -- N.B. \x9..\xD == "\t\n\v\f\r" -- | Recognize the same characters as Perl's @/\s/@ in Unicode mode. -- In particular, we recognize POSIX 1003.2 @[[:space:]]@ except -- @\'\v\'@, and recognize the Unicode @\'\x85\'@, @\'\x2028\'@, -- @\'\x2029\'@. Notably, @\'\x85\'@ belongs to Latin-1 (but not -- ASCII) and therefore does not belong to POSIX 1003.2 @[[:space:]]@ -- (nor non-Unicode @/\s/@). isPerlSpace :: Char -> Bool isPerlSpace c = (' ' == c) || ('\t' <= c && c <= '\r' && c /= '\v') || ('\x85' == c) || ('\x2028' == c) || ('\x2029' == c) {-# INLINE isPerlSpace #-} -- | 'Data.Attoparsec.Char8.isSpace', duplicated here because it's -- not exported. This is the definition as of attoparsec-0.8.1.0. isSpace :: Char -> Bool isSpace c = c `B8.elem` spaces where spaces = B8.pack " \n\r\t\v\f" {-# NOINLINE spaces #-} {-# INLINE isSpace #-} -- | An alternate version of 'Data.Attoparsec.Char8.isSpace'. isSpace_Char8 :: Char -> Bool isSpace_Char8 c = (' ' == c) || ('\t' <= c && c <= '\r') {-# INLINE isSpace_Char8 #-} -- | An alternate version of 'Data.Char.isSpace'. This uses the -- same trick as 'isSpace_Char8' but we include Unicode whitespaces -- too, in order to have the same results as 'Data.Char.isSpace' -- (whereas 'isSpace_Char8' doesn't recognize Unicode whitespace). isSpace_Char :: Char -> Bool isSpace_Char c = (' ' == c) || ('\t' <= c && c <= '\r') || ('\xA0' == c) || (iswspace (fromIntegral (C.ord c)) /= 0) {-# INLINE isSpace_Char #-} foreign import ccall unsafe "u_iswspace" iswspace :: CInt -> CInt -- | Verbatim version of 'Data.Char.isSpace' (i.e., 'GHC.Unicode.isSpace' -- as of base-4.2.0.2) in order to try to figure out why 'isSpace_Char' -- is slower than 'Data.Char.isSpace'. It appears to be something -- special in how the base library was compiled. isSpace_DataChar :: Char -> Bool isSpace_DataChar c = c == ' ' || c == '\t' || c == '\n' || c == '\r' || c == '\f' || c == '\v' || c == '\xa0' || iswspace (fromIntegral (C.ord c)) /= 0 {-# INLINE isSpace_DataChar #-} -- | A 'Word8' version of 'Data.Attoparsec.Char8.isSpace'. isSpace_w8 :: Word8 -> Bool isSpace_w8 w = (w == 32) || (9 <= w && w <= 13) {-# INLINE isSpace_w8 #-} ---------------------------------------------------------------- main :: IO () main = defaultMain [ bench "Data.Char.isSpace" $ nf (map C.isSpace) ['\x0'..'\255'] , bench "isSpace_DataChar" $ nf (map isSpace_DataChar) ['\x0'..'\255'] , bench "isSpace_Char" $ nf (map isSpace_Char) ['\x0'..'\255'] , bench "isPerlSpace" $ nf (map isPerlSpace) ['\x0'..'\255'] , bench "Data.Attoparsec.Char8.isSpace" $ nf (map isSpace) ['\x0'..'\255'] , bench "isSpace_Char8" $ nf (map isSpace_Char8) ['\x0'..'\255'] , bench "isSpace_w8" $ nf (map isSpace_w8) [0..255] ] ---------------------------------------------------------------- ----------------------------------------------------------- fin. attoparsec-0.13.2.4/benchmarks/Links.hs0000644000000000000000000000401407346545000016025 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} module Links (links) where import Control.Applicative import Control.DeepSeq (NFData(..)) import Criterion.Main (Benchmark, bench, nf) import Data.Attoparsec.ByteString as A import Data.Attoparsec.ByteString.Char8 as A8 import Data.ByteString.Char8 as B8 data Link = Link { linkURL :: ByteString , linkParams :: [(ByteString, ByteString)] } deriving (Eq, Show) instance NFData Link where rnf l = rnf (linkURL l) `seq` rnf (linkParams l) link :: Parser Link link = Link <$> url <*> many (char8 ';' *> skipSpace *> param) where url = char8 '<' *> A8.takeTill (=='>') <* char8 '>' <* skipSpace param :: Parser (ByteString, ByteString) param = do name <- paramName skipSpace *> "=" *> skipSpace c <- peekChar' let isTokenChar = A.inClass "!#$%&'()*+./0-9:<=>?@a-zA-Z[]^_`{|}~-" val <- case c of '"' -> quotedString _ -> A.takeWhile isTokenChar skipSpace return (name, val) data Quot = Literal | Backslash quotedString :: Parser ByteString quotedString = char '"' *> (fixup <$> body) <* char '"' where body = A8.scan Literal $ \s c -> case (s,c) of (Literal, '\\') -> backslash (Literal, '"') -> Nothing _ -> literal literal = Just Literal backslash = Just Backslash fixup = B8.pack . go . B8.unpack where go ('\\' : x@'\\' : xs) = x : go xs go ('\\' : x@'"' : xs) = x : go xs go (x : xs) = x : go xs go xs = xs paramName :: Parser ByteString paramName = do name <- A.takeWhile1 $ A.inClass "a-zA-Z0-9!#$&+-.^_`|~" c <- peekChar return $ case c of Just '*' -> B8.snoc name '*' _ -> name links :: Benchmark links = bench "links" $ nf (A.parseOnly link) lnk where lnk = "; rel=\"next\", ; rel=\"last\"" attoparsec-0.13.2.4/benchmarks/Links.hs0000755000000000000000000000401407346545000016030 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} module Links (links) where import Control.Applicative import Control.DeepSeq (NFData(..)) import Criterion.Main (Benchmark, bench, nf) import Data.Attoparsec.ByteString as A import Data.Attoparsec.ByteString.Char8 as A8 import Data.ByteString.Char8 as B8 data Link = Link { linkURL :: ByteString , linkParams :: [(ByteString, ByteString)] } deriving (Eq, Show) instance NFData Link where rnf l = rnf (linkURL l) `seq` rnf (linkParams l) link :: Parser Link link = Link <$> url <*> many (char8 ';' *> skipSpace *> param) where url = char8 '<' *> A8.takeTill (=='>') <* char8 '>' <* skipSpace param :: Parser (ByteString, ByteString) param = do name <- paramName skipSpace *> "=" *> skipSpace c <- peekChar' let isTokenChar = A.inClass "!#$%&'()*+./0-9:<=>?@a-zA-Z[]^_`{|}~-" val <- case c of '"' -> quotedString _ -> A.takeWhile isTokenChar skipSpace return (name, val) data Quot = Literal | Backslash quotedString :: Parser ByteString quotedString = char '"' *> (fixup <$> body) <* char '"' where body = A8.scan Literal $ \s c -> case (s,c) of (Literal, '\\') -> backslash (Literal, '"') -> Nothing _ -> literal literal = Just Literal backslash = Just Backslash fixup = B8.pack . go . B8.unpack where go ('\\' : x@'\\' : xs) = x : go xs go ('\\' : x@'"' : xs) = x : go xs go (x : xs) = x : go xs go xs = xs paramName :: Parser ByteString paramName = do name <- A.takeWhile1 $ A.inClass "a-zA-Z0-9!#$&+-.^_`|~" c <- peekChar return $ case c of Just '*' -> B8.snoc name '*' _ -> name links :: Benchmark links = bench "links" $ nf (A.parseOnly link) lnk where lnk = "; rel=\"next\", ; rel=\"last\"" attoparsec-0.13.2.4/benchmarks/Main.hs0000755000000000000000000000011007346545000015625 0ustar0000000000000000import Sets import Criterion.Main main = defaultMain [Sets.benchmarks] attoparsec-0.13.2.4/benchmarks/Makefile0000755000000000000000000000016007346545000016052 0ustar0000000000000000all: med.txt tiny tiny: Tiny.hs ghc -O --make -o $@ $< %: %.bz2 bunzip2 -k $< clean: -rm -f *.o *.hi tiny attoparsec-0.13.2.4/benchmarks/Numbers.hs0000644000000000000000000000545607346545000016373 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} {-# OPTIONS_GHC -fno-warn-deprecations #-} module Numbers (numbers) where import Criterion.Main (bench, bgroup, nf) import Criterion.Types (Benchmark) import Data.Scientific (Scientific(..)) import Text.Parsec.Text () import Text.Parsec.Text.Lazy () import qualified Data.Attoparsec.ByteString.Char8 as AC import qualified Data.Attoparsec.Text as AT import qualified Data.ByteString.Char8 as BC import qualified Data.Text as T strN, strNePos, strNeNeg :: String strN = "1234.56789" strNePos = "1234.56789e3" strNeNeg = "1234.56789e-3" numbers :: Benchmark numbers = bgroup "numbers" [ let !tN = T.pack strN !tNePos = T.pack strNePos !tNeNeg = T.pack strNeNeg in bgroup "Text" [ bgroup "no power" [ bench "double" $ nf (AT.parseOnly AT.double) tN , bench "number" $ nf (AT.parseOnly AT.number) tN , bench "rational" $ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tN , bench "scientific" $ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tN ] , bgroup "positive power" [ bench "double" $ nf (AT.parseOnly AT.double) tNePos , bench "number" $ nf (AT.parseOnly AT.number) tNePos , bench "rational" $ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNePos , bench "scientific" $ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNePos ] , bgroup "negative power" [ bench "double" $ nf (AT.parseOnly AT.double) tNeNeg , bench "number" $ nf (AT.parseOnly AT.number) tNeNeg , bench "rational" $ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNeNeg , bench "scientific" $ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNeNeg ] ] , let !bN = BC.pack strN !bNePos = BC.pack strNePos !bNeNeg = BC.pack strNeNeg in bgroup "ByteString" [ bgroup "no power" [ bench "double" $ nf (AC.parseOnly AC.double) bN , bench "number" $ nf (AC.parseOnly AC.number) bN , bench "rational" $ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bN , bench "scientific" $ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bN ] , bgroup "positive power" [ bench "double" $ nf (AC.parseOnly AC.double) bNePos , bench "number" $ nf (AC.parseOnly AC.number) bNePos , bench "rational" $ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNePos , bench "scientific" $ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNePos ] , bgroup "negative power" [ bench "double" $ nf (AC.parseOnly AC.double) bNeNeg , bench "number" $ nf (AC.parseOnly AC.number) bNeNeg , bench "rational" $ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNeNeg , bench "scientific" $ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNeNeg ] ] ] attoparsec-0.13.2.4/benchmarks/Numbers.hs0000755000000000000000000000545607346545000016376 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} {-# OPTIONS_GHC -fno-warn-deprecations #-} module Numbers (numbers) where import Criterion.Main (bench, bgroup, nf) import Criterion.Types (Benchmark) import Data.Scientific (Scientific(..)) import Text.Parsec.Text () import Text.Parsec.Text.Lazy () import qualified Data.Attoparsec.ByteString.Char8 as AC import qualified Data.Attoparsec.Text as AT import qualified Data.ByteString.Char8 as BC import qualified Data.Text as T strN, strNePos, strNeNeg :: String strN = "1234.56789" strNePos = "1234.56789e3" strNeNeg = "1234.56789e-3" numbers :: Benchmark numbers = bgroup "numbers" [ let !tN = T.pack strN !tNePos = T.pack strNePos !tNeNeg = T.pack strNeNeg in bgroup "Text" [ bgroup "no power" [ bench "double" $ nf (AT.parseOnly AT.double) tN , bench "number" $ nf (AT.parseOnly AT.number) tN , bench "rational" $ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tN , bench "scientific" $ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tN ] , bgroup "positive power" [ bench "double" $ nf (AT.parseOnly AT.double) tNePos , bench "number" $ nf (AT.parseOnly AT.number) tNePos , bench "rational" $ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNePos , bench "scientific" $ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNePos ] , bgroup "negative power" [ bench "double" $ nf (AT.parseOnly AT.double) tNeNeg , bench "number" $ nf (AT.parseOnly AT.number) tNeNeg , bench "rational" $ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNeNeg , bench "scientific" $ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNeNeg ] ] , let !bN = BC.pack strN !bNePos = BC.pack strNePos !bNeNeg = BC.pack strNeNeg in bgroup "ByteString" [ bgroup "no power" [ bench "double" $ nf (AC.parseOnly AC.double) bN , bench "number" $ nf (AC.parseOnly AC.number) bN , bench "rational" $ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bN , bench "scientific" $ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bN ] , bgroup "positive power" [ bench "double" $ nf (AC.parseOnly AC.double) bNePos , bench "number" $ nf (AC.parseOnly AC.number) bNePos , bench "rational" $ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNePos , bench "scientific" $ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNePos ] , bgroup "negative power" [ bench "double" $ nf (AC.parseOnly AC.double) bNeNeg , bench "number" $ nf (AC.parseOnly AC.number) bNeNeg , bench "rational" $ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNeNeg , bench "scientific" $ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNeNeg ] ] ] attoparsec-0.13.2.4/benchmarks/Sets.hs0000644000000000000000000000132407346545000015664 0ustar0000000000000000module Sets (benchmarks) where import Criterion import Data.Char (ord) import qualified Data.Attoparsec.Text.FastSet as FastSet import qualified TextFastSet import qualified Data.HashSet as HashSet import qualified Data.IntSet as IntSet smallSet :: String smallSet = ['a'..'z'] ++ ['A'..'Z'] ++ ['0'..'9'] benchmarks :: Benchmark benchmarks = bgroup "sets" [ bench "Fast" $ whnf (FastSet.member '*') (FastSet.fromList smallSet) , bench "Hash" $ whnf (HashSet.member '*') (HashSet.fromList smallSet) , bench "Int" $ whnf (IntSet.member (ord '*')) (IntSet.fromList (map ord smallSet)) , bench "TextFast" $ whnf (TextFastSet.member '*') (TextFastSet.fromList smallSet) ] attoparsec-0.13.2.4/benchmarks/Sets.hs0000755000000000000000000000132407346545000015667 0ustar0000000000000000module Sets (benchmarks) where import Criterion import Data.Char (ord) import qualified Data.Attoparsec.Text.FastSet as FastSet import qualified TextFastSet import qualified Data.HashSet as HashSet import qualified Data.IntSet as IntSet smallSet :: String smallSet = ['a'..'z'] ++ ['A'..'Z'] ++ ['0'..'9'] benchmarks :: Benchmark benchmarks = bgroup "sets" [ bench "Fast" $ whnf (FastSet.member '*') (FastSet.fromList smallSet) , bench "Hash" $ whnf (HashSet.member '*') (HashSet.fromList smallSet) , bench "Int" $ whnf (IntSet.member (ord '*')) (IntSet.fromList (map ord smallSet)) , bench "TextFast" $ whnf (TextFastSet.member '*') (TextFastSet.fromList smallSet) ] attoparsec-0.13.2.4/benchmarks/TextFastSet.hs0000644000000000000000000000736207346545000017174 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} ------------------------------------------------------------------------------ -- | -- Module : Data.Attoparsec.FastSet -- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : felipe.lessa@gmail.com -- Stability : experimental -- Portability : unknown -- -- Fast set membership tests for 'Char' values. We test for -- membership using a hashtable implemented with Robin Hood -- collision resolution. The set representation is unboxed, -- and the characters and hashes interleaved, for efficiency. -- -- ----------------------------------------------------------------------------- module TextFastSet ( -- * Data type FastSet -- * Construction , fromList , set -- * Lookup , member -- * Handy interface , charClass ) where import Data.Bits ((.|.), (.&.), shiftR) import Data.Function (on) import Data.List (sort, sortBy) import qualified Data.Array.Base as AB import qualified Data.Array.Unboxed as A import qualified Data.Text as T data FastSet = FastSet { table :: {-# UNPACK #-} !(A.UArray Int Int) , mask :: {-# UNPACK #-} !Int } data Entry = Entry { key :: {-# UNPACK #-} !Char , initialIndex :: {-# UNPACK #-} !Int , index :: {-# UNPACK #-} !Int } offset :: Entry -> Int offset e = index e - initialIndex e resolveCollisions :: [Entry] -> [Entry] resolveCollisions [] = [] resolveCollisions [e] = [e] resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries) where (a', b') | index a < index b = (a, b) | offset a < offset b = (b { index=index a }, a { index=index a + 1 }) | otherwise = (a, b { index=index a + 1 }) pad :: Int -> [Entry] -> [Entry] pad = go 0 where -- ensure that we pad enough so that lookups beyond the -- last hash in the table fall within the array go !_ !m [] = replicate (max 1 m + 1) empty go k m (e:entries) = map (const empty) [k..i - 1] ++ e : go (i + 1) (m + i - k - 1) entries where i = index e empty = Entry '\0' maxBound 0 nextPowerOf2 :: Int -> Int nextPowerOf2 0 = 1 nextPowerOf2 x = go (x - 1) 1 where go y 32 = y + 1 go y k = go (y .|. (y `shiftR` k)) $ k * 2 fastHash :: Char -> Int fastHash = fromEnum fromList :: String -> FastSet fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved) mask' where s' = ordNub (sort s) l = length s' mask' = nextPowerOf2 ((5 * l) `div` 4) - 1 entries = pad mask' . resolveCollisions . sortBy (compare `on` initialIndex) . zipWith (\c i -> Entry c i i) s' . map ((.&. mask') . fastHash) $ s' interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e]) entries ordNub :: Eq a => [a] -> [a] ordNub [] = [] ordNub (y:ys) = go y ys where go x (z:zs) | x == z = go x zs | otherwise = x : go z zs go x [] = [x] set :: T.Text -> FastSet set = fromList . T.unpack -- | Check the set for membership. member :: Char -> FastSet -> Bool member c a = go (2 * i) where i = fastHash c .&. mask a lookupAt j b = (i' <= i) && (c == c' || b) where c' = toEnum $ AB.unsafeAt (table a) j i' = AB.unsafeAt (table a) $ j + 1 go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) . lookupAt (j + 6) . go $ j + 8 charClass :: String -> FastSet charClass = fromList . go where go (a:'-':b:xs) = [a..b] ++ go xs go (x:xs) = x : go xs go _ = "" attoparsec-0.13.2.4/benchmarks/TextFastSet.hs0000755000000000000000000000736207346545000017177 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} ------------------------------------------------------------------------------ -- | -- Module : Data.Attoparsec.FastSet -- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : felipe.lessa@gmail.com -- Stability : experimental -- Portability : unknown -- -- Fast set membership tests for 'Char' values. We test for -- membership using a hashtable implemented with Robin Hood -- collision resolution. The set representation is unboxed, -- and the characters and hashes interleaved, for efficiency. -- -- ----------------------------------------------------------------------------- module TextFastSet ( -- * Data type FastSet -- * Construction , fromList , set -- * Lookup , member -- * Handy interface , charClass ) where import Data.Bits ((.|.), (.&.), shiftR) import Data.Function (on) import Data.List (sort, sortBy) import qualified Data.Array.Base as AB import qualified Data.Array.Unboxed as A import qualified Data.Text as T data FastSet = FastSet { table :: {-# UNPACK #-} !(A.UArray Int Int) , mask :: {-# UNPACK #-} !Int } data Entry = Entry { key :: {-# UNPACK #-} !Char , initialIndex :: {-# UNPACK #-} !Int , index :: {-# UNPACK #-} !Int } offset :: Entry -> Int offset e = index e - initialIndex e resolveCollisions :: [Entry] -> [Entry] resolveCollisions [] = [] resolveCollisions [e] = [e] resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries) where (a', b') | index a < index b = (a, b) | offset a < offset b = (b { index=index a }, a { index=index a + 1 }) | otherwise = (a, b { index=index a + 1 }) pad :: Int -> [Entry] -> [Entry] pad = go 0 where -- ensure that we pad enough so that lookups beyond the -- last hash in the table fall within the array go !_ !m [] = replicate (max 1 m + 1) empty go k m (e:entries) = map (const empty) [k..i - 1] ++ e : go (i + 1) (m + i - k - 1) entries where i = index e empty = Entry '\0' maxBound 0 nextPowerOf2 :: Int -> Int nextPowerOf2 0 = 1 nextPowerOf2 x = go (x - 1) 1 where go y 32 = y + 1 go y k = go (y .|. (y `shiftR` k)) $ k * 2 fastHash :: Char -> Int fastHash = fromEnum fromList :: String -> FastSet fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved) mask' where s' = ordNub (sort s) l = length s' mask' = nextPowerOf2 ((5 * l) `div` 4) - 1 entries = pad mask' . resolveCollisions . sortBy (compare `on` initialIndex) . zipWith (\c i -> Entry c i i) s' . map ((.&. mask') . fastHash) $ s' interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e]) entries ordNub :: Eq a => [a] -> [a] ordNub [] = [] ordNub (y:ys) = go y ys where go x (z:zs) | x == z = go x zs | otherwise = x : go z zs go x [] = [x] set :: T.Text -> FastSet set = fromList . T.unpack -- | Check the set for membership. member :: Char -> FastSet -> Bool member c a = go (2 * i) where i = fastHash c .&. mask a lookupAt j b = (i' <= i) && (c == c' || b) where c' = toEnum $ AB.unsafeAt (table a) j i' = AB.unsafeAt (table a) $ j + 1 go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) . lookupAt (j + 6) . go $ j + 8 charClass :: String -> FastSet charClass = fromList . go where go (a:'-':b:xs) = [a..b] ++ go xs go (x:xs) = x : go xs go _ = "" attoparsec-0.13.2.4/benchmarks/Tiny.hs0000755000000000000000000000171607346545000015701 0ustar0000000000000000import Control.Applicative ((<|>), many) import Control.Monad (forM_) import System.Environment (getArgs) import qualified Data.Attoparsec.ByteString.Char8 as A import qualified Data.ByteString.Char8 as B import qualified Text.Parsec as P import qualified Text.Parsec.ByteString as P attoparsec = do args <- getArgs forM_ args $ \arg -> do input <- B.readFile arg case A.parse p input `A.feed` B.empty of A.Done _ xs -> print (length xs) what -> print what where slow = many (A.many1 A.letter_ascii <|> A.many1 A.digit) fast = many (A.takeWhile1 isLetter <|> A.takeWhile1 isDigit) isDigit c = c >= '0' && c <= '9' isLetter c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') p = fast parsec = do args <- getArgs forM_ args $ \arg -> do input <- readFile arg case P.parse (P.many (P.many1 P.letter P.<|> P.many1 P.digit)) "" input of Left err -> print err Right xs -> print (length xs) main = attoparsec attoparsec-0.13.2.4/benchmarks/Warp.hs0000644000000000000000000000077207346545000015665 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} module Warp (benchmarks) where import Criterion.Main (bench, bgroup, nf) import Criterion.Types (Benchmark) import Data.ByteString (ByteString) import Network.Wai.Handler.Warp.ReadInt (readInt) import qualified Data.Attoparsec.ByteString.Char8 as B benchmarks :: Benchmark benchmarks = bgroup "warp" [ bgroup "decimal" [ bench "warp" $ nf (readInt :: ByteString -> Int) "31337" , bench "atto" $ nf (B.parse (B.decimal :: B.Parser Int)) "31337" ] ] attoparsec-0.13.2.4/benchmarks/Warp.hs0000755000000000000000000000077207346545000015670 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} module Warp (benchmarks) where import Criterion.Main (bench, bgroup, nf) import Criterion.Types (Benchmark) import Data.ByteString (ByteString) import Network.Wai.Handler.Warp.ReadInt (readInt) import qualified Data.Attoparsec.ByteString.Char8 as B benchmarks :: Benchmark benchmarks = bgroup "warp" [ bgroup "decimal" [ bench "warp" $ nf (readInt :: ByteString -> Int) "31337" , bench "atto" $ nf (B.parse (B.decimal :: B.Parser Int)) "31337" ] ] attoparsec-0.13.2.4/benchmarks/attoparsec-benchmarks.cabal0000755000000000000000000000145007346545000021661 0ustar0000000000000000-- These benchmarks are not intended to be installed. -- So don't install 'em. name: attoparsec-benchmarks version: 0 cabal-version: >=1.6 build-type: Simple executable attoparsec-benchmarks main-is: Benchmarks.hs other-modules: Common HeadersByteString HeadersByteString.Atto HeadersText Links Numbers Network.Wai.Handler.Warp.ReadInt Sets TextFastSet Warp hs-source-dirs: .. . warp-3.0.1.1 ghc-options: -O2 -Wall -rtsopts build-depends: array, base == 4.*, bytestring >= 0.10.4.0, case-insensitive, containers, criterion >= 1.0, deepseq >= 1.1, directory, filepath, ghc-prim, http-types, parsec >= 3.1.2, scientific >= 0.3.1, text >= 1.1.1.0, transformers, unordered-containers, vector attoparsec-0.13.2.4/benchmarks/http-request.txt0000755000000000000000000000104707346545000017625 0ustar0000000000000000GET / HTTP/1.1 Host: twitter.com Accept: text/html, application/xhtml+xml, application/xml; q=0.9, image/webp, */*; q=0.8 Accept-Encoding: gzip,deflate,sdch Accept-Language: en-GB,en-US;q=0.8,en;q=0.6 Cache-Control: max-age=0 Cookie: guest_id=v1%3A139; _twitter_sess=BAh7CSIKZmxhc2hJQz-e1e1; __utma=43838368.452555194.1399611824.1; __utmb=43838368; __utmc=43838368; __utmz=1399611824.1.1.utmcsr=(direct)|utmcmd=(none) User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10_8_5) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/35.0.1916.86 Safari/537.36 attoparsec-0.13.2.4/benchmarks/http-response.txt0000755000000000000000000000126207346545000017772 0ustar0000000000000000HTTP/1.1 200 OK Date: Fri, 09 May 2014 04:24:57 GMT Expires: -1 Cache-Control: private, max-age=0 Content-Type: text/html; charset=ISO-8859-1 Set-Cookie: PREF=ID=1a871afc4240db5e:FF:LM=1399609497:S=e5MZ0itEekjVwNcU; expires=Sun, 08-May-2016 04:24:57 GMT; path=/; domain=.google.com Set-Cookie: NID=67=-WlfaDG6VSEPk7abAjrK98HBSoCD2ID6JKkUR95tEumzDmg7Fc8pSQ8; expires=Sat, 08-Nov-2014 04:24:57 GMT; path=/; domain=.google.com; HttpOnly P3P: CP="This is not a P3P policy! See http://www.google.com/support/accounts/bin/answer.py?hl=en&answer=151657 for more info." Server: gws X-XSS-Protection: 1; mode=block X-Frame-Options: SAMEORIGIN Alternate-Protocol: 80:quic Transfer-Encoding: chunked attoparsec-0.13.2.4/benchmarks/json-data/0000755000000000000000000000000007346545000016272 5ustar0000000000000000attoparsec-0.13.2.4/benchmarks/json-data/example.json0000755000000000000000000000661407346545000020632 0ustar0000000000000000{"web-app": { "servlet": [ { "servlet-name": "cofaxCDS", "servlet-class": "org.cofax.cds.CDSServlet", "init-param": { "configGlossary:installationAt": "Philadelphia, PA", "configGlossary:adminEmail": "ksm@pobox.com", "configGlossary:poweredBy": "Cofax", "configGlossary:poweredByIcon": "/images/cofax.gif", "configGlossary:staticPath": "/content/static", "templateProcessorClass": "org.cofax.WysiwygTemplate", "templateLoaderClass": "org.cofax.FilesTemplateLoader", "templatePath": "templates", "templateOverridePath": "", "defaultListTemplate": "listTemplate.htm", "defaultFileTemplate": "articleTemplate.htm", "useJSP": false, "jspListTemplate": "listTemplate.jsp", "jspFileTemplate": "articleTemplate.jsp", "cachePackageTagsTrack": 200, "cachePackageTagsStore": 200, "cachePackageTagsRefresh": 60, "cacheTemplatesTrack": 100, "cacheTemplatesStore": 50, "cacheTemplatesRefresh": 15, "cachePagesTrack": 200, "cachePagesStore": 100, "cachePagesRefresh": 10, "cachePagesDirtyRead": 10, "searchEngineListTemplate": "forSearchEnginesList.htm", "searchEngineFileTemplate": "forSearchEngines.htm", "searchEngineRobotsDb": "WEB-INF/robots.db", "useDataStore": true, "dataStoreClass": "org.cofax.SqlDataStore", "redirectionClass": "org.cofax.SqlRedirection", "dataStoreName": "cofax", "dataStoreDriver": "com.microsoft.jdbc.sqlserver.SQLServerDriver", "dataStoreUrl": "jdbc:microsoft:sqlserver://LOCALHOST:1433;DatabaseName=goon", "dataStoreUser": "sa", "dataStorePassword": "dataStoreTestQuery", "dataStoreTestQuery": "SET NOCOUNT ON;select test='test';", "dataStoreLogFile": "/usr/local/tomcat/logs/datastore.log", "dataStoreInitConns": 10, "dataStoreMaxConns": 100, "dataStoreConnUsageLimit": 100, "dataStoreLogLevel": "debug", "maxUrlLength": 500}}, { "servlet-name": "cofaxEmail", "servlet-class": "org.cofax.cds.EmailServlet", "init-param": { "mailHost": "mail1", "mailHostOverride": "mail2"}}, { "servlet-name": "cofaxAdmin", "servlet-class": "org.cofax.cds.AdminServlet"}, { "servlet-name": "fileServlet", "servlet-class": "org.cofax.cds.FileServlet"}, { "servlet-name": "cofaxTools", "servlet-class": "org.cofax.cms.CofaxToolsServlet", "init-param": { "templatePath": "toolstemplates/", "log": 1, "logLocation": "/usr/local/tomcat/logs/CofaxTools.log", "logMaxSize": "", "dataLog": 1, "dataLogLocation": "/usr/local/tomcat/logs/dataLog.log", "dataLogMaxSize": "", "removePageCache": "/content/admin/remove?cache=pages&id=", "removeTemplateCache": "/content/admin/remove?cache=templates&id=", "fileTransferFolder": "/usr/local/tomcat/webapps/content/fileTransferFolder", "lookInContext": 1, "adminGroupID": 4, "betaServer": true}}], "servlet-mapping": { "cofaxCDS": "/", "cofaxEmail": "/cofaxutil/aemail/*", "cofaxAdmin": "/admin/*", "fileServlet": "/static/*", "cofaxTools": "/tools/*"}, "taglib": { "taglib-uri": "cofax.tld", "taglib-location": "/WEB-INF/tlds/cofax.tld"}}} attoparsec-0.13.2.4/benchmarks/json-data/geometry.json0000755000000000000000000020254307346545000021031 0ustar0000000000000000{"geometry": {"type": "Polygon", "coordinates": [[[-0.939359853061118, 51.57401065198471], [-0.939440892477492, 51.57431080772057], [-0.939543636564569, 51.57460846194951], [-0.939564627628489, 51.574822653966265], [-0.939763179055758, 51.575406210178826], [-0.939787182642249, 51.575552991614], [-0.939819571231525, 51.57564949527348], [-0.939851290904264, 51.57571272360808], [-0.939975682132949, 51.57588648747347], [-0.940036822193859, 51.57598774653439], [-0.940072640734852, 51.57606090267849], [-0.940109693338918, 51.576205104339515], [-0.940125502187331, 51.57645611534466], [-0.940118623499009, 51.57662779459441], [-0.94008851367835, 51.57680555827417], [-0.939998015208524, 51.57709787034017], [-0.939928028667517, 51.577252794653916], [-0.939830628174189, 51.57740747134858], [-0.939796941313687, 51.57749078985784], [-0.939785586773343, 51.57754463746666], [-0.939770656147318, 51.57769016804059], [-0.939658154074368, 51.57824573765943], [-0.939485738834128, 51.57883313597966], [-0.93945717030888, 51.579192545519916], [-0.939524336079755, 51.57928306919007], [-0.939540939284811, 51.57931379092206], [-0.939553921057406, 51.579748206813974], [-0.939549110634237, 51.57983088690364], [-0.939520940649101, 51.58004913048237], [-0.93951863934971, 51.58014801827346], [-0.939525037302583, 51.580245186310094], [-0.939540364690294, 51.58033074581249], [-0.939561798495469, 51.58040197377017], [-0.939594984852117, 51.58046431619436], [-0.939708262827559, 51.580619996404984], [-0.939729069878358, 51.58065615108302], [-0.939759224390201, 51.58072476025555], [-0.939813615319267, 51.58093026195459], [-0.939900523550716, 51.58172321441459], [-0.939894144544868, 51.581997403240464], [-0.939910832471369, 51.58208657162566], [-0.940114353648015, 51.582457967531546], [-0.94022333049887, 51.58267475179605], [-0.940267247821581, 51.58277225843995], [-0.94038427828014, 51.583077233742756], [-0.940493362377966, 51.583289522851196], [-0.940571515796737, 51.58340442254201], [-0.940725857371931, 51.58359464061899], [-0.941198340240742, 51.584069167875626], [-0.941335307610427, 51.584261925920295], [-0.941372786463165, 51.5843261048293], [-0.941416540699353, 51.58443080287741], [-0.941461326187118, 51.584739621364996], [-0.941517445876004, 51.5849954910945], [-0.941575869597484, 51.58533860085252], [-0.941574762730556, 51.58538624677686], [-0.941565185406358, 51.58542572382202], [-0.941550002863301, 51.58545795698674], [-0.941515976834126, 51.58549361692739], [-0.941470510606583, 51.585524677868065], [-0.941423872780384, 51.585544039043356], [-0.94131509921043, 51.585566436558274], [-0.941075026707647, 51.58558675057684], [-0.940953181611661, 51.58561262652464], [-0.940734943851404, 51.58568708689612], [-0.940229533088359, 51.585883040066975], [-0.940067635923264, 51.58595531027499], [-0.939917220191166, 51.58603038143916], [-0.939797255285709, 51.586099433232604], [-0.939675637701456, 51.586177461657186], [-0.939611074554604, 51.58622273608784], [-0.939340396866166, 51.586441486256], [-0.93912244296424, 51.58662744303347], [-0.938817233975319, 51.58671729893312], [-0.938661522913105, 51.586771639765516], [-0.938087678078033, 51.586992141762096], [-0.937332636663603, 51.5873072119485], [-0.93492634290483, 51.58836081134952], [-0.934774110277819, 51.58845114531925], [-0.934663126573178, 51.588505886685766], [-0.934565467487243, 51.588546362183585], [-0.934462140700832, 51.588582290320545], [-0.934337145222589, 51.58861892084846], [-0.934213782000904, 51.588647473549656], [-0.934055887760941, 51.588671216763295], [-0.933259701136762, 51.58864510257983], [-0.933213278816969, 51.588716614209304], [-0.932681740160827, 51.588792708227174], [-0.931992471253759, 51.58900853446031], [-0.930629113767652, 51.58946908647644], [-0.928525036745892, 51.59005953842682], [-0.928533690860491, 51.59024394687689], [-0.928456010745829, 51.59047792078815], [-0.928256501298223, 51.5906748158337], [-0.927916132025856, 51.59066181734799], [-0.927671608556404, 51.590624516635486], [-0.927319567022116, 51.59061680481465], [-0.926850285435352, 51.59062240702726], [-0.926313746570405, 51.59066425819173], [-0.925516790702947, 51.59079184232522], [-0.925387133168341, 51.59078076476673], [-0.925293323156809, 51.59077990606886], [-0.925202187496562, 51.59078806346173], [-0.925112304116411, 51.59080432476366], [-0.925036768134577, 51.59082431403807], [-0.924968299737815, 51.59085066215826], [-0.924899640304234, 51.59088510100373], [-0.924851228495836, 51.590917926896914], [-0.924734051019008, 51.59105082982951], [-0.924694255912291, 51.59108553291224], [-0.924446018071168, 51.59126668934789], [-0.924204972773907, 51.59150995377465], [-0.923492520665307, 51.59215352189589], [-0.922775141969353, 51.59288246146081], [-0.922298613651092, 51.59343737077436], [-0.922101568270595, 51.59365046303728], [-0.92149319027045, 51.59422483935332], [-0.921029930136652, 51.59464499018023], [-0.919455791303858, 51.595519790418045], [-0.919908472816787, 51.59560757835559], [-0.919902358174605, 51.595621908790214], [-0.919721503870405, 51.59588190272939], [-0.919513222918683, 51.59614164398608], [-0.919057326435374, 51.59661490568889], [-0.918991959815932, 51.59669253146064], [-0.918853979663433, 51.59690975873926], [-0.91882720841051, 51.59694278142396], [-0.918711889332325, 51.597056812913756], [-0.918614808732714, 51.59713234806153], [-0.918297245740306, 51.59749448485627], [-0.918073703114389, 51.59778825130676], [-0.917853804369843, 51.59811082427763], [-0.917772408698363, 51.59831598343439], [-0.917709563771812, 51.59853030520902], [-0.917692745480418, 51.59856971355161], [-0.917634249201942, 51.59866178857289], [-0.917443039919903, 51.59887043094418], [-0.917335250471836, 51.598971042984616], [-0.916888284039272, 51.599309503426845], [-0.916921110547038, 51.59938623548714], [-0.916942485633783, 51.5995195094582], [-0.916937652924948, 51.599601289122916], [-0.916945811778801, 51.599683188627004], [-0.916964246289877, 51.599757989575366], [-0.917049297107238, 51.59994580090974], [-0.917089705367533, 51.60000731699611], [-0.917171120773417, 51.60010517795964], [-0.91752823274465, 51.60044925531009], [-0.917834023417531, 51.600765883511485], [-0.917913079603466, 51.600902386385464], [-0.918033251654948, 51.60107073894696], [-0.91851090277833, 51.601507638962644], [-0.918694916056997, 51.601663091331545], [-0.919167224655989, 51.60214309940451], [-0.919302231291783, 51.6024167896932], [-0.919552009673002, 51.60266096432073], [-0.919812571846437, 51.60293760761218], [-0.920091738726093, 51.60358667644501], [-0.920208566517809, 51.603592246724574], [-0.920644522919282, 51.60359715428394], [-0.921093152621479, 51.6036156641763], [-0.921168285587618, 51.603613657034074], [-0.921469264587163, 51.6035867495928], [-0.921584776688781, 51.603586911416876], [-0.921718864440287, 51.603595336217005], [-0.921999521996191, 51.60363387995426], [-0.922136050325758, 51.603661209181794], [-0.922248015684399, 51.60368921195661], [-0.922346882036963, 51.60372159023333], [-0.922478548042792, 51.60377135359644], [-0.922605777045377, 51.603825571929555], [-0.92269948345521, 51.60389297005248], [-0.922855181916126, 51.60396453348124], [-0.922908065211369, 51.60398749776935], [-0.923525984356841, 51.604174796116844], [-0.923689774691443, 51.6042095667925], [-0.923842334751645, 51.60423074681459], [-0.924020987014581, 51.604247669912816], [-0.924152253615336, 51.604253368572344], [-0.924379056519158, 51.60424915231234], [-0.924491916632975, 51.60423939614583], [-0.925129396784027, 51.604149022807746], [-0.925308707040747, 51.60413807581467], [-0.925396812395019, 51.604137083863186], [-0.925816640142735, 51.60415261457396], [-0.926339243350925, 51.604157394450915], [-0.926627592983669, 51.60417621577326], [-0.928219342008724, 51.60433911850777], [-0.928540897883304, 51.60435823822504], [-0.928666454251138, 51.6043611822271], [-0.928925123731038, 51.60435275210506], [-0.929272427371303, 51.60432085222454], [-0.929350681081097, 51.604308977474346], [-0.929525019586135, 51.60426381040009], [-0.929730308556221, 51.60419195021111], [-0.929806393059037, 51.60414948374236], [-0.929854111423592, 51.60408517871234], [-0.929877477717563, 51.604012559228565], [-0.929880189120251, 51.60395863398061], [-0.930157001898001, 51.603362311928585], [-0.930233415197893, 51.60324431822904], [-0.930397156019029, 51.60303540508514], [-0.93058677482955, 51.602831223239896], [-0.930747612253953, 51.60268432562219], [-0.931065151604954, 51.602443542878724], [-0.931358556224333, 51.60224659876122], [-0.931494751600125, 51.602165114969594], [-0.931807666849096, 51.601998019766675], [-0.932115553298882, 51.60186055047904], [-0.932344261944379, 51.601774512081256], [-0.932581062209752, 51.601712824287226], [-0.932837650566022, 51.60166929919289], [-0.93304760157037, 51.60164423223924], [-0.933247236692325, 51.60162806284857], [-0.933524572231589, 51.601623388892406], [-0.93367307135076, 51.60163283011416], [-0.933854562367985, 51.601651562386515], [-0.934222940436163, 51.60170526005669], [-0.934582321335698, 51.60177326158339], [-0.935176916778695, 51.60190903449902], [-0.935323237909383, 51.60194992468383], [-0.935449328012611, 51.60199153042619], [-0.935555166022244, 51.60203475076641], [-0.935754957696255, 51.60213547009268], [-0.935920944220561, 51.60219991608389], [-0.936105992086264, 51.60225194623237], [-0.936251123590137, 51.60228203448254], [-0.9362553703842, 51.602285669620606], [-0.935954861941404, 51.603034649313756], [-0.936025513047831, 51.60328615677915], [-0.937604653681525, 51.60374194595848], [-0.937842729718605, 51.6037494948452], [-0.937998245297976, 51.60376798569096], [-0.938149157504488, 51.60379812385097], [-0.938282536474463, 51.60383709493093], [-0.938398403200176, 51.60388400001471], [-0.938549544157173, 51.60396629131982], [-0.938542113846477, 51.60403725821696], [-0.938540670189083, 51.60403724516617], [-0.938690470772444, 51.60417707075241], [-0.93885671831091, 51.60429276731543], [-0.938949655717409, 51.60433227129961], [-0.939171393952754, 51.60435945147724], [-0.939491406642938, 51.60438302306183], [-0.939580914110842, 51.60438383145672], [-0.939698081584302, 51.604374998744255], [-0.939860253923854, 51.60435578228165], [-0.940131370864495, 51.60430877574863], [-0.940224037565311, 51.60429792302206], [-0.941065905352937, 51.604358569226044], [-0.941456261791824, 51.60439985396626], [-0.94172260946072, 51.604433725629356], [-0.942065117075164, 51.604483568721975], [-0.942405972956444, 51.60454238758566], [-0.942542307804962, 51.60457868292929], [-0.942668453620936, 51.60461848302318], [-0.942754322773386, 51.60465162617505], [-0.942930037674105, 51.6047332338937], [-0.94300827141212, 51.60478429141865], [-0.943050642772121, 51.60482513526179], [-0.943095505071305, 51.604883085645305], [-0.943175837511794, 51.60503037259752], [-0.943199044776033, 51.60508812802956], [-0.943264927978451, 51.605360268787045], [-0.94328295289835, 51.6055168856955], [-0.943285556153251, 51.605653582182974], [-0.94327790338372, 51.60573443814757], [-0.943262026480571, 51.60579633763445], [-0.943228365851772, 51.605877858692274], [-0.943092212068021, 51.60614458434088], [-0.943074097962666, 51.60624063192375], [-0.943061365824471, 51.606415854446915], [-0.943044862244347, 51.60650472320056], [-0.943017897594943, 51.606608783583646], [-0.942979591589439, 51.606703750216774], [-0.942905884027612, 51.60683076806164], [-0.942741267849139, 51.60707925374213], [-0.942655006715899, 51.607249318295594], [-0.942630361430127, 51.60731563455148], [-0.942616263944651, 51.607425205688976], [-0.942621958529523, 51.60749089598715], [-0.942636336634899, 51.60755576531453], [-0.942660904708633, 51.607617129739225], [-0.942696981288364, 51.607680396114986], [-0.942747433102709, 51.60774648940761], [-0.942856244975984, 51.6078490746924], [-0.94299552290573, 51.60794563997599], [-0.943040847342192, 51.60798381288104], [-0.943186973159248, 51.608158666884215], [-0.943285889122319, 51.60825217104693], [-0.943509689787491, 51.60844031193307], [-0.94379690141149, 51.609007570967925], [-0.943824004868445, 51.60908424372538], [-0.943831400135399, 51.609201201602104], [-0.943839541642426, 51.60922375393887], [-0.943852077204152, 51.6092436483043], [-0.943874740412961, 51.60926273459518], [-0.943900416430683, 51.60927645299323], [-0.944008015202393, 51.60930709311221], [-0.944074894993692, 51.60934995527111], [-0.944126815315737, 51.60941516198104], [-0.944143328071964, 51.60945037786937], [-0.944150844233183, 51.609499899486615], [-0.944148608042361, 51.60953404761941], [-0.944074023202655, 51.60969882315075], [-0.94403415265091, 51.60986121332522], [-0.944017357658548, 51.60996266784037], [-0.943992023164905, 51.61030771903426], [-0.943965568458423, 51.61051428886229], [-0.943938629028152, 51.61067949277199], [-0.943919488028492, 51.61075754789674], [-0.943885949921455, 51.61083367520212], [-0.943827406881077, 51.61092935920088], [-0.943739589608875, 51.61104186395993], [-0.943638735204063, 51.61115604969767], [-0.943533757272514, 51.611261206608894], [-0.942952360107171, 51.61179457356613], [-0.942768364001955, 51.61194397664764], [-0.942436714102017, 51.61217027698273], [-0.942010518369458, 51.61248743929258], [-0.941742162181165, 51.61266215641604], [-0.941369087685306, 51.61286829880399], [-0.941218061678922, 51.612965845186196], [-0.941055044244821, 51.613082165678385], [-0.940962318642569, 51.61315685920963], [-0.940802313735133, 51.613329853845215], [-0.940532273923746, 51.613638528438315], [-0.940201080800705, 51.61403027273604], [-0.940058816377521, 51.614185443187054], [-0.939985695447699, 51.614286388653916], [-0.939953592073967, 51.614362527773245], [-0.939906859457064, 51.614508669589505], [-0.939802341993177, 51.61490335803689], [-0.939554942446072, 51.615603370947234], [-0.939452722231603, 51.61596121406953], [-0.939421935085161, 51.61604275989804], [-0.939387192811998, 51.616108085051245], [-0.939207265482904, 51.61639149465681], [-0.939036585027605, 51.61671185322904], [-0.938852844916865, 51.61697274874371], [-0.938765881571911, 51.61710953487875], [-0.938636321443754, 51.617400592062225], [-0.93858227703968, 51.617550263869646], [-0.938563060896774, 51.61763101488344], [-0.938557821588965, 51.617793716095726], [-0.938568952285691, 51.6178738422429], [-0.938586194898738, 51.61793963701825], [-0.93864824402059, 51.61806608070808], [-0.938712639101221, 51.61815388154161], [-0.938801458484915, 51.61824729803767], [-0.938902019778203, 51.61833272809444], [-0.939001577491258, 51.61839926656718], [-0.939080060597956, 51.6184404379885], [-0.939144458958051, 51.618466196342986], [-0.93924483456823, 51.61849767462955], [-0.939389936057716, 51.61853135511866], [-0.939533886937889, 51.618552436752374], [-0.939605967169062, 51.618558482633226], [-0.939704125343146, 51.618561167280205], [-0.940011869234288, 51.61855765138392], [-0.940970156479417, 51.61846828865034], [-0.942814559287174, 51.61834913395653], [-0.9433943585448, 51.61832378069166], [-0.943791844341078, 51.61831207069643], [-0.944095316626396, 51.61830580819228], [-0.944345189840605, 51.61830625638639], [-0.944633949874169, 51.618311549349706], [-0.944866264500346, 51.618321729423634], [-0.945069571918896, 51.61833704343469], [-0.945259736594118, 51.618358533188456], [-0.945405071369022, 51.6183823175338], [-0.945538707551366, 51.61841229079249], [-0.945670733169093, 51.618449442740584], [-0.945789657802543, 51.61849097274293], [-0.945898390514756, 51.618536007789324], [-0.946002624502939, 51.61858819565799], [-0.946144975691139, 51.61867849034559], [-0.946290660655923, 51.61881197458077], [-0.946424293873759, 51.618966930407886], [-0.94648587943588, 51.619052004215185], [-0.946597289998464, 51.61923103785771], [-0.946748500992991, 51.619500344620654], [-0.946865282768134, 51.619759451627154], [-0.94692090631825, 51.619852564183816], [-0.946986743272162, 51.619941272483025], [-0.947121992710119, 51.62008904866086], [-0.947221067183078, 51.620177155655796], [-0.947357337089385, 51.62028088174252], [-0.947636341593443, 51.62045871900467], [-0.947732020809812, 51.62050633282523], [-0.947832261440868, 51.62054409665008], [-0.948024909405708, 51.6205835873772], [-0.948272727755043, 51.62061098363029], [-0.94903310890345, 51.62064836261257], [-0.949342820854191, 51.62068530212313], [-0.949548509996597, 51.62072310869445], [-0.949603327033706, 51.620726296510135], [-0.94966121922192, 51.62072141934501], [-0.949725095662238, 51.62070760405018], [-0.949813979767225, 51.620674230793945], [-0.949850856696741, 51.620766275113425], [-0.949938127431095, 51.62092800552347], [-0.95012170684362, 51.62142328688538], [-0.950137689181391, 51.621481875301626], [-0.950144591409982, 51.621558365780544], [-0.950143525838059, 51.62166715485939], [-0.950086848280287, 51.62218276713024], [-0.950081566444785, 51.62234906486587], [-0.950091380322934, 51.6227375905417], [-0.950012857804674, 51.623198158520914], [-0.949963053357781, 51.62366617649237], [-0.94993621019599, 51.62382778558582], [-0.949887611273865, 51.62405573809743], [-0.94981748429385, 51.62434014525264], [-0.949698012983878, 51.6246969431444], [-0.949601071539472, 51.62520410239216], [-0.949519655994856, 51.62547671925938], [-0.949509640700394, 51.62553507516918], [-0.949509569744091, 51.62560071332227], [-0.949517625184728, 51.6256898023632], [-0.949539397678852, 51.62581048474923], [-0.949602831958219, 51.626066413978656], [-0.949622600072634, 51.6262113557699], [-0.949625807500304, 51.62644786389373], [-0.949588359660548, 51.62688092470566], [-0.949587162842075, 51.62718303218221], [-0.949593421398238, 51.627287390862], [-0.949641886384285, 51.62762860642186], [-0.949677564559904, 51.627772791296934], [-0.949732061930258, 51.62791534613564], [-0.949847071945823, 51.62812767746571], [-0.95005020451512, 51.62890367131774], [-0.949860358893705, 51.62924185674224], [-0.949849459019953, 51.62927592739189], [-0.949848649628705, 51.62931098742953], [-0.949857806222275, 51.62935243070728], [-0.949882540677514, 51.62940750068883], [-0.949782851646605, 51.62940750843079], [-0.949684104107472, 51.6296170289926], [-0.949619670293909, 51.62984214210067], [-0.949589348281571, 51.62990391300069], [-0.949478823262764, 51.63006027755304], [-0.949419643728549, 51.63018293320961], [-0.949378577882241, 51.63033452402259], [-0.949364251310331, 51.63051692549393], [-0.949339228920643, 51.63059942443184], [-0.949248633732607, 51.63076855530058], [-0.949181283974238, 51.630869557872636], [-0.949044504574139, 51.63103647701982], [-0.948893935504611, 51.63136242402941], [-0.948761069414249, 51.631297394415576], [-0.948669492362367, 51.63125880992652], [-0.948537801268757, 51.63120547966423], [-0.948447461288637, 51.63117589768262], [-0.948353982967507, 51.63115707745748], [-0.948302104865814, 51.63115121794117], [-0.948079606840815, 51.63115102360314], [-0.947964190602531, 51.63114369566099], [-0.94782149485015, 51.63112892992514], [-0.947725107052886, 51.63111098229264], [-0.947684910040859, 51.63109983219839], [-0.947483021604023, 51.63102069524269], [-0.947447137482345, 51.63101048287877], [-0.947306094892948, 51.630986739722026], [-0.947000710620611, 51.63094713644845], [-0.946674033898238, 51.6308911565172], [-0.946364247153943, 51.63079216747898], [-0.946230490849763, 51.63076579091048], [-0.946172752135344, 51.63076347450912], [-0.94612066649297, 51.630766603772976], [-0.945914796224295, 51.63079712600587], [-0.94583241748209, 51.63079818492752], [-0.945382953779145, 51.63067905708907], [-0.945085984219956, 51.63058827220451], [-0.944883205963743, 51.630547786680644], [-0.944304065189339, 51.630538086402446], [-0.94394898927073, 51.630523204990325], [-0.943611477254356, 51.63049858971805], [-0.943603681926519, 51.6307098224617], [-0.943277115569317, 51.63102249010073], [-0.943359247728321, 51.63109426279834], [-0.942862682241593, 51.631385618132356], [-0.942777562378065, 51.63144239822567], [-0.942532313252267, 51.63161282917167], [-0.942337892928893, 51.63177202827151], [-0.94226606523137, 51.631816339444626], [-0.942197377359527, 51.63184988892168], [-0.942115813951467, 51.631877927416205], [-0.941937005967162, 51.631924871353945], [-0.941512981586086, 51.63201636159427], [-0.94144898217334, 51.6320346671529], [-0.94125937051438, 51.632111184999914], [-0.940790185204025, 51.6323425346351], [-0.940501042462563, 51.632535943664614], [-0.940243238615803, 51.63268647504363], [-0.940131608045529, 51.632764593869275], [-0.939328651391563, 51.63361514453957], [-0.939011405652477, 51.634145481445906], [-0.93882930544315, 51.63451878632893], [-0.93850479164515, 51.63486472819315], [-0.93841585373771, 51.63483694950617], [-0.938308667759282, 51.63503379600045], [-0.938237520065274, 51.63511048065125], [-0.938174497877949, 51.635148574806536], [-0.938097155068085, 51.63518114448376], [-0.938014243480848, 51.63520467214815], [-0.937885103100742, 51.635227781700706], [-0.937899482630853, 51.63529265131639], [-0.937852791962712, 51.635312010611116], [-0.937756752174709, 51.63534081433219], [-0.93768849662133, 51.635355482713884], [-0.937445207164159, 51.63537845841074], [-0.937282775985471, 51.6354039635962], [-0.936848828519967, 51.635485456519916], [-0.935951432459366, 51.63561220386278], [-0.935719677036262, 51.635636179646525], [-0.935420148631615, 51.63565414571281], [-0.935249454884316, 51.63560044703531], [-0.935077590540852, 51.635535048401415], [-0.934717727795324, 51.63535285185533], [-0.934413155884105, 51.635216113905294], [-0.934240481559584, 51.635123731852076], [-0.934130824273522, 51.63505529964683], [-0.934018404467151, 51.63498144729724], [-0.93379675026591, 51.63482118293064], [-0.933679892303923, 51.6347517857655], [-0.933595523374065, 51.63471415412531], [-0.933350473747258, 51.63462740768713], [-0.933261876876166, 51.63458524160035], [-0.933052343088727, 51.63446285066096], [-0.932887751506176, 51.63439571653097], [-0.932638117941304, 51.63431971687678], [-0.932307197466639, 51.63419801967628], [-0.931343887912331, 51.63380981222079], [-0.931071830619705, 51.63376597498289], [-0.930956833347264, 51.63374065092008], [-0.930823331188951, 51.63370346918478], [-0.930701576222194, 51.633658301797674], [-0.930601553796263, 51.63361063468632], [-0.930506119022842, 51.63355221932683], [-0.930386739592999, 51.633467510133144], [-0.930286034494439, 51.633387466714524], [-0.930225334024314, 51.63332666999925], [-0.930188937852857, 51.633276884582266], [-0.930114567680391, 51.63312155131756], [-0.92999324620862, 51.63293521875163], [-0.929900400330813, 51.63282827174111], [-0.929602366751531, 51.6325378240622], [-0.929499431873266, 51.632429885607195], [-0.929341000864788, 51.63222433167361], [-0.929059923028374, 51.631889079042224], [-0.928963213558906, 51.63176231446386], [-0.928896162303318, 51.6316645934755], [-0.928844852932023, 51.631573310156845], [-0.928688841592085, 51.63126527289447], [-0.928672375509884, 51.6312282570475], [-0.928615004479859, 51.631026321392014], [-0.928599834825331, 51.63099561149414], [-0.928552267379979, 51.63092953870757], [-0.928477466267079, 51.630854225808044], [-0.928389580173335, 51.630782390113474], [-0.928294323595921, 51.6307167812279], [-0.928190294396403, 51.63065558801307], [-0.928078937075949, 51.630598823630024], [-0.927494137115659, 51.630339021667446], [-0.927177150281751, 51.63017967221046], [-0.927053070740772, 51.63011110151437], [-0.926922044883713, 51.63003077810591], [-0.926774152423019, 51.6299305188448], [-0.926569924361936, 51.62976860145066], [-0.926465515994788, 51.62966244509719], [-0.926222881099496, 51.62935271335746], [-0.925807083215573, 51.62885077488713], [-0.925685153671251, 51.62869140695483], [-0.925627779063265, 51.628612654944924], [-0.925107975398826, 51.62780494620014], [-0.925039238852947, 51.627717997425265], [-0.924853081975605, 51.627525670804864], [-0.924566287633664, 51.62725149768458], [-0.924018135317732, 51.62666651663998], [-0.9236755124427, 51.62631000590676], [-0.923506463123086, 51.62618886774415], [-0.92325024557972, 51.62602736696645], [-0.923179326155173, 51.62597186775246], [-0.923151247824846, 51.62593744208942], [-0.923025917353845, 51.62573937605691], [-0.922746731858051, 51.625388839233764], [-0.922647729925315, 51.625421200084226], [-0.922438316532782, 51.62517470633975], [-0.922266691774008, 51.62491866820555], [-0.922176577184834, 51.624819832363215], [-0.921722712186069, 51.62440384906751], [-0.921324388846087, 51.624082786314446], [-0.921078577970903, 51.623909687134365], [-0.920860652296657, 51.62377910436709], [-0.920574889783577, 51.623646099345635], [-0.920239048968319, 51.623492851580735], [-0.920014292502202, 51.62371107994427], [-0.919774493442185, 51.623954346092496], [-0.9196346398006, 51.62406455586703], [-0.919395541436808, 51.62427815528515], [-0.919291601043514, 51.624396787581134], [-0.919216417933559, 51.6245210794288], [-0.919153464283899, 51.62467785367513], [-0.919134125069682, 51.624762197061855], [-0.919115026043568, 51.62495803894169], [-0.919049238753011, 51.62517323267518], [-0.919009465019033, 51.625266379578875], [-0.918926652164549, 51.625407685106715], [-0.91889138185638, 51.62549368011671], [-0.918887531877765, 51.62553410703284], [-0.918896749679156, 51.62569334383204], [-0.918892707420934, 51.62574186144837], [-0.918872585162246, 51.62579832350382], [-0.918836276012485, 51.62586722482348], [-0.918763089019947, 51.62596815648993], [-0.918486277330256, 51.626309088016214], [-0.918317614737411, 51.62653682130949], [-0.917905561785174, 51.626975413689514], [-0.917718470441796, 51.62724883363936], [-0.917588198962995, 51.627380709193844], [-0.917518986462533, 51.627435819379606], [-0.917391270738013, 51.627520961779815], [-0.916852199941663, 51.62783249660931], [-0.916708494011591, 51.62822500463541], [-0.916564194300437, 51.62882431452802], [-0.91642514281193, 51.62950639562586], [-0.916399138398425, 51.62974892972319], [-0.916394191477189, 51.62995659074321], [-0.917260413231125, 51.62992321851857], [-0.917422640699178, 51.63166639247214], [-0.91745600722272, 51.63232848375385], [-0.917204699151121, 51.632324368705305], [-0.916787813832452, 51.632356490901394], [-0.916473041038736, 51.63240843616508], [-0.91615824611563, 51.63246127954521], [-0.916096846672852, 51.632491284427324], [-0.916000979824314, 51.632573122584574], [-0.916035541448316, 51.63300234215989], [-0.916058746179642, 51.633180590521675], [-0.916070697537387, 51.63322475979131], [-0.916098260729099, 51.63328076225654], [-0.916287121367376, 51.6334803208717], [-0.916556537933578, 51.63369500893812], [-0.916833436931067, 51.63389897542989], [-0.916980624704717, 51.63396776999687], [-0.917236275570907, 51.634093312450645], [-0.91746761535009, 51.63414759643489], [-0.917599467742121, 51.63382870989293], [-0.917652284973834, 51.63367364156546], [-0.917677934007693, 51.63362802065708], [-0.917745133700401, 51.63359716923921], [-0.917749446066394, 51.633598108140106], [-0.917778102484095, 51.633608262991594], [-0.918084580428658, 51.633662338963], [-0.918258883815884, 51.633684625273325], [-0.918506861448772, 51.63370758977881], [-0.918953829589691, 51.63374767133924], [-0.919245145699076, 51.633771033193085], [-0.919300707852053, 51.63386505735126], [-0.919518444759651, 51.63449197843591], [-0.919277685382965, 51.63446908250848], [-0.919031520477806, 51.63467362436313], [-0.918786199566619, 51.63490335001199], [-0.918632752044247, 51.63503681158531], [-0.918623327237537, 51.63512933850577], [-0.918590569006466, 51.635413172104], [-0.918679820058316, 51.63554886817429], [-0.918329488250497, 51.63557621368664], [-0.918276435808259, 51.635741170885815], [-0.918247752304029, 51.6360358318421], [-0.918226764712395, 51.6364321689642], [-0.918316733144818, 51.63702374696847], [-0.918287332378286, 51.63783452012518], [-0.918306713699577, 51.63835621240955], [-0.918316674296085, 51.639213205140855], [-0.918347519668651, 51.639799742499974], [-0.918322169732004, 51.63995416480466], [-0.918318885834364, 51.64003146244247], [-0.91832686087795, 51.64012145202931], [-0.91837911416845, 51.640354816042915], [-0.918418495846573, 51.64070405330022], [-0.918530296534871, 51.64128953760163], [-0.918512952473936, 51.64147190762244], [-0.918367217757134, 51.64200916315153], [-0.917905817511154, 51.6420255938785], [-0.917874522823857, 51.64200462484983], [-0.9178264462409, 51.64196012300076], [-0.917792775459127, 51.641917552189355], [-0.917773553228143, 51.64187511449974], [-0.917765526057023, 51.64184806570082], [-0.917757894232724, 51.6417436926823], [-0.917749532884981, 51.64142711089125], [-0.917739557627689, 51.64136048104305], [-0.917720785029217, 51.641299165096676], [-0.917688816437575, 51.64124581999865], [-0.917649452591449, 51.641199600032465], [-0.917568381483579, 51.64114490323613], [-0.917433423830488, 51.64098630616572], [-0.917315173490429, 51.64079369481265], [-0.916601390868836, 51.640243120219885], [-0.916329281834837, 51.640018517003504], [-0.916001068304932, 51.63966211774633], [-0.915790319174844, 51.63947044935813], [-0.915502073944432, 51.63913509831614], [-0.915393357554307, 51.63902799332443], [-0.915169439572157, 51.63884339546647], [-0.914312592230519, 51.638234837864296], [-0.913969150495335, 51.63797270396478], [-0.913808719070197, 51.63773204326735], [-0.913709021859032, 51.63761063348384], [-0.913238840648949, 51.637814889395024], [-0.912211197236081, 51.63818662075986], [-0.912057780107923, 51.6382571327065], [-0.911911629192503, 51.63832591344631], [-0.911683066608314, 51.6384568717294], [-0.911571655864317, 51.638583520328496], [-0.910821072629623, 51.63897039510019], [-0.910799442348496, 51.63890815232427], [-0.910457034748542, 51.63884473254883], [-0.90959863753988, 51.63872527019996], [-0.909397970101408, 51.639078576087414], [-0.909048252097236, 51.63925965643008], [-0.909362542404515, 51.63959166868019], [-0.90780907162756, 51.64013291512084], [-0.906217399025103, 51.640939038154336], [-0.905898125060113, 51.64111499768922], [-0.905490384709512, 51.641363863281036], [-0.905329841704473, 51.64154939281248], [-0.905189541321435, 51.641794455508446], [-0.90489098319803, 51.64194992468491], [-0.904781623731163, 51.641990266433346], [-0.904676706895303, 51.64202615370086], [-0.904609919053975, 51.64203901826923], [-0.904237228330216, 51.64209218907456], [-0.90337364044862, 51.64224597828853], [-0.902975191138407, 51.642348358507896], [-0.90292303291413, 51.6422939216028], [-0.902563354675933, 51.64240655335107], [-0.902346768622897, 51.642458479170756], [-0.900824166346957, 51.64291090498388], [-0.900831401206159, 51.64297031739377], [-0.900456613238591, 51.64299018760407], [-0.900019098619797, 51.64297440185565], [-0.899740380937974, 51.64290615240652], [-0.899740489711103, 51.64290165761423], [-0.899316872364163, 51.642849133775655], [-0.899203336991784, 51.642822893203494], [-0.898949902655656, 51.64272520647125], [-0.898783095909619, 51.642631028913314], [-0.898613530793898, 51.64253143027416], [-0.898274969154989, 51.64230885935864], [-0.898003026265053, 51.642080618381755], [-0.897815191816853, 51.641840577798526], [-0.897681652652772, 51.6416262230417], [-0.897327401428262, 51.64091885338664], [-0.896908641882592, 51.6401308512027], [-0.896689777704333, 51.63985994571793], [-0.896199107519928, 51.639356299928586], [-0.896147069948886, 51.63929736526477], [-0.896071667668875, 51.63912941223961], [-0.896034388155249, 51.63881974973283], [-0.89604243255033, 51.63866696761571], [-0.896079873457203, 51.63849378104931], [-0.896158355572289, 51.63829670279626], [-0.896345617779906, 51.63796397393339], [-0.896436991088377, 51.637771512438086], [-0.896627579786388, 51.63748017587825], [-0.896853716275347, 51.63721255114492], [-0.896930541034958, 51.63714313797598], [-0.897052325259386, 51.63706695367484], [-0.897622203318074, 51.636806151704704], [-0.897875248140837, 51.636679946210485], [-0.898045509693898, 51.63657094674504], [-0.898161794997489, 51.63648302058021], [-0.898300490282884, 51.636364732965696], [-0.898761753797595, 51.63587451909389], [-0.898944791614438, 51.635595696246455], [-0.899167964890093, 51.63497197055003], [-0.899296205851425, 51.63450920414348], [-0.899574174378538, 51.633591065468096], [-0.89965934952667, 51.63323579470252], [-0.899745200652967, 51.632733067337156], [-0.89977291429982, 51.632065248259224], [-0.899749317297925, 51.63190587518938], [-0.899730833669311, 51.631833768913715], [-0.899698165870897, 51.631750739777836], [-0.89965967663145, 51.63166945441679], [-0.899415121605884, 51.63126703489972], [-0.899342021743563, 51.6311233827535], [-0.899274678557411, 51.630980683675816], [-0.899221406706553, 51.63067446858268], [-0.899099405183406, 51.63046202142283], [-0.899036514315775, 51.63037421293725], [-0.898969246754073, 51.63028816171176], [-0.898790586842518, 51.63008867047265], [-0.898592010806669, 51.62987640386868], [-0.898497321924236, 51.62978919602221], [-0.898330098469121, 51.62965455114822], [-0.898092642525963, 51.62949676796704], [-0.897090362270362, 51.62894426419184], [-0.896737033461809, 51.62879887742956], [-0.896347312922056, 51.6286648367393], [-0.895633444660858, 51.62837398981453], [-0.895432402381131, 51.628264199314984], [-0.895328663542796, 51.62819308870188], [-0.895257753282041, 51.62813847178444], [-0.895144755729953, 51.62803220648194], [-0.894948239644532, 51.627795675481295], [-0.894944118635818, 51.62766795529761], [-0.894659948504904, 51.62723368184], [-0.894597856997988, 51.62711350846984], [-0.894557343909314, 51.62699713484451], [-0.894469809950127, 51.62655661915932], [-0.894297931114171, 51.625960652861906], [-0.894027819576293, 51.62530531541029], [-0.893931965007508, 51.62514795788166], [-0.893770350871199, 51.62496210671055], [-0.893637995566781, 51.62476124514902], [-0.893507481839104, 51.62466290563429], [-0.892108104715385, 51.62369479825078], [-0.891788795844237, 51.623459800649094], [-0.891922368328922, 51.62337294285213], [-0.891402229815371, 51.62296161084893], [-0.891224922435199, 51.622768414566416], [-0.890089770742591, 51.621276764770215], [-0.890188416566163, 51.62120036880181], [-0.889947380146256, 51.62101466068101], [-0.889727152716072, 51.62086421627997], [-0.889328903798693, 51.62066892786315], [-0.889153387824523, 51.620758083474584], [-0.888409981594066, 51.6201459098237], [-0.888016456293258, 51.619876030785385], [-0.887588982852847, 51.619754191291285], [-0.887143566599165, 51.61965735685454], [-0.88701981132148, 51.61963820065132], [-0.886790744842007, 51.619613550199404], [-0.886603228328527, 51.619602780759124], [-0.886388075513318, 51.619599841439666], [-0.886090409498186, 51.61960421155123], [-0.8851368584814, 51.61967159165818], [-0.883828125903616, 51.61979133688442], [-0.883515973065361, 51.619797361107345], [-0.883424375160774, 51.6198216668555], [-0.883259776293847, 51.619877648328995], [-0.883163867754863, 51.61990101371408], [-0.883044634749604, 51.619815357981636], [-0.881854770311083, 51.61956485587701], [-0.881704286246311, 51.61951666620604], [-0.881635675440863, 51.619487239450166], [-0.881560131370525, 51.619446057447796], [-0.881477720403852, 51.619390423316226], [-0.881374708667671, 51.619291432867335], [-0.880834298239682, 51.61853547912722], [-0.880617549323506, 51.618127888748454], [-0.880388345702594, 51.61816796449318], [-0.879226788544387, 51.6185884841998], [-0.878534686661489, 51.61883184500677], [-0.878385021629543, 51.61898507235025], [-0.878148819949825, 51.61913297697072], [-0.878102165244257, 51.61915051459153], [-0.87804120240859, 51.61916252048532], [-0.877967464227806, 51.619165412606506], [-0.877896924603018, 51.61915574690363], [-0.877839648002824, 51.61913541789456], [-0.877812586845032, 51.61911987344738], [-0.877382402665225, 51.61869944717381], [-0.877261875140598, 51.61866682400238], [-0.877087293116294, 51.618600414623565], [-0.876592344555959, 51.61846350297477], [-0.876408990128558, 51.61845995037962], [-0.876374465270622, 51.61845422502283], [-0.876347205240439, 51.61844677083749], [-0.87630299358364, 51.61842386858449], [-0.876241963569583, 51.618380124514495], [-0.876216636094276, 51.618352907107045], [-0.876152781748704, 51.618131100785114], [-0.876106882196741, 51.61811807314475], [-0.876305643178539, 51.617614643124426], [-0.875030363348109, 51.6174927341714], [-0.874705473526163, 51.61748872204597], [-0.874564111923802, 51.6174810731233], [-0.874279482039409, 51.61730930128958], [-0.874259717266618, 51.61699889890464], [-0.874416434195306, 51.61673604585861], [-0.874423036602998, 51.61652750219062], [-0.870144618410033, 51.61769939147719], [-0.870074692270606, 51.617607003497994], [-0.869665459226217, 51.61768399010514], [-0.869137937974611, 51.617812887107476], [-0.868711126950696, 51.61789959196275], [-0.868460959800069, 51.617969115035805], [-0.866874516019656, 51.61827841686334], [-0.866642434191741, 51.6183175388698], [-0.866517885416195, 51.61833072340073], [-0.866392071649004, 51.61833670224208], [-0.865776872894858, 51.61833166083683], [-0.865633662902087, 51.618340168339564], [-0.865493072065054, 51.618359490991885], [-0.864874419821269, 51.618492883413026], [-0.864829070270363, 51.61851582340227], [-0.8648101986804, 51.61846169086974], [-0.864778464993556, 51.618402038980314], [-0.864733824417545, 51.61833866562683], [-0.864681918741689, 51.61827702035103], [-0.864649512487616, 51.61824433697217], [-0.864492159027339, 51.61812502442397], [-0.864510219622979, 51.618037979732996], [-0.864490008258273, 51.61792179156664], [-0.863791866117017, 51.616668790850674], [-0.863578496430752, 51.61619016667409], [-0.863939572338851, 51.6160749702936], [-0.864141702322916, 51.61602027805823], [-0.864343742093738, 51.615969181278444], [-0.864684853799959, 51.61590144547291], [-0.864287415633653, 51.61573755014447], [-0.864114344880943, 51.615611790807684], [-0.86394143216696, 51.615479738556914], [-0.863424226660599, 51.6150224515856], [-0.863108525016747, 51.61470918210108], [-0.862999136822108, 51.61463618943345], [-0.862947760773663, 51.614611414387845], [-0.862827479233939, 51.614569786988696], [-0.862764327092327, 51.6145538895073], [-0.862690954996651, 51.614542388851355], [-0.862422671693898, 51.614528100870835], [-0.862278208948609, 51.61452939875511], [-0.862025067586916, 51.614544929155834], [-0.861633333855888, 51.61461576315295], [-0.861195617216796, 51.61467715820802], [-0.860991546767721, 51.61469406144679], [-0.860819513274215, 51.61470048511226], [-0.860591345418716, 51.61469917048917], [-0.860366335624517, 51.61468709604235], [-0.860199196800327, 51.61467108707321], [-0.860140174693704, 51.6146633207896], [-0.859842784619867, 51.61460018922178], [-0.85969929013584, 51.61456282905675], [-0.859501466379857, 51.61450336097874], [-0.859306643699259, 51.614439425872085], [-0.859175017225196, 51.614389591981386], [-0.858977780895874, 51.61430675031806], [-0.858172868778381, 51.61392127488393], [-0.856305510909038, 51.61299763777437], [-0.855879431428414, 51.61282624136621], [-0.855413827571698, 51.612676038205095], [-0.855073660630441, 51.61259179657028], [-0.854915624510577, 51.612558784566126], [-0.854688372582268, 51.61252150056368], [-0.854459541396129, 51.6124895957323], [-0.854208848612115, 51.61246556965946], [-0.853413812340721, 51.612436228916096], [-0.851724243907319, 51.61242871018406], [-0.851450292115, 51.612410744947404], [-0.850998615679464, 51.61233888823236], [-0.850653274334699, 51.61223120468302], [-0.850372939737194, 51.61235164666859], [-0.850315593337778, 51.61233490012849], [-0.850193999216673, 51.612288751000705], [-0.850146601119627, 51.612278395984944], [-0.849926028861458, 51.61226274823948], [-0.849854084982468, 51.61225215268858], [-0.849714847013531, 51.612218418620564], [-0.849473435162227, 51.61217019573735], [-0.849372523204365, 51.61216291272777], [-0.849235958321253, 51.61219484371945], [-0.849170915863905, 51.6121969037703], [-0.849112126238191, 51.61218014249445], [-0.8487984760956, 51.61201881385575], [-0.848813983178796, 51.61186251023449], [-0.848805967905994, 51.611779707971536], [-0.848777693193183, 51.61169850541887], [-0.848751669639592, 51.61164250170296], [-0.848740414389996, 51.61163070213332], [-0.848685616135578, 51.61162746733029], [-0.848598109857592, 51.61148993537107], [-0.848561752293423, 51.61144282198033], [-0.848420551583887, 51.61131555337684], [-0.848346143135118, 51.61123120073643], [-0.848017978126262, 51.61073074025961], [-0.84803240586268, 51.61067423405594], [-0.848009203184881, 51.61062095534751], [-0.848010806265629, 51.61061467688053], [-0.848360723390725, 51.61054078070849], [-0.848731046077576, 51.61040234328455], [-0.848814480324059, 51.61035820278237], [-0.848820437461021, 51.610351067821576], [-0.848690278305866, 51.610072847084595], [-0.847947554822518, 51.60900543974003], [-0.847435103308081, 51.6083125448088], [-0.847167998407497, 51.60796823756615], [-0.846186886755928, 51.60662333116728], [-0.845549998419521, 51.605828497430636], [-0.845383680959569, 51.60566770865375], [-0.844840468159951, 51.60522267062485], [-0.84443530295085, 51.60497141150611], [-0.844232696249957, 51.60481835643492], [-0.843486943931864, 51.60416181103064], [-0.84332558359401, 51.60420428093958], [-0.842908147301968, 51.603868373383044], [-0.842663709069561, 51.603714004109015], [-0.842310199280505, 51.603533382087996], [-0.841471682375652, 51.60311958453644], [-0.841215384127901, 51.602977683579475], [-0.840873068217364, 51.60281155440105], [-0.840467421086961, 51.602637605395635], [-0.840268344470896, 51.602516948405764], [-0.840203154295604, 51.60246864832527], [-0.838474883614574, 51.601841924417336], [-0.838334815858368, 51.60178568911777], [-0.838125139250388, 51.60168470536249], [-0.837520083534699, 51.60134782062488], [-0.837365310402971, 51.60124558073874], [-0.837143016970701, 51.6010734356079], [-0.83702163004049, 51.600964332538595], [-0.836879440722268, 51.60082175386177], [-0.836733036616179, 51.60067463738169], [-0.836105420124444, 51.59992210370809], [-0.836001567218505, 51.59980508080317], [-0.835894758960057, 51.59969072601903], [-0.835646409012494, 51.5994652683849], [-0.835572705263831, 51.59941148620318], [-0.835355212679077, 51.599278049641256], [-0.835001490423373, 51.59910819321327], [-0.834666328550124, 51.59894661249016], [-0.834023851532118, 51.59860753956394], [-0.833813699592692, 51.59846967713012], [-0.832219972267628, 51.59727861587006], [-0.831975375091702, 51.59713321406168], [-0.83180286996819, 51.597047874561696], [-0.83156138306724, 51.59695015903964], [-0.831279067386554, 51.596868221715724], [-0.831119729288761, 51.59683246683902], [-0.830996129682144, 51.596810555210986], [-0.830798964246538, 51.59678611250204], [-0.829935838169309, 51.596720865686486], [-0.82967342169104, 51.596707460026586], [-0.829378950815281, 51.59670542343618], [-0.828672101908656, 51.596738836236966], [-0.828529092462618, 51.59674190522934], [-0.828241907711544, 51.596737240965595], [-0.828066024571149, 51.59672739285258], [-0.827854311754233, 51.596707295846045], [-0.827399248313258, 51.59666228882735], [-0.827164974703315, 51.59662128423301], [-0.827063074447412, 51.59659778687348], [-0.826830893268571, 51.59653162563389], [-0.826403126611598, 51.596379885757386], [-0.826320361645679, 51.596342192238744], [-0.826196596762853, 51.596270819297594], [-0.825930135887572, 51.596078429107884], [-0.825702044863314, 51.59590980062742], [-0.825239717878873, 51.595531118786504], [-0.824901250965003, 51.59522021379687], [-0.824412039116432, 51.59470908081712], [-0.8242790371805, 51.59460434384618], [-0.824162427084317, 51.59453573788591], [-0.823734544991122, 51.59433363318264], [-0.822923577534385, 51.59387232098135], [-0.82274220720895, 51.593740122024236], [-0.822758790294358, 51.59343366962803], [-0.822450529949737, 51.592123177421634], [-0.822408018987733, 51.591980681321466], [-0.82236394886053, 51.59184266543808], [-0.822242174035691, 51.59158338051977], [-0.821801765862476, 51.5908065697487], [-0.821372709449585, 51.59009371260957], [-0.821171850754746, 51.58982284235581], [-0.820679968304875, 51.58936291919855], [-0.820417155492676, 51.58914357740762], [-0.82015811620844, 51.5888901042506], [-0.820045903377484, 51.58876399099103], [-0.81975498206002, 51.5884040936899], [-0.819793038416411, 51.58838379523831], [-0.819648800144719, 51.588268149727725], [-0.819147039514258, 51.58763368041164], [-0.818936357700162, 51.58740856531028], [-0.818746726401906, 51.58698404449756], [-0.818744261992127, 51.58691208559554], [-0.818786542624285, 51.586561832259704], [-0.818798419467402, 51.58638211648965], [-0.818772601288344, 51.58593047014409], [-0.818622316220491, 51.585380460186784], [-0.818493730937228, 51.58471737211902], [-0.818460174123387, 51.58461992329734], [-0.818316632401033, 51.58436670899539], [-0.818092592164715, 51.58404524580265], [-0.817774082795079, 51.58341531231479], [-0.817553796530972, 51.58311636524129], [-0.817445537064436, 51.58300557512581], [-0.81689125274485, 51.582562990062094], [-0.816348587477007, 51.58217357091916], [-0.816214612729635, 51.58210837837547], [-0.816144330954904, 51.58209148442308], [-0.816059129697027, 51.58209332267878], [-0.815742672724781, 51.5820523651453], [-0.815217212787465, 51.58194545592985], [-0.815002344756643, 51.58188304223224], [-0.814826435408141, 51.5818210214772], [-0.814485295861823, 51.581730356582035], [-0.81444044205173, 51.581790148477246], [-0.813566956536122, 51.581635656767844], [-0.813282023122958, 51.58154825394594], [-0.813052037332166, 51.581456910143594], [-0.812870182657061, 51.581346270732034], [-0.812790810356639, 51.58129061819263], [-0.812604263086127, 51.581138568732094], [-0.812386509085548, 51.58085492331321], [-0.812249092317067, 51.58070067277682], [-0.812167619564544, 51.58055957666617], [-0.812051961231651, 51.58029045130041], [-0.812042798783181, 51.580254391465495], [-0.812034433182585, 51.580187767648724], [-0.812033188044369, 51.58012481260171], [-0.812058064730261, 51.580000977815104], [-0.81229781440549, 51.579440518478464], [-0.812247901650195, 51.57941753400863], [-0.812446355706805, 51.57916777205078], [-0.81277233113049, 51.578787120404634], [-0.813191367818544, 51.57821318632392], [-0.813476583358647, 51.57767926033569], [-0.81372993476285, 51.57714950751218], [-0.813894821439398, 51.57669169369027], [-0.813998634879093, 51.57614064720803], [-0.814138744624452, 51.57508193151095], [-0.814120940539715, 51.57493428638376], [-0.81419874804071, 51.57321943977239], [-0.814492542549023, 51.572575897898666], [-0.814547744449169, 51.57211787423915], [-0.814549364628156, 51.57200009817749], [-0.81449843948966, 51.57157247390041], [-0.81447275908744, 51.57022974030085], [-0.814470739157426, 51.56964165674743], [-0.814429823166273, 51.56938407823071], [-0.814416473674158, 51.5693425811485], [-0.814362577800679, 51.569251219648685], [-0.81406844007837, 51.5689659058573], [-0.813908308238922, 51.56874308971205], [-0.813853532979604, 51.56863013877188], [-0.81375715260415, 51.56839717647337], [-0.81371284208748, 51.56815934527622], [-0.813667666933597, 51.567788426746645], [-0.813915408556528, 51.567527470860746], [-0.814280993234198, 51.56684059466537], [-0.814704823511867, 51.56613272518902], [-0.814994772052415, 51.56569055892733], [-0.815202529336662, 51.56519091397622], [-0.815219131565213, 51.56505170869626], [-0.815351636137841, 51.564671793906264], [-0.815511116853932, 51.56436408558186], [-0.815565592175225, 51.5642108755608], [-0.815662011458114, 51.564053592855515], [-0.815731002538058, 51.56389693250399], [-0.815762954470268, 51.56377766396064], [-0.815882314039101, 51.56307031436626], [-0.815899206541573, 51.563030920866616], [-0.815918960262566, 51.5629924554096], [-0.816100387305838, 51.56272812828101], [-0.816239061970809, 51.562387838558415], [-0.816351227865814, 51.56217946080997], [-0.816402225233145, 51.562104443964415], [-0.816445731089239, 51.56204014171416], [-0.816755073070336, 51.56173843863565], [-0.81682883069147, 51.5615089920632], [-0.81709149295673, 51.56100450196165], [-0.817126546068515, 51.5610435199925], [-0.817036868291134, 51.56144185218239], [-0.817602599672938, 51.56148891511105], [-0.817650902097453, 51.56129517879352], [-0.81772376875861, 51.56109989153342], [-0.818544773098936, 51.56114952106405], [-0.818940645385275, 51.56112652991029], [-0.819286252234888, 51.56087194248433], [-0.820505192935939, 51.560762809232635], [-0.821152924392013, 51.56109751750433], [-0.821401734784996, 51.56112699167495], [-0.821468077854438, 51.561127657861135], [-0.821837057068471, 51.56108460493917], [-0.822551882107614, 51.56083281445182], [-0.822991148836609, 51.56069335159132], [-0.823298868990794, 51.56056425765945], [-0.823427756279142, 51.560489119484224], [-0.823816316952276, 51.56018999039105], [-0.823841530161624, 51.56016326766115], [-0.823879440321637, 51.5600917131651], [-0.823939663402364, 51.55926686943448], [-0.824000930577316, 51.55924050793579], [-0.823876052668265, 51.55798579953388], [-0.823797968341331, 51.557154174451156], [-0.823813910366727, 51.55698348995032], [-0.824268965579194, 51.556733581409404], [-0.824612742777356, 51.55649154853787], [-0.826344281900068, 51.55484359477631], [-0.826657025878971, 51.55457337099326], [-0.827233265990788, 51.554040521447654], [-0.827929376968602, 51.55344502444081], [-0.828029419518581, 51.553368693973354], [-0.828246668974642, 51.55322159923911], [-0.828485269800709, 51.5530855074047], [-0.828605105979095, 51.55302466009866], [-0.829372820563392, 51.55267264797847], [-0.830416538296143, 51.552300003050114], [-0.830341853307235, 51.55217517181714], [-0.830015969895102, 51.55217192349864], [-0.82991663595149, 51.55216463892005], [-0.829524156953837, 51.55211486704629], [-0.829282415323888, 51.552092673855796], [-0.828838545910614, 51.55207835426137], [-0.828599504055965, 51.55206338004898], [-0.828680519991051, 51.55199764928292], [-0.828534433277995, 51.55195752639793], [-0.828384829125967, 51.55188589688778], [-0.827987906418731, 51.55167242458396], [-0.827957477145366, 51.551621766572], [-0.827834232346298, 51.55159086272802], [-0.827633977763617, 51.551525919798664], [-0.827259642164726, 51.55144395104261], [-0.826879262755715, 51.5513727108443], [-0.826619197529414, 51.551334143723224], [-0.825020961294276, 51.55117248609027], [-0.825087548806697, 51.55099511486544], [-0.825080332863119, 51.55093929339289], [-0.825041927300218, 51.55086247849746], [-0.82502361605882, 51.55078946149474], [-0.825044884876699, 51.55069166368164], [-0.825058487270179, 51.550667521970404], [-0.82509857658956, 51.550622964257876], [-0.825145597538488, 51.55058926609727], [-0.825325151596322, 51.5505056412203], [-0.824909915146001, 51.550164291306395], [-0.82525013660448, 51.550002248032946], [-0.825332063085088, 51.549957209837], [-0.825638185418255, 51.54977504214384], [-0.82578350044032, 51.54967668704559], [-0.825923116734683, 51.54957557721289], [-0.826170603160388, 51.54937393870707], [-0.826371785812396, 51.54917813090106], [-0.826492161334072, 51.549039961540565], [-0.826611394860751, 51.548890091280356], [-0.82670116630089, 51.54876420424681], [-0.826782355507479, 51.54863553380353], [-0.826823019292071, 51.54856850170786], [-0.827062757600335, 51.548106920435835], [-0.827101368877001, 51.54800749719491], [-0.827194201898492, 51.54770629998806], [-0.827307057244965, 51.54741159704493], [-0.827582602426052, 51.54684696658141], [-0.827901482950928, 51.54639156924703], [-0.828226190833503, 51.54604592938406], [-0.828636291311094, 51.545744301711125], [-0.82879259021163, 51.54566673370386], [-0.828904643767125, 51.545627388779295], [-0.829074413403866, 51.54558682127211], [-0.829642313890905, 51.54554213206049], [-0.831137752395514, 51.5457125947128], [-0.831296230672639, 51.545718668970665], [-0.831381409559054, 51.545715021306385], [-0.831520416985355, 51.54569302674314], [-0.831658465956176, 51.54565213966273], [-0.832162223002951, 51.54540897973132], [-0.832259763552867, 51.545373083913695], [-0.832342495362879, 51.54535232675641], [-0.832449690786029, 51.545333611293344], [-0.832560958333776, 51.54532482723805], [-0.832748224427793, 51.54533298427906], [-0.833594396864807, 51.5455158387706], [-0.833803468208608, 51.5455736658201], [-0.834066591719905, 51.54566080332341], [-0.834319302360527, 51.54576042533909], [-0.834632701147966, 51.545911902800114], [-0.834743597643834, 51.54597414830218], [-0.834972095381443, 51.546118487532766], [-0.835101437527799, 51.546192605160904], [-0.835308853525451, 51.54642845092972], [-0.835597379030446, 51.546650714213946], [-0.835675530378703, 51.54669644865621], [-0.835765285050956, 51.54673960061442], [-0.835946924814448, 51.54679895002405], [-0.836738145066418, 51.54693268079673], [-0.837616543696299, 51.54698454508781], [-0.837668585980954, 51.546979665457], [-0.837867989708348, 51.546964555807335], [-0.83797367625272, 51.54694851789646], [-0.838105566972017, 51.54692284834119], [-0.838233315283634, 51.54688994418392], [-0.838329229403341, 51.54686122067977], [-0.838482151664417, 51.546802489195365], [-0.839036827411148, 51.54642762424692], [-0.83955396219585, 51.54605418383688], [-0.840116011657223, 51.54567219327131], [-0.840736658187885, 51.54525391246058], [-0.840941426195899, 51.54514083988849], [-0.841049279937165, 51.54509604683764], [-0.841194847094701, 51.5450426342828], [-0.841299520083949, 51.545009498946165], [-0.841898633062652, 51.544870644649805], [-0.842282244574123, 51.54481328536381], [-0.842762474116396, 51.54475597844143], [-0.843565178344648, 51.54477737891959], [-0.844086979548171, 51.54484366398717], [-0.845732620874625, 51.545006428046236], [-0.847066038668597, 51.54519847249473], [-0.847735465249349, 51.545415455459946], [-0.84773690700669, 51.54541546961599], [-0.848634731053663, 51.54572550693968], [-0.849946581441456, 51.54620234699594], [-0.850255922443757, 51.54628810259981], [-0.850450510421732, 51.5463493547082], [-0.850677807173489, 51.54642891042725], [-0.850994850981171, 51.546552505063595], [-0.852786328510159, 51.547342426670774], [-0.85300310746802, 51.547496506935786], [-0.853571212311598, 51.54778799706584], [-0.854020445083318, 51.54798930492918], [-0.854581807452525, 51.548205193183556], [-0.85478620907829, 51.54827822314386], [-0.854963577157503, 51.54833660211785], [-0.855161244465997, 51.54839068294659], [-0.855663052553423, 51.5485088736389], [-0.856166529832507, 51.54867563412252], [-0.856279761006, 51.54870371304979], [-0.856530960852844, 51.54875111981111], [-0.856804082121709, 51.54878705024175], [-0.857112033920981, 51.54881432744164], [-0.857381573472553, 51.548820548731904], [-0.857549123049589, 51.54881049056259], [-0.857844479857821, 51.548764809719025], [-0.858057604662229, 51.54872012637499], [-0.858337617310588, 51.54865361386837], [-0.858552497890933, 51.54859635820055], [-0.859049392399301, 51.548450127924276], [-0.859439117962245, 51.5483792842905], [-0.859697682244768, 51.54836291412634], [-0.859779823131423, 51.54836551056866], [-0.860170027263243, 51.548390881318824], [-0.860456238387038, 51.54842243448379], [-0.861009536104037, 51.548500639150554], [-0.861158816462501, 51.54852906321894], [-0.861352413335375, 51.54857320311727], [-0.861544411683264, 51.54862362144007], [-0.861731905414109, 51.5486811891874], [-0.862073439754406, 51.548807688741114], [-0.86254414698236, 51.54901726458452], [-0.86282747298222, 51.54916477803516], [-0.863015068128655, 51.549276295417606], [-0.863120154717426, 51.549342054318615], [-0.863285809311142, 51.54946594721784], [-0.863418211576468, 51.54959311456195], [-0.863530092020445, 51.54973357070672], [-0.863653360363745, 51.549937978681236], [-0.863733641061499, 51.550131180181424], [-0.863790336700716, 51.5503448343906], [-0.863824973966162, 51.550691353426465], [-0.863841717303786, 51.55100353042492], [-0.863889686614544, 51.55116225019172], [-0.863971345177536, 51.55135816235228], [-0.864192531443895, 51.5518009005184], [-0.864636908176204, 51.552606367995786], [-0.864885616784935, 51.55304487507487], [-0.864984710926909, 51.55317801261536], [-0.865042267578469, 51.5532415116859], [-0.86524661818949, 51.553434113390985], [-0.866448255146234, 51.55464702695421], [-0.866553639357719, 51.55475954277147], [-0.86713929523259, 51.555454866418074], [-0.86728119491555, 51.55560729781788], [-0.867357192432134, 51.55568356216347], [-0.867846797612144, 51.55612348793147], [-0.867948777192819, 51.5561991033314], [-0.868039688780355, 51.55625572917072], [-0.868162193200772, 51.55631805467487], [-0.868334859667638, 51.55639345221028], [-0.868507816648064, 51.556457162985154], [-0.868686743286876, 51.556512838449954], [-0.868885971532242, 51.55656421341042], [-0.869870431325262, 51.55700170522159], [-0.870538382015661, 51.557289577406756], [-0.87065953954758, 51.55734829060127], [-0.870968323528286, 51.55751940747054], [-0.871084688448939, 51.55759695683154], [-0.871173919806704, 51.55766345498963], [-0.871421843971099, 51.55790412108149], [-0.871517352960249, 51.558008444760674], [-0.871560414081151, 51.55807539786269], [-0.871689483441928, 51.558339198343305], [-0.871715457861831, 51.558455441841], [-0.871819115572425, 51.558871857901316], [-0.872116688986198, 51.559438501590606], [-0.87224925001588, 51.559678057158926], [-0.872395481580982, 51.5598898694294], [-0.872503199025109, 51.56002578071336], [-0.872616797176149, 51.56015725249727], [-0.872767427555836, 51.560307962534345], [-0.873712440787397, 51.560887112412736], [-0.874019840047307, 51.56105730856152], [-0.874413245272104, 51.56124990894107], [-0.875159636577155, 51.56157807024888], [-0.875469862748955, 51.561692540724444], [-0.875618818634067, 51.561736229028845], [-0.87605776549836, 51.56183754414599], [-0.876366373823489, 51.56190074371407], [-0.87668521195865, 51.561958645316366], [-0.876968369886447, 51.56200091867397], [-0.877197163756339, 51.56202468778881], [-0.877516822654725, 51.5620493254706], [-0.878098847659676, 51.56208186543848], [-0.879220205739232, 51.56212315048378], [-0.879742407250114, 51.562124539056946], [-0.8803196812009, 51.56211566057546], [-0.88047709073344, 51.562109069498774], [-0.880781923890852, 51.5620912956137], [-0.881058065229737, 51.56206695318683], [-0.881262135404653, 51.56204012483733], [-0.881418631531618, 51.562011943580096], [-0.881649213834679, 51.56196288783239], [-0.882003250428868, 51.56187993977645], [-0.882376388095226, 51.56178278572967], [-0.882764299497775, 51.56167138432022], [-0.883194585739291, 51.561537905452155], [-0.883498576630078, 51.5614364931922], [-0.883756281221724, 51.56134003501421], [-0.884086956514705, 51.56120920221847], [-0.884407665982054, 51.56107287871968], [-0.885457870533961, 51.5606602434964], [-0.885606584631741, 51.56059601575753], [-0.88578613479336, 51.56050960117672], [-0.88595858283258, 51.56041862303493], [-0.886091760097573, 51.560340759581955], [-0.886521253482028, 51.56006159461465], [-0.886883345687433, 51.559824949307504], [-0.887389733197074, 51.559468282123994], [-0.887580604245187, 51.55927227271282], [-0.887708691217493, 51.559107139161064], [-0.888191015763102, 51.55861266662589], [-0.888192457957821, 51.55861268028735], [-0.888287760756616, 51.55849039596854], [-0.888562664893145, 51.558278995716826], [-0.888677108662246, 51.55814070717499], [-0.888887527216288, 51.55791161122132], [-0.889030158653071, 51.55774121885465], [-0.889203011709727, 51.557514464273005], [-0.88945350380216, 51.55717964382524], [-0.889600043815338, 51.556967026485395], [-0.889736358446423, 51.55670036168757], [-0.889858423154084, 51.55648571413559], [-0.889957478394766, 51.55626815130874], [-0.88999480235023, 51.556157006507235], [-0.890171676314085, 51.5555274577222], [-0.89040150985715, 51.554855248874496], [-0.891496918227321, 51.55316795557777], [-0.892148150167392, 51.55212836271704], [-0.892302414411729, 51.5517746441604], [-0.892679622502675, 51.55097074336506], [-0.892968782461996, 51.55046633574481], [-0.893655961353766, 51.54930928124159], [-0.894173495307085, 51.548604708475054], [-0.894625223197592, 51.54805597035748], [-0.895275002004698, 51.547308578527485], [-0.895581553072133, 51.54691762432374], [-0.89567259455686, 51.54679079793778], [-0.895853734572665, 51.54651645501248], [-0.896746527292651, 51.54508077321264], [-0.896901839906062, 51.544860136456265], [-0.897255891587921, 51.54494888564188], [-0.898115394177492, 51.545187148067974], [-0.89822539056202, 51.54523044209882], [-0.898280925208036, 51.54525973711452], [-0.898317695099433, 51.54528975512979], [-0.898473190139101, 51.54530020648797], [-0.899619101095523, 51.54544313546729], [-0.901006352145532, 51.54562517973134], [-0.901825064903737, 51.54570208025918], [-0.903152296119515, 51.54586195719927], [-0.903215411109321, 51.54587603470979], [-0.903297183099556, 51.545893883241035], [-0.903017403675823, 51.54655396139701], [-0.902616538461231, 51.54745118838641], [-0.902395351374664, 51.54801290343283], [-0.902224993241029, 51.54837997226972], [-0.902166365216381, 51.54859882282856], [-0.902146545476892, 51.54876318664974], [-0.902208891983797, 51.54892921824649], [-0.902230894835185, 51.549033728477525], [-0.902380735585514, 51.54999904656443], [-0.902673692529055, 51.551610411429984], [-0.902806620567669, 51.55250003963136], [-0.902816651036337, 51.55268266601908], [-0.902804979597758, 51.55292803179951], [-0.902756997764027, 51.55318384821566], [-0.902654701329301, 51.55353896524768], [-0.902427419928527, 51.55423280167036], [-0.901847751389036, 51.555843197130926], [-0.901770133963284, 51.556011515784924], [-0.90172081219273, 51.556082988265544], [-0.902203201151337, 51.55617741874876], [-0.906010818638152, 51.55679743475821], [-0.906204734572883, 51.556771367660915], [-0.906311884484255, 51.55675438267928], [-0.906358975073264, 51.55689599188705], [-0.90638590166065, 51.55691602462513], [-0.906615524939952, 51.55696492104195], [-0.907278267614382, 51.55705831304524], [-0.907858939004531, 51.55720578727805], [-0.908174621569804, 51.5572752632291], [-0.908339760107985, 51.55730647205926], [-0.908420198492941, 51.557320707807335], [-0.908923514869315, 51.557385632424236], [-0.909322889103033, 51.5574540848968], [-0.909506497855653, 51.557497152980005], [-0.909658336207082, 51.557541723987356], [-0.909754316957776, 51.55756959081508], [-0.909871264277585, 51.557625526703404], [-0.91002439519459, 51.55767640345812], [-0.91014009429463, 51.557724234915874], [-0.910363938659539, 51.55783421414451], [-0.910769828656022, 51.55805288423369], [-0.910899633150579, 51.55817457810929], [-0.911134211672749, 51.55843931338367], [-0.911191431662737, 51.558519870694006], [-0.911262279817118, 51.55863382382822], [-0.911345597527786, 51.558829717406], [-0.911347039740573, 51.55882973078292], [-0.911354152248679, 51.55895478193117], [-0.911501156990394, 51.55932300828838], [-0.911744284152759, 51.55977395051585], [-0.911784714781588, 51.55983277167005], [-0.911848028397377, 51.559899897522016], [-0.911951124589094, 51.55999256899618], [-0.912043240814804, 51.56006176008463], [-0.912343203354435, 51.560247072388215], [-0.91252735254784, 51.560389049785144], [-0.912663001694362, 51.56050809825428], [-0.913644040185922, 51.561715780647766], [-0.914729932802775, 51.56149024267299], [-0.915936249212879, 51.561720788632314], [-0.917099342153636, 51.56255696600573], [-0.917716153850379, 51.56209778262442], [-0.918510926061236, 51.561494569835055], [-0.919190082061234, 51.56187308324347], [-0.919265061021478, 51.56187467281339], [-0.919319677161742, 51.561883268238525], [-0.919395565855925, 51.56190734542486], [-0.919450182060758, 51.561915940789575], [-0.919451624375034, 51.56191595406745], [-0.919612764956992, 51.561873377936905], [-0.919684473323871, 51.562134798108005], [-0.919731696029427, 51.56227280618616], [-0.919795125391412, 51.562396576626476], [-0.919877773921036, 51.56250074208832], [-0.920024454979703, 51.56264236275641], [-0.920273793481437, 51.562835281288635], [-0.920455811890565, 51.56300779833283], [-0.92054707457537, 51.56311384087594], [-0.920622684574115, 51.56321074767881], [-0.920768557091237, 51.56344767224896], [-0.920815933327546, 51.56357938704838], [-0.92087756775181, 51.56365728255545], [-0.920897207761338, 51.56368084160506], [-0.920950783915168, 51.5637334861553], [-0.921113636188415, 51.563862665653886], [-0.921195103215065, 51.56395602921301], [-0.921351882125165, 51.56422002842434], [-0.921395592904906, 51.56432383493418], [-0.921420893006769, 51.56441308549212], [-0.921438619701684, 51.56451755238376], [-0.921413985191466, 51.56464410933019], [-0.92167481147157, 51.56453500840272], [-0.923479752756133, 51.56373602685831], [-0.924155377789785, 51.5634113259626], [-0.924873111301507, 51.56399247344971], [-0.924951149378637, 51.56404803772923], [-0.925274524870032, 51.56428388466152], [-0.92664770764064, 51.56515336065692], [-0.927393574791524, 51.56558368874587], [-0.927927453464337, 51.5659491340051], [-0.92835633038721, 51.56599441223158], [-0.928244524844939, 51.56725223174753], [-0.928125342518282, 51.56741209518939], [-0.9281054698832, 51.56745956981058], [-0.927839528670842, 51.568092855254655], [-0.93052584537502, 51.568532778436946], [-0.930434864440691, 51.56872077542371], [-0.930290537945866, 51.568968530677175], [-0.93032458943141, 51.568993118606556], [-0.930407160146686, 51.56904062792432], [-0.930494248489543, 51.56908008580425], [-0.93056005729139, 51.5691040638391], [-0.930644619283805, 51.56912821268005], [-0.930755210497826, 51.569149901051155], [-0.931002865082897, 51.56917193845677], [-0.931506345671459, 51.5692367670135], [-0.9319179887186, 51.56928007686346], [-0.93222706378822, 51.569328746497334], [-0.932389335623021, 51.56936169347699], [-0.932508352034028, 51.56939334769875], [-0.932608510110525, 51.56942932617174], [-0.932871163025979, 51.56955040480943], [-0.933086053531851, 51.569616199317096], [-0.933414865356232, 51.569684826955594], [-0.93386895042082, 51.56976448240679], [-0.934635570791928, 51.5700537823344], [-0.934785550106084, 51.57011898456062], [-0.934985327167408, 51.57021431104797], [-0.935122135234023, 51.5702874858722], [-0.935333952219633, 51.570423383659445], [-0.935683954424458, 51.570697207984594], [-0.935948857561102, 51.57084617434456], [-0.936321009353978, 51.57109861741231], [-0.936776166293208, 51.57138058458356], [-0.936874033955222, 51.57139136186155], [-0.937185388877335, 51.57140497135624], [-0.937358713203379, 51.57139754881963], [-0.937474500211682, 51.571382411871916], [-0.937604964789291, 51.57135661760672], [-0.938082770631526, 51.571224267138255], [-0.938303744516349, 51.57115343316592], [-0.938622419406116, 51.57103852370375], [-0.938583754985448, 51.57127375671787], [-0.938615426417796, 51.5714008261012], [-0.938651384040882, 51.57152973256723], [-0.938810396393867, 51.572013125409214], [-0.938917102284257, 51.5723881447753], [-0.938977920287056, 51.572564931845086], [-0.939147081147104, 51.57298457478389], [-0.93921529881351, 51.57340150695511], [-0.939295227462625, 51.57374930879435], [-0.939359853061118, 51.57401065198471]]]}} attoparsec-0.13.2.4/benchmarks/json-data/integers.json0000755000000000000000000001377307346545000021023 0ustar0000000000000000[1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 4, 4, 4, 4, 5, 5, 5, 6, 6, 7, 7, 7, 8, 9, 9, 10, 10, 11, 12, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 26, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 50, 53, 56, 60, 63, 67, 72, 76, 81, 86, 91, 96, 102, 109, 115, 122, 130, 138, 146, 155, 165, 175, 186, 197, 209, 222, 236, 250, 266, 282, 299, 318, 337, 358, 380, 403, 428, 454, 482, 511, 543, 576, 611, 649, 688, 730, 775, 823, 873, 926, 983, 1043, 1107, 1175, 1247, 1323, 1404, 1490, 1582, 1679, 1781, 1890, 2006, 2129, 2259, 2398, 2544, 2700, 2865, 3041, 3227, 3425, 3634, 3857, 4093, 4343, 4609, 4891, 5191, 5509, 5846, 6204, 6583, 6986, 7414, 7868, 8349, 8860, 9403, 9978, 10589, 11237, 11925, 12655, 13430, 14252, 15124, 16050, 17032, 18075, 19181, 20355, 21601, 22923, 24326, 25815, 27396, 29072, 30852, 32740, 34744, 36871, 39128, 41523, 44064, 46762, 49624, 52661, 55884, 59305, 62935, 66787, 70875, 75213, 79817, 84702, 89887, 95389, 101227, 107423, 113998, 120976, 128381, 136239, 144578, 153427, 162818, 172784, 183360, 194583, 206493, 219132, 232545, 246778, 261883, 277912, 294923, 312975, 332131, 352460, 374034, 396928, 421223, 447005, 474365, 503400, 534212, 566911, 601610, 638433, 677511, 718980, 762987, 809688, 859247, 911840, 967652, 1026880, 1089734, 1156434, 1227217, 1302333, 1382046, 1466638, 1556408, 1651673, 1752769, 1860052, 1973902, 2094721, 2222934, 2358996, 2503385, 2656613, 2819219, 2991777, 3174898, 3369227, 3575451, 3794297, 4026539, 4272995, 4534536, 4812086, 5106625, 5419191, 5750889, 6102889, 6476435, 6872845, 7293518, 7739939, 8213686, 8716429, 9249944, 9816115, 10416939, 11054539, 11731166, 12449207, 13211198, 14019829, 14877955, 15788605, 16754994, 17780533, 18868844, 20023768, 21249383, 22550016, 23930257, 25394980, 26949356, 28598872, 30349352, 32206975, 34178300, 36270285, 38490317, 40846232, 43346349, 45999492, 48815029, 51802899, 54973651, 58338478, 61909260, 65698602, 69719882, 73987297, 78515911, 83321713, 88421668, 93833782, 99577160, 105672079, 112140056, 119003924, 126287916, 134017747, 142220706, 150925751, 160163614, 169966908, 180370243, 191410345, 203126189, 215559137, 228753081, 242754599, 257613123, 273381107, 290114218, 307871529, 326715729, 346713346, 367934976, 390455540, 414354543, 439716356, 466630515, 495192035, 525501749, 557666661, 591800322, 628023236, 666463282, 707256166, 750545902, 796485316, 845236589, 896971830, 951873682, 1010135966, 1071964368, 1137577163, 1207205986, 1281096650, 1359510014, 1442722903, 1531029087, 1624740315, 1724187420, 1829721484, 1941715077, 2060563573, 2186686548, 2320529259, 2462564214, 2613292844, 2773247272, 2942992191, 3123126858, 3314287206, 3517148098, 3732425698, 3960880011, 4203317554, 4460594215, 4733618266, 5023353573, 5330822998, 5657112012, 6003372524, 6370826950, 6760772526, 7174585891, 7613727944, 8079749004, 8574294281, 9099109685, 9656047991, 10247075377, 10874278366, 11539871197, 12246203633, 12995769265, 13791214310, 14635346955, 15531147272, 16481777734, 17490594386, 18561158687, 19697250088, 20902879371, 22182302812, 23540037202, 24980875800, 26509905246, 28132523526, 29854459026, 31681790754, 33620969802, 35678842122, 37862672691, 40180171161, 42639519077, 45249398761, 48019023960, 50958172379, 54077220194, 57387178688, 60899733121, 64627283986, 68582990784, 72780818484, 77235586822, 81963022620, 86979815309, 92303675844, 97953399235, 103948930895, 110311437058, 117063379497, 124228594829, 131832378662, 139901574895, 148464670491, 157551896043, 167195332496, 177429024407, 188289100133, 199813899374, 212044108527, 225022904322, 238796106249, 253412338321, 268923200725, 285383451995, 302851202324, 321388118716, 341059642687, 361935221296, 384088552321, 407597844432, 432546093294, 459021374572, 487117154867, 516932621682, 548573033590, 582150091830, 617782334651, 655595555791, 695723248569, 738307077168, 783497376747, 831453684183, 882345301285, 936351892486, 993664119121, 1054484312524, 1119027188325, 1187520604468, 1260206365627, 1337341076854, 1419197049486, 1506063262491, 1598246382662, 1696071847252, 1799885012878, 1910052374747, 2026962860500, 2151029203266, 2282689398739, 2422408251457, 2570679015712, 2728025136906, 2895002099486, 3072199387991, 3260242568131, 3459795495242, 3671562657914, 3896291665080, 4134775885316, 4387857247705, 4656429214122, 4941439933460, 5243895588908, 5564863950114, 5905478142772, 6266940648935, 6650527552175, 7057593042589, 7489574197539, 7947996055022, 8434476997558, 8950734465625, 9498591020797, 10079980779998, 10696956243580, 11351695541337, 12046510122031, 12783852913581, 13566326982715, 14396694724673, 15277887615381, 16213016560543, 17205382878181, 18258489953389, 19376055606456, 20562025218016, 21820585657560, 23156180064488, 24573523533875, 26077619762337, 27673778712750, 29367635360200, 31165169585327, 33072727285306, 35097042776985, 37245262571278, 39524970602741, 41944215003394, 44511536515321, 47235998642351, 50127219647252, 53195406507421, 56451390948928, 59906667686130, 63573435001862, 67464637811456, 71594013362620, 75976139732519, 80626487293267, 85561473327514, 90798519986944, 96356115798305, 102253880934088, 108512636478302, 115154477931865, 122202853217119, 129682645456833, 137620260819954, 146043721744222, 154982765864743, 164468950997792, 174535766550465, 185218751749486, 196555621106568, 208586397563259, 221353553785311, 234902162105402, 249280053643550, 264537987166964, 280729828285480, 297912739615178, 316147382581544, 335498131574595, 356033301212013, 377825387512598, 400951323831468, 425492752460545, 451536312853150, 479173947490266, 508503226468250, 539627691953919, 572657223723034, 607708427072674, 644905044476938, 684378392439283, 726267825083707, 770721226121430, 817895530929871, 867957280587026, 921083209817197, 977460870923688, 1037289295911185, 1100779699135317, 1168156222959992, 1239656729054927, 1315533638126921, 1396054821049394, 1481504544536185, 1572184474698156, 1668414742025481, 1770535071555377, 1878905982215138, 1993910059574563, 2115953306501003, 2245466576485316, 2382907094698829, 2528760072151156, 2683540418647385, 2847794560591953] attoparsec-0.13.2.4/benchmarks/json-data/jp10.json0000755000000000000000000003520607346545000017750 0ustar0000000000000000{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://babyprincess.sakura.ne.jp/about/" rel="nofollow">\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71</a>"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bit.ly/Fossetta" rel="nofollow">\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1</a>"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.docodemo.jp/twil/" rel="nofollow">Twil2 (Tweet Anytime, Anywhere by Mail)</a>"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/kyo4to4" rel="nofollow">lost-sheep-bot</a>"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u3055\u3042\u3084\u3093\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(>_<)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":15,"page":1,"completed_in":0.104827,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}attoparsec-0.13.2.4/benchmarks/json-data/jp100.json0000755000000000000000000024561507346545000020037 0ustar0000000000000000{"results":[{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:40:04 +0000","from_user":"ChuriSta_gt","id_str":"41190705623732224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3072\u3089\u304c\u306a\u306e\u300c\u3064\u300d\u306f\u3082\u3046Twitter\u306e\u300c\u3064\u300d\u3060\uff01","id":41190705623732224,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"71746558","profile_image_url":"http://a2.twimg.com/profile_images/591641547/wwd_normal.gif","created_at":"Fri, 25 Feb 2011 17:40:02 +0000","from_user":"fuckkilldiestar","id_str":"41190699571494912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u306b\u3057\u3066\u3082Twitter\u3084pixiv\u96e2\u308c\u3092\u3069\u3046\u306b\u304b\u3057\u308d\u674f\u4ec1\u30d6\u30eb\u30de","id":41190699571494912,"from_user_id":71746558,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"131230176","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"proory_bot","id_str":"41190683922546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30ea\u30cd\u30f3\u30dd\u30fc\u30c1 http://bit.ly/btjqlH","id":41190683922546688,"from_user_id":131230176,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://proory.com/" rel="nofollow">proory tems</a>"},{"from_user_id_str":"120359038","profile_image_url":"http://a1.twimg.com/profile_images/946521484/200805161826000_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"tukinosuke","id_str":"41190680835391488","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190680835391488,"from_user_id":120359038,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"166512109","profile_image_url":"http://a3.twimg.com/profile_images/1224583217/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:50 +0000","from_user":"yurii1129","id_str":"41190649839620096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u6c17\u4ed8\u3044\u305f\u2026\u307f\u3043\u304f\u3093\u306eTwitter\u540d\u3001\u3084\u307e\u306d\u3084\u3093(\uffe3\u25c7\uffe3;)","id":41190649839620096,"from_user_id":166512109,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"228999619","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:39:49 +0000","from_user":"takami926","id_str":"41190644793745408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7530\u539f\u3055\u3093\u3001\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002WEB\u3082TWITTER\u3082\u62dd\u898b\u3057\u3066\u307e\u3059\u3002\u7530\u539f\u3055\u3093\u304c\u653f\u6cbb\u5bb6\u306b\u306a\u3063\u3066\u3001\u65e5\u672c\u3092\u5909\u3048\u3066\u304f\u3060\u3055\u3044\u3002\u5c16\u95a3\u3001\u5317\u65b9\u554f\u984c\u5171\u306b\u65e5\u672c\u306e\u653f\u6cbb\u306e\u5931\u6557\u3067\u3059\u3002\u8a55\u8ad6\u5bb6\u306f\u8272\u3005\u8a00\u3063\u3066\u307e\u3059\u304c\u3001\u4e2d\u6771\u307b\u3069\u56fd\u6c11\u306e\u71b1\u6c17\u304c\u7121\u304f\u3001\u683c\u5dee\u304c\u3042\u308a\u3001\u4f55\u3082\u5909\u308f\u3089\u306a\u3044\u666f\u6c17\u4f4e\u8ff7\u306e\u65e5\u672c\u306b\u56fd\u6c11\u306f\u8ae6\u3081\u3066\u308b\u3093\u3067\u3059\u3002","id":41190644793745408,"from_user_id":228999619,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"151773701","profile_image_url":"http://a0.twimg.com/profile_images/1213699753/obi_nao_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:44 +0000","from_user":"obi_nao","id_str":"41190622949941248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3060\u3044\u3076\u5e74\u4e0b\u306e\u5f8c\u8f29\u306b\u3001\u30d3\u30b8\u30cd\u30b9\u3084\u308b\u306a\u3089\u771f\u5263\u306bTwitter\u3084\u308c\uff01\u3063\u3066\u6012\u3089\u308c\u305f\u3002\u306a\u306e\u3067\u4eca\u65e5\u304b\u3089\u771f\u5263\u306b\u3064\u3076\u3084\u304f\u3053\u3068\u306b\u3057\u307e\u3059\u3002\u3088\u308d\u3057\u304f\u3067\u3059\u3002","id":41190622949941248,"from_user_id":151773701,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"20817229","profile_image_url":"http://a0.twimg.com/profile_images/1212012721/205_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"allte","id_str":"41190619804082176","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7206\u7b11\u3057\u3066\u547c\u5438\u56f0\u96e3\u3067\u75d9\u6523\u3059\u308b\u5618\u304f\u3093\u304c\u898b\u308c\u308b\u306e\u306fTwitter\u3060\u3051","id":41190619804082176,"from_user_id":20817229,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"166907967","profile_image_url":"http://a2.twimg.com/profile_images/1250526230/___normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"NTTYAHOOOOOOOI","id_str":"41190618235412480","metadata":{"result_type":"recent"},"to_user_id":106469594,"text":"@takahirororo \u3066\u304b\u4f55\u3067twitter\u4e0a\u3067\u30a2\u30c9\u30d0\u30a4\u30b9\u3082\u3089\u3063\u3066\u3093\u306d\u3093\uff57","id":41190618235412480,"from_user_id":166907967,"to_user":"takahirororo","geo":null,"iso_language_code":"ja","to_user_id_str":"106469594","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"82581287","profile_image_url":"http://a0.twimg.com/profile_images/774721566/miyaru2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:38 +0000","from_user":"kine_rahchaos","id_str":"41190598132244480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093\u304cTwitter\u59cb\u3081\u305f\u3060\u3068\u2026","id":41190598132244480,"from_user_id":82581287,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"136633905","profile_image_url":"http://a2.twimg.com/profile_images/1247161991/yama_normal.png","created_at":"Fri, 25 Feb 2011 17:39:35 +0000","from_user":"yamachi39","id_str":"41190584706285568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3084\u3063\u3071\u308amixi\u3088\u308atwitter\u306e\u304c\u597d\u304d\u304b\u3082","id":41190584706285568,"from_user_id":136633905,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://jigtwi.jp/?p=1" rel="nofollow">jigtwi</a>"},{"from_user_id_str":"44029295","profile_image_url":"http://a2.twimg.com/profile_images/1112965522/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:32 +0000","from_user":"no2yosee","id_str":"41190572769280000","metadata":{"result_type":"recent"},"to_user_id":97721124,"text":"@hn0345 \u3042\u3001\u500b\u4eba\u7684\u306b\u306f\u4eca\u306ftwitter\u306e\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u306b\u66f8\u3044\u3066\u3042\u308b\u30d6\u30ed\u30b0\u306e\u30e6\u30cb\u30c3\u30c8\u3092\u306e\u3093\u3073\u308a\u3084\u3063\u3066\u307e\u3059w","id":41190572769280000,"from_user_id":44029295,"to_user":"hn0345","geo":null,"iso_language_code":"ja","to_user_id_str":"97721124","source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"149872179","profile_image_url":"http://a0.twimg.com/profile_images/1145770150/Winter11_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:31 +0000","from_user":"xmyyyxx","id_str":"41190566951653376","metadata":{"result_type":"recent"},"to_user_id":95069405,"text":"@rindofu \u653b\u7565\u672c\u3042\u308c\u3070\u3044\u3044\u306e\u306b\u3063\u3066\u601d\u3044\u307e\u3059(T\u03c9T)/~~~ \u79c1\u3082\u76f4\u3057\u305f\u3044\u3068\u3053\u3044\u3063\u3071\u3044\u3060\u3051\u3069\u3001\u3042\u306860\u5e74\u304f\u3089\u3044\u3044\u304d\u3089\u308c\u308b\u306f\u305a\u3060\u3057\u3001\u306e\u3093\u3073\u308a\u76f4\u308c\u3070\u3044\u3044\u306a\u3042 \u304a\u3084\u3059\u307f\u3067\u3059^^\uff01\u308a\u3093\u3055\u3093\u3068twitter\u3067\u4ef2\u826f\u304f\u306a\u308c\u3066\u3088\u304b\u3063\u305f\u3067\u3059\u3063","id":41190566951653376,"from_user_id":149872179,"to_user":"rindofu","geo":null,"iso_language_code":"ja","to_user_id_str":"95069405","source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"105579892","profile_image_url":"http://a0.twimg.com/profile_images/1212950455/love_happy_pink_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"love_happy_pink","id_str":"41190566494601216","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u308c\u898b\u305f\u3044\u306a\u266aRT @kazukt \u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41190566494601216,"from_user_id":105579892,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.nibirutech.com/" rel="nofollow">TwitBird iPad</a>"},{"from_user_id_str":"16996368","profile_image_url":"http://a0.twimg.com/profile_images/1198892387/pochi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"HyoYoshikawa","id_str":"41190564187611136","metadata":{"result_type":"recent"},"to_user_id":1800565,"text":"@shinichiro_beck \u73fe\u5730\u304b\u3089\u306a\u3089\u826f\u304f\u3066\u4ed6\u306e\u5730\u57df\u304b\u3089\u3060\u4f59\u8a08\u306a\u3089\u3001\u4f55\u306e\u305f\u3081\u306bTwitter\u304c\u3042\u308b\u306e\u304b\u308f\u304b\u3089\u306a\u3044\u3088\u3002\u3044\u307e\u8d77\u304d\u3066\u308b\u3053\u3068\u306e\u8aac\u660e\u3082\u3064\u304b\u306a\u3044\u3002\u30a2\u30eb\u30b8\u30e3\u30b8\u30fc\u30e9\u304c\u4f1d\u3048\u3066\u308b\u3053\u3068\u304c\u5168\u3066\u3058\u3083\u306a\u3044\u3057\u3001\u65e5\u672c\u306eTV\u306f\u4f1d\u3048\u306a\u3044\u3067\u3057\u3087\u3046\u3002\u77e5\u308a\u305f\u304c\u3063\u3066\u308b\u4eba\u3082\u305f\u304f\u3055\u3093\u3044\u308b\u3002","id":41190564187611136,"from_user_id":16996368,"to_user":"shinichiro_beck","geo":null,"iso_language_code":"ja","to_user_id_str":"1800565","source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"119070802","profile_image_url":"http://a2.twimg.com/profile_images/1229773005/346d8435099798113a1326e1ba4949ee_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:39:25 +0000","from_user":"takotako726","id_str":"41190545439207424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5\u5c11\u5973\u307e\u3069\u304b\u30de\u30ae\u30ab\u306e\u53cd\u97ff\u304ctwitter\u3067\u306f\u3093\u3071\u306d\u3048\u4ef6\u3002","id":41190545439207424,"from_user_id":119070802,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"165695316","profile_image_url":"http://a1.twimg.com/profile_images/681748782/ring_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:21 +0000","from_user":"pandora_shotbar","id_str":"41190526447390720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u2026\uff5chttp://pandora-twitter.seesaa.net/article/187809936.html","id":41190526447390720,"from_user_id":165695316,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.seesaa.jp/" rel="nofollow">SeesaaBlog</a>"},{"from_user_id_str":"88862311","profile_image_url":"http://a2.twimg.com/profile_images/1182243698/161113_100001897885617_169366_q_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:16 +0000","from_user":"amebaguide","id_str":"41190504926416896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30a2\u30e1\u30d6\u30ed\u653b\u7565\u30ac\u30a4\u30c9\u306e\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30d6\u30ed\u30b0\u306e\u653b\u7565\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u96c6\uff5chttp://accessup-twitter.seesaa.net/article/187809931.html","id":41190504926416896,"from_user_id":88862311,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.seesaa.jp/" rel="nofollow">SeesaaBlog</a>"},{"from_user_id_str":"186895007","profile_image_url":"http://a2.twimg.com/profile_images/1229610799/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:11 +0000","from_user":"zizikt","id_str":"41190486123356161","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u308c\u306f\u500b\u4eba\u7684\u306b\u306f\u91cd\u5b9d\u3067\u3059\u3002\n\u25c6iPhone&iPad\u5411\u3051Twitter\u30a2\u30d7\u30ea\u300c\u3064\u3044\u3063\u3077\u308b\u300d\u306bEvernote\u3068\u306e\u9023\u643a\u6a5f\u80fd\u3092\u8ffd\u52a0 \nhttp://bit.ly/hPf44u","id":41190486123356161,"from_user_id":186895007,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"132320738","profile_image_url":"http://a3.twimg.com/profile_images/1229760475/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:04 +0000","from_user":"faina_","id_str":"41190453592334336","metadata":{"result_type":"recent"},"to_user_id":167894537,"text":"@gjmorley \u30e2\u30fc\u30ea\u30fc\u3055\u3093\u306e\u7ffb\u8a33\u306e\u8a00\u8449\u306e\u30bb\u30f3\u30b9\u304c\u3059\u304d\u3067\u3059\u3002\u305d\u3057\u3066\u3001Twitter\u3067\u77e5\u308b\u3001\u73fe\u5730\u306e\u4eba\u306e\u76ee\u306e\u529b\u3084\u3001\u60c5\u5831\u3092\u4f1d\u3048\u3066\u304f\u308c\u308b\u7686\u3055\u3093\u306e\u60c5\u71b1\u306b\u611f\u52d5\u3057\u3066\u3044\u307e\u3059\u3002\u611f\u52d5\u3059\u308b\u3063\u3066\u3059\u3054\u3044\u30a8\u30cd\u30eb\u30ae\u30fc\u3067\u3059\uff01\uff01","id":41190453592334336,"from_user_id":132320738,"to_user":"gjmorley","geo":null,"iso_language_code":"ja","to_user_id_str":"167894537","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"24870552","profile_image_url":"http://a3.twimg.com/profile_images/907130634/4_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:03 +0000","from_user":"tana1192","id_str":"41190450480021504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u500b\u4eba\u7684\u306b\u306f\u3001\u30bf\u30b0\u5f3e\u304d\u3059\u308c\u3070\u3044\u3044\uff08\u5f3e\u3051\u308b\u30c4\u30fc\u30eb\u3092\u4f7f\u3063\u3066Twitter\u3092\u3059\u308c\u3070\u3044\u3044\uff09\u3068\u601d\u3046\u3093\u3060\u3051\u3069\u306a\u3042\u3002\u307f\u3093\u306a\u305d\u308c\u306a\u308a\u306bTwitter\u3084\u308b\u4eba\u3060\u3057\u3001\u30c4\u30fc\u30eb\u9078\u3073\u304f\u3089\u3044\u5e45\u3092\u6301\u3063\u3066\u3084\u3063\u3066\u3082\u3002 \u307e\u3042\u3001\u4ffa\u30a2\u30cb\u30e1\u306f\u89b3\u308b\u89b3\u308b\u8a50\u6b3a\u3059\u308b\u3060\u3051\u306e\u4eba\u3060\u304b\u3089\u95a2\u4fc2\u306a\u3044\u3093\u3060\u3051\u3069\u3082\uff57\uff57\u5b9f\u6cc1\u306f\u697d\u3057\u305d\u3046\u306b\u898b\u3048\u308b\u3088\u3002","id":41190450480021504,"from_user_id":24870552,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"58509646","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Fri, 25 Feb 2011 17:39:02 +0000","from_user":"kakuyas","id_str":"41190446663344128","metadata":{"result_type":"recent"},"to_user_id":107076877,"text":"@Dayspool \u6df1\u591c\uff12\uff19\u6642\u304f\u3089\u3044\u307e\u3067\u306f\u6bce\u65e5\u55b6\u696d\u3057\u3066\u308b\u306e\u3067\u3001twitter\u3001\u30e1\u30c3\u30bb\u3001PS3\u306a\u3069\u3067\u3088\u3093\u3067\u3051\u308c\u3002\u3053\u3063\u3061\u304b\u3089\u58f0\u304b\u3051\u308b\u3053\u3068\u3082\u3042\u308b\u304b\u3082\u3060\u304c\uff57","id":41190446663344128,"from_user_id":58509646,"to_user":"Dayspool","geo":null,"iso_language_code":"ja","to_user_id_str":"107076877","source":"<a href="http://cheebow.info/chemt/archives/2007/04/twitterwindowst.html" rel="nofollow">Twit for Windows</a>"},{"from_user_id_str":"149128527","profile_image_url":"http://a2.twimg.com/profile_images/1254922702/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:00 +0000","from_user":"uni13yoki","id_str":"41190437087748096","metadata":{"result_type":"recent"},"to_user_id":119468594,"text":"@kuro_wr84 \u304a\u308c\u3068\u304a\u524d\u3067Twitter\u3067\u4f1a\u8a71\u3057\u305f\u3089\u3001\u5927\u5909\u306a\u3053\u3068\u306b\u306a\u308b\u306a","id":41190437087748096,"from_user_id":149128527,"to_user":"kuro_wr84","geo":null,"iso_language_code":"ja","to_user_id_str":"119468594","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"18670595","profile_image_url":"http://a2.twimg.com/profile_images/1250674062/ProfilePhoto_normal.png","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"nyuuuuun","id_str":"41190436450222080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3078\u30fc\u3053\u3093\u306a\u306b\u3088\u304f\u4f3c\u308b\u3053\u3068\u3082\u3042\u308b\u3093\u3060\u30fc\nhttp://twitter.com/Re_44/status/35943233016168448\nhttp://twitter.com/3510_misaka/status/36122114821988352","id":41190436450222080,"from_user_id":18670595,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"96267603","profile_image_url":"http://a3.twimg.com/profile_images/1245253473/DSiLL3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"arivis","id_str":"41190433119940608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://twitter.com/#!/arivis/status/40636755380142080 \u306a\u3093\u3064\u3046\u304b\u3053\u308c\u3067\u8d64\u3063\u3066\u306e\u3082\u3061\u3087\u3063\u3068\u3042\u308c\u3063\u3059\u306d\u3002\u305d\u3057\u3066\u4e88\u671f\u3057\u3066\u3044\u305f\u304b\u306e\u3088\u3046\u3060","id":41190433119940608,"from_user_id":96267603,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"148097776","profile_image_url":"http://a3.twimg.com/profile_images/1166904064/broken-heart_normal.png","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"ReajuBreaker_A","id_str":"41190422135058432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u672c\u57a2\u30d5\u30a9\u30ed\u30fc\u3088\u308d\u3057\u304f\u3067\u3059\u2192 http://twitter.com/ReajuBreaker \uff08\uff20\u3060\u3068\u30ea\u30d7\u30e9\u30a4\u304c\u57cb\u307e\u308b\u305f\u3081\u3001URL\u306b\u3057\u3066\u3042\u308a\u307e\u3059\uff09","id":41190422135058432,"from_user_id":148097776,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.twitter.com/ReajuBreaker" rel="nofollow">\u73fe\u5145\u6bba\u3057\u306e\u7121\u4eba\u9023\u545f\uff1c\u30aa\u30fc\u30c8\u30c4\u30a4\u30fc\u30c8\uff1e</a>"},{"from_user_id_str":"59711654","profile_image_url":"http://a2.twimg.com/profile_images/416212928/flowers-06-1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"agamo45","id_str":"41190421522546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41190421522546688,"from_user_id":59711654,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"145311373","profile_image_url":"http://a3.twimg.com/profile_images/1187802576/a_gam_02_normal.png","created_at":"Fri, 25 Feb 2011 17:38:55 +0000","from_user":"nogic1008","id_str":"41190418141937664","metadata":{"result_type":"recent"},"to_user_id":88117317,"text":"@runasoru \u307e\u3042\u5acc\u306a\u3089\u6df1\u591c\u5e2f\u306bTwitter\u898b\u306a\u304d\u3083\u3044\u3044\u3060\u3051\u3067\u3059\u304b\u3089\u306d\u30fc \u30103/19BDM\u30aa\u30d5http://twvt.us/bdoff_kansai\u3011","id":41190418141937664,"from_user_id":145311373,"to_user":"runasoru","geo":null,"iso_language_code":"ja","to_user_id_str":"88117317","source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"195851300","profile_image_url":"http://a2.twimg.com/profile_images/1124572815/be7b4c0a06cb60e8_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:49 +0000","from_user":"LoveLAscrewDoll","id_str":"41190391147540480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @jp_mjp: SCREW TV SHOW Vol.6\u306e\u653e\u9001\u304c\u7121\u4e8b\u306b\u7d42\u4e86\u3044\u305f\u3057\u307e\u3057\u305f\u3002\u3054\u89a7\u9802\u304d\u3042\u308a\u304c\u3068\u3046\u3054\u3056\u3044\u307e\u3057\u305f\uff01\u6b21\u56de\u653e\u9001\u306f3\u670818\u65e5(\u91d1)\u3067\u3059\u3002\u8996\u8074\u8005\u30d7\u30ec\u30bc\u30f3\u30c8\u306e\u8a73\u7d30\u306f\u5f8c\u65e5MJP\u3067\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u3002\u305d\u306e\u969b\u306b\u306f\u3001\u3053\u306eTwitter\u3067\u3082\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u306e\u3067\u3001\u304a\u697d\u3057\u307f\u306b\uff01#SCREWTV","id":41190391147540480,"from_user_id":195851300,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"ChuriSta_gt","id_str":"41190389549510656","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u3053\u4e00\u9031\u9593Twitter\u304c\u3084\u305f\u3089\u697d\u3057\u3044\u306e\u3067\u3059\u3051\u3069\u30fc\u30fc\u30fc\uff01\u306b\u3072\u3072\u3063\u7b11","id":41190389549510656,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"50592111","profile_image_url":"http://a0.twimg.com/profile_images/1252176582/lFjpi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"crowNeko","id_str":"41190387271864320","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a8\u30ed\u30b2\u30d7\u30ec\u30a4\u3057\u306a\u304c\u3089\u307e\u3069\u30de\u30aeTL\u3092\u898b\u306a\u3044\u3088\u3046\u306b\u534a\u76ee\u306b\u306a\u308a\u306a\u304c\u3089Twitter\u3057\u3066\u308b\u6df1\u591c2\u6642\u534a\u3002","id":41190387271864320,"from_user_id":50592111,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://stone.com/Twittelator" rel="nofollow">Twittelator</a>"},{"from_user_id_str":"7141467","profile_image_url":"http://a3.twimg.com/profile_images/1198540741/icon12912579345276_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:40 +0000","from_user":"hina_geshi","id_str":"41190355961380864","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7d50\u5c40\u30cd\u30bf\u30d0\u30ec\u3059\u3093\u306a\u3063\u3066\u8a00\u3046\u65b9\u304c\u30a2\u30ec\u3060\u3088\u306d\u3001\u3057\u306a\u3044\u308f\u3051\u7121\u3044\u3058\u3083\u306a\u3044\u8133\u5185\u5782\u308c\u6d41\u3057\u304cTwitter\u306a\u3093\u3060\u304b\u3089\u3055","id":41190355961380864,"from_user_id":7141467,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"},{"from_user_id_str":"149608984","profile_image_url":"http://a0.twimg.com/profile_images/1205950885/090702_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"Mr_Tsubaki","id_str":"41190349447774208","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3069\u304b\u306fTwitter\u5408\u308f\u305b\u3066\uff11\u6642\u9593\u306f\u697d\u3057\u3044","id":41190349447774208,"from_user_id":149608984,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"122271550","profile_image_url":"http://a0.twimg.com/profile_images/961936499/neoneko_bot5jpg_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"neoneko_bot5","id_str":"41190348726345728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30c6\u30b9\u30c8\uff1a23\u3011\u4eca\u65e5\u304b\u3089\u5ba3\u4f1d\u958b\u59cb\u2606\u306d\u304a\u306d\u3053\u306eTwitter \u3067 EasyBottex\u3000\u3067\u304d\u308b\u307e\u3067\uff01\u2192http://neoneko.blog31.fc2.com/","id":41190348726345728,"from_user_id":122271550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www20.atpages.jp/neoneko/" rel="nofollow">neoneko_bot5</a>"},{"from_user_id_str":"127069188","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:38:37 +0000","from_user":"MYCHEBOT","id_str":"41190340908163074","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30eb\u30d5\u3055\u3093\u304c\u914d\u4fe1\u3092\u7d42\u4e86\u3057\u307e\u3057\u305f\uff01/ http://777labo.com/mychecker/view/745.php / \u30c8\u30d4\u30c3\u30af:XSplit\u30c6\u30b9\u30c8\u3000twitter\u2192http://twitter.com/rukh01","id":41190340908163074,"from_user_id":127069188,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://777labo.com/mychecker/" rel="nofollow">MYCHEBOT</a>"},{"from_user_id_str":"107626142","profile_image_url":"http://a1.twimg.com/profile_images/1104968421/SuperMaika1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:34 +0000","from_user":"MaikaPaPa","id_str":"41190328614666240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"75\u5e74\u524d\u306e\u4eca\u65e52\u670826\u65e5\u672a\u660e\u3001\u82e5\u304d\u9752\u5e74\u5c06\u6821\u3089\u304c\u653f\u6cbb\u8150\u6557\u3068\u8fb2\u6751\u306e\u56f0\u7aae\u306b\u5bfe\u3057\u3066\u6c7a\u8d77\u3057\u307e\u3057\u305f\u3002\u3082\u3061\u308d\u3093\u5f53\u6642\u306fTwitter\u3082FB\u3082\u3001\u307e\u305f\u5f53\u7136\u306a\u304c\u3089Internet\u3082\u3042\u308a\u307e\u305b\u3093\u3067\u3057\u305f\u3002\u4e00\u65b9\u3001\u30c1\u30e5\u30cb\u30b8\u30a2\u3001\u30a8\u30b8\u30d7\u30c8\u3001\u4e2d\u6771\u306b\u5e83\u304c\u308b\u53cd\u653f\u5e9c\u30c7\u30e2\u3068\u5f37\u6a29\u4f53\u5236\u306e\u5d29\u58ca\u3002\u73fe\u5728\u306e\u65e5\u672c\u3067\u306f\u8003\u3048\u3089\u308c\u306a\u3044\u3053\u3068\u3067\u3059\u3002","id":41190328614666240,"from_user_id":107626142,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"11111695","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"kumatchipooh","id_str":"41190306145775617","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @inosenaoki: \u306a\u308b\u307b\u3069\u306d\u3002 RT @dansrmz @inosenaoki \u3053\u3061\u3089\u304c\u30bd\u30d5\u30c8\u30d0\u30f3\u30af\u526f\u793e\u9577\u306e\u677e\u672c\u5fb9\u4e09\u3055\u3093\u306e\u3001Twitter\u306b\u95a2\u3059\u308b\u8ad6\u8003\u3067\u3059\u3002 \u25b6 "Twitter\u306e2\u30c1\u30e3\u30f3\u30cd\u30eb\u5316\u306f\u9632\u6b62\u51fa\u6765\u308b\u304b" http://t.co/Mwzb8Zf","id":41190306145775617,"from_user_id":11111695,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"212161909","profile_image_url":"http://a1.twimg.com/profile_images/1252895790/natm01_normal.gif","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"n34hitman","id_str":"41190303830511616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u30fb\u30d6\u30ed\u30b0\u30a2\u30d5\u30a3\u30ea\u30a8\u30a4\u30c8\u81ea\u52d5\u6295.... http://goo.gl/a4RHB 4054","id":41190303830511616,"from_user_id":212161909,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twibow.net/" rel="nofollow">Twibow</a>"},{"from_user_id_str":"105945593","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:38:24 +0000","from_user":"nakano_bot","id_str":"41190285710983168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u306ebot\u306f\u4e0d\u52d5\u7523\u4f1a\u793e\u69d8\u5411\u3051\u306e\u4e0d\u52d5\u7523\u30dd\u30fc\u30bf\u30eb\u30b5\u30a4\u30c8\u3078\u306e\u4e00\u62ec\u8ee2\u9001\uff0bTwitter\u7121\u6599\u8ee2\u9001\u30b5\u30fc\u30d3\u30b9\u306b\u3088\u308a\u3064\u3076\u3084\u304d\u307e\u3059\u3002\u3054\u5229\u7528\u306b\u306a\u308a\u305f\u3044\u5834\u5408\u306f http://bit.ly/demey0 \u306b\u304a\u6c17\u8efd\u306b\u304a\u554f\u3044\u5408\u308f\u305b\u4e0b\u3055\u3044\u3002","id":41190285710983168,"from_user_id":105945593,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.teramax.jp/aboutus.html" rel="nofollow">tmxbot</a>"},{"from_user_id_str":"170904226","profile_image_url":"http://a2.twimg.com/profile_images/1249020397/1789kb_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:21 +0000","from_user":"1789kb","id_str":"41190274428305408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3068\u308a\u3042\u3048\u305a\u4eca\u56de\u521d\u3081\u3066\u30ea\u30a2\u30eb\u30bf\u30a4\u30e0\u3067\u898b\u3066\u308f\u304b\u3063\u305f\u306e\u306f\u3001QB\u306f\u5168\u8eab\u304c\u30a2\u30f3\u30d1\u30f3\u30bf\u30a4\u30d7\u3060\u3068\u3044\u3046\u3053\u3068\u3068\u3001\u307e\u3069\u30de\u30ae\u7d42\u4e86\u5f8c\u306eTwitter\u306e\u3056\u308f\u3064\u304d\u304c\u3059\u3054\u3044\u3068\u3044\u3046\u3053\u3068","id":41190274428305408,"from_user_id":170904226,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"166169644","profile_image_url":"http://a1.twimg.com/profile_images/1217017679/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:18 +0000","from_user":"Okkkkkkkkkkun","id_str":"41190262420017152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3063\u3066Twitter\u3067\u3064\u3076\u3084\u304f\u81ea\u5206\u3082\u76f8\u5f53\u5c0f\u3055\u3044\u306a\u3002","id":41190262420017152,"from_user_id":166169644,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"196623456","profile_image_url":"http://a3.twimg.com/profile_images/1219076661/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:06 +0000","from_user":"NoMoneyClub","id_str":"41190213342601216","metadata":{"result_type":"recent"},"to_user_id":195462431,"text":"@yosal15 \nTwitter\u3084\u3063\u3066\u308b\u3089\u3057\u3044\u3002\u3051\u3069\u3001\u898b\u3064\u304b\u3089\u306a\u3044\u3002","id":41190213342601216,"from_user_id":196623456,"to_user":"yosal15","geo":null,"iso_language_code":"ja","to_user_id_str":"195462431","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"126984048","profile_image_url":"http://a3.twimg.com/profile_images/1254579571/zipyaru-20090829-23-0012_normal.png","created_at":"Fri, 25 Feb 2011 17:38:02 +0000","from_user":"minaduki_naduki","id_str":"41190196418584576","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u203b\u30e1\u30fc\u30eb\u3067\u5973\u306e\u5b50\u53e3\u8aac\u304f\u306e\u306b\u5fd9\u3057\u3044\u3093\u3060\u305d\u3046\u3067\u3059\u3000\u307e\u3058\u3058\u3054\u308d RT @yowano_k: \u5fd9\u3057\u304f\u3066\u3082Twitter\u306b\u9854\u3092\u51fa\u3057\u305f\u304f\u306a\u308b\u50d5\u30a7\u2026\u2026","id":41190196418584576,"from_user_id":126984048,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://seesmic.com/seesmic_desktop/sd2" rel="nofollow">Seesmic Desktop</a>"},{"from_user_id_str":"200568705","profile_image_url":"http://a3.twimg.com/profile_images/1242179765/101230_1355_01_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:01 +0000","from_user":"hammerstrap","id_str":"41190190428979200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6628\u65e5\u91d1\u66dc\u65e5\u306f\u732e\u8840\u306b\u5f80\u304f\u3002\u4eca\u306e\u50d5\u306e\u4eba\u9593\u3068\u3057\u3066\u306e\u4fa1\u5024\u306f\u3001\u7cbe\u3005\u3053\u306e\u7a0b\u5ea6\u3002\u8179\u304c\u6e1b\u3063\u305f\u3002\u5374\u8aac\u3002twitter\u306e\u767e\u56db\u5341\u6587\u5b57\u306b\u82db\u3005\u3068\u3057\u3066\u3001\u4e00\u3064\u306e\u4eee\u8aac\u306b\u4fe1\u6191\u6027\u3092\u5f97\u308b\u3002\u6226\u6642\u4e0b\u306e\u7d19\u306e\u7d71\u5236\u3068\u3001\u4e2d\u5cf6\u6566\u306e\u6587\u7ae0\u306e\u95a2\u4fc2\u6027\u3002\u73fe\u5728\u30a6\u30a7\u30d6\u30ed\u30b0\u306b\u3001\u7e8f\u3081\u3066\u3044\u308b\u6700\u4e2d\u3002\u8fd1\u65e5\u516c\u958b\u4e88\u5b9a\u3002","id":41190190428979200,"from_user_id":200568705,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"164970427","profile_image_url":"http://a0.twimg.com/profile_images/1227176662/9192b021ef85ce9902c28955f86e604b_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:59 +0000","from_user":"syuigetsuIT","id_str":"41190184041197569","metadata":{"result_type":"recent"},"to_user_id":141926331,"text":"@iliad_tga \u30a4\u30ea\u30a2\u30b9\u3055\u3093\u304c\u305d\u306e\u8fba\u7406\u89e3\u306e\u3042\u308b\u3053\u3068\u306f\u5206\u304b\u3063\u3066\u307e\u3059\uff57\u3000\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u306ftwitter\u306e\u6c7a\u5b9a\u7684\u306a\u6b20\u70b9\u3060\u3068\u601d\u3044\u307e\u3059\u306d\u3047\u3002","id":41190184041197569,"from_user_id":164970427,"to_user":"iliad_tga","geo":null,"iso_language_code":"ja","to_user_id_str":"141926331","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"94526795","profile_image_url":"http://a0.twimg.com/profile_images/679411954/akb48_in_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:56 +0000","from_user":"akb48_in","id_str":"41190171248431104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"AKB48\u67cf\u6728\u7531\u7d00 \u304a\u75b2\u308c\u69d8\u3002: \n\u3053\u3093\u3070\u3093\u306f(^O^)\uff0f\u266a\n\u3000\n\u3000\n\u3000\n\u4eca\u65e5\u306e\u516c\u6f14\u697d\u3057\u304b\u3063\u305f\u301c\n\u3000\n\u3000\n\u4e45\u3057\u3076\u308a\u3067\u7dca\u5f35\u3057\u305f\u3051\u3069\u3001\u306f\u3058\u3051\u307e\u304f\u3063\u305f\u305c\u3043\uff01\uff01\n\u3000\n\u3000\n\u3000\nMC\u306f\u565b\u307f\u307e\u304f\u308a\u306e\u30c6\u30f3\u30d1\u308a\u307e\u304f... http://bit.ly/ie8bEa akb48 twitter","id":41190171248431104,"from_user_id":94526795,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"222270374","profile_image_url":"http://a3.twimg.com/profile_images/1250946143/P1040062_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:53 +0000","from_user":"chrxpac","id_str":"41190158455943168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671f\u3011Twitter\u306f\uff8a\uff9f\uff7f\uff7a\uff9d\u304b\u3089\u3057\u304b\u3067\u304d\u306a\u3044\u306e\u3067\uff98\uff8c\uff9f\u8fd4\u3057\u304c\u9045\u304f\u306a\u308a\u307e\u3059(\u00b4\u30fb\u03c9\u30fb\uff40)\u3054\u4e86\u627f\u4e0b\u3055\u3044!!","id":41190158455943168,"from_user_id":222270374,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"64009258","profile_image_url":"http://a2.twimg.com/profile_images/1154025023/Mixi___normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:52 +0000","from_user":"Tatsuyuko","id_str":"41190153447944192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4f01\u696d\u304c\u5c31\u6d3b\u751f\u306bFacebook\u3092\u4f7f\u3063\u3066\u7533\u8acb\u305b\u3088\u3068\u3044\u3044\u3001\u4f01\u696d\u304cFacebook\u3092\u4f7f\u3048\u3068\u4f01\u696d\u304c\u8a00\u3063\u3066\u304d\u305f\u308a\u3059\u308c\u3070\u305d\u308c\u3069\u3053\u308d\u3058\u3083\u306a\u3044\u304b\u3068\u3002\u5c11\u306a\u304f\u3068\u3082\u5c31\u6d3b\u3067Twitter\u306e\u8a00\u52d5\u3084\u30d5\u30a9\u30ed\u30ef\u30fc\u3092\u8abf\u67fb\u3059\u308b\u4f01\u696d\u306f\u304b\u306a\u308a\u591a\u3044\u3067\u3059 RT @Isshee: \u4f01\u696d\u3067\u3082\u540c\u3058\u3067\u3057\u3087 RT","id":41190153447944192,"from_user_id":64009258,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"105145175","profile_image_url":"http://static.twitter.com/images/default_profile_normal.png","created_at":"Fri, 25 Feb 2011 17:37:49 +0000","from_user":"snao813","id_str":"41190141703753728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @yumisaiki: \u795e\u69d8\u306f\u672c\u5f53\u306b\u4eba\u9593\u3092\u3059\u3070\u3089\u3057\u3044\u30d0\u30e9\u30f3\u30b9\u3067\u914d\u7f6e\u3057\u3066\u304a\u3089\u308c\u308b\u3002\u795d\u5cf6\u307f\u305f\u3044\u306a\u5c0f\u3055\u3044\u3068\u3053\u308d\u306b\u306a\u3093\u3067\u3053\u3093\u306a\u306b\u7acb\u6d3e\u306a\u4eba\u304c\u305f\u304f\u3055\u3093\u3044\u308b\u3093\u3060\u308d\u3046\u3002\u795e\u69d8\u3042\u308a\u304c\u3068\u3046\u3002\u672c\u5f53\u306b\u3042\u308a\u304c\u3068\u3046\u3002\u4eba\u9593\u3063\u3066\u3059\u3070\u3089\u3057\u3044\u3068\u601d\u3048\u305f\u3002twitter\u3082\u3042\u308a\u304c\u3068\u3046\u3002\u3000#kaminoseki","id":41190141703753728,"from_user_id":105145175,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://seesmic.com/seesmic_desktop/sd2" rel="nofollow">Seesmic Desktop</a>"},{"from_user_id_str":"203667204","profile_image_url":"http://a2.twimg.com/profile_images/1254664000/eve_blackcat_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:46 +0000","from_user":"eve_blackcat","id_str":"41190129292943361","metadata":{"result_type":"recent"},"to_user_id":146894340,"text":"@kuroiso02 \u3057\u308a\u3068\u308a\u3068\u304b\uff1f\n\u2026\u3067\u3082Twitter\u3060\u3068\u7d42\u308f\u3089\u306a\u304f\u306a\u308b\u30b1\u30c9\u2026","id":41190129292943361,"from_user_id":203667204,"to_user":"kuroiso02","geo":null,"iso_language_code":"ja","to_user_id_str":"146894340","source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"6528403","profile_image_url":"http://a0.twimg.com/profile_images/1240591244/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:45 +0000","from_user":"sortiee","id_str":"41190125924917248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30cb\u30e1\u5b9f\u6cc1\u306ftwitter\u306e\u764c","id":41190125924917248,"from_user_id":6528403,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/peraperaprv/Home" rel="nofollow">P3:PeraPeraPrv</a>"},{"from_user_id_str":"186058304","profile_image_url":"http://a0.twimg.com/profile_images/1250454564/IMG_0210_normal.JPG","created_at":"Fri, 25 Feb 2011 17:37:37 +0000","from_user":"00o8o00","id_str":"41190090386448384","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190090386448384,"from_user_id":186058304,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49219631","profile_image_url":"http://a2.twimg.com/profile_images/1231873117/__2-colornow__2__normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:33 +0000","from_user":"irisgazer","id_str":"41190073227550720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3059\u3088\u306d\u3047 RT @minamitaiheiyou: \u6545\u306b\u30cd\u30bf\u30d0\u30ec\u3092\u3059\u308b\u306e\u3082\u81ea\u7531\u3002\u30cd\u30bf\u3070\u308c\u3057\u305f\u4eba\u3092\u30c7\u30a3\u30b9\u308b\u306e\u3082\u81ea\u7531\u3002\u3042\u3068\u306f\u5404\u3005\u306e\u88c1\u91cf\u3067\u4e57\u308a\u5207\u3063\u3066\u304f\u3060\u3055\u3044\u3088\u3081\u3093\u3069\u304f\u3055\u3044\u306a RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41190073227550720,"from_user_id":49219631,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"98560114","profile_image_url":"http://a0.twimg.com/profile_images/1252332545/IMGP8170_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:32 +0000","from_user":"qess0093","id_str":"41190070706905088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30b7\u30e5\u30fc\u30c6\u30a3\u304f\u305d\u3046\u305c\u3048\uff57 RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41190070706905088,"from_user_id":98560114,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:37:31 +0000","from_user":"SyokoShiratori","id_str":"41190064243478528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.50kg \u540c\u3058\u304f\u30c0\u30a4\u30a8\u30c3\u30c8\u4e2d\u3067\u3059\u3002\u3088\u304f\u3053\u306e\u30b5\u30a4\u30c8\u3067\u4f53\u91cd\u5831\u544a\u3057\u3066\u307e\u3059\u266a http://bit.ly/fhN2fM RT @msophiah \u3046\u3046\u3046\u30fb\u30fb\u30fb\u304a\u8179\u3059\u3044\u305f\u301c\u30fb\u30fb\u30fb\u6211\u6162\u3001\u6211\u6162\u3001\u6211\u6162\u3002\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3002","id":41190064243478528,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mob-mc.com" rel="nofollow">\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick</a>"},{"from_user_id_str":"180410237","profile_image_url":"http://a3.twimg.com/profile_images/1254473979/icon_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:30 +0000","from_user":"ka_ph","id_str":"41190062184079360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671fpost\u3011\u30d5\u30a7\u30eb\u30c7\u30a3\u30ca\u30f3\u30c8bot( http://twitter.com/ferdinand_bot )\u4f5c\u308a\u307e\u3057\u305f\u3002\u304a\u5b50\u69d8\u306e\u540d\u524d\u304a\u501f\u308a\u3055\u305b\u3066\u304f\u308c\u308b\u65b9\u3044\u307e\u3057\u305f\u3089@ka_ph\u307e\u3067\u304a\u9858\u3044\u3057\u307e\u3059\u3002","id":41190062184079360,"from_user_id":180410237,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"52283906","profile_image_url":"http://a3.twimg.com/profile_images/387644016/10100654519_s_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"rolling_bean","id_str":"41190043313913856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3081\u307e\u3044\u304c\u3057\u307e\u3059\u306d\u301cRT @yurikalin:\u30b3\u30a4\u30c4\u30e9\u5168\u54e1\u3044\u306a\u304f\u306a\u3063\u305f\u3089\u3001\u660e\u308b\u304f\u306a\u308b\u3060\u308d\u3046\u306a\u3041\uff5e\u266a\uff1e\u65e5\u672c\u306e\u30d3\u30b8\u30e7\u30f3 RT roll \u65e5\u7d4c\uff06CSIS\u30b7\u30f3\u30dd\u30b8\u30a6\u30e0\u300c\u5b89\u4fdd\u6539\u5b9a50\u5468\u5e74\u3001\u3069\u3046\u306a\u308b\u65e5\u7c73\u95a2\u4fc2\u300d http://bit.ly/dES8PY\u3000http://bit.ly/ihg0GT","id":41190043313913856,"from_user_id":52283906,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tabtter.jp" rel="nofollow">\u30bf\u30d6\u30c3\u30bf\u30fc</a>"},{"from_user_id_str":"351896","profile_image_url":"http://a3.twimg.com/profile_images/1179865336/icon12911887173020_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"cicada","id_str":"41190043292925952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4e2d\u5b66\u53d7\u9a13\u7a0b\u5ea6\u306e\u7b97\u6570\u306e\u554f\u984c\u3092\u51fa\u3059BOT http://twitter.com/arithmetic_bot \u6c17\u306b\u306f\u306a\u308b\u304c\u3001\u3061\u3083\u3093\u3068\u898b\u308b\u65e5\u304c\u6765\u308b\u3060\u308d\u3046\u304b\u30fb\u30fb\u3000#tearai\uff1a\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c http://locolabo.com/mz/ #mzlf","id":41190043292925952,"from_user_id":351896,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://locolabo.com/mz/" rel="nofollow">\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c</a>"},{"from_user_id_str":"744554","profile_image_url":"http://a1.twimg.com/profile_images/1088753125/11868894_normal.gif","created_at":"Fri, 25 Feb 2011 17:37:20 +0000","from_user":"Febreze","id_str":"41190019020505088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u3042\u307e\u308a\u6c17\u306b\u3057\u306a\u3044\u30bf\u30a4\u30d7\u3060\u3051\u3069\u306a\u3093\u304b\u3053\u3046Twitter\u958b\u304f\u3060\u3051\u3067\u30ac\u30f3\u30ac\u30f3\u30cd\u30bf\u30d0\u30ec\u5165\u3063\u3066\u304f\u308b\u306e\u306f\u306a\u3093\u3068\u3082\u8a00\u3048\u306a\u3044\u306a\u3002","id":41190019020505088,"from_user_id":744554,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"203371794","profile_image_url":"http://a1.twimg.com/profile_images/1226537594/___normal.png","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"himeko24","id_str":"41190004139114496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b21\u3044\u3063\u3066\u307f\u3088\u30fc\u3000\u306f\u3044\u3053\u308c\u3000 \u6fc0\u5b89\u26052010\u5e74\u590f\u65b0\u30c7\u30b6\u30a4\u30f3\u2605\u30bb\u30af\u30b7\u30fc\u306a\u9023\u4f53\u5f0f\u7121\u5730\u6c34\u7740 \u80f8\u30d1\u30c3\u30c9\u4ed8\u304dQ122 http://bit.ly/h72C4i","id":41190004139114496,"from_user_id":203371794,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.google.co.jp" rel="nofollow">himeko24</a>"},{"from_user_id_str":"119988932","profile_image_url":"http://a3.twimg.com/profile_images/1214344633/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"7na_love_6sa","id_str":"41190002000007169","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0\u3057\u307e\u3057\u305f\uff01Twitter\uff06mixi\u304b\u3089\u3082\u30b3\u30e1\u30f3\u30c8\u5b9c\u3057\u304f\u306d\u266a\n\u300c\u30cd\u30a4\u30eb\u30c1\u30a7\u30f3\u30b8\u266a\u300d http://amba.to/hy0Do2","id":41190002000007169,"from_user_id":119988932,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"217408835","profile_image_url":"http://a1.twimg.com/profile_images/1215428655/____4.0157_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"nikubenki1123","id_str":"41189985424125952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f"\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044"\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f"\u80cc\u8ca0\u3048"\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189985424125952,"from_user_id":217408835,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tweetlogix.com" rel="nofollow">Tweetlogix</a>"},{"from_user_id_str":"139137996","profile_image_url":"http://a0.twimg.com/profile_images/1087408006/cut_work_18_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"fujiokayouko","id_str":"41189984354566144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u591c\u4e2d\u306bTwitter\u3092\u306a\u3093\u3068\u306a\u304f\u8997\u3044\u305f\u3089\u3082\u306e\u3059\u3054\u3044\u307e\u3069\u30de\u30aeTL\u3067","id":41189984354566144,"from_user_id":139137996,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Mobile Web</a>"},{"from_user_id_str":"61221002","profile_image_url":"http://a3.twimg.com/profile_images/554916301/_1259757374_61_normal.png","created_at":"Fri, 25 Feb 2011 17:37:08 +0000","from_user":"hiromk63","id_str":"41189970613903360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kenji_kohashi \u7121\u4e8b\u6620\u753b\u88fd\u4f5c\u306e\u5831\u544a\u306f\u3067\u304d\u305f\u3051\u3069\u4eca\u3060\u7de8\u96c6\u306f\u7d9a\u3044\u3066\u307e\u3059w \u305d\u3093\u306a\u3068\u3053\u3067 \u6620\u753b\u300cDON'T STOP!\u300d\u306eTwitter \u30a2\u30ab\u30a6\u30f3\u30c8 @DONTSTOPMOVIE \u3082\u958b\u59cb\u3001\u3082\u3057\u826f\u304b\u3063\u305f\u3089\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u304f\u3060\u3055\u3044\uff01\u50d5\u3082\u542b\u3081\u6620\u753b\u88fd\u4f5c\u95a2\u4fc2\u8005\u304c\u6c17\u9577\u306b\u3064\u3076\u3084\u304d\u307e\u3059","id":41189970613903360,"from_user_id":61221002,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"147393812","profile_image_url":"http://a1.twimg.com/profile_images/1114001122/hana_10_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"tubasa_uki","id_str":"41189965924667392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff10\uff10\uff17\u3082\u3073\u3063\u304f\u308a\u3000\u5927\u56fd\u306e\u5927\u7d71\u9818\u9078\u304b\u3089\u3000\u5cf6\u56fd\u306e\u5730\u65b9\u9078\u306e\u9078\u6319\u307e\u3067\u306b\u3082\u3000\u6697\u8e8d\u3057\u3066\u3044\u308b\uff3e\uff3e\u3000\u3053\u306eTwitter \u30b9\u30ad\u30e3\u30f3\u30c0\u30eb\u3084\u60aa\u8cea\u306a\u4e8b\u4ef6\u306b\u3082\u7d61\u3080\u304c\u3000Twitter\u304b\u3089\u767a\u4fe1\u3055\u308c\u305f\u3000\u5e73\u548c\u3078\u306e\u8ca2\u732e\u306f\u3000\u307e\u3055\u306b\u30ce\u30fc\u3079\u30eb\u5e73\u548c\u8cde\u3082\u306e http://bit.ly/esjWDG #dotubo_ss","id":41189965924667392,"from_user_id":147393812,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"96081746","profile_image_url":"http://a0.twimg.com/profile_images/1244505419/illust832_normal.png","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"kazukt","id_str":"41189963131387904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41189963131387904,"from_user_id":96081746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://janetter.net/" rel="nofollow">Janetter</a>"},{"from_user_id_str":"86306230","profile_image_url":"http://a1.twimg.com/profile_images/593004766/j2j_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:03 +0000","from_user":"excite_j2j","id_str":"41189949927596032","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u79c1\u306f\u3001\u65e9\u7a32\u7530\u5927\u5b66\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u306e\u5b66\u751f\u306e\u8003\u3048\u3066\u3044\u308b\u3001\u5352\u696d\u751fSoudai /\u65e9\u7a32\u7530\u30ab\u30fc\u30c9\u4f1a\u54e1/ Soudai\u5b66\u751f\u89aa/\u3001\u8ab0\u304b\u304c\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u65e9\u7a32\u7530\u5927\u5b662000\u5186\u306e\u5165\u5834\u6599\u306e\u30e1\u30f3\u30d0\u30fc\u3092\u7d39\u4ecb\u3057\u3066\u304f\u308c\u305f\u65b9\u304c\u305a\u3063\u3068\u5b89\u4e0a\u304c\u308a\u3060\u3002 (\u5143\u767a\u8a00 http://bit.ly/esxiwT )","id":41189949927596032,"from_user_id":86306230,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://d.hatena.ne.jp/fn7" rel="nofollow">\u65e5\u672c\u8a9e\u65e5\u672c\u8a9e\u7ffb\u8a33\u30b8\u30a7\u30cd\u30ec\u30fc\u30bf</a>"},{"from_user_id_str":"120927161","profile_image_url":"http://a0.twimg.com/profile_images/1230006483/20110131_13022_26776_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:00 +0000","from_user":"FRISKFOSSILFANG","id_str":"41189933855158272","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189933855158272,"from_user_id":120927161,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"228973151","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:59 +0000","from_user":"daisuke1589","id_str":"41189931887890432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u3063\u3066\u52dd\u624b\u306b\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u3082\u3044\u3044\u3093\u3060\u3063\u3051\uff1f","id":41189931887890432,"from_user_id":228973151,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"54314110","profile_image_url":"http://a2.twimg.com/profile_images/1193541240/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:57 +0000","from_user":"Alohazuki","id_str":"41189922668953600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u306e\u5e83\u5cf6\u5f01\u3082\u3042\u3063\u305f\u3093\u3060\u306d\u3002","id":41189922668953600,"from_user_id":54314110,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"72594681","profile_image_url":"http://a3.twimg.com/profile_images/1227240916/____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:56 +0000","from_user":"uri4ichi","id_str":"41189916922744832","metadata":{"result_type":"recent"},"to_user_id":226852303,"text":"@7_fuka Twitter\u304b\u3076\u308c\u306f\u3001\u3059\u3050\u306bD\u306b\u8d70\u308b\u306e\u3067\u3002\u306a\u3093\u3060\u304b\u5fae\u7b11\u307e\u3057\u3044\u306e\u3067\u3059( \u2579\u25e1\u2579)","id":41189916922744832,"from_user_id":72594681,"to_user":"7_fuka","geo":null,"iso_language_code":"ja","to_user_id_str":"226852303","source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"168393854","profile_image_url":"http://a3.twimg.com/profile_images/1253554518/GuNp3xVS_normal","created_at":"Fri, 25 Feb 2011 17:36:55 +0000","from_user":"makonyanhime","id_str":"41189913701515264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6589\u85e4\u3055\u3093\u3082\u30c0\u30e1\u3060...\u4eca\u591c\u306fTwitter\u5909\u3060\u306a\u3041(;_;)","id":41189913701515264,"from_user_id":168393854,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"122636787","profile_image_url":"http://a2.twimg.com/profile_images/1189607563/DSC01987_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:54 +0000","from_user":"enpy1217","id_str":"41189908500594688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u4e45\u3057\u3076\u308a\u306b\u958b\u3044\u305f\u3002\u3068\u3066\u3082\u591a\u5fd9\u3060\u3063\u305f\u3002\u75b2\u308c\u305f\u3002\u304a\u98a8\u5442\u306b\u3082\u5165\u308c\u306a\u304b\u3063\u305f\u3002\u30ad\u30bf\u30cd\u2026","id":41189908500594688,"from_user_id":122636787,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"81663694","profile_image_url":"http://a3.twimg.com/profile_images/1177576126/__normal.png","created_at":"Fri, 25 Feb 2011 17:36:51 +0000","from_user":"progmiya","id_str":"41189895494049792","metadata":{"result_type":"recent"},"to_user_id":94050844,"text":"@hirasai_skyhigh \u6674\u308c\u541b\u3002\u30cd\u30bf\u30d0\u30ec\u306f\u898b\u305f\u304f\u306a\u3044\u3051\u3069\u30012ch\u3082twitter\u3082\u3084\u308a\u305f\u3044\u306e\u304c\u4eba\u3068\u8a00\u3046\u3082\u306e\u3088","id":41189895494049792,"from_user_id":81663694,"to_user":"hirasai_skyhigh","geo":null,"iso_language_code":"ja","to_user_id_str":"94050844","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"159237469","profile_image_url":"http://a3.twimg.com/profile_images/1140433484/______2_normal.png","created_at":"Fri, 25 Feb 2011 17:36:50 +0000","from_user":"hikari_juku","id_str":"41189892096532480","metadata":{"result_type":"recent"},"to_user_id":135634241,"text":"@sssukimasuky \n\u4f55\u304b\u3042\u3063\u305f\u98a8\u3067\u3059\u306d\uff08\u7b11\uff09\u3000\u78ba\u304b\u306bTwitter\u306f\u6c17\u8efd\u3067\u3059\u3057\u306d\u3002\u30e1\u30fc\u30eb\u306b\u306a\u308b\u3068\u30d5\u30c3\u30c8\u30ef\u30fc\u30af\u304c\u91cd\u304f\u306a\u308b\u5834\u5408\u3082\u3042\u308b\u304b\u3082\u3057\u308c\u307e\u305b\u3093\u306d\u3002\u305d\u3046\u8003\u3048\u308b\u3068\u3059\u3054\u3044\u6642\u4ee3\u3060\u3002","id":41189892096532480,"from_user_id":159237469,"to_user":"sssukimasuky","geo":null,"iso_language_code":"ja","to_user_id_str":"135634241","source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"141915990","profile_image_url":"http://a0.twimg.com/profile_images/1248969898/icon679566266564378764images_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:48 +0000","from_user":"adashino_","id_str":"41189886878949376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189886878949376,"from_user_id":141915990,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"111308629","profile_image_url":"http://a1.twimg.com/profile_images/1137421845/mmooton_normal.png","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"mmooton","id_str":"41189877940748288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @minponjp: \u3010\u3064\u3076\u3084\u304f\u3060\u3051\u306710000\u5186\u5546\u54c1\u5238GET\u3011<<visa\u30ae\u30d5\u30c8\u30ab\u30fc\u30c910000\u5186\u5206\u3092\u6bce\u6708\u62bd\u9078\u3067\u30d7\u30ec\u30bc\u30f3\u30c8>> \u21d2\u8a73\u3057\u304f\u306f\u4e0b\u306e\uff35\uff32\uff2c\u3088\u308a\u2193\u2193\u2193\u2193\u2193 http://minpon.jp/user_data/twitter_campaign.php","id":41189877940748288,"from_user_id":111308629,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"140945098","profile_image_url":"http://a0.twimg.com/profile_images/1198948281/b7664c71-87bc-4187-9d46-a61ab8d41b96_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"waruimayuko","id_str":"41189877122867200","metadata":{"result_type":"recent"},"to_user_id":113371008,"text":"@toumeisyoujyo \u3042\u3053\u3061\u3083\u3093Twitter\u3084\u3063\u3066\u305f\u306e\u306d\u3002\u307e\u3060\u304a\u5e2d\u3042\u308b\u305d\u3046\u306a\u306e\u3067\u662f\u975e\uff01","id":41189877122867200,"from_user_id":140945098,"to_user":"toumeisyoujyo","geo":null,"iso_language_code":"ja","to_user_id_str":"113371008","source":"<a href="http://twimi.jp/?r=via" rel="nofollow">twimi\u2606new</a>"},{"from_user_id_str":"167512527","profile_image_url":"http://a1.twimg.com/profile_images/1172286365/newspaper_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"KoranKaget","id_str":"41189871775252480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://bit.ly/93Eeud RT @motocentrism \u30d6\u30ed\u30b0\u8a18\u4e8b\u66f8\u304d\u307e\u3057\u305f\u30fc\uff1a MotoGP\u3000\u30d6\u30c3\u30af\u30e1\u30fc\u30ab\u30fc\u306b\u898b\u308b\u5404\u30e9\u30a4\u30c0\u30fc\u306e\u4e0b\u99ac\u8a55 - http://goo.gl/xVe6... http://bit.ly/hDYxyx @motogpudpate","id":41189871775252480,"from_user_id":167512527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"160251772","profile_image_url":"http://a3.twimg.com/profile_images/1150692471/_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"keikochaki","id_str":"41189870781075456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u305a\u3063\u3068twitter\u3084\u3063\u3066\u308b\u3088\u306d\u300d\u3068\u6012\u3089\u308c\u3066\u3057\u307e\u3063\u305f(\u82e6\u7b11)","id":41189870781075456,"from_user_id":160251772,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"211565766","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:36:42 +0000","from_user":"sayap1yo","id_str":"41189858236043264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u98df\u4e8b\u4f1a\u884c\u304d\u305f\u304b\u3063\u305f\u3051\u3069\n\u53cb\u9054\u3068\u904a\u3093\u3067\u307e\u3093\u305f\ue056\ue326\n\nTwitter\u898b\u3066\u307e\u3057\u305f\u3051\u3069\n\u3064\u3076\u3084\u304f\u30bf\u30a4\u30df\u30f3\u30b0\n\u5931\u3063\u3066\u305f\u3060\u3051\u3067\u3059( \u00b4 \u25bd ` )\uff89\u7b11","id":41189858236043264,"from_user_id":211565766,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.nibirutech.com" rel="nofollow">TwitBird</a>"},{"from_user_id_str":"19603191","profile_image_url":"http://a1.twimg.com/profile_images/1254077264/116_normal.gif","created_at":"Fri, 25 Feb 2011 17:36:40 +0000","from_user":"Purple_Flash","id_str":"41189851873157120","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189851873157120,"from_user_id":19603191,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"215930291","profile_image_url":"http://a0.twimg.com/profile_images/1247906106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"minori_millie","id_str":"41189810055938048","metadata":{"result_type":"recent"},"to_user_id":212972774,"text":"@c_c_chika \u7b11\u3063\u3066\u305d\u3046\u3060\u306a\u3063\u3066\u601d\u3063\u3066\u305f(o^^o)\u30c1\u30ab\u306e\u7b11\u3044\u58f0\u304c\u805e\u3053\u3048\u3066\u304d\u305f\u3082\u3093\u3002mail\u306bTwitter\u3067\u5927\u5fd9\u3057\u3084\u3002","id":41189810055938048,"from_user_id":215930291,"to_user":"c_c_chika","geo":null,"iso_language_code":"ja","to_user_id_str":"212972774","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"SyokoShiratori","id_str":"41189809586311168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.90kg \u30c0\u30a4\u30a8\u30c3\u30c8\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002(*^^*)\u30c0\u30a4\u30a8\u30c3\u30c8\u4f53\u91cd\u5831\u544a\u306e\u3064\u3076\u3084\u304d\u3067\u3059\u3002 http://bit.ly/fhN2fM RT @hayayumi \u3053\u3093\u306a\u6642\u9593\u306b\u3084\u304d\u306b\u304f\u30fc\u266b\u30c0\u30a4\u30a8\u30c3\u30c8\u671f\u9593\u306a\u306e\u306b\u306d....","id":41189809586311168,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mob-mc.com" rel="nofollow">\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick</a>"},{"from_user_id_str":"12337665","profile_image_url":"http://a0.twimg.com/profile_images/1146194926/pixiv-icon_normal.png","created_at":"Fri, 25 Feb 2011 17:36:27 +0000","from_user":"t_a_k_i","id_str":"41189797364121600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Google\u30ea\u30fc\u30c0\u30fc\u3067\u30b5\u30a4\u30c8\u306e\u66f4\u65b0\u30c1\u30a7\u30c3\u30af\u3059\u308b\u3088\u308a\u3001Twitter\u30a2\u30ab\u30a6\u30f3\u30c8\u3092\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u66f4\u65b0\u3092\u77e5\u308b\u307b\u3046\u304c\u4fbf\u5229\u3060\u306a\u3053\u308c","id":41189797364121600,"from_user_id":12337665,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"104862453","profile_image_url":"http://a3.twimg.com/profile_images/1248609864/Image014_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:25 +0000","from_user":"yuz_ume","id_str":"41189787943714816","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189787943714816,"from_user_id":104862453,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"213846746","profile_image_url":"http://a1.twimg.com/profile_images/1242263342/haruhi1_normal.png","created_at":"Fri, 25 Feb 2011 17:36:23 +0000","from_user":"sloth888jpgame","id_str":"41189778409922560","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u643a\u5e2f\u96fb\u8a71\u7528\u306eTwitter\u3092\u5229\u7528\u3057\u305f\u30b2\u30fc\u30e0\u3092\u77e5\u3063\u3066\u3044\u308b\u4eba\u306f\u3001\u7d39\u4ecb\u3057\u3066\u304f\u3060\u3055\u3044\u3002 #TwitterGame","id":41189778409922560,"from_user_id":213846746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"17484724","profile_image_url":"http://a2.twimg.com/profile_images/1138677235/iconue_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:22 +0000","from_user":"tsutcho","id_str":"41189777831231490","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093twitter\u306b\u7acb\u3064\u30fb\u30fb\u30fb\u3060\u3068\u30fb\u30fb\u30fb\uff1f\uff12\u756a\u76ee\u306e\u30d5\u30a9\u30ed\u30ef\u30fc\u306e\u5ea7\u3092\u3044\u305f\u3060\u3044\u3066\u304a\u3053\u3046","id":41189777831231490,"from_user_id":17484724,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"220041064","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"sloth888jp_bot5","id_str":"41189772521254914","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6642\u3005\u3001TwiAll\uff08\u30c4\u30a4\u30aa\u30fc\u30eb\uff09\u3067Twitter\u306e\u81ea\u52d5\u30d5\u30a9\u30ed\u30fc\u30fb\u30d5\u30a9\u30ed\u30fc\u8fd4\u3057\u3092\u3057\u3066\u3044\u307e\u3059\u3002","id":41189772521254914,"from_user_id":220041064,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"177693537","profile_image_url":"http://a0.twimg.com/profile_images/1240130924/20110207213206_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"Na_Okinawa","id_str":"41189769912397824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41189769912397824,"from_user_id":177693537,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"147006592","profile_image_url":"http://a2.twimg.com/profile_images/1251306448/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"takasu_rika","id_str":"41189763532865536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41189763532865536,"from_user_id":147006592,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"100239985","profile_image_url":"http://a1.twimg.com/profile_images/733461294/CIMG0207_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"strangebarjun","id_str":"41189762182152192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u3092\u59cb\u3081\u3066\u3001\u305d\u308d\u305d\u308d\u4e00\u5e74\u306b\u306a\u308a\u307e\u3059\u3002\u632f\u308a\u8fd4\u308b\u3068\u3001\u307c\u304f\u306e\u4eba\u9593\u6027\u3092\u305d\u3063\u304f\u308a\u53cd\u6620\u3059\u308b\u304c\u5982\u304f\u3001\u534a\u7aef\u3067\u3059\u306d\u3002\u60c5\u5831\u53ce\u96c6\u30c4\u30fc\u30eb\u3001\u60c5\u5831\u767a\u4fe1\u30c4\u30fc\u30eb\u3001\u30b3\u30df\u30e5\u30cb\u30b1\u30fc\u30b7\u30e7\u30f3\u30c4\u30fc\u30eb\u3001\u3069\u308c\u3082\u6a5f\u80fd\u3057\u5207\u308c\u3066\u3044\u306a\u3044\u306a\u3042\u3001\u3068\u3002\u305d\u3057\u3066\u3042\u308b\u306e\u306f\u300c\u3069\u3053\u304b\u3089\u3082\u76f8\u624b\u306b\u3055\u308c\u3066\u3044\u306a\u3044\u300d\u3068\u3044\u3046\u3001\u65e2\u77e5\u306e\u73fe\u5b9f\u3067\u3059\u3002","id":41189762182152192,"from_user_id":100239985,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"126390384","profile_image_url":"http://a2.twimg.com/profile_images/1176065038/nemunemu_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:18 +0000","from_user":"gesukapper","id_str":"41189757476286464","metadata":{"result_type":"recent"},"to_user_id":80935865,"text":"@tatsugorou \u306a\u3093\u304b\u4e16\u306e\u4e2d\u306b\u306f\u611a\u75f4\u3082\u4e0b\u30cd\u30bf\u3082\u8a00\u3044\u653e\u984c\u306etwitter\u3068\u3044\u3046\u3082\u306e\u304c\u3042\u308b\u305d\u3046\u3067\u3059\u3002","id":41189757476286464,"from_user_id":126390384,"to_user":"tatsugorou","geo":null,"iso_language_code":"ja","to_user_id_str":"80935865","source":"<a href="http://janetter.net/" rel="nofollow">Janetter</a>"},{"from_user_id_str":"196059029","profile_image_url":"http://a1.twimg.com/profile_images/1208831726/ruka2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:17 +0000","from_user":"luka_m_bot","id_str":"41189756666777600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u308f\u305f\u3057\u3082twitter\u306f\u3058\u3081\u307e\u3057\u305f","id":41189756666777600,"from_user_id":196059029,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www24.atpages.jp/aoi2/bot.php" rel="nofollow">\u5de1\u308b\u97f3</a>"},{"from_user_id_str":"88135613","profile_image_url":"http://a3.twimg.com/profile_images/1088552877/P9280150_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:14 +0000","from_user":"Roko38","id_str":"41189740321587200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff46\uff42\u306b\u30ed\u30b0\u30a4\u30f3\u3059\u308b\u6a5f\u4f1a\u304c\u65e5\u306b\u65e5\u306b\u5897\u3048\u3066\u304d\u305f\uff3e\uff3e \u6163\u308c\u3066\u304f\u308b\u3068\u3042\u3063\u3061\u306e\u304c\u9762\u767d\u3044\uff06\u4f7f\u3044\u52dd\u624b\u304c\u3044\u3044\u3088\u3046\u306a\u6c17\u304c\u3059\u308b\u3002\u8907\u5408\u7684\u306b\u8272\u3005\u51fa\u6765\u307e\u3059\u3088\u306d\u2026\u3063\u3066\u3001\u601d\u3063\u305f\u3053\u3068\u3092\u545f\u304f\u306e\u306fTwitter\u3060\u3063\u305f\u308a\u3067\u3059\u304c\u2026(^_^; \u305d\u3057\u3066\u81ea\u5206\u306e\u5834\u5408\u306f\u30c4\u30a4\u3068\u9023\u52d5\u3057\u3065\u3089\u3044\u72b6\u6cc1\u3060\u3063\u305f\u308a\u3067\u2026\u3002","id":41189740321587200,"from_user_id":88135613,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"110825211","profile_image_url":"http://a2.twimg.com/profile_images/1108977866/o_t_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:12 +0000","from_user":"kou_nanjyo","id_str":"41189731941363712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f"\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044"\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f"\u80cc\u8ca0\u3048"\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189731941363712,"from_user_id":110825211,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tweetlogix.com" rel="nofollow">Tweetlogix</a>"},{"from_user_id_str":"2095960","profile_image_url":"http://a2.twimg.com/profile_images/1248999075/majiresu2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:10 +0000","from_user":"guldeen","id_str":"41189726945947648","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3083\u307e\u3041\u3002\u25bchttp://bit.ly/et4vVa \uff3b\u89d2\u5ddd\u66f8\u5e97\uff3d\u300c\u30b6\u30fb\u30b9\u30cb\u30fc\u30ab\u30fc\u300d\u4f11\u520a\u3078\u3000\u300c\u6dbc\u5bae\u30cf\u30eb\u30d2\u300d\u751f\u3093\u3060\u30e9\u30ce\u30d9\u96d1\u8a8c18\u5e74\u3067\u5e55 via http://twitter.com/lkj777","id":41189726945947648,"from_user_id":2095960,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"164121549","profile_image_url":"http://a1.twimg.com/profile_images/1251758789/m_108-07ae3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:09 +0000","from_user":"hachi_touhi","id_str":"41189719299727360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u6c17\u306b\u3057\u3066\u305f\u3089Twitter\u3084\u3063\u3066\u3089\u308c\u306a\u3044ww","id":41189719299727360,"from_user_id":164121549,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twicca.r246.jp/" rel="nofollow">twicca</a>"},{"from_user_id_str":"194494659","profile_image_url":"http://a3.twimg.com/profile_images/1249717822/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:08 +0000","from_user":"tomonattomo","id_str":"41189715415801856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308f\u3001\u660e\u65e5\u671d\u304b\u3089\u30d0\u30a4\u30c8\u3084\u306e\u306b\u306a\u3093\u3060\u3053\u306e\u306d\u3075\u304b\u3057\u3002\u3042\u3001\u591c\u66f4\u304b\u3057\u3002\u30d1\u30d4\u30eb\u30b9\u3068BUMP\u3001\u3048\u307f\u3068Twitter\u306eDM\u3057\u3059\u304e\u305f\u306a\u2026","id":41189715415801856,"from_user_id":194494659,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mixi.jp/promotion.pl?id=voice_twitter" rel="nofollow"> mixi \u30dc\u30a4\u30b9 </a>"},{"from_user_id_str":"97224364","profile_image_url":"http://a3.twimg.com/profile_images/1150074355/fb8bcca60d340862c053a756377bfae8_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:36:06 +0000","from_user":"xxxheat","id_str":"41189709174677504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u5b8c\u5168\u306b\u30d0\u30b0\u3063\u3066\u308borz","id":41189709174677504,"from_user_id":97224364,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"}],"max_id":41190705623732224,"since_id":38643906774044672,"refresh_url":"?since_id=41190705623732224&q=twitter","next_page":"?page=2&max_id=41190705623732224&rpp=100&lang=ja&q=twitter","results_per_page":100,"page":1,"completed_in":0.093336,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41190705623732224","query":"twitter"}attoparsec-0.13.2.4/benchmarks/json-data/jp50.json0000755000000000000000000013012407346545000017747 0ustar0000000000000000{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://babyprincess.sakura.ne.jp/about/" rel="nofollow">\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71</a>"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bit.ly/Fossetta" rel="nofollow">\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1</a>"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.docodemo.jp/twil/" rel="nofollow">Twil2 (Tweet Anytime, Anywhere by Mail)</a>"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/kyo4to4" rel="nofollow">lost-sheep-bot</a>"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u3055\u3042\u3084\u3093\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(>_<)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"},{"from_user_id_str":"104712480","profile_image_url":"http://a3.twimg.com/profile_images/1204016928/icon5087697006727791368kuro2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:31:51 +0000","from_user":"asongfor_xx","id_str":"30649192296751104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7f8e\u4eba\u5929\u6c17\u304b\u3089tweet\u3059\u308b\u3068\u3053\u3093\u306a\u611f\u3058\u306a\u3093\u3060\u306a\u3002 RT asongfor_xx: \u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u304b\u306a\u3053\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u6674\u6642\u3005\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u73870%\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th","id":30649192296751104,"from_user_id":104712480,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"165965113","profile_image_url":"http://a0.twimg.com/profile_images/1200885316/shogomeguro_normal.jpg","created_at":"Thu, 27 Jan 2011 15:24:35 +0000","from_user":"shogomeguro","id_str":"30647362477105152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"2011.1.26 \u793e\u7a93\u304b\u3089\u3002\u4e0d\u601d\u8b70\u306a\u5929\u6c17\u3067\u3053\u306e\u5f8c\u96ea\u304c\u3061\u3089\u3064\u3044\u305f\u3093\u3060\u3088\u306d\u3002\u6771\u4eac\u306e\u521d\u96ea\u3067\u3057\u305f\u3002 http://instagr.am/p/BO_xn/","id":30647362477105152,"from_user_id":165965113,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://instagr.am" rel="nofollow">instagram</a>"},{"from_user_id_str":"166018520","profile_image_url":"http://a0.twimg.com/profile_images/1207460953/100-40030_normal.jpg","created_at":"Thu, 27 Jan 2011 15:18:17 +0000","from_user":"115nayume","id_str":"30645776254238722","metadata":{"result_type":"recent"},"to_user_id":118384679,"text":"@dancinpea09 \u6771\u4eac\u3001\u660e\u65e5\u3082\u5929\u6c17\u826f\u3044\u307f\u305f\u3044\u3067\u3001\u3088\u304b\u3063\u305f\u3067\u3059\u306d\u30fc\u266a \u30ca\u30a4\u30b9\u30c8\u30ea\u30c3\u30d7\uff01\u304a\u3084\u3059\u307f\u306a\u3055\u3044\u3002 http://twitpic.com/3tvun3","id":30645776254238722,"from_user_id":166018520,"to_user":"dancinpea09","geo":null,"iso_language_code":"ja","to_user_id_str":"118384679","source":"<a href="http://tweetli.st/" rel="nofollow">TweetList!</a>"},{"from_user_id_str":"202937674","profile_image_url":"http://a1.twimg.com/profile_images/1218797578/______2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:11:48 +0000","from_user":"ryuusisan","id_str":"30644146498699264","metadata":{"result_type":"recent"},"to_user_id":203058384,"text":"@manaasutakshi \u6771\u4eac\u306f\u964d\u3063\u3066\u306a\u3044\u3093\u3067\u3059\u304b\u30fb\u30fb\u30fb\u5929\u6c17\u4e88\u5831\u306b\u3088\u308b\u3068\u660e\u65e5\u3082\u6771\u4eac\u306f\u964d\u3089\u306a\u3044\u305d\u3046\u3067\u3059\u306d\uff01\uff01\u79c1\u306e\u4f4f\u3093\u3067\u3044\u308b\u3068\u3053\u308d\u306f\u5fae\u5999\u306b\u964d\u308a\u305d\u3046\u3067\u51fa\u52e4\u6642\u306b\u964d\u3063\u3066\u305f\u3089\u3061\u3087\u3063\u3068\u5acc\u3060\u306a\u3041\u3000\u306a\u3093\u3066\u601d\u3044\u307e\u3059","id":30644146498699264,"from_user_id":202937674,"to_user":"manaasutakshi","geo":null,"iso_language_code":"ja","to_user_id_str":"203058384","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"3222182","profile_image_url":"http://a0.twimg.com/profile_images/1199090957/ProfilePhoto_normal.png","created_at":"Thu, 27 Jan 2011 15:09:35 +0000","from_user":"44mune","id_str":"30643589545459713","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u306e\u308a\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d http://twitpic.com/3tvruh","id":30643589545459713,"from_user_id":3222182,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"154341982","profile_image_url":"http://a0.twimg.com/profile_images/1155496864/_____normal.jpg","created_at":"Thu, 27 Jan 2011 15:02:39 +0000","from_user":"slave_420_bot","id_str":"30641845490946049","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u30f3\u3068\u3053\u899a\u3048\u3066\u308b\u306e\u306f\u300c\u672d\u5e4c\u300d\u300c\u4ed9\u53f0\u300d\u300c\u6771\u4eac\u300d\u300c\u5927\u962a\u300d\u300c\u540d\u53e4\u5c4b\u300d\u300c\u798f\u5ca1\u300d\u306e\u4eca\u65e5\u3068\u660e\u65e5\u306e\u5929\u6c17\u3060\u306a\u3002\u5929\u6c17\u304c\u77e5\u308a\u305f\u3044\u6642\u306f\u300c\u5834\u6240\u300d\u3068\u300c\u4eca\u65e5\u306e\u5929\u6c17\u300d\u304b\u300c\u660e\u65e5\u306e\u5929\u6c17\u300d\u3092\u304a\u7533\u3057\u4ed8\u3051\u304f\u3060\u3055\u3044\u3001\u304a\u5b22\u69d8\uff1f","id":30641845490946049,"from_user_id":154341982,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bot.syoyu.net/" rel="nofollow">\u7adc\u30f6\u5cf0\u90b8\u306e\u3069\u3053\u304b</a>"},{"from_user_id_str":"72042678","profile_image_url":"http://a3.twimg.com/profile_images/1198771027/larxene_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:57 +0000","from_user":"larxene_bot","id_str":"30641668772339712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u5929\u6c17\u306f \u672d\u5e4c\u304c\u6674\u308c \u4ed9\u53f0\u304c\u66c7\u6642\u3005\u96ea \u6771\u4eac\u304c\u6674\u306e\u3061\u66c7 \u540d\u53e4\u5c4b\u304c\u6674\u6642\u3005\u66c7 \u5927\u962a\u304c\u6674\u6642\u3005\u66c7 \u798f\u5ca1\u304c\u6674\u308c \u3089\u3057\u3044\u308f\u3088 \u6ce8\u610f\u3057\u306a\u3055\u3044","id":30641668772339712,"from_user_id":72042678,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www4.kiwi-us.com/~yuuna/larxene_bot_manual/index.html" rel="nofollow">\u5fd8\u5374\u306e\u57ce \u5730\u4e0a\u306e12\u968e</a>"},{"from_user_id_str":"101331893","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 15:01:34 +0000","from_user":"yoshiftan","id_str":"30641572240424961","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3073\u3063\u304f\u308a\uff01\u6691\u305d\u3046\u3060\u306a\u3053\u308a\u3083\u3002","id":30641572240424961,"from_user_id":101331893,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"Keitai Mail"},{"from_user_id_str":"65207550","profile_image_url":"http://a3.twimg.com/profile_images/448731969/_________R_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:33 +0000","from_user":"kabuyo","id_str":"30641566469066752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u5929\u6c17\u4e88\u5831\u3067\u306f\u6771\u4eac\u3067\u306f\u4e7e\u71e5\u6ce8\u610f\u5831\u304c\u7d9a\u3044\u3066\u3044\u308b\u3089\u3057\u3044\u306e\u306b\u3001\u306a\u305c\u79c1\u304c\u5e72\u3057\u305f\u6d17\u6fef\u7269\u306f\u96e8\u306b\u6fe1\u308c\u3066\u3057\u307e\u3063\u305f\u306e\u3060\u308d\u3046\u304b\u2025\u3000\u3088\u3063\u307d\u3069\u904b\u304c\u60aa\u3044\u3089\u3057\u3044\u2025","id":30641566469066752,"from_user_id":65207550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:54:30 +0000","from_user":"mikutyan","id_str":"30639792026812416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066","id":30639792026812416,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:53:06 +0000","from_user":"mikutyan","id_str":"30639439847890944","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u660e\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306a\u3093\u3060\u308d\u3046 \u96e8\u964d\u3063\u305f\u3089\u56f0\u308b\u3002","id":30639439847890944,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 14:47:19 +0000","from_user":"Cirno_fan","id_str":"30637984684449792","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u305f\u3044\u30c1\u30eb\u30ce\uff01\u30dc\u30c3\u30c8\u3060\u3051\u3069\u5929\u6c17\u4e88\u5831\u3082\u3067\u304d\u308b\u3088\uff01\u300c\u6771\u4eac\u306e\u4eca\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066\u300d\u307f\u305f\u3044\u306bTL\u767a\u8a00\u3057\u3066\u304f\u308c\u308c\u3070\u8abf\u3079\u3066\u3042\u3052\u308b\uff01 #followme #followmejp #followmevip #tenki","id":30637984684449792,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"33858777","profile_image_url":"http://a0.twimg.com/profile_images/352864695/muga_normal.jpg","created_at":"Thu, 27 Jan 2011 14:46:12 +0000","from_user":"collonist","id_str":"30637702105796610","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u3063\u3066\u51ac\u306f\u57fa\u672c\u7684\u306b\u6674\u308c\u3066\u308b\u304b\u3089\u3001\u5929\u6c17\u4e88\u5831\u898b\u306a\u304f\u3066\u3082\u5168\u7136\u554f\u984c\u306a\u3044\u3002\u5c71\u5f62\u3060\u3068\u660e\u65e5\u306f\u3069\u3093\u3060\u3051\u96ea\u304c\u964d\u308b\u306e\u304b\u3001\u3069\u3093\u3060\u3051\u5bd2\u3044\u306e\u304b\u628a\u63e1\u3057\u3066\u3068\u304d\u305f\u3044\u306e\u3067\u3001\u5929\u6c17\u4e88\u5831\u306f\u5fc5\u305a\u30c1\u30a7\u30c3\u30af\u3057\u3066\u305f\u306e\u3060\u304c\u3002","id":30637702105796610,"from_user_id":33858777,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"79336228","profile_image_url":"http://a0.twimg.com/profile_images/1130029876/zmanmu_normal.png","created_at":"Thu, 27 Jan 2011 14:30:23 +0000","from_user":"atsuki777","id_str":"30633725041573890","metadata":{"result_type":"recent"},"to_user_id":null,"text":"MXTV\u306e\u5929\u6c17\u4e88\u5831\u521d\u3081\u3066\u898b\u305f\u3051\u3069\u6771\u4eac\u753a\u7530\u516b\u738b\u5b50\u3063\u3066\u5730\u57df\u8868\u793a\u304c\u2026w\u516b\u738b\u5b50\u3068\u753a\u7530\u306f\u6771\u4eac\u3058\u3083\u306a\u3044\u306e\u304bwww","id":30633725041573890,"from_user_id":79336228,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"90576097","profile_image_url":"http://a0.twimg.com/profile_images/1203320254/nanami1_normal.png","created_at":"Thu, 27 Jan 2011 14:28:26 +0000","from_user":"dycroft","id_str":"30633234245099521","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633234245099521,"from_user_id":90576097,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"147215268","profile_image_url":"http://a2.twimg.com/profile_images/1198555202/ichika-7.4.0-3P_normal.gif","created_at":"Thu, 27 Jan 2011 14:28:23 +0000","from_user":"kiaran5032","id_str":"30633222211637248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002\u6674\u308c\u6642\u3005\u304f\u3082\u308a #MX","id":30633222211637248,"from_user_id":147215268,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"1741599","profile_image_url":"http://a0.twimg.com/profile_images/1205744888/950637_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:21 +0000","from_user":"dasaitama","id_str":"30633212535382016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u3001\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633212535382016,"from_user_id":1741599,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"34140879","profile_image_url":"http://a3.twimg.com/profile_images/1186413535/__6_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:17 +0000","from_user":"ryuji_chaos","id_str":"30633197016449024","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002","id":30633197016449024,"from_user_id":34140879,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"1400","profile_image_url":"http://a0.twimg.com/profile_images/1198556839/westerndog_20090104_320x320_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:16 +0000","from_user":"westerndog","id_str":"30633191232503808","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633191232503808,"from_user_id":1400,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"89239832","profile_image_url":"http://a3.twimg.com/profile_images/519522846/noriko_normal.jpg","created_at":"Thu, 27 Jan 2011 14:15:01 +0000","from_user":"Noriko_Fujimoto","id_str":"30629857234788352","metadata":{"result_type":"recent"},"to_user_id":115645219,"text":"@nossa430402 \u5bcc\u5c71\u306f\u3059\u3054\u3044\u96ea\u307f\u305f\u3044\u3067\u3059\u306d\uff5e\uff08\u5bd2\u3063\uff09\u3000\u6771\u4eac\u306f\u305d\u306e\u5206\u6bce\u65e5\u826f\u3044\u5929\u6c17\u3067\u3059\u3002\u5bd2\u3044\u3051\u3069\u30fb\u30fb\u30fb\u3002","id":30629857234788352,"from_user_id":89239832,"to_user":"nossa430402","geo":null,"iso_language_code":"ja","to_user_id_str":"115645219","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"107265539","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 14:01:10 +0000","from_user":"kurumasuki330","id_str":"30626371826884608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u9031\u571f\u66dc\u65e5\u3001\u8eca\u3067\u6771\u4eac\u304b\u3089\u6771\u540d\u3001\u7c73\u539f\u7d4c\u7531\u3067\u91d1\u6ca2\u306e\u5b9f\u5bb6\u3078\u3002\u305d\u3057\u3066\u3001\u6708\u66dc\u65e5\u306b\u6771\u4eac\u3078\u5e30\u308b\u30b9\u30b1\u30b8\u30e5\u30fc\u30eb\u3002\u5929\u6c17\u4e88\u5831\u3060\u3068\u4eca\u9031\u672b\u3001\u5317\u9678\u5730\u65b9\u306f\u5927\u96ea\uff01\u5e30\u308c\u308b\u304b\u81ea\u4fe1\u304c\u306a\u304f\u306a\u3063\u3066\u304d\u305f\u3002\u307e\u305f\u3001\u305d\u306e\u6642\u5b9f\u6cc1\u4e2d\u7d99\u3057\u307e\u3059\u3002","id":30626371826884608,"from_user_id":107265539,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"155313166","profile_image_url":"http://a3.twimg.com/profile_images/1167554721/73931_1408370184003_1674923704_920888_5686998_n_normal.jpg","created_at":"Thu, 27 Jan 2011 14:00:50 +0000","from_user":"takuya_aoki","id_str":"30626287127105536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3081\u3063\u3061\u3083\u3044\u3044\u5929\u6c17\u3067\u904e\u3054\u3057\u3084\u3059\u3044\u3051\u3069\u30c9\u30e9\u30a4\u30a2\u30a4\u306b\u306f\u3061\u3087\u3063\u3068\u304d\u3064\u3044\u306a\u30fb\u30fb\u30fb\u76ee\u85ac\u304c\u624b\u653e\u305b\u306a\u3044","id":30626287127105536,"from_user_id":155313166,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"179984398","profile_image_url":"http://a1.twimg.com/profile_images/1182382310/g4350_normal.jpg","created_at":"Thu, 27 Jan 2011 13:52:50 +0000","from_user":"aiilabo","id_str":"30624271902449664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0 \u25c6\u611f\u60c5\u3092\u307f\u3064\u3081\u308b\u65b9\u6cd5 - \u3053\u3053\u6570\u65e5\u3001\u6642\u6298\u96e8\u304c\u30d1\u30e9\u30d1\u30e9\u3000\u5fae\u5999\u306a\u5929\u6c17\u306e\u6771\u4eac\u304b\u3089\u3042\u308b\u304c\u307e\u307e\u3067\u3059\u3002 \n\n \u4eca\u65e5\u306f\u3001\u6628\u65e5\u306e\u300c\u30de\u30a4\u30ca\u30b9\u611f\u60c5\u306f\u60aa\u3067\u3059\u304b\uff1f\n.. \u27aa http://am6.jp/e3e9tS","id":30624271902449664,"from_user_id":179984398,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://feedtweet.am6.jp/" rel="nofollow">\u261e feedtweet.jp \u261c</a>"},{"from_user_id_str":"185992391","profile_image_url":"http://a2.twimg.com/profile_images/1192695844/otenki_normal.png","created_at":"Thu, 27 Jan 2011 13:00:37 +0000","from_user":"otenki_luci_bot","id_str":"30611130938298368","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u767a\u58f2\u65e5\u304b\u2026\u2026\u541b\u305f\u3061\u306b\u3068\u3063\u3066\u306f\u591a\u5206\u300190\u65e5\u5f8c\u306e\u3053\u3068\u3060\u3002\u3055\u3066\u660e\u65e5\u306e\u6771\u4eac\u90fd\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3060\u305d\u3046\u3060\u3002\u3055\u3059\u304c\u306b\u4f55\u304b\u7740\u305f\u65b9\u304c\u3044\u3044\u305e\u3001\u30a4\u30fc\u30ce\u30c3\u30af\u3002","id":30611130938298368,"from_user_id":185992391,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/otenki_luci_bot" rel="nofollow">\u304a\u3066\u3093\u304d\u308b\u3057\u3075\u3047\u308b</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 13:00:04 +0000","from_user":"heta_weather01","id_str":"30610995843964928","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Jo napot.\u30cf\u30f3\u30ac\u30ea\u30fc\u3067\u3059\u3002\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3067\u660e\u65e5\u306f\u6674\u6642\u3005\u66c7\u3001\u79c1\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067-2\u2103\u3067\u3059\u3002\u3048\u3001\u3053\u306e\u30d5\u30e9\u30a4\u30d1\u30f3\u3067\u3059\u304b\uff1f\u2026\u3061\u3087\u3063\u3068\u500b\u4eba\u7684\u306b\u6bb4\u308a\u305f\u3044\u4eba\u304c\u3044\u308b\u3093\u3067\u3059\u266a","id":30610995843964928,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"109740077","profile_image_url":"http://a0.twimg.com/profile_images/1212763349/1d3d3821-6b3a-449f-a636-05b95ce3d5d8_normal.png","created_at":"Thu, 27 Jan 2011 12:59:41 +0000","from_user":"snow_arai","id_str":"30610896141156354","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3001\u30ab\u30e9\u30ab\u30e9\u9023\u7d9a\u3000\uff13\u4f4d\u30bf\u30a4 - \u65e9\u8d77\u304d\u2606\u304a\u5929\u6c17\u2606ONAIR\u65e5\u8a18\uff1a\u65e5\u7d4c\u30a6\u30fc\u30de\u30f3\u30aa\u30f3\u30e9\u30a4\u30f3 http://j.mp/hxP3Di","id":30610896141156354,"from_user_id":109740077,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"53407951","profile_image_url":"http://a1.twimg.com/profile_images/397960795/airman_normal.jpg","created_at":"Thu, 27 Jan 2011 12:57:32 +0000","from_user":"Airman2009","id_str":"30610355541508096","metadata":{"result_type":"recent"},"to_user_id":null,"text":". @04mmy22 @qsk1 \u98a8\u3068\u96f2\u30fb\u30fb\u30fb\u98db\u884c\u6a5f\u306e\u5927\u5c0f\u554f\u308f\u305a\u3001\u3053\u308c\u3070\u304b\u308a\u306f\u3069\u3046\u3057\u3088\u3046\u3082\u7121\u3044\u3067\u3059\u3088\u306d\u3002 \u6700\u8fd1\u306e\u5357\u6771\u4eac\u306e\u5929\u6c17\u306f\u5909\u3067\u3059\u306d\u3002\u3002\u3002","id":30610355541508096,"from_user_id":53407951,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"111826019","profile_image_url":"http://a1.twimg.com/profile_images/1121742732/DVC00052_normal.jpg","created_at":"Thu, 27 Jan 2011 12:51:12 +0000","from_user":"nijiks","id_str":"30608762859421696","metadata":{"result_type":"recent"},"to_user_id":100014282,"text":"@sanaeru \u79c1\u3053\u3093\u306a\u5929\u6c17\u306e\u4e2d\uff64\u4e8c\u6cca\u4e09\u65e5\u3067\u660e\u65e5\u304b\u3089\u6771\u4eac\u884c\u304f\u3093\u3067\u3059\u3051\u3069\u2026\uff61\u65e5\u66dc\u65e5\u98db\u884c\u6a5f\u98db\u3076\u304b\u3057\u3089\u2026\uff1f","id":30608762859421696,"from_user_id":111826019,"to_user":"sanaeru","geo":null,"iso_language_code":"ja","to_user_id_str":"100014282","source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"164951488","profile_image_url":"http://a3.twimg.com/profile_images/799082230/twitter_normal.jpg","created_at":"Thu, 27 Jan 2011 12:47:49 +0000","from_user":"minorif_jp","id_str":"30607912309096448","metadata":{"result_type":"recent"},"to_user_id":105078670,"text":"@ecco_HIRADO \u5e73\u6238\u725b\u3063\u3066\u5143\u306f\u30aa\u30e9\u30f3\u30c0\u304b\u3089\u304d\u305f\u725b\u306a\u3093\u3060\u306d\u3002\u304a\u3044\u3057\u305d\u3046\u2026\u3002\u5e73\u6238\u306f\u3088\u304b\u6240\u305f\u3043\u3002\u3042\u305f\u3044\u3052\u3047\u3093\u5b9f\u5bb6\u3093\u65b9\u306f\u30c0\u30d6\u30eb\u706b\u5c71\u3084\u9ce5\u30a4\u30f3\u30d5\u30eb\u3067\u5927\u5909\u3084\u3063\u3069\u3002\u6771\u4eac\u3093\u826f\u304b\u3068\u3053\u306f\u5929\u6c17\u306e\u5fc3\u914d\u305b\u305a\u66ae\u3089\u305b\u308b\u3068\u3053\u3058\u3083\u3063\u3069\u3093\u3002","id":30607912309096448,"from_user_id":164951488,"to_user":"ecco_HIRADO","geo":null,"iso_language_code":"ja","to_user_id_str":"105078670","source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"10456803","profile_image_url":"http://a1.twimg.com/profile_images/145280215/vot_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:43:37 +0000","from_user":"vot_","id_str":"30606853377363968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3086\u3063\u304f\u308a\u5929\u6c17\u4e88\u5831\u3067\u3059\u3002\u6771\u4eac\u90fd,\u5927\u5cf6\u5730\u65b9\u300228\u65e5\uff08\u91d1\u66dc\u65e5\u306e\u5929\u6c17\u306f\u6674\u308c\u306e\u3061\u66c7\u308a\u3001\u6700\u9ad8\u6c17\u6e29\u306f7\u5ea6 \u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3057\u3087\u3046\u3002","id":30606853377363968,"from_user_id":10456803,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://voiceoftwitter.com" rel="nofollow">\uff56\uff4f\uff49\uff43\uff45 \uff4f\uff46 \uff54\uff57\uff49\uff54\uff54\uff45\uff52</a>"},{"from_user_id_str":"23900716","profile_image_url":"http://a3.twimg.com/profile_images/1092646332/twitter_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:38:00 +0000","from_user":"keiyama","id_str":"30605442639990784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u30c8\u30e2\u30b3\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/27(\u6728)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3tuekm #bt_tenki","id":30605442639990784,"from_user_id":23900716,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"32018516","profile_image_url":"http://a0.twimg.com/profile_images/1089472069/237_normal.jpg","created_at":"Thu, 27 Jan 2011 12:36:28 +0000","from_user":"DigJandG","id_str":"30605057460281344","metadata":{"result_type":"recent"},"to_user_id":196050661,"text":"@kosumoworld55 \u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3044\u3064\u3082\u601d\u3046\u3093\u3060\u3002\u4f55\u3067\u6a2a\u6d5c\u3042\u305f\u308a\u306f\u3044\u3064\u3082\u597d\u3044\u5929\u6c17\u306a\u3093\u3060\u3002\u6771\u4eac\u3082\u3002\u3061\u306a\u307f\u306b\u516c\u9b5a\u306f\u3042\u3093\u307e\u308a\u597d\u304d\u3067\u306f\u3042\u308a\u307e\u305b\u3093\u3002\u306a\u3093\u304b\u81ed\u304f\u3063\u3066\u3002\u3067\u3082\u3001\u7435\u7436\u6e56\u3067\u516c\u9b5a\u3063\u3066\u3042\u307e\u308a\u805e\u304b\u306a\u3044\u69d8\u306a\u30fb\u30fb\u30fb\u3002\u4ffa\u304c\u91e3\u308a\u3092\u3057\u306a\u3044\u304b\u3089\u304b\u306a\uff1f","id":30605057460281344,"from_user_id":32018516,"to_user":"kosumoworld55","geo":null,"iso_language_code":"ja","to_user_id_str":"196050661","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"90935348","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 12:34:34 +0000","from_user":"sorakeiko","id_str":"30604575937396737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u95a2\u6771\u5730\u65b9\u306e\u660e\u65e5\u306e\u5929\u6c17\u2015\u7d9a\u304d\u3002\u660e\u65e5\u671d\u6700\u4f4e\u6c17\u6e29\u30fb\u8ed2\u4e26\u307f\u6c37\u70b9\u4e0b\u30fb\u5b87\u90fd\u5bae\u3001\u6c34\u6238\u30de\u30a4\u30ca\u30b95\u5ea6\u30fb\u6771\u4eac\u3001\u6a2a\u6d5c1\u5ea6\u3002\u6700\u9ad8\u6c17\u6e29\u30fb\u4eca\u65e5\u3088\u308a3\u5ea6\u524d\u5f8c\u4f4e\u304f5\uff5e8\u5ea6\u30fb\u6771\u4eac\u3001\u5343\u84498\u5ea6\u3002\u5411\u3053\u3046\u4e00\u9031\u9593\u30fb\u4e7e\u71e5\u3057\u305f\u6674\u308c\u7d9a\u304f\u30fb\uff08\u571f\uff09\u4f0a\u8c46\u8af8\u5cf6\u306b\u51b7\u305f\u3044\u96e8\u3084\u96ea\u304c\u898b\u3089\u308c\u305d\u3046\u3060\u304c\u3001\u95a2\u6771\u306e\u4e7e\u3044\u305f\u72b6\u614b\u7d9a\u304f\u3002","id":30604575937396737,"from_user_id":90935348,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"6113557","profile_image_url":"http://a3.twimg.com/profile_images/1227080026/profile_red_herencia_normal.png","created_at":"Thu, 27 Jan 2011 12:33:57 +0000","from_user":"fmoto7","id_str":"30604423327653888","metadata":{"result_type":"recent"},"to_user_id":null,"text":""\u6771\u4eac\u6c34\u904b\u7528\u30bb\u30f3\u30bf\u30fc\u306f\u3001\u524d\u534a\u6226\u304c\u7d42\u308f\u3063\u305f\u3068\u3053\u308d\u3067\u4e00\u6c17\u306b\u6c34\u5727\u9ad8\u3081\u3001\u5f8c\u534a\u6226\u59cb\u307e\u308b\u3068\u6c34\u5727\u4e0b\u3052\u3001\u7d42\u308f\u308b\u3068\u307e\u305f\u3059\u3050\u4e0a\u3052\u308b\u3002\u30c6\u30ec\u30d3\u306e\u8996\u8074\u3001\u305d\u306e\u65e5\u306e\u5929\u6c17\u306a\u3069\u30e9\u30a4..." http://tumblr.com/xjy1cwiwrm","id":30604423327653888,"from_user_id":6113557,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tumblr.com/" rel="nofollow">Tumblr</a>"},{"from_user_id_str":"118092912","profile_image_url":"http://a3.twimg.com/profile_images/1225330653/____normal.PNG","created_at":"Thu, 27 Jan 2011 12:29:13 +0000","from_user":"saechuchun","id_str":"30603231042207744","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3082\u5730\u9707\u306e\u8a71\u984c\u306e\u3068\u304d\u306e\u300c\u3082\u3057\u6771\u4eac\u3067\u76f4\u4e0b\u578b\u5730\u9707\u304c\u8d77\u304d\u305f\u3089\u300d\u3068\u304b\u5929\u6c17\u4e88\u5831\u306e\u3068\u304d\u306f\u897f\u3067\u96e8\u3060\u308d\u3046\u3068\u300c\u6771\u4eac\u3067\u306f\u301c\u65e5\u9593\u4e7e\u71e5\u3057\u3066\u307e\u3059\u306d\u30fc\u300d\u3068\u304b\u305d\u3046\u3044\u3046\u30ad\u30fc\u5c40\u306e\u95a2\u6771\u4e2d\u5fc3\u4e3b\u7fa9\u306f\u597d\u304d\u3067\u306f\u306a\u3044","id":30603231042207744,"from_user_id":118092912,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&rpp=50&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":50,"page":1,"completed_in":0.170202,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}attoparsec-0.13.2.4/benchmarks/json-data/numbers.json0000755000000000000000000003121407346545000020644 0ustar0000000000000000[1.15, 1.3224999999999998, 1.5208749999999998, 1.7490062499999994, 2.0113571874999994, 2.313060765624999, 2.6600198804687487, 3.0590228625390607, 3.5178762919199196, 4.045557735707907, 4.652391396064092, 5.350250105473706, 6.152787621294761, 7.075705764488975, 8.137061629162321, 9.357620873536668, 10.761264004567169, 12.375453605252241, 14.231771646040077, 16.36653739294609, 18.821518001888, 21.644745702171196, 24.891457557496874, 28.625176191121405, 32.918952619789614, 37.856795512758055, 43.535314839671756, 50.06561206562252, 57.57545387546589, 66.21177195678577, 76.14353775030362, 87.56506841284916, 100.69982867477653, 115.804802975993, 133.17552342239193, 153.15185193575073, 176.1246297261133, 202.5433241850303, 232.9248228127848, 267.86354623470254, 308.04307816990786, 354.24953989539404, 407.3869708797031, 468.49501651165855, 538.7692689884072, 619.5846593366683, 712.5223582371685, 819.4007119727437, 942.3108187686552, 1083.6574415839534, 1246.2060578215462, 1433.136966494778, 1648.1075114689947, 1895.323638189344, 2179.622183917745, 2506.565511505407, 2882.5503382312177, 3314.9328889659, 3812.172822310785, 4383.998745657402, 5041.598557506012, 5797.838341131914, 6667.5140923017, 7667.641206146955, 8817.787387068996, 10140.455495129345, 11661.523819398746, 13410.752392308557, 15422.365251154839, 17735.720038828065, 20396.078044652273, 23455.489751350113, 26973.813214052625, 31019.885196160518, 35672.867975584595, 41023.79817192228, 47177.36789771062, 54253.97308236721, 62392.06904472228, 71750.87940143062, 82513.5113116452, 94890.53800839197, 109124.11870965076, 125492.73651609836, 144316.6469935131, 165964.14404254008, 190858.76564892105, 219487.5804962592, 252410.71757069806, 290272.32520630275, 333813.17398724816, 383885.1500853353, 441467.9225981356, 507688.1109878559, 583841.3276360342, 671417.5267814393, 772130.1557986551, 887949.6791684533, 1021142.1310437213, 1174313.4507002793, 1350460.4683053212, 1553029.5385511192, 1785983.969333787, 2053881.564733855, 2361963.7994439327, 2716258.369360523, 3123697.124764601, 3592251.6934792907, 4131089.447501184, 4750752.864626361, 5463365.794320315, 6282870.663468362, 7225301.262988616, 8309096.452436907, 9555460.920302443, 10988780.058347808, 12637097.067099977, 14532661.627164973, 16712560.871239718, 19219445.001925673, 22102361.752214525, 25417716.0150467, 29230373.417303704, 33614929.42989926, 38657168.84438414, 44455744.17104176, 51124105.79669802, 58792721.66620272, 67611629.91613312, 77753374.40355308, 89416380.56408603, 102828837.64869894, 118253163.29600377, 135991137.79040432, 156389808.45896497, 179848279.7278097, 206825521.68698114, 237849349.94002828, 273526752.4310325, 314555765.2956874, 361739130.09004045, 415999999.60354644, 478399999.5440784, 550159999.4756901, 632683999.3970436, 727586599.3066001, 836724589.20259, 962233277.5829784, 1106568269.2204251, 1272553509.6034887, 1463436536.044012, 1682952016.4506137, 1935394818.9182055, 2225704041.755936, 2559559648.019326, 2943493595.222225, 3385017634.5055585, 3892770279.681392, 4476685821.6336, 5148188694.87864, 5920416999.1104355, 6808479548.977001, 7829751481.32355, 9004214203.522081, 10354846334.050394, 11908073284.157951, 13694284276.781643, 15748426918.29889, 18110690956.04372, 20827294599.450275, 23951388789.367817, 27544097107.772987, 31675711673.938934, 36427068425.02977, 41891128688.78423, 48174797992.10186, 55401017690.91714, 63711170344.5547, 73267845896.2379, 84258022780.67358, 96896726197.77461, 111431235127.4408, 128145920396.5569, 147367808456.04044, 169472979724.44647, 194893926683.11343, 224128015685.58044, 257747218038.41748, 296409300744.1801, 340870695855.80707, 392001300234.1781, 450801495269.3048, 518421719559.70044, 596184977493.6555, 685612724117.7037, 788454632735.3593, 906722827645.6631, 1042731251792.5125, 1199140939561.3892, 1379012080495.5974, 1585863892569.937, 1823743476455.4275, 2097304997923.7415, 2411900747612.3022, 2773685859754.1475, 3189738738717.2695, 3668199549524.8594, 4218429481953.5884, 4851193904246.626, 5578872989883.619, 6415703938366.162, 7378059529121.086, 8484768458489.248, 9757483727262.635, 11221106286352.03, 12904272229304.832, 14839913063700.555, 17065900023255.637, 19625785026743.98, 22569652780755.58, 25955100697868.91, 29848365802549.246, 34325620672931.63, 39474463773871.375, 45395633339952.07, 52204978340944.88, 60035725092086.61, 69041083855899.59, 79397246434284.53, 91306833399427.2, 105002858409341.27, 120753287170742.45, 138866280246353.81, 159696222283306.88, 183650655625802.88, 211198253969673.3, 242877992065124.28, 279309690874892.9, 321206144506126.8, 369387066182045.8, 424795126109352.6, 488514395025755.5, 561791554279618.75, 646060287421561.5, 742969330534795.8, 854414730115015.0, 982576939632267.1, 1129963480577107.2, 1299458002663673.2, 1494376703063224.0, 1718533208522707.5, 1976313189801113.5, 2272760168271280.5, 2613674193511972.0, 3005725322538767.5, 3456584120919582.5, 3975071739057519.5, 4571332499916147.0, 5257032374903569.0, 6045587231139104.0, 6952425315809969.0, 7995289113181464.0, 9194582480158682.0, 1.0573769852182484e+16, 1.2159835330009856e+16, 1.3983810629511332e+16, 1.6081382223938032e+16, 1.8493589557528736e+16, 2.1267627991158044e+16, 2.4457772189831748e+16, 2.8126438018306508e+16, 3.234540372105248e+16, 3.719721427921035e+16, 4.27767964210919e+16, 4.919331588425568e+16, 5.657231326689403e+16, 6.505816025692813e+16, 7.481688429546734e+16, 8.603941693978744e+16, 9.894532948075555e+16, 1.1378712890286886e+17, 1.3085519823829918e+17, 1.5048347797404406e+17, 1.7305599967015066e+17, 1.9901439962067325e+17, 2.288665595637742e+17, 2.6319654349834032e+17, 3.026760250230913e+17, 3.48077428776555e+17, 4.002890430930382e+17, 4.603323995569939e+17, 5.29382259490543e+17, 6.087895984141244e+17, 7.00108038176243e+17, 8.051242439026793e+17, 9.258928804880812e+17, 1.0647768125612933e+18, 1.224493334445487e+18, 1.4081673346123103e+18, 1.6193924348041567e+18, 1.8623013000247798e+18, 2.1416464950284966e+18, 2.462893469282771e+18, 2.8323274896751867e+18, 3.257176613126464e+18, 3.7457531050954337e+18, 4.3076160708597484e+18, 4.95375848148871e+18, 5.696822253712016e+18, 6.551345591768818e+18, 7.53404743053414e+18, 8.66415454511426e+18, 9.963777726881399e+18, 1.1458344385913608e+19, 1.3177096043800648e+19, 1.5153660450370744e+19, 1.7426709517926355e+19, 2.0040715945615307e+19, 2.30468233374576e+19, 2.650384683807624e+19, 3.047942386378767e+19, 3.505133744335582e+19, 4.030903805985919e+19, 4.635539376883806e+19, 5.330870283416377e+19, 6.130500825928833e+19, 7.0500759498181575e+19, 8.10758734229088e+19, 9.323725443634512e+19, 1.0722284260179688e+20, 1.233062689920664e+20, 1.4180220934087634e+20, 1.6307254074200778e+20, 1.8753342185330894e+20, 2.1566343513130526e+20, 2.4801295040100103e+20, 2.8521489296115116e+20, 3.2799712690532385e+20, 3.7719669594112236e+20, 4.337762003322907e+20, 4.988426303821342e+20, 5.7366902493945437e+20, 6.597193786803724e+20, 7.586772854824282e+20, 8.724788783047925e+20, 1.0033507100505113e+21, 1.1538533165580878e+21, 1.326931314041801e+21, 1.5259710111480708e+21, 1.7548666628202813e+21, 2.0180966622433234e+21, 2.3208111615798217e+21, 2.668932835816795e+21, 3.0692727611893135e+21, 3.529663675367711e+21, 4.059113226672867e+21, 4.667980210673796e+21, 5.368177242274866e+21, 6.173403828616095e+21, 7.099414402908508e+21, 8.164326563344784e+21, 9.388975547846502e+21, 1.0797321880023475e+22, 1.2416920162026996e+22, 1.4279458186331043e+22, 1.64213769142807e+22, 1.8884583451422802e+22, 2.171727096913622e+22, 2.497486161450665e+22, 2.872109085668265e+22, 3.3029254485185042e+22, 3.798364265796279e+22, 4.368118905665721e+22, 5.0233367415155795e+22, 5.7768372527429155e+22, 6.643362840654352e+22, 7.639867266752504e+22, 8.78584735676538e+22, 1.0103724460280185e+23, 1.1619283129322213e+23, 1.3362175598720545e+23, 1.5366501938528623e+23, 1.7671477229307915e+23, 2.0322198813704103e+23, 2.3370528635759717e+23, 2.687610793112367e+23, 3.090752412079222e+23, 3.554365273891105e+23, 4.0875200649747705e+23, 4.700648074720986e+23, 5.405745285929133e+23, 6.216607078818502e+23, 7.149098140641278e+23, 8.221462861737468e+23, 9.454682290998088e+23, 1.0872884634647801e+24, 1.250381732984497e+24, 1.4379389929321714e+24, 1.653629841871997e+24, 1.9016743181527962e+24, 2.1869254658757156e+24, 2.5149642857570727e+24, 2.8922089286206334e+24, 3.326040267913728e+24, 3.824946308100787e+24, 4.3986882543159046e+24, 5.05849149246329e+24, 5.817265216332783e+24, 6.6898549987827e+24, 7.693333248600105e+24, 8.84733323589012e+24, 1.0174433221273637e+25, 1.1700598204464681e+25, 1.3455687935134384e+25, 1.547404112540454e+25, 1.779514729421522e+25, 2.04644193883475e+25, 2.353408229659962e+25, 2.7064194641089563e+25, 3.1123823837253e+25, 3.5792397412840944e+25, 4.116125702476708e+25, 4.733544557848214e+25, 5.443576241525446e+25, 6.260112677754262e+25, 7.199129579417401e+25, 8.27899901633001e+25, 9.52084886877951e+25, 1.0948976199096437e+26, 1.25913226289609e+26, 1.4480021023305035e+26, 1.665202417680079e+26, 1.9149827803320907e+26, 2.202230197381904e+26, 2.5325647269891895e+26, 2.9124494360375676e+26, 3.349316851443203e+26, 3.8517143791596826e+26, 4.429471536033635e+26, 5.09389226643868e+26, 5.857976106404481e+26, 6.736672522365153e+26, 7.747173400719924e+26, 8.909249410827912e+26, 1.0245636822452099e+27, 1.1782482345819913e+27, 1.35498546976929e+27, 1.5582332902346833e+27, 1.7919682837698857e+27, 2.0607635263353683e+27, 2.3698780552856732e+27, 2.725359763578524e+27, 3.1341637281153025e+27, 3.6042882873325974e+27, 4.1449315304324867e+27, 4.7666712599973594e+27, 5.481671948996963e+27, 6.303922741346507e+27, 7.249511152548482e+27, 8.336937825430755e+27, 9.587478499245366e+27, 1.102560027413217e+28, 1.2679440315251995e+28, 1.4581356362539794e+28, 1.6768559816920761e+28, 1.9283843789458875e+28, 2.2176420357877703e+28, 2.5502883411559357e+28, 2.932831592329326e+28, 3.3727563311787245e+28, 3.8786697808555327e+28, 4.460470247983863e+28, 5.129540785181441e+28, 5.8989719029586575e+28, 6.783817688402455e+28, 7.801390341662823e+28, 8.971598892912247e+28, 1.0317338726849081e+29, 1.1864939535876443e+29, 1.3644680466257909e+29, 1.5691382536196593e+29, 1.8045089916626083e+29, 2.0751853404119993e+29, 2.3864631414737988e+29, 2.7444326126948684e+29, 3.1560975045990984e+29, 3.629512130288963e+29, 4.173938949832307e+29, 4.800029792307153e+29, 5.520034261153225e+29, 6.348039400326208e+29, 7.300245310375139e+29, 8.39528210693141e+29, 9.65457442297112e+29, 1.1102760586416787e+30, 1.2768174674379305e+30, 1.46834008755362e+30, 1.6885911006866628e+30, 1.941879765789662e+30, 2.2331617306581113e+30, 2.568135990256828e+30, 2.9533563887953516e+30, 3.396359847114654e+30, 3.905813824181852e+30, 4.491685897809129e+30, 5.165438782480498e+30, 5.940254599852573e+30, 6.831292789830458e+30, 7.855986708305026e+30, 9.034384714550779e+30, 1.0389542421733396e+31, 1.1947973784993405e+31, 1.3740169852742412e+31, 1.5801195330653773e+31, 1.817137463025184e+31, 2.0897080824789613e+31, 2.4031642948508052e+31, 2.7636389390784257e+31, 3.1781847799401893e+31, 3.6549124969312175e+31, 4.2031493714709e+31, 4.833621777191535e+31, 5.558665043770264e+31, 6.392464800335803e+31, 7.3513345203861735e+31, 8.454034698444098e+31, 9.722139903210713e+31, 1.1180460888692319e+32, 1.2857530021996165e+32, 1.478615952529559e+32, 1.7004083454089925e+32, 1.9554695972203414e+32, 2.2487900368033926e+32, 2.586108542323901e+32, 2.974024823672486e+32, 3.420128547223359e+32, 3.933147829306862e+32, 4.523120003702891e+32, 5.2015880042583246e+32, 5.981826204897073e+32, 6.879100135631634e+32, 7.910965155976377e+32, 9.097609929372833e+32, 1.0462251418778757e+33, 1.2031589131595571e+33, 1.3836327501334904e+33, 1.591177662653514e+33, 1.8298543120515409e+33, 2.104332458859272e+33, 2.4199823276881623e+33, 2.7829796768413863e+33, 3.200426628367594e+33, 3.6804906226227334e+33, 4.232564216016143e+33, 4.867448848418564e+33, 5.597566175681348e+33, 6.437201102033549e+33, 7.402781267338582e+33, 8.513198457439368e+33, 9.790178226055273e+33, 1.1258704959963564e+34, 1.2947510703958096e+34, 1.488963730955181e+34, 1.712308290598458e+34, 1.9691545341882266e+34, 2.2645277143164603e+34, 2.604206871463929e+34, 2.994837902183518e+34, 3.4440635875110457e+34, 3.960673125637702e+34, 4.554774094483357e+34, 5.237990208655861e+34, 6.023688739954239e+34, 6.927242050947375e+34, 7.96632835858948e+34, 9.161277612377902e+34, 1.0535469254234585e+35, 1.2115789642369772e+35, 1.3933158088725236e+35, 1.6023131802034022e+35, 1.8426601572339122e+35, 2.119059180818999e+35, 2.4369180579418488e+35, 2.8024557666331258e+35, 3.2228241316280944e+35, 3.706247751372308e+35, 4.262184914078154e+35, 4.901512651189877e+35, 5.636739548868358e+35, 6.482250481198611e+35, 7.454588053378403e+35, 8.572776261385162e+35, 9.858692700592935e+35, 1.1337496605681875e+36, 1.3038121096534156e+36, 1.499383926101428e+36, 1.7242915150166418e+36, 1.982935242269138e+36, 2.2803755286095084e+36] attoparsec-0.13.2.4/benchmarks/json-data/twitter1.json0000755000000000000000000000152607346545000020757 0ustar0000000000000000{"results":[{"from_user_id_str":"80430860","profile_image_url":"http://a2.twimg.com/profile_images/536455139/icon32_normal.png","created_at":"Wed, 26 Jan 2011 07:07:02 +0000","from_user":"kazu_yamamoto","id_str":"30159761706061824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell Server Pages \u3063\u3066\u3001\u307e\u3060\u7d9a\u3044\u3066\u3044\u305f\u306e\u304b\uff01","id":30159761706061824,"from_user_id":80430860,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30159761706061824,"since_id":0,"refresh_url":"?since_id=30159761706061824&q=haskell","next_page":"?page=2&max_id=30159761706061824&rpp=1&q=haskell","results_per_page":1,"page":1,"completed_in":0.012606,"since_id_str":"0","max_id_str":"30159761706061824","query":"haskell"}attoparsec-0.13.2.4/benchmarks/json-data/twitter10.json0000755000000000000000000001470107346545000021036 0ustar0000000000000000{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=10&q=haskell","results_per_page":10,"page":1,"completed_in":0.012714,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}attoparsec-0.13.2.4/benchmarks/json-data/twitter100.json0000755000000000000000000017302307346545000021121 0ustar0000000000000000{"results":[{"from_user_id_str":"3646730","profile_image_url":"http://a3.twimg.com/profile_images/404973767/avatar_normal.jpg","created_at":"Wed, 26 Jan 2011 04:35:07 +0000","from_user":"nicolaslara","id_str":"30121530767708160","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 Python y Clojure. Obviamente son diferentes, y cada uno tiene sus ventajas y desventajas. De Haskell faltar\u00eda pattern matching","id":30121530767708160,"from_user_id":3646730,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://friendfeed.com" rel="nofollow">FriendFeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy & Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":""Social safety net into a hammock." So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that "knowledge engine" again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision & speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twmode.sf.net/" rel="nofollow">twmode</a>"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://tommorris.org/" rel="nofollow">tommorris' hacksample</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://identi.ca" rel="nofollow">identica</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"5912444","profile_image_url":"http://a2.twimg.com/profile_images/546261026/ssf0xg11_normal.jpg","created_at":"Wed, 26 Jan 2011 00:45:45 +0000","from_user":"shelarcy","id_str":"30063810773516288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @Hackage: download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30063810773516288,"from_user_id":5912444,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:41:00 +0000","from_user":"kudzu_naoki","id_str":"30062613287141376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u9b54\u6cd5Haskell\u5c11\u5973\u5019\u88dc\u3092\u63a2\u3059\u306e\u3082\u5927\u5909\u306a\u3093\u3060","id":30062613287141376,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:40:25 +0000","from_user":"omasanori","id_str":"30062465656033280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5Haskell\u5c11\u5973\u306e\u4e00\u65e5\u306fGHC HEAD\u306e\u30d3\u30eb\u30c9\u304b\u3089\u59cb\u307e\u308b","id":30062465656033280,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:37:12 +0000","from_user":"omasanori","id_str":"30061656331526144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061656331526144,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:35:42 +0000","from_user":"kudzu_naoki","id_str":"30061282665168896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061282665168896,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"1631333","profile_image_url":"http://a1.twimg.com/profile_images/81268862/profile300_normal.jpg","created_at":"Wed, 26 Jan 2011 00:30:02 +0000","from_user":"qnighy","id_str":"30059855884582913","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30059855884582913,"from_user_id":1631333,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9093754","profile_image_url":"http://a1.twimg.com/profile_images/99435906/PHD_3d_col_blk_normal.jpg","created_at":"Wed, 26 Jan 2011 00:26:20 +0000","from_user":"phdwine","id_str":"30058925516656640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Last weekend of Tri Nations Tasting with PHD wines at Haskell Vineyards. Hope you didn't miss the Pinot Noir tasting last week !","id":30058925516656640,"from_user_id":9093754,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"2119923","profile_image_url":"http://a2.twimg.com/profile_images/1096701078/djayprofile_normal.jpg","created_at":"Wed, 26 Jan 2011 00:21:14 +0000","from_user":"djay75","id_str":"30057639543050240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30057639543050240,"from_user_id":2119923,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"134323731","profile_image_url":"http://a2.twimg.com/profile_images/1225818824/IMG00518-20110125-1547_normal.jpg","created_at":"Wed, 26 Jan 2011 00:19:30 +0000","from_user":"PrinceOfBrkeley","id_str":"30057205554216960","metadata":{"result_type":"recent"},"to_user_id":167093027,"text":"@PayThaPrince go to haskell.","id":30057205554216960,"from_user_id":134323731,"to_user":"PayThaPrince","geo":null,"iso_language_code":"en","to_user_id_str":"167093027","source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"705857","profile_image_url":"http://a1.twimg.com/profile_images/429483912/ben_twitter_normal.jpg","created_at":"Wed, 26 Jan 2011 00:03:28 +0000","from_user":"bennadel","id_str":"30053166972141569","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Using #Homebrew to install Haskell - the last of the Seven Languages (in Seven Weeks) http://bit.ly/eA9Cv1 This has been some journey.","id":30053166972141569,"from_user_id":705857,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"251466","profile_image_url":"http://a2.twimg.com/profile_images/1194100934/pass_normal.jpg","created_at":"Wed, 26 Jan 2011 00:02:54 +0000","from_user":"simonszu","id_str":"30053025502466048","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Ouh yeah! Ich werde doch produktiv sein, diese Semesterferien. Ich werde funktional Programmieren lernen. #haskell, Baby.","id":30053025502466048,"from_user_id":251466,"geo":null,"iso_language_code":"de","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"357786","profile_image_url":"http://a0.twimg.com/profile_images/612044841/FM_2010_normal.jpg","created_at":"Tue, 25 Jan 2011 23:59:13 +0000","from_user":"diligiant","id_str":"30052100973006848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @paulrbrown: "...we only discovered a single bug after compilation." (http://t.co/K0wlEYz) #haskell","id":30052100973006848,"from_user_id":357786,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"101597523","profile_image_url":"http://a1.twimg.com/profile_images/1206183256/2010-12-12-204902_normal.jpg","created_at":"Tue, 25 Jan 2011 23:54:46 +0000","from_user":"wlad_kent","id_str":"30050977964892160","metadata":{"result_type":"recent"},"to_user_id":86297184,"text":"@Nilson_Neto Isso eh bem basico. quando vc estiver estudando recurs\u00e3o em Haskell, ai vc vai ver oq eh papo de nerd - kkk - 1\u00ba periodo isso.","id":30050977964892160,"from_user_id":101597523,"to_user":"Nilson_Neto","geo":null,"iso_language_code":"pt","to_user_id_str":"86297184","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 23:51:22 +0000","from_user":"listwarenet","id_str":"30050123383832577","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84336-haskell-cafe-monomorphic-let-bindings-and-darcs.html Haskell-cafe - Monomorph","id":30050123383832577,"from_user_id":144546280,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"5776901","profile_image_url":"http://a0.twimg.com/profile_images/472682157/lucabw_normal.JPG","created_at":"Tue, 25 Jan 2011 23:48:40 +0000","from_user":"lsbardel","id_str":"30049446469312512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Very interesting technology stack these guys use http://bit.ly/ghAjS7 #python #redis #haskell","id":30049446469312512,"from_user_id":5776901,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"3005901","profile_image_url":"http://a0.twimg.com/profile_images/278943006/Lone_Pine_Peak_-_Peter_200x200_normal.jpg","created_at":"Tue, 25 Jan 2011 23:45:48 +0000","from_user":"pmonks","id_str":"30048721110573056","metadata":{"result_type":"recent"},"to_user_id":203834278,"text":"@techielicous Haskell: http://bit.ly/gy3oFi ;-)","id":30048721110573056,"from_user_id":3005901,"to_user":"techielicous","geo":null,"iso_language_code":"en","to_user_id_str":"203834278","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"162697074","profile_image_url":"http://a2.twimg.com/profile_images/826205838/ryan3_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:47 +0000","from_user":"TheRonaldMCD","id_str":"30048468781244416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Aldi Food Market (4122 Gaston Ave, Haskell, Dallas) http://4sq.com/ekqRY7","id":30048468781244416,"from_user_id":162697074,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"203834278","profile_image_url":"http://a0.twimg.com/profile_images/1223375080/me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:04 +0000","from_user":"techielicous","id_str":"30048286589067264","metadata":{"result_type":"recent"},"to_user_id":3005901,"text":"@pmonks I was thinking Haskell or Scheme","id":30048286589067264,"from_user_id":203834278,"to_user":"pmonks","geo":null,"iso_language_code":"en","to_user_id_str":"3005901","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"537690","profile_image_url":"http://a3.twimg.com/profile_images/45665122/nushiostamp_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:14 +0000","from_user":"nushio","id_str":"30046818658164737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u3046\u3044\u3084\u5951\u7d04\u306b\u3088\u308b\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0\u3068\u304b\u3042\u3063\u305f\u306a\u3002Haskell\u306a\u3093\u304b\u3088\u308a\u3042\u3063\u3061\u306e\u65b9\u304c\u9b54\u6cd5\u5c11\u5973\u547c\u3070\u308f\u308a\u306b\u3075\u3055\u308f\u3057\u3044\u3002","id":30046818658164737,"from_user_id":537690,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"181192","profile_image_url":"http://a2.twimg.com/profile_images/1089890701/q530888600_9828_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:03 +0000","from_user":"aodag","id_str":"30046772223016960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046772223016960,"from_user_id":181192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"5886055","profile_image_url":"http://a3.twimg.com/profile_images/85531669/ichi_normal.jpg","created_at":"Tue, 25 Jan 2011 23:37:53 +0000","from_user":"kanaya","id_str":"30046729243983873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9e97\u3057\u3044\u3002\u201c@omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d\u201d","id":30046729243983873,"from_user_id":5886055,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/app/twitter/id333903271?mt=8" rel="nofollow">Twitter for iPad</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Tue, 25 Jan 2011 23:36:26 +0000","from_user":"omasanori","id_str":"30046367187476481","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046367187476481,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"1659992","profile_image_url":"http://a1.twimg.com/profile_images/504488750/1_normal.jpg","created_at":"Tue, 25 Jan 2011 23:16:13 +0000","from_user":"finalfusion","id_str":"30041278544609280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30041278544609280,"from_user_id":1659992,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"272513","profile_image_url":"http://a2.twimg.com/profile_images/320244078/Mike_Painting2_normal.png","created_at":"Tue, 25 Jan 2011 23:05:09 +0000","from_user":"mikehadlow","id_str":"30038492373319680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just written the same simple program in C#, F# and Haskell: 18, 12 and 9 LoC respectively. And I'm much better at C# than F# or Haskell.","id":30038492373319680,"from_user_id":272513,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"89393264","profile_image_url":"http://a0.twimg.com/profile_images/1169486472/020_portland_me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:01:28 +0000","from_user":"newsportlandme","id_str":"30037564589084673","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Governor's Choice to Run Maine DOC Under Scrutiny - MPBN: State Rep. Anne Haskell, a Portland Democrat, says Mai... http://bit.ly/fO30gC","id":30037564589084673,"from_user_id":89393264,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"38138","profile_image_url":"http://a3.twimg.com/profile_images/1212565885/Screen_shot_2011-01-11_at_5.28.47_PM_normal.png","created_at":"Tue, 25 Jan 2011 22:59:55 +0000","from_user":"michaelneale","id_str":"30037174615281664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The haskell EvilMangler http://t.co/P2Tls7J","id":30037174615281664,"from_user_id":38138,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"45692","profile_image_url":"http://a3.twimg.com/profile_images/1177741507/dogkarno_r_normal.jpg","created_at":"Tue, 25 Jan 2011 22:45:06 +0000","from_user":"karno","id_str":"30033448286552064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3063\u3066\u95a2\u6570\u306b\u30ab\u30ec\u30fc\u7c89\u3076\u3061\u8fbc\u3080\u3068\u304b\u306a\u3093\u3068\u304b","id":30033448286552064,"from_user_id":45692,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://yubitter.com/" rel="nofollow">yubitter</a>"},{"from_user_id_str":"27605","profile_image_url":"http://a2.twimg.com/profile_images/15826632/meron_normal.jpg","created_at":"Tue, 25 Jan 2011 22:44:23 +0000","from_user":"celeron1ghz","id_str":"30033268761956352","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30033268761956352,"from_user_id":27605,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:43:30 +0000","from_user":"necocen","id_str":"30033044035346432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3042Haskell\u77e5\u3089\u3093\u3057\u306d","id":30033044035346432,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:42:54 +0000","from_user":"necocen","id_str":"30032894856531968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30032894856531968,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"10821270","profile_image_url":"http://a0.twimg.com/profile_images/1195474259/Salto_Marlon_normal.jpg","created_at":"Tue, 25 Jan 2011 22:35:09 +0000","from_user":"jjedMoriAnktah","id_str":"30030942106025984","metadata":{"result_type":"recent"},"to_user_id":null,"text":""A Haskell program that outputs a Python program that outputs a Ruby program that outputs the original Haskell program" http://is.gd/E6Julu","id":30030942106025984,"from_user_id":10821270,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"7554762","profile_image_url":"http://a0.twimg.com/profile_images/100515212/ajay-photo_normal.jpg","created_at":"Tue, 25 Jan 2011 22:34:30 +0000","from_user":"comatose_kid","id_str":"30030780205899776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @bumptech: Bump Dev Blog - Why we use Haskell at Bump http://devblog.bu.mp/haskell-at-bump","id":30030780205899776,"from_user_id":7554762,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"148474705","profile_image_url":"http://a0.twimg.com/profile_images/1119234716/fur_hat_-_gilbeys_vodka_-_life_-_11-30-1962_normal.JPG","created_at":"Tue, 25 Jan 2011 22:29:19 +0000","from_user":"landmvintage","id_str":"30029476003840000","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @faerymoongodess: Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30029476003840000,"from_user_id":148474705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"37715508","profile_image_url":"http://a1.twimg.com/profile_images/1207891411/ballerina_normal.jpg","created_at":"Tue, 25 Jan 2011 22:24:52 +0000","from_user":"faerymoongodess","id_str":"30028356326002688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30028356326002688,"from_user_id":37715508,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 22:17:16 +0000","from_user":"Hackage","id_str":"30026442456694784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"base16-bytestring 0.1.0.0, added by BryanOSullivan: Fast base16 (hex) encoding and deconding for ByteStrings http://bit.ly/eu75TN","id":30026442456694784,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"199750997","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 22:12:07 +0000","from_user":"benreads","id_str":"30025146991382528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Writing Systems Software in a Functional Language -- brief, but fun. I want to see how well they can make Systems Haskell perform at scale.","id":30025146991382528,"from_user_id":199750997,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"35359797","profile_image_url":"http://a1.twimg.com/profile_images/1173453785/48893_521140819_1896062_q_normal.jpg","created_at":"Tue, 25 Jan 2011 22:09:45 +0000","from_user":"jcawthorne1","id_str":"30024549265309696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just saw Jeff Haskell give the middle finger!! Lol awesome","id":30024549265309696,"from_user_id":35359797,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Tue, 25 Jan 2011 22:06:44 +0000","from_user":"goodfox","id_str":"30023790381498369","metadata":{"result_type":"recent"},"to_user_id":null,"text":"At the Haskell Convocation. (@ Haskell Indian Nations U Auditorium) http://4sq.com/eKKXyn","id":30023790381498369,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"14674418","profile_image_url":"http://a2.twimg.com/profile_images/238230125/IMG_1030-1_normal.jpg","created_at":"Tue, 25 Jan 2011 22:02:31 +0000","from_user":"sanityinc","id_str":"30022731919523840","metadata":{"result_type":"recent"},"to_user_id":371289,"text":"@xshay Haskell's great, but Clojure's similarly lazy in all the ways that matter, and is more practical for day-to-day use.","id":30022731919523840,"from_user_id":14674418,"to_user":"xshay","geo":null,"iso_language_code":"en","to_user_id_str":"371289","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"371289","profile_image_url":"http://a2.twimg.com/profile_images/1113482439/me-brisbane_normal.jpg","created_at":"Tue, 25 Jan 2011 21:58:29 +0000","from_user":"xshay","id_str":"30021714444292096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just made a lazy sequence of prime numbers in haskell. I'm smitten.","id":30021714444292096,"from_user_id":371289,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"199453873","profile_image_url":"http://a3.twimg.com/a/1294785484/images/default_profile_3_normal.png","created_at":"Tue, 25 Jan 2011 21:48:40 +0000","from_user":"stackfeed","id_str":"30019243982454784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Practical Scala reference manual, for searching things like method names: Hello, \n\nInspired by\nHaskell API Searc... http://bit.ly/g4zWZQ","id":30019243982454784,"from_user_id":199453873,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:32 +0000","from_user":"aapnoot","id_str":"30018455189065728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018455189065728,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"aapnoot","id_str":"30018452601180160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30018452601180160,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"Hackage","id_str":"30018451867176960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018451867176960,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"138502705","profile_image_url":"http://a1.twimg.com/profile_images/1083845614/yclogo_normal.gif","created_at":"Tue, 25 Jan 2011 21:45:04 +0000","from_user":"newsyc100","id_str":"30018340839755777","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell improves log processing 4x over Python http://devblog.bu.mp/haskell-at-bump (http://bit.ly/gQxxR8)","id":30018340839755777,"from_user_id":138502705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://news.ycombinator.com" rel="nofollow">newsyc</a>"},{"from_user_id_str":"1578246","profile_image_url":"http://a0.twimg.com/profile_images/59312315/avatar_simpson_small_normal.jpg","created_at":"Tue, 25 Jan 2011 21:43:32 +0000","from_user":"magthe","id_str":"30017953801969665","metadata":{"result_type":"recent"},"to_user_id":null,"text":"New version of download uploaded to #hackage #haskell","id":30017953801969665,"from_user_id":1578246,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://api.supertweet.net" rel="nofollow">MyAuth API Proxy</a>"},{"from_user_id_str":"135838970","profile_image_url":"http://a2.twimg.com/profile_images/1079929891/logo_normal.png","created_at":"Tue, 25 Jan 2011 21:37:51 +0000","from_user":"reward999","id_str":"30016525180084224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Found Great Dane (Main & Haskell- Dallas): We found a great dane. 214-712-0000 http://bit.ly/fQ8iBw","id":30016525180084224,"from_user_id":135838970,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"137719265","profile_image_url":"http://a2.twimg.com/profile_images/1092224079/8__4__normal.jpg","created_at":"Tue, 25 Jan 2011 21:34:22 +0000","from_user":"WeiMatas","id_str":"30015646020411392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Fourth day Rez party Eddie Haskell County in second life \u2013 which took place in cabaret Tadd","id":30015646020411392,"from_user_id":137719265,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://dlvr.it" rel="nofollow">dlvr.it</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 21:33:21 +0000","from_user":"listwarenet","id_str":"30015392571195392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/83889-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Haskell-cafe -","id":30015392571195392,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"}],"max_id":30121530767708160,"since_id":0,"refresh_url":"?since_id=30121530767708160&q=haskell","next_page":"?page=2&max_id=30121530767708160&rpp=100&q=haskell","results_per_page":100,"page":1,"completed_in":1.195569,"since_id_str":"0","max_id_str":"30121530767708160","query":"haskell"}attoparsec-0.13.2.4/benchmarks/json-data/twitter20.json0000755000000000000000000002744007346545000021043 0ustar0000000000000000{"results":[{"from_user_id_str":"166199691","profile_image_url":"http://a2.twimg.com/profile_images/1252958188/38_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"_classicc","id_str":"41191052790603776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"my twitter is actin slow today.","id":41191052790603776,"from_user_id":166199691,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"138835410","profile_image_url":"http://a1.twimg.com/profile_images/1250985094/243321801_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"amereronday","id_str":"41191050307567616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter jail, here i come.","id":41191050307567616,"from_user_id":138835410,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"359548","profile_image_url":"http://a2.twimg.com/profile_images/53612334/don_otvos_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"donnyo","id_str":"41191050110451712","metadata":{"result_type":"recent"},"to_user_id":7074534,"text":"@stlsmallbiz I see there is currently a Twitter promo too....tempting....","id":41191050110451712,"from_user_id":359548,"to_user":"stlsmallbiz","geo":null,"iso_language_code":"en","place":{"id":"82b7b2f97b12261d","type":"poi","full_name":"Yammer Inc, San Francisco"},"to_user_id_str":"7074534","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"122523770","profile_image_url":"http://a0.twimg.com/profile_images/1073533262/11646_1076222405045_1810798478_156114_3663737_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"msBreChan","id_str":"41191049720238080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"so twitter gt spam now -_-","id":41191049720238080,"from_user_id":122523770,"geo":{"type":"Point","coordinates":[35.2213,-80.8276]},"iso_language_code":"en","place":{"id":"4d5ed95f830e9b41","type":"neighborhood","full_name":"Elizabeth, Charlotte"},"to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"229024950","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"NinaMaechik","id_str":"41191047853912064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Glad I can remember my twitter password! LOL! Hugs to Nick from his aunties...","id":41191047853912064,"from_user_id":229024950,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"215545822","profile_image_url":"http://a2.twimg.com/profile_images/1239909540/RTL_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"RightToLaugh","id_str":"41191047371558912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"#Bacon wrapped dates http://bit.ly/hUxVC9 Just like my grandma used to make http://twitter.com/#","id":41191047371558912,"from_user_id":215545822,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"217845526","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"TheShoeLooker","id_str":"41191047052804096","metadata":{"result_type":"recent"},"to_user_id":38033240,"text":"@ShoeDazzle love love love to twitter or blog about your deals and shoes!\ntheshoelooker.blogspot.com","id":41191047052804096,"from_user_id":217845526,"to_user":"shoedazzle","geo":null,"iso_language_code":"en","to_user_id_str":"38033240","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"24953438","profile_image_url":"http://a3.twimg.com/profile_images/1181252763/76820_10150100014748783_677998782_7386695_4377006_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"liljermaine32","id_str":"41191046025056256","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter fam I gotta question 4 ya is texas south or midwest #arguments","id":41191046025056256,"from_user_id":24953438,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"122451024","profile_image_url":"http://a2.twimg.com/profile_images/1143400129/100706-ETCanada_201134_1__normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"Kim_DEon","id_str":"41191045161164801","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Help @CARE @EvaLongoria and ME use Twitter to change the lives of girls in poverty across the world! Ready? Go to http://TwitChange.com NOW!","id":41191045161164801,"from_user_id":122451024,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128351479","profile_image_url":"http://a3.twimg.com/profile_images/1150198829/Kirby_Photo__edit__normal.JPG","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"TheDaveKirby","id_str":"41191043894493184","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Maybe its time to clean house...MY HOUSE http://bit.ly/ejG22P","id":41191043894493184,"from_user_id":128351479,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"87512773","profile_image_url":"http://a0.twimg.com/profile_images/1252511106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"supportthehood","id_str":"41191043206610946","metadata":{"result_type":"recent"},"to_user_id":2467330,"text":"@eastcoastmp3 #FF it's the way twitter works !!!","id":41191043206610946,"from_user_id":87512773,"to_user":"eastcoastmp3","geo":null,"iso_language_code":"en","to_user_id_str":"2467330","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"149894545","profile_image_url":"http://a0.twimg.com/profile_images/1219334400/patrick_camo_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"suburbpat","id_str":"41191040912330752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I havent had a rib session on twitter in a while.......I wanna Rib with a nigga with alot followers lol","id":41191040912330752,"from_user_id":149894545,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"97749622","profile_image_url":"http://a0.twimg.com/profile_images/1254640781/IMG1633A_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"jrricardosantos","id_str":"41191040547430400","metadata":{"result_type":"recent"},"to_user_id":101017476,"text":"@yofzs pq tirou o CAPS LOCK? kkkk tava bem legal...hehehe eu estou no t\u00e9dio...kkk tbm estou no twitter e msn..aff!!","id":41191040547430400,"from_user_id":97749622,"to_user":"yofzs","geo":null,"iso_language_code":"en","to_user_id_str":"101017476","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"94381536","profile_image_url":"http://a1.twimg.com/profile_images/1174777929/41509_100001699300415_3521888_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"DonNieves","id_str":"41191038978752512","metadata":{"result_type":"recent"},"to_user_id":151926400,"text":"@TiiH13 cheira meu ovo, no email, no orkut, no msn, no facebook, no twitter, no skype, no spark, no ICQ e no google talk","id":41191038978752512,"from_user_id":94381536,"to_user":"TiiH13","geo":null,"iso_language_code":"en","to_user_id_str":"151926400","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"211858432","profile_image_url":"http://a3.twimg.com/profile_images/1231906180/JonasBrothers_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"OriginalJBfans","id_str":"41191038328651776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I literally forgot about this twitter... so whats occuring followers?","id":41191038328651776,"from_user_id":211858432,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"90317132","profile_image_url":"http://a3.twimg.com/profile_images/1230085056/254101635_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"Just2smooth","id_str":"41191036936126464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wassup twitter","id":41191036936126464,"from_user_id":90317132,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://ubersocial.com" rel="nofollow">\u00dcberSocial</a>"},{"from_user_id_str":"144771504","profile_image_url":"http://a1.twimg.com/profile_images/1243343836/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"ima_b_b_badman","id_str":"41191036638339072","metadata":{"result_type":"recent"},"to_user_id":null,"text":"i been M.I.A. all day twitter my bad","id":41191036638339072,"from_user_id":144771504,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207922664","profile_image_url":"http://a2.twimg.com/profile_images/1237106108/258356167_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"itsthecarter_","id_str":"41191036013391873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter is a stupid addiction.","id":41191036013391873,"from_user_id":207922664,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://ubersocial.com" rel="nofollow">\u00dcberSocial</a>"},{"from_user_id_str":"150000649","profile_image_url":"http://a0.twimg.com/profile_images/1237789059/belllaa_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"angelicabrvo","id_str":"41191035707207680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"que hubo twitter? huy que feoxd","id":41191035707207680,"from_user_id":150000649,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"185713003","profile_image_url":"http://a2.twimg.com/profile_images/1191421540/163229_177015295661467_154687431227587_492170_2147500_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"downbytheshores","id_str":"41191033945595905","metadata":{"result_type":"recent"},"to_user_id":null,"text":"follow us on twitter\nwww.twitter.com/downbytheshores http://fb.me/DhDS915e","id":41191033945595905,"from_user_id":185713003,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"}],"max_id":41191052790603776,"since_id":38643906774044672,"refresh_url":"?since_id=41191052790603776&q=twitter","next_page":"?page=2&max_id=41191052790603776&rpp=20&lang=en&q=twitter","results_per_page":20,"page":1,"completed_in":0.128719,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41191052790603776","query":"twitter"}attoparsec-0.13.2.4/benchmarks/json-data/twitter50.json0000755000000000000000000007631307346545000021051 0ustar0000000000000000{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://friendfeed.com" rel="nofollow">FriendFeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy & Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":""Social safety net into a hammock." So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that "knowledge engine" again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision & speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twmode.sf.net/" rel="nofollow">twmode</a>"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://tommorris.org/" rel="nofollow">tommorris' hacksample</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://identi.ca" rel="nofollow">identica</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=50&q=haskell","results_per_page":50,"page":1,"completed_in":0.291696,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}attoparsec-0.13.2.4/benchmarks/med.txt.bz20000755000000000000000000000100607346545000016414 0ustar0000000000000000BZh91AY&SYO`1! `2@@@@JGUD u  IBiB ҄dPPBIBIB҄ԡiB R %J6 rJ9%J0 yJ1J=J;J:J2 |R ҄B(+$k: e0@1;@4@4@4MzJ5TJ BQ(@(@(@(@(@PP z t e(@Pt)B B %R)B B R J=҄BRPiB )B(+$k#)0@13jD@j#RUPRn%UQ/$KeT )0v%% .% Z%IeUDZUD% ,%$UQ,Iz% L檩&RhK$YPR~.p!attoparsec-0.13.2.4/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/0000755000000000000000000000000007346545000022616 5ustar0000000000000000attoparsec-0.13.2.4/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hs0000644000000000000000000000514607346545000024506 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE MagicHash #-} {-# LANGUAGE BangPatterns #-} -- Copyright : Erik de Castro Lopo -- License : BSD3 module Network.Wai.Handler.Warp.ReadInt ( readInt , readInt64 ) where -- This function lives in its own file because the MagicHash pragma interacts -- poorly with the CPP pragma. import Data.ByteString (ByteString) import qualified Data.ByteString as S import Data.Int (Int64) import GHC.Prim import GHC.Types import GHC.Word {-# INLINE readInt #-} readInt :: Integral a => ByteString -> a readInt bs = fromIntegral $ readInt64 bs -- This function is used to parse the Content-Length field of HTTP headers and -- is a performance hot spot. It should only be replaced with something -- significantly and provably faster. -- -- It needs to be able work correctly on 32 bit CPUs for file sizes > 2G so we -- use Int64 here and then make a generic 'readInt' that allows conversion to -- Int and Integer. {-# NOINLINE readInt64 #-} readInt64 :: ByteString -> Int64 readInt64 bs = S.foldl' (\ !i !c -> i * 10 + fromIntegral (mhDigitToInt c)) 0 $ S.takeWhile isDigit bs data Table = Table !Addr# {-# NOINLINE mhDigitToInt #-} mhDigitToInt :: Word8 -> Int mhDigitToInt (W8# i) = I# (word2Int# (indexWord8OffAddr# addr (word2Int# i))) where !(Table addr) = table table :: Table table = Table "\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x01\x02\x03\x04\x05\x06\x07\x08\x09\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00"# isDigit :: Word8 -> Bool isDigit w = w >= 48 && w <= 57 attoparsec-0.13.2.4/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hs0000644000000000000000000001342707346545000025722 0ustar0000000000000000{-# LANGUAGE DeriveDataTypeable #-} {-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE BangPatterns #-} module Network.Wai.Handler.Warp.RequestHeader ( parseHeaderLines , parseByteRanges ) where import Control.Exception (Exception, throwIO) import Control.Monad (when) import Data.Typeable (Typeable) import qualified Data.ByteString as S import qualified Data.ByteString.Char8 as B (unpack, readInteger) import Data.ByteString.Internal (ByteString(..), memchr) import qualified Data.CaseInsensitive as CI import Data.Word (Word8) import Foreign.ForeignPtr (withForeignPtr) import Foreign.Ptr (Ptr, plusPtr, minusPtr, nullPtr) import Foreign.Storable (peek) import qualified Network.HTTP.Types as H -- import Network.Wai.Handler.Warp.Types import qualified Network.HTTP.Types.Header as HH -- $setup -- >>> :set -XOverloadedStrings data InvalidRequest = NotEnoughLines [String] | BadFirstLine String | NonHttp | IncompleteHeaders | ConnectionClosedByPeer | OverLargeHeader deriving (Eq, Typeable, Show) instance Exception InvalidRequest ---------------------------------------------------------------- parseHeaderLines :: [ByteString] -> IO (H.Method ,ByteString -- Path ,ByteString -- Path, parsed ,ByteString -- Query ,H.HttpVersion ,H.RequestHeaders ) parseHeaderLines [] = throwIO $ NotEnoughLines [] parseHeaderLines (firstLine:otherLines) = do (method, path', query, httpversion) <- parseRequestLine firstLine let path = H.extractPath path' hdr = map parseHeader otherLines return (method, path', path, query, httpversion, hdr) ---------------------------------------------------------------- -- | -- -- >>> parseRequestLine "GET / HTTP/1.1" -- ("GET","/","",HTTP/1.1) -- >>> parseRequestLine "POST /cgi/search.cgi?key=foo HTTP/1.0" -- ("POST","/cgi/search.cgi","?key=foo",HTTP/1.0) -- >>> parseRequestLine "GET " -- *** Exception: Warp: Invalid first line of request: "GET " -- >>> parseRequestLine "GET /NotHTTP UNKNOWN/1.1" -- *** Exception: Warp: Request line specified a non-HTTP request parseRequestLine :: ByteString -> IO (H.Method ,ByteString -- Path ,ByteString -- Query ,H.HttpVersion) parseRequestLine requestLine@(PS fptr off len) = withForeignPtr fptr $ \ptr -> do when (len < 14) $ throwIO baderr let methodptr = ptr `plusPtr` off limptr = methodptr `plusPtr` len lim0 = fromIntegral len pathptr0 <- memchr methodptr 32 lim0 -- ' ' when (pathptr0 == nullPtr || (limptr `minusPtr` pathptr0) < 11) $ throwIO baderr let pathptr = pathptr0 `plusPtr` 1 lim1 = fromIntegral (limptr `minusPtr` pathptr0) httpptr0 <- memchr pathptr 32 lim1 -- ' ' when (httpptr0 == nullPtr || (limptr `minusPtr` httpptr0) < 9) $ throwIO baderr let httpptr = httpptr0 `plusPtr` 1 lim2 = fromIntegral (httpptr0 `minusPtr` pathptr) checkHTTP httpptr !hv <- httpVersion httpptr queryptr <- memchr pathptr 63 lim2 -- '?' let !method = bs ptr methodptr pathptr0 !path | queryptr == nullPtr = bs ptr pathptr httpptr0 | otherwise = bs ptr pathptr queryptr !query | queryptr == nullPtr = S.empty | otherwise = bs ptr queryptr httpptr0 return (method,path,query,hv) where baderr = BadFirstLine $ B.unpack requestLine check :: Ptr Word8 -> Int -> Word8 -> IO () check p n w = do w0 <- peek $ p `plusPtr` n when (w0 /= w) $ throwIO NonHttp checkHTTP httpptr = do check httpptr 0 72 -- 'H' check httpptr 1 84 -- 'T' check httpptr 2 84 -- 'T' check httpptr 3 80 -- 'P' check httpptr 4 47 -- '/' check httpptr 6 46 -- '.' httpVersion httpptr = do major <- peek $ httpptr `plusPtr` 5 minor <- peek $ httpptr `plusPtr` 7 return $ if major == (49 :: Word8) && minor == (49 :: Word8) then H.http11 else H.http10 bs ptr p0 p1 = PS fptr o l where o = p0 `minusPtr` ptr l = p1 `minusPtr` p0 ---------------------------------------------------------------- -- | -- -- >>> parseHeader "Content-Length:47" -- ("Content-Length","47") -- >>> parseHeader "Accept-Ranges: bytes" -- ("Accept-Ranges","bytes") -- >>> parseHeader "Host: example.com:8080" -- ("Host","example.com:8080") -- >>> parseHeader "NoSemiColon" -- ("NoSemiColon","") parseHeader :: ByteString -> H.Header parseHeader s = let (k, rest) = S.break (== 58) s -- ':' rest' = S.dropWhile (\c -> c == 32 || c == 9) $ S.drop 1 rest in (CI.mk k, rest') parseByteRanges :: S.ByteString -> Maybe HH.ByteRanges parseByteRanges bs1 = do bs2 <- stripPrefix "bytes=" bs1 (r, bs3) <- range bs2 ranges (r:) bs3 where range bs2 = case stripPrefix "-" bs2 of Just bs3 -> do (i, bs4) <- B.readInteger bs3 Just (HH.ByteRangeSuffix i, bs4) Nothing -> do (i, bs3) <- B.readInteger bs2 bs4 <- stripPrefix "-" bs3 case B.readInteger bs4 of Nothing -> Just (HH.ByteRangeFrom i, bs4) Just (j, bs5) -> Just (HH.ByteRangeFromTo i j, bs5) ranges front bs3 = case stripPrefix "," bs3 of Nothing -> Just (front []) Just bs4 -> do (r, bs5) <- range bs4 ranges (front . (r:)) bs5 stripPrefix x y | x `S.isPrefixOf` y = Just (S.drop (S.length x) y) | otherwise = Nothing attoparsec-0.13.2.4/changelog.md0000755000000000000000000000626707346545000014564 0ustar00000000000000000.13.2.1 * Improved performance of `Data.Attoparsec.Text.asciiCI` 0.13.2.0 * `pure` is now strict in `Position` 0.13.1.0 * `runScanner` now correctly returns the final state (https://github.com/bos/attoparsec/issues/105). * `Parser`, `ZeptoT`, `Buffer`, and `More` now expose `Semigroup` instances. * `Parser`, and `ZeptoT` now expose `MonadFail` instances. 0.13.0.2 * Restore the fast specialised character set implementation for Text * Move testsuite from test-framework to tasty * Performance optimization of takeWhile and takeWhile1 0.13.0.1 * Fixed a bug in the implementations of inClass and notInClass for Text (https://github.com/bos/attoparsec/issues/103) 0.13.0.0 * Made the parser type in the Zepto module a monad transformer (needed by aeson's string unescaping parser). 0.12.1.6 * Fixed a case folding bug in the ByteString version of stringCI. 0.12.1.5 * Fixed an indexing bug in the new Text implementation of string, reported by Michel Boucey. 0.12.1.4 * Fixed a case where the string parser would consume an unnecessary amount of input before failing a match, when it could bail much earlier (https://github.com/bos/attoparsec/issues/97) * Added more context to error messages (https://github.com/bos/attoparsec/pull/79) 0.12.1.3 * Fixed incorrect tracking of Text lengths (https://github.com/bos/attoparsec/issues/80) 0.12.1.2 * Fixed the incorrect tracking of capacity if the initial buffer was empty (https://github.com/bos/attoparsec/issues/75) 0.12.1.1 * Fixed a data corruption bug that occurred under some circumstances if a buffer grew after prompting for more input (https://github.com/bos/attoparsec/issues/74) 0.12.1.0 * Now compatible with GHC 7.9 * Reintroduced the Chunk class, used by the parsers package 0.12.0.0 * A new internal representation makes almost all real-world parsers faster, sometimes by big margins. For example, parsing JSON data with aeson is now up to 70% faster. These performance improvements also come with reduced memory consumption and some new capabilities. * The new match combinator gives both the result of a parse and the input that it matched. * The test suite has doubled in size. This made it possible to switch to the new internal representation with a decent degree of confidence that everything was more or less working. * The benchmark suite now contains a small family of benchmarks taken from real-world uses of attoparsec. * A few types that ought to have been private now are. * A few obsolete modules and functions have been marked as deprecated. They will be removed from the next major release. 0.11.3.0 * New function scientific is compatible with rational, but parses integers more efficiently (https://github.com/bos/aeson/issues/198) 0.11.2.0 * The new Chunk typeclass allows for some code sharing with Ed Kmett's parsers package: http://hackage.haskell.org/package/parsers * New function runScanner generalises scan to return the final state of the scanner as well as the input consumed. 0.11.1.0 * New dependency: the scientific package. This allows us to parse numbers much more efficiently. * peekWord8', peekChar': new primitive parsers that allow single-character lookahead. attoparsec-0.13.2.4/examples/0000755000000000000000000000000007346545000014113 5ustar0000000000000000attoparsec-0.13.2.4/examples/Atto_RFC2616.hs0000755000000000000000000000221207346545000016367 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} module Main (main) where import Control.Applicative import Control.Exception (bracket) import Control.Monad (forM_) import Data.Attoparsec.ByteString import RFC2616 import System.Environment import System.IO import qualified Data.ByteString.Char8 as B refill :: Handle -> IO B.ByteString refill h = B.hGet h (80*1024) listy :: FilePath -> Handle -> IO () listy file h = do r <- parseWith (refill h) (many request) =<< refill h case r of Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg Done _ reqs -> print (length reqs) incrementy :: FilePath -> Handle -> IO () incrementy file h = go (0::Int) =<< refill h where go !n is = do r <- parseWith (refill h) request is case r of Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg Done bs _req | B.null bs -> do s <- refill h if B.null s then print (n+1) else go (n+1) s | otherwise -> go (n+1) bs main :: IO () main = do args <- getArgs forM_ args $ \arg -> bracket (openFile arg ReadMode) hClose $ -- listy arg incrementy arg attoparsec-0.13.2.4/examples/Makefile0000755000000000000000000000072307346545000015560 0ustar0000000000000000CC := cc CFLAGS := -O3 -Wall # To make the code about 6% faster: # CFLAGS += -fwhole-program --combine CPPFLAGS := -I$(HOME)/hg/http-parser all: c-http c-http: rfc2616.c http_parser.c $(CC) $(CFLAGS) $(CPPFLAGS) -o $@ $^ clean: rm -f *.hi *.o c-http http_parser.c: http_parser.h curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.c http_parser.h: curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.h attoparsec-0.13.2.4/examples/Parsec_RFC2616.hs0000755000000000000000000000550007346545000016700 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, FlexibleContexts #-} module Main (main) where import Control.Applicative import Control.Exception (bracket) import System.Environment (getArgs) import System.IO (hClose, openFile, IOMode(ReadMode)) import Text.Parsec.Char (anyChar, char, satisfy, string) import Text.Parsec.Combinator (many1, manyTill, skipMany1) import Text.Parsec.Prim hiding (many, token, (<|>)) import qualified Data.IntSet as S #if 1 import Text.Parsec.ByteString.Lazy (Parser, parseFromFile) import qualified Data.ByteString.Lazy as B #else import Text.Parsec.ByteString (Parser, parseFromFile) import qualified Data.ByteString as B #endif token :: Stream s m Char => ParsecT s u m Char token = satisfy $ \c -> S.notMember (fromEnum c) set where set = S.fromList . map fromEnum $ ['\0'..'\31'] ++ "()<>@,;:\\\"/[]?={} \t" ++ ['\128'..'\255'] isHorizontalSpace :: Char -> Bool isHorizontalSpace c = c == ' ' || c == '\t' skipHSpaces :: Stream s m Char => ParsecT s u m () skipHSpaces = skipMany1 (satisfy isHorizontalSpace) data Request = Request { _requestMethod :: String , _requestUri :: String , _requestProtocol :: String } deriving (Eq, Ord, Show) requestLine :: Stream s m Char => ParsecT s u m Request requestLine = do method <- many1 token <* skipHSpaces uri <- many1 (satisfy (not . isHorizontalSpace)) <* skipHSpaces <* string "HTTP/" proto <- many httpVersion <* endOfLine return $! Request method uri proto where httpVersion = satisfy $ \c -> c == '1' || c == '0' || c == '.' endOfLine :: Stream s m Char => ParsecT s u m () endOfLine = (string "\r\n" *> pure ()) <|> (char '\n' *> pure ()) data Header = Header { _headerName :: String , _headerValue :: [String] } deriving (Eq, Ord, Show) messageHeader :: Stream s m Char => ParsecT s u m Header messageHeader = do header <- many1 token <* char ':' <* skipHSpaces body <- manyTill anyChar endOfLine conts <- many $ skipHSpaces *> manyTill anyChar endOfLine return $! Header header (body:conts) request :: Stream s m Char => ParsecT s u m (Request, [Header]) request = (,) <$> requestLine <*> many messageHeader <* endOfLine listy :: FilePath -> IO () listy arg = do r <- parseFromFile (many request) arg case r of Left err -> putStrLn $ arg ++ ": " ++ show err Right rs -> print (length rs) chunky :: FilePath -> IO () chunky arg = bracket (openFile arg ReadMode) hClose $ \h -> loop (0::Int) =<< B.hGetContents h where loop !n bs | B.null bs = print n | otherwise = case parse myReq arg bs of Left err -> putStrLn $ arg ++ ": " ++ show err Right (r,bs') -> loop (n+1) bs' myReq :: Parser ((Request, [Header]), B.ByteString) myReq = liftA2 (,) request getInput main :: IO () main = mapM_ f =<< getArgs where --f = listy f = chunky attoparsec-0.13.2.4/examples/RFC2616.hs0000755000000000000000000000400407346545000015401 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} module RFC2616 ( Header(..) , Request(..) , Response(..) , request , response ) where import Control.Applicative import Data.Attoparsec.ByteString as P import Data.Attoparsec.ByteString.Char8 (char8, endOfLine, isDigit_w8) import Data.ByteString (ByteString) import Data.Word (Word8) import Data.Attoparsec.ByteString.Char8 (isEndOfLine, isHorizontalSpace) isToken :: Word8 -> Bool isToken w = w <= 127 && notInClass "\0-\31()<>@,;:\\\"/[]?={} \t" w skipSpaces :: Parser () skipSpaces = satisfy isHorizontalSpace *> skipWhile isHorizontalSpace data Request = Request { requestMethod :: ByteString , requestUri :: ByteString , requestVersion :: ByteString } deriving (Eq, Ord, Show) httpVersion :: Parser ByteString httpVersion = "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46) requestLine :: Parser Request requestLine = Request <$> (takeWhile1 isToken <* char8 ' ') <*> (takeWhile1 (/=32) <* char8 ' ') <*> (httpVersion <* endOfLine) data Header = Header { headerName :: ByteString , headerValue :: [ByteString] } deriving (Eq, Ord, Show) messageHeader :: Parser Header messageHeader = Header <$> (P.takeWhile isToken <* char8 ':' <* skipWhile isHorizontalSpace) <*> ((:) <$> (takeTill isEndOfLine <* endOfLine) <*> (many $ skipSpaces *> takeTill isEndOfLine <* endOfLine)) request :: Parser (Request, [Header]) request = (,) <$> requestLine <*> many messageHeader <* endOfLine data Response = Response { responseVersion :: ByteString , responseCode :: ByteString , responseMsg :: ByteString } deriving (Eq, Ord, Show) responseLine :: Parser Response responseLine = Response <$> (httpVersion <* char8 ' ') <*> (P.takeWhile isDigit_w8 <* char8 ' ') <*> (takeTill isEndOfLine <* endOfLine) response :: Parser (Response, [Header]) response = (,) <$> responseLine <*> many messageHeader <* endOfLine attoparsec-0.13.2.4/examples/rfc2616.c0000755000000000000000000001126607346545000015361 0ustar0000000000000000/* * This is a simple driver for the http-parser package. It is * intended to read one HTTP request after another from a file, * nothing more. * * For "feature parity" with the Haskell code in RFC2616.hs, we * allocate and populate a simple structure describing each request, * since that's the sort of thing that many real applications would * themselves do and the library doesn't do this for us. * * For the http-parser source, see * https://github.com/joyent/http-parser/blob/master/http_parser.c */ /* * Turn off this preprocessor symbol to have the callbacks do nothing * at all, which "improves performance" by about 50%. */ /*#define LOOK_BUSY*/ #include #include #include #include #include #include #include #include #include "http_parser.h" struct http_string { size_t len; char value[0]; }; struct http_header { struct http_string *name; struct http_string *value; struct http_header *next; }; struct http_request { struct http_string *method; struct http_string *uri; struct http_header *headers, *last; }; struct data { size_t count; struct http_request req; }; static void *xmalloc(size_t size) { void *ptr; if ((ptr = malloc(size)) == NULL) { perror("malloc"); exit(1); } return ptr; } static struct http_string *xstrdup(const char *src, size_t len, size_t extra) { struct http_string *dst = xmalloc(sizeof(*dst) + len + extra); memcpy(dst->value, src, len); dst->len = len; return dst; } static void xstrcat(struct http_string **dst, const char *src, size_t len) { struct http_string *p; if (*dst == NULL) { *dst = xstrdup(src, len, 0); return; } p = xstrdup((*dst)->value, (*dst)->len, len); memcpy(p->value + (*dst)->len, src, len); p->len += len; free(*dst); *dst = p; } static int begin(http_parser *p) { struct data *data = p->data; data->count++; return 0; } static int url(http_parser *p, const char *at, size_t len) { #ifdef LOOK_BUSY struct data *data = p->data; xstrcat(&data->req.uri, at, len); #endif return 0; } static int header_field(http_parser *p, const char *at, size_t len) { #ifdef LOOK_BUSY struct data *data = p->data; if (data->req.last && data->req.last->value == NULL) { xstrcat(&data->req.last->name, at, len); } else { struct http_header *hdr = xmalloc(sizeof(*hdr)); hdr->name = xstrdup(at, len, 0); hdr->value = NULL; hdr->next = NULL; if (data->req.last != NULL) data->req.last->next = hdr; data->req.last = hdr; if (data->req.headers == NULL) data->req.headers = hdr; } #endif return 0; } static int header_value(http_parser *p, const char *at, size_t len) { #ifdef LOOK_BUSY struct data *data = p->data; xstrcat(&data->req.last->value, at, len); #endif return 0; } static int complete(http_parser *p) { #ifdef LOOK_BUSY struct data *data = p->data; struct http_header *hdr, *next; free(data->req.method); free(data->req.uri); for (hdr = data->req.headers; hdr != NULL; hdr = next) { next = hdr->next; free(hdr->name); free(hdr->value); free(hdr); hdr = next; } data->req.method = NULL; data->req.uri = NULL; data->req.headers = NULL; data->req.last = NULL; #endif /* Bludgeon http_parser into understanding that we really want to * keep parsing after a request that in principle ought to close * the "connection". */ if (!http_should_keep_alive(p)) { p->http_major = 1; p->http_minor = 1; p->flags &= ~6; } return 0; } static void parse(const char *path, int fd) { struct data data; http_parser_settings s; http_parser p; ssize_t nread; memset(&s, 0, sizeof(s)); s.on_message_begin = begin; s.on_url = url; s.on_header_field = header_field; s.on_header_value = header_value; s.on_message_complete = complete; p.data = &data; http_parser_init(&p, HTTP_REQUEST); data.count = 0; data.req.method = NULL; data.req.uri = NULL; data.req.headers = NULL; data.req.last = NULL; do { char buf[HTTP_MAX_HEADER_SIZE]; size_t np; nread = read(fd, buf, sizeof(buf)); np = http_parser_execute(&p, &s, buf, nread); if (np != nread) { fprintf(stderr, "%s: parse failed\n", path); break; } } while (nread > 0); printf("%ld\n", (unsigned long) data.count); } int main(int argc, char **argv) { int i; for (i = 1; i < argc; i++) { int fd; fd = open(argv[i], O_RDONLY); if (fd == -1) { perror(argv[i]); continue; } parse(argv[i], fd); close(fd); } return 0; } /* * Local Variables: * c-file-style: "stroustrup" * End: */ attoparsec-0.13.2.4/tests/0000755000000000000000000000000007346545000013437 5ustar0000000000000000attoparsec-0.13.2.4/tests/QC.hs0000644000000000000000000000105307346545000014275 0ustar0000000000000000{-# OPTIONS_GHC -fno-warn-missing-signatures #-} module Main (main) where import qualified QC.Buffer as Buffer import qualified QC.ByteString as ByteString import qualified QC.Combinator as Combinator import qualified QC.Simple as Simple import qualified QC.Text as Text import Test.Tasty (defaultMain, testGroup) main = defaultMain tests tests = testGroup "tests" [ testGroup "bs" ByteString.tests , testGroup "buf" Buffer.tests , testGroup "combinator" Combinator.tests , testGroup "simple" Simple.tests , testGroup "text" Text.tests ] attoparsec-0.13.2.4/tests/QC.hs0000755000000000000000000000105307346545000014300 0ustar0000000000000000{-# OPTIONS_GHC -fno-warn-missing-signatures #-} module Main (main) where import qualified QC.Buffer as Buffer import qualified QC.ByteString as ByteString import qualified QC.Combinator as Combinator import qualified QC.Simple as Simple import qualified QC.Text as Text import Test.Tasty (defaultMain, testGroup) main = defaultMain tests tests = testGroup "tests" [ testGroup "bs" ByteString.tests , testGroup "buf" Buffer.tests , testGroup "combinator" Combinator.tests , testGroup "simple" Simple.tests , testGroup "text" Text.tests ] attoparsec-0.13.2.4/tests/QC/0000755000000000000000000000000007346545000013742 5ustar0000000000000000attoparsec-0.13.2.4/tests/QC/Buffer.hs0000644000000000000000000000531607346545000015514 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, OverloadedStrings, TypeSynonymInstances #-} module QC.Buffer (tests) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<$>)) import Data.Monoid (Monoid(mconcat)) #endif import QC.Common () import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.ByteString.Buffer as BB import qualified Data.Attoparsec.Text.Buffer as BT import qualified Data.ByteString as B import qualified Data.ByteString.Unsafe as B import qualified Data.Text as T import qualified Data.Text.Unsafe as T data BP t b = BP [t] !t !b deriving (Eq, Show) type BPB = BP B.ByteString BB.Buffer type BPT = BP T.Text BT.Buffer instance Arbitrary BPB where arbitrary = do bss <- arbitrary return $! toBP BB.buffer bss shrink (BP bss _ _) = toBP BB.buffer <$> shrink bss instance Arbitrary BPT where arbitrary = do bss <- arbitrary return $! toBP BT.buffer bss shrink (BP bss _ _) = toBP BT.buffer <$> shrink bss toBP :: (Monoid a, Monoid b) => (a -> b) -> [a] -> BP a b toBP buf bss = BP bss (mconcat bss) (mconcat (map buf bss)) b_unbuffer :: BPB -> Property b_unbuffer (BP _ts t buf) = t === BB.unbuffer buf t_unbuffer :: BPT -> Property t_unbuffer (BP _ts t buf) = t === BT.unbuffer buf b_length :: BPB -> Property b_length (BP _ts t buf) = B.length t === BB.length buf t_length :: BPT -> Property t_length (BP _ts t buf) = T.lengthWord16 t === BT.length buf b_unsafeIndex :: BPB -> Gen Property b_unsafeIndex (BP _ts t buf) = do let l = B.length t i <- choose (0,l-1) return $ l === 0 .||. B.unsafeIndex t i === BB.unsafeIndex buf i t_iter :: BPT -> Gen Property t_iter (BP _ts t buf) = do let l = T.lengthWord16 t i <- choose (0,l-1) let it (T.Iter c q) = (c,q) return $ l === 0 .||. it (T.iter t i) === it (BT.iter buf i) t_iter_ :: BPT -> Gen Property t_iter_ (BP _ts t buf) = do let l = T.lengthWord16 t i <- choose (0,l-1) return $ l === 0 .||. T.iter_ t i === BT.iter_ buf i b_unsafeDrop :: BPB -> Gen Property b_unsafeDrop (BP _ts t buf) = do i <- choose (0, B.length t) return $ B.unsafeDrop i t === BB.unsafeDrop i buf t_dropWord16 :: BPT -> Gen Property t_dropWord16 (BP _ts t buf) = do i <- choose (0, T.lengthWord16 t) return $ T.dropWord16 i t === BT.dropWord16 i buf tests :: [TestTree] tests = [ testProperty "b_unbuffer" b_unbuffer , testProperty "t_unbuffer" t_unbuffer , testProperty "b_length" b_length , testProperty "t_length" t_length , testProperty "b_unsafeIndex" b_unsafeIndex , testProperty "t_iter" t_iter , testProperty "t_iter_" t_iter_ , testProperty "b_unsafeDrop" b_unsafeDrop , testProperty "t_dropWord16" t_dropWord16 ] attoparsec-0.13.2.4/tests/QC/Buffer.hs0000755000000000000000000000531607346545000015517 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, OverloadedStrings, TypeSynonymInstances #-} module QC.Buffer (tests) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<$>)) import Data.Monoid (Monoid(mconcat)) #endif import QC.Common () import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.ByteString.Buffer as BB import qualified Data.Attoparsec.Text.Buffer as BT import qualified Data.ByteString as B import qualified Data.ByteString.Unsafe as B import qualified Data.Text as T import qualified Data.Text.Unsafe as T data BP t b = BP [t] !t !b deriving (Eq, Show) type BPB = BP B.ByteString BB.Buffer type BPT = BP T.Text BT.Buffer instance Arbitrary BPB where arbitrary = do bss <- arbitrary return $! toBP BB.buffer bss shrink (BP bss _ _) = toBP BB.buffer <$> shrink bss instance Arbitrary BPT where arbitrary = do bss <- arbitrary return $! toBP BT.buffer bss shrink (BP bss _ _) = toBP BT.buffer <$> shrink bss toBP :: (Monoid a, Monoid b) => (a -> b) -> [a] -> BP a b toBP buf bss = BP bss (mconcat bss) (mconcat (map buf bss)) b_unbuffer :: BPB -> Property b_unbuffer (BP _ts t buf) = t === BB.unbuffer buf t_unbuffer :: BPT -> Property t_unbuffer (BP _ts t buf) = t === BT.unbuffer buf b_length :: BPB -> Property b_length (BP _ts t buf) = B.length t === BB.length buf t_length :: BPT -> Property t_length (BP _ts t buf) = T.lengthWord16 t === BT.length buf b_unsafeIndex :: BPB -> Gen Property b_unsafeIndex (BP _ts t buf) = do let l = B.length t i <- choose (0,l-1) return $ l === 0 .||. B.unsafeIndex t i === BB.unsafeIndex buf i t_iter :: BPT -> Gen Property t_iter (BP _ts t buf) = do let l = T.lengthWord16 t i <- choose (0,l-1) let it (T.Iter c q) = (c,q) return $ l === 0 .||. it (T.iter t i) === it (BT.iter buf i) t_iter_ :: BPT -> Gen Property t_iter_ (BP _ts t buf) = do let l = T.lengthWord16 t i <- choose (0,l-1) return $ l === 0 .||. T.iter_ t i === BT.iter_ buf i b_unsafeDrop :: BPB -> Gen Property b_unsafeDrop (BP _ts t buf) = do i <- choose (0, B.length t) return $ B.unsafeDrop i t === BB.unsafeDrop i buf t_dropWord16 :: BPT -> Gen Property t_dropWord16 (BP _ts t buf) = do i <- choose (0, T.lengthWord16 t) return $ T.dropWord16 i t === BT.dropWord16 i buf tests :: [TestTree] tests = [ testProperty "b_unbuffer" b_unbuffer , testProperty "t_unbuffer" t_unbuffer , testProperty "b_length" b_length , testProperty "t_length" t_length , testProperty "b_unsafeIndex" b_unsafeIndex , testProperty "t_iter" t_iter , testProperty "t_iter_" t_iter_ , testProperty "b_unsafeDrop" b_unsafeDrop , testProperty "t_dropWord16" t_dropWord16 ] attoparsec-0.13.2.4/tests/QC/ByteString.hs0000644000000000000000000001520607346545000016374 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-} module QC.ByteString (tests) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<*>), (<$>)) #endif import Data.Char (chr, ord, toUpper) import Data.Int (Int64) import Data.Word (Word8) import Prelude hiding (take, takeWhile) import QC.Common (ASCII(..), liftOp, parseBS, toStrictBS) import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.ByteString as P import qualified Data.Attoparsec.ByteString.Char8 as P8 import qualified Data.Attoparsec.ByteString.FastSet as S import qualified Data.Attoparsec.ByteString.Lazy as PL import qualified Data.ByteString as B import qualified Data.ByteString.Char8 as B8 import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Lazy.Char8 as L8 -- Basic byte-level combinators. satisfy :: Word8 -> L.ByteString -> Property satisfy w s = parseBS (P.satisfy (<=w)) (L.cons w s) === Just w satisfyWith :: Word8 -> L.ByteString -> Property satisfyWith w s = parseBS (P.satisfyWith (chr . fromIntegral) (<=c)) (L.cons (fromIntegral (ord c)) s) === Just c where c = chr (fromIntegral w) word8 :: Word8 -> L.ByteString -> Property word8 w s = parseBS (P.word8 w) (L.cons w s) === Just w skip :: Word8 -> L.ByteString -> Property skip w s = case (parseBS (P.skip ( maybe (property True) (expectFailure . it) mcs (Just _, mcs) -> maybe (property False) it mcs where it cs = liftOp "<" (<) (fst cs) w anyWord8 :: L.ByteString -> Property anyWord8 s | L.null s = p === Nothing | otherwise = p === Just (L.head s) where p = parseBS P.anyWord8 s notWord8 :: Word8 -> NonEmptyList Word8 -> Property notWord8 w (NonEmpty s) = parseBS (P.notWord8 w) bs === if v == w then Nothing else Just v where v = L.head bs bs = L.pack s peekWord8 :: L.ByteString -> Property peekWord8 s | L.null s = p === Just (Nothing, s) | otherwise = p === Just (Just (L.head s), s) where p = parseBS ((,) <$> P.peekWord8 <*> P.takeLazyByteString) s peekWord8' :: L.ByteString -> Property peekWord8' s = parseBS P.peekWord8' s === (fst <$> L.uncons s) string :: L.ByteString -> L.ByteString -> Property string s t = parseBS (P.string s') (s `L.append` t) === Just s' where s' = toStrictBS s stringCI :: ASCII L.ByteString -> ASCII L.ByteString -> Property stringCI (ASCII s) (ASCII t) = parseBS (P8.stringCI up) (s `L.append` t) === Just s' where s' = toStrictBS s up = B8.map toUpper s' strings :: L.ByteString -> L.ByteString -> L.ByteString -> Property strings s t u = parseBS (P.string (toStrictBS s) >> P.string t') (L.concat [s,t,u]) === Just t' where t' = toStrictBS t skipWhile :: Word8 -> L.ByteString -> Property skipWhile w s = let t = L.dropWhile (<=w) s in case PL.parse (P.skipWhile (<=w)) s of PL.Done t' () -> t === t' _ -> property False takeCount :: Positive Int -> L.ByteString -> Property takeCount (Positive k) s = case parseBS (P.take k) s of Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s) Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s) takeWhile :: Word8 -> L.ByteString -> Property takeWhile w s = let (h,t) = L.span (==w) s in case PL.parse (P.takeWhile (==w)) s of PL.Done t' h' -> t === t' .&&. toStrictBS h === h' _ -> property False take :: Int -> L.ByteString -> Property take n s = maybe (property $ L.length s < fromIntegral n) (=== B.take n (toStrictBS s)) $ parseBS (P.take n) s takeByteString :: L.ByteString -> Property takeByteString s = maybe (property False) (=== toStrictBS s) . parseBS P.takeByteString $ s takeLazyByteString :: L.ByteString -> Property takeLazyByteString s = maybe (property False) (=== s) . parseBS P.takeLazyByteString $ s takeWhile1 :: Word8 -> L.ByteString -> Property takeWhile1 w s = let s' = L.cons w s (h,t) = L.span (<=w) s' in case PL.parse (P.takeWhile1 (<=w)) s' of PL.Done t' h' -> t === t' .&&. toStrictBS h === h' _ -> property False takeTill :: Word8 -> L.ByteString -> Property takeTill w s = let (h,t) = L.break (==w) s in case PL.parse (P.takeTill (==w)) s of PL.Done t' h' -> t === t' .&&. toStrictBS h === h' _ -> property False takeWhile1_empty :: Property takeWhile1_empty = parseBS (P.takeWhile1 undefined) L.empty === Nothing endOfInput :: L.ByteString -> Property endOfInput s = parseBS P.endOfInput s === if L.null s then Just () else Nothing endOfLine :: L.ByteString -> Property endOfLine s = case (parseBS P8.endOfLine s, L8.uncons s) of (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs (Just _, mcs) -> maybe (property False) eol mcs where eol (c,s') = c === '\n' .||. (c, fst <$> L8.uncons s') === ('\r', Just '\n') scan :: L.ByteString -> Positive Int64 -> Property scan s (Positive k) = parseBS p s === Just (toStrictBS $ L.take k s) where p = P.scan k $ \ n _ -> if n > 0 then let !n' = n - 1 in Just n' else Nothing members :: [Word8] -> Property members s = property $ all (`S.memberWord8` set) s where set = S.fromList s nonmembers :: [Word8] -> [Word8] -> Property nonmembers s s' = property . not . any (`S.memberWord8` set) $ filter (not . (`elem` s)) s' where set = S.fromList s tests :: [TestTree] tests = [ testProperty "anyWord8" anyWord8 , testProperty "endOfInput" endOfInput , testProperty "endOfLine" endOfLine , testProperty "notWord8" notWord8 , testProperty "peekWord8" peekWord8 , testProperty "peekWord8'" peekWord8' , testProperty "satisfy" satisfy , testProperty "satisfyWith" satisfyWith , testProperty "scan" scan , testProperty "skip" skip , testProperty "skipWhile" skipWhile , testProperty "string" string , testProperty "stringCI" stringCI , testProperty "strings" strings , testProperty "take" take , testProperty "takeByteString" takeByteString , testProperty "takeCount" takeCount , testProperty "takeLazyByteString" takeLazyByteString , testProperty "takeTill" takeTill , testProperty "takeWhile" takeWhile , testProperty "takeWhile1" takeWhile1 , testProperty "takeWhile1_empty" takeWhile1_empty , testProperty "word8" word8 , testProperty "members" members , testProperty "nonmembers" nonmembers ] attoparsec-0.13.2.4/tests/QC/ByteString.hs0000755000000000000000000001520607346545000016377 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-} module QC.ByteString (tests) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<*>), (<$>)) #endif import Data.Char (chr, ord, toUpper) import Data.Int (Int64) import Data.Word (Word8) import Prelude hiding (take, takeWhile) import QC.Common (ASCII(..), liftOp, parseBS, toStrictBS) import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.ByteString as P import qualified Data.Attoparsec.ByteString.Char8 as P8 import qualified Data.Attoparsec.ByteString.FastSet as S import qualified Data.Attoparsec.ByteString.Lazy as PL import qualified Data.ByteString as B import qualified Data.ByteString.Char8 as B8 import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Lazy.Char8 as L8 -- Basic byte-level combinators. satisfy :: Word8 -> L.ByteString -> Property satisfy w s = parseBS (P.satisfy (<=w)) (L.cons w s) === Just w satisfyWith :: Word8 -> L.ByteString -> Property satisfyWith w s = parseBS (P.satisfyWith (chr . fromIntegral) (<=c)) (L.cons (fromIntegral (ord c)) s) === Just c where c = chr (fromIntegral w) word8 :: Word8 -> L.ByteString -> Property word8 w s = parseBS (P.word8 w) (L.cons w s) === Just w skip :: Word8 -> L.ByteString -> Property skip w s = case (parseBS (P.skip ( maybe (property True) (expectFailure . it) mcs (Just _, mcs) -> maybe (property False) it mcs where it cs = liftOp "<" (<) (fst cs) w anyWord8 :: L.ByteString -> Property anyWord8 s | L.null s = p === Nothing | otherwise = p === Just (L.head s) where p = parseBS P.anyWord8 s notWord8 :: Word8 -> NonEmptyList Word8 -> Property notWord8 w (NonEmpty s) = parseBS (P.notWord8 w) bs === if v == w then Nothing else Just v where v = L.head bs bs = L.pack s peekWord8 :: L.ByteString -> Property peekWord8 s | L.null s = p === Just (Nothing, s) | otherwise = p === Just (Just (L.head s), s) where p = parseBS ((,) <$> P.peekWord8 <*> P.takeLazyByteString) s peekWord8' :: L.ByteString -> Property peekWord8' s = parseBS P.peekWord8' s === (fst <$> L.uncons s) string :: L.ByteString -> L.ByteString -> Property string s t = parseBS (P.string s') (s `L.append` t) === Just s' where s' = toStrictBS s stringCI :: ASCII L.ByteString -> ASCII L.ByteString -> Property stringCI (ASCII s) (ASCII t) = parseBS (P8.stringCI up) (s `L.append` t) === Just s' where s' = toStrictBS s up = B8.map toUpper s' strings :: L.ByteString -> L.ByteString -> L.ByteString -> Property strings s t u = parseBS (P.string (toStrictBS s) >> P.string t') (L.concat [s,t,u]) === Just t' where t' = toStrictBS t skipWhile :: Word8 -> L.ByteString -> Property skipWhile w s = let t = L.dropWhile (<=w) s in case PL.parse (P.skipWhile (<=w)) s of PL.Done t' () -> t === t' _ -> property False takeCount :: Positive Int -> L.ByteString -> Property takeCount (Positive k) s = case parseBS (P.take k) s of Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s) Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s) takeWhile :: Word8 -> L.ByteString -> Property takeWhile w s = let (h,t) = L.span (==w) s in case PL.parse (P.takeWhile (==w)) s of PL.Done t' h' -> t === t' .&&. toStrictBS h === h' _ -> property False take :: Int -> L.ByteString -> Property take n s = maybe (property $ L.length s < fromIntegral n) (=== B.take n (toStrictBS s)) $ parseBS (P.take n) s takeByteString :: L.ByteString -> Property takeByteString s = maybe (property False) (=== toStrictBS s) . parseBS P.takeByteString $ s takeLazyByteString :: L.ByteString -> Property takeLazyByteString s = maybe (property False) (=== s) . parseBS P.takeLazyByteString $ s takeWhile1 :: Word8 -> L.ByteString -> Property takeWhile1 w s = let s' = L.cons w s (h,t) = L.span (<=w) s' in case PL.parse (P.takeWhile1 (<=w)) s' of PL.Done t' h' -> t === t' .&&. toStrictBS h === h' _ -> property False takeTill :: Word8 -> L.ByteString -> Property takeTill w s = let (h,t) = L.break (==w) s in case PL.parse (P.takeTill (==w)) s of PL.Done t' h' -> t === t' .&&. toStrictBS h === h' _ -> property False takeWhile1_empty :: Property takeWhile1_empty = parseBS (P.takeWhile1 undefined) L.empty === Nothing endOfInput :: L.ByteString -> Property endOfInput s = parseBS P.endOfInput s === if L.null s then Just () else Nothing endOfLine :: L.ByteString -> Property endOfLine s = case (parseBS P8.endOfLine s, L8.uncons s) of (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs (Just _, mcs) -> maybe (property False) eol mcs where eol (c,s') = c === '\n' .||. (c, fst <$> L8.uncons s') === ('\r', Just '\n') scan :: L.ByteString -> Positive Int64 -> Property scan s (Positive k) = parseBS p s === Just (toStrictBS $ L.take k s) where p = P.scan k $ \ n _ -> if n > 0 then let !n' = n - 1 in Just n' else Nothing members :: [Word8] -> Property members s = property $ all (`S.memberWord8` set) s where set = S.fromList s nonmembers :: [Word8] -> [Word8] -> Property nonmembers s s' = property . not . any (`S.memberWord8` set) $ filter (not . (`elem` s)) s' where set = S.fromList s tests :: [TestTree] tests = [ testProperty "anyWord8" anyWord8 , testProperty "endOfInput" endOfInput , testProperty "endOfLine" endOfLine , testProperty "notWord8" notWord8 , testProperty "peekWord8" peekWord8 , testProperty "peekWord8'" peekWord8' , testProperty "satisfy" satisfy , testProperty "satisfyWith" satisfyWith , testProperty "scan" scan , testProperty "skip" skip , testProperty "skipWhile" skipWhile , testProperty "string" string , testProperty "stringCI" stringCI , testProperty "strings" strings , testProperty "take" take , testProperty "takeByteString" takeByteString , testProperty "takeCount" takeCount , testProperty "takeLazyByteString" takeLazyByteString , testProperty "takeTill" takeTill , testProperty "takeWhile" takeWhile , testProperty "takeWhile1" takeWhile1 , testProperty "takeWhile1_empty" takeWhile1_empty , testProperty "word8" word8 , testProperty "members" members , testProperty "nonmembers" nonmembers ] attoparsec-0.13.2.4/tests/QC/Combinator.hs0000644000000000000000000000355107346545000016377 0ustar0000000000000000{-# LANGUAGE CPP, OverloadedStrings #-} module QC.Combinator where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<*>), (<$>), (<*), (*>)) #endif import Data.Maybe (fromJust, isJust) import Data.Word (Word8) import QC.Common (Repack, parseBS, repackBS, toLazyBS) import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.ByteString.Char8 as P import qualified Data.Attoparsec.Combinator as C import qualified Data.ByteString as B import qualified Data.ByteString.Char8 as B8 choice :: NonEmptyList (NonEmptyList Word8) -> Gen Property choice (NonEmpty xs) = do let ys = map (B.pack . getNonEmpty) xs return . forAll (repackBS <$> arbitrary <*> elements ys) $ maybe False (`elem` ys) . parseBS (C.choice (map P.string ys)) count :: Positive (Small Int) -> Repack -> B.ByteString -> Bool count (Positive (Small n)) rs s = (length <$> parseBS (C.count n (P.string s)) input) == Just n where input = repackBS rs (B.concat (replicate (n+1) s)) lookAhead :: NonEmptyList Word8 -> Bool lookAhead (NonEmpty xs) = let ys = B.pack xs withLookAheadThenConsume = (\x y -> (x, y)) <$> C.lookAhead (P.string ys) <*> P.string ys mr = parseBS withLookAheadThenConsume $ toLazyBS ys in isJust mr && fst (fromJust mr) == snd (fromJust mr) match :: Int -> NonNegative Int -> NonNegative Int -> Repack -> Bool match n (NonNegative x) (NonNegative y) rs = parseBS (P.match parser) (repackBS rs input) == Just (input, n) where parser = P.skipWhile (=='x') *> P.signed P.decimal <* P.skipWhile (=='y') input = B.concat [ B8.replicate x 'x', B8.pack (show n), B8.replicate y 'y' ] tests :: [TestTree] tests = [ testProperty "choice" choice , testProperty "count" count , testProperty "lookAhead" lookAhead , testProperty "match" match ] attoparsec-0.13.2.4/tests/QC/Combinator.hs0000755000000000000000000000355107346545000016402 0ustar0000000000000000{-# LANGUAGE CPP, OverloadedStrings #-} module QC.Combinator where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<*>), (<$>), (<*), (*>)) #endif import Data.Maybe (fromJust, isJust) import Data.Word (Word8) import QC.Common (Repack, parseBS, repackBS, toLazyBS) import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.ByteString.Char8 as P import qualified Data.Attoparsec.Combinator as C import qualified Data.ByteString as B import qualified Data.ByteString.Char8 as B8 choice :: NonEmptyList (NonEmptyList Word8) -> Gen Property choice (NonEmpty xs) = do let ys = map (B.pack . getNonEmpty) xs return . forAll (repackBS <$> arbitrary <*> elements ys) $ maybe False (`elem` ys) . parseBS (C.choice (map P.string ys)) count :: Positive (Small Int) -> Repack -> B.ByteString -> Bool count (Positive (Small n)) rs s = (length <$> parseBS (C.count n (P.string s)) input) == Just n where input = repackBS rs (B.concat (replicate (n+1) s)) lookAhead :: NonEmptyList Word8 -> Bool lookAhead (NonEmpty xs) = let ys = B.pack xs withLookAheadThenConsume = (\x y -> (x, y)) <$> C.lookAhead (P.string ys) <*> P.string ys mr = parseBS withLookAheadThenConsume $ toLazyBS ys in isJust mr && fst (fromJust mr) == snd (fromJust mr) match :: Int -> NonNegative Int -> NonNegative Int -> Repack -> Bool match n (NonNegative x) (NonNegative y) rs = parseBS (P.match parser) (repackBS rs input) == Just (input, n) where parser = P.skipWhile (=='x') *> P.signed P.decimal <* P.skipWhile (=='y') input = B.concat [ B8.replicate x 'x', B8.pack (show n), B8.replicate y 'y' ] tests :: [TestTree] tests = [ testProperty "choice" choice , testProperty "count" count , testProperty "lookAhead" lookAhead , testProperty "match" match ] attoparsec-0.13.2.4/tests/QC/Common.hs0000644000000000000000000000661007346545000015531 0ustar0000000000000000{-# LANGUAGE CPP, FlexibleInstances #-} {-# OPTIONS_GHC -fno-warn-orphans #-} module QC.Common ( ASCII(..) , parseBS , parseT , toLazyBS , toStrictBS , Repack , repackBS , repackBS_ , repackT , repackT_ , liftOp ) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<*>), (<$>)) #endif import Data.Char (isAlpha) import Test.QuickCheck import Test.QuickCheck.Unicode (shrinkChar, string) import qualified Data.ByteString as B import qualified Data.ByteString.Lazy as BL import qualified Data.Text as T import qualified Data.Text.Lazy as TL import qualified Data.Attoparsec.ByteString.Lazy as BL import qualified Data.Attoparsec.Text.Lazy as TL #if !MIN_VERSION_base(4,4,0) -- This should really be a dependency on the random package :-( instance Random Word8 where randomR = integralRandomR random = randomR (minBound,maxBound) instance Arbitrary Word8 where arbitrary = choose (minBound, maxBound) #endif parseBS :: BL.Parser r -> BL.ByteString -> Maybe r parseBS p = BL.maybeResult . BL.parse p parseT :: TL.Parser r -> TL.Text -> Maybe r parseT p = TL.maybeResult . TL.parse p toStrictBS :: BL.ByteString -> B.ByteString toStrictBS = B.concat . BL.toChunks toLazyBS :: B.ByteString -> BL.ByteString toLazyBS = BL.fromChunks . (:[]) instance Arbitrary B.ByteString where arbitrary = B.pack <$> arbitrary shrink = map B.pack . shrink . B.unpack instance Arbitrary BL.ByteString where arbitrary = repackBS <$> arbitrary <*> arbitrary shrink = map BL.pack . shrink . BL.unpack newtype ASCII a = ASCII { fromASCII :: a } deriving (Eq, Ord, Show) instance Arbitrary (ASCII B.ByteString) where arbitrary = (ASCII . B.pack) <$> listOf (choose (0,127)) shrink = map (ASCII . B.pack) . shrink . B.unpack . fromASCII instance Arbitrary (ASCII BL.ByteString) where arbitrary = ASCII <$> (repackBS <$> arbitrary <*> (fromASCII <$> arbitrary)) shrink = map (ASCII . BL.pack) . shrink . BL.unpack . fromASCII type Repack = NonEmptyList (Positive (Small Int)) repackBS :: Repack -> B.ByteString -> BL.ByteString repackBS (NonEmpty bs) = BL.fromChunks . repackBS_ (map (getSmall . getPositive) bs) repackBS_ :: [Int] -> B.ByteString -> [B.ByteString] repackBS_ = go . cycle where go (b:bs) s | B.null s = [] | otherwise = let (h,t) = B.splitAt b s in h : go bs t go _ _ = error "unpossible" instance Arbitrary T.Text where arbitrary = T.pack <$> string shrink = map T.pack . shrinkList shrinkChar . T.unpack instance Arbitrary TL.Text where arbitrary = TL.pack <$> string shrink = map TL.pack . shrinkList shrinkChar . TL.unpack repackT :: Repack -> T.Text -> TL.Text repackT (NonEmpty bs) = TL.fromChunks . repackT_ (map (getSmall . getPositive) bs) repackT_ :: [Int] -> T.Text -> [T.Text] repackT_ = go . cycle where go (b:bs) s | T.null s = [] | otherwise = let (h,t) = T.splitAt b s in h : go bs t go _ _ = error "unpossible" liftOp :: (Show a, Testable prop) => String -> (a -> a -> prop) -> a -> a -> Property liftOp name f x y = counterexample desc (f x y) where op = case name of (c:_) | isAlpha c -> " `" ++ name ++ "` " | otherwise -> " " ++ name ++ " " _ -> " ??? " desc = "not (" ++ show x ++ op ++ show y ++ ")" attoparsec-0.13.2.4/tests/QC/Common.hs0000755000000000000000000000661007346545000015534 0ustar0000000000000000{-# LANGUAGE CPP, FlexibleInstances #-} {-# OPTIONS_GHC -fno-warn-orphans #-} module QC.Common ( ASCII(..) , parseBS , parseT , toLazyBS , toStrictBS , Repack , repackBS , repackBS_ , repackT , repackT_ , liftOp ) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<*>), (<$>)) #endif import Data.Char (isAlpha) import Test.QuickCheck import Test.QuickCheck.Unicode (shrinkChar, string) import qualified Data.ByteString as B import qualified Data.ByteString.Lazy as BL import qualified Data.Text as T import qualified Data.Text.Lazy as TL import qualified Data.Attoparsec.ByteString.Lazy as BL import qualified Data.Attoparsec.Text.Lazy as TL #if !MIN_VERSION_base(4,4,0) -- This should really be a dependency on the random package :-( instance Random Word8 where randomR = integralRandomR random = randomR (minBound,maxBound) instance Arbitrary Word8 where arbitrary = choose (minBound, maxBound) #endif parseBS :: BL.Parser r -> BL.ByteString -> Maybe r parseBS p = BL.maybeResult . BL.parse p parseT :: TL.Parser r -> TL.Text -> Maybe r parseT p = TL.maybeResult . TL.parse p toStrictBS :: BL.ByteString -> B.ByteString toStrictBS = B.concat . BL.toChunks toLazyBS :: B.ByteString -> BL.ByteString toLazyBS = BL.fromChunks . (:[]) instance Arbitrary B.ByteString where arbitrary = B.pack <$> arbitrary shrink = map B.pack . shrink . B.unpack instance Arbitrary BL.ByteString where arbitrary = repackBS <$> arbitrary <*> arbitrary shrink = map BL.pack . shrink . BL.unpack newtype ASCII a = ASCII { fromASCII :: a } deriving (Eq, Ord, Show) instance Arbitrary (ASCII B.ByteString) where arbitrary = (ASCII . B.pack) <$> listOf (choose (0,127)) shrink = map (ASCII . B.pack) . shrink . B.unpack . fromASCII instance Arbitrary (ASCII BL.ByteString) where arbitrary = ASCII <$> (repackBS <$> arbitrary <*> (fromASCII <$> arbitrary)) shrink = map (ASCII . BL.pack) . shrink . BL.unpack . fromASCII type Repack = NonEmptyList (Positive (Small Int)) repackBS :: Repack -> B.ByteString -> BL.ByteString repackBS (NonEmpty bs) = BL.fromChunks . repackBS_ (map (getSmall . getPositive) bs) repackBS_ :: [Int] -> B.ByteString -> [B.ByteString] repackBS_ = go . cycle where go (b:bs) s | B.null s = [] | otherwise = let (h,t) = B.splitAt b s in h : go bs t go _ _ = error "unpossible" instance Arbitrary T.Text where arbitrary = T.pack <$> string shrink = map T.pack . shrinkList shrinkChar . T.unpack instance Arbitrary TL.Text where arbitrary = TL.pack <$> string shrink = map TL.pack . shrinkList shrinkChar . TL.unpack repackT :: Repack -> T.Text -> TL.Text repackT (NonEmpty bs) = TL.fromChunks . repackT_ (map (getSmall . getPositive) bs) repackT_ :: [Int] -> T.Text -> [T.Text] repackT_ = go . cycle where go (b:bs) s | T.null s = [] | otherwise = let (h,t) = T.splitAt b s in h : go bs t go _ _ = error "unpossible" liftOp :: (Show a, Testable prop) => String -> (a -> a -> prop) -> a -> a -> Property liftOp name f x y = counterexample desc (f x y) where op = case name of (c:_) | isAlpha c -> " `" ++ name ++ "` " | otherwise -> " " ++ name ++ " " _ -> " ??? " desc = "not (" ++ show x ++ op ++ show y ++ ")" attoparsec-0.13.2.4/tests/QC/IPv6/0000755000000000000000000000000007346545000014526 5ustar0000000000000000attoparsec-0.13.2.4/tests/QC/IPv6/Internal.hs0000644000000000000000000002774307346545000016653 0ustar0000000000000000-- ----------------------------------------------------------------------------- -- | -- Module : Text.IPv6Addr -- Copyright : Copyright © Michel Boucey 2011-2015 -- License : BSD-Style -- Maintainer : michel.boucey@gmail.com -- -- Dealing with IPv6 address text representations, canonization and manipulations. -- -- ----------------------------------------------------------------------------- {-# LANGUAGE OverloadedStrings #-} module QC.IPv6.Internal where {- ( expandTokens , macAddr , maybeIPv6AddrTokens , ipv4AddrToIPv6AddrTokens , ipv6TokensToText , ipv6TokensToIPv6Addr , isIPv6Addr , maybeTokIPv6Addr , maybeTokPureIPv6Addr , fromDoubleColon , fromIPv6Addr , toDoubleColon ) where -} import Debug.Trace import Control.Monad (replicateM) import Data.Attoparsec.Text import Data.Char (isDigit,isHexDigit,toLower) import Data.Monoid ((<>)) import Control.Applicative ((<|>),(<*)) import Data.List (group,isSuffixOf,elemIndex,elemIndices,intersperse) import Data.Word (Word32) import Numeric (showHex) import qualified Data.Text as T import qualified Data.Text.Read as R (decimal) import Data.Maybe (fromJust) import QC.IPv6.Types tok0 = "0" -- | Returns the 'T.Text' of an IPv6 address. fromIPv6Addr :: IPv6Addr -> T.Text fromIPv6Addr (IPv6Addr t) = t -- | Given an arbitrary list of 'IPv6AddrToken', returns the corresponding 'T.Text'. ipv6TokensToText :: [IPv6AddrToken] -> T.Text ipv6TokensToText l = T.concat $ map ipv6TokenToText l -- | Returns the corresponding 'T.Text' of an IPv6 address token. ipv6TokenToText :: IPv6AddrToken -> T.Text ipv6TokenToText (SixteenBit s) = s ipv6TokenToText Colon = ":" ipv6TokenToText DoubleColon = "::" ipv6TokenToText AllZeros = tok0 -- "A single 16-bit 0000 field MUST be represented as 0" (RFC 5952, 4.1) ipv6TokenToText (IPv4Addr a) = a -- | Returns 'True' if a list of 'IPv6AddrToken' constitutes a valid IPv6 Address. isIPv6Addr :: [IPv6AddrToken] -> Bool isIPv6Addr [] = False isIPv6Addr [DoubleColon] = True isIPv6Addr [DoubleColon,SixteenBit tok1] = True isIPv6Addr tks = diffNext tks && (do let cdctks = countDoubleColon tks let lentks = length tks let lasttk = last tks let lenconst = (lentks == 15 && cdctks == 0) || (lentks < 15 && cdctks == 1) firstValidToken tks && (case countIPv4Addr tks of 0 -> case lasttk of SixteenBit _ -> lenconst DoubleColon -> lenconst AllZeros -> lenconst _ -> False 1 -> case lasttk of IPv4Addr _ -> (lentks == 13 && cdctks == 0) || (lentks < 12 && cdctks == 1) _ -> False otherwise -> False)) where diffNext [] = False diffNext [_] = True diffNext (t:ts) = do let h = head ts case t of SixteenBit _ -> case h of SixteenBit _ -> False AllZeros -> False _ -> diffNext ts AllZeros -> case h of SixteenBit _ -> False AllZeros -> False _ -> diffNext ts _ -> diffNext ts firstValidToken l = case head l of SixteenBit _ -> True DoubleColon -> True AllZeros -> True _ -> False countDoubleColon l = length $ elemIndices DoubleColon l tok1 = "1" countIPv4Addr = foldr oneMoreIPv4Addr 0 where oneMoreIPv4Addr t c = case t of IPv4Addr _ -> c + 1 otherwise -> c -- | This is the main function which returns 'Just' the list of a tokenized IPv6 -- address text representation validated against RFC 4291 and canonized -- in conformation with RFC 5952, or 'Nothing'. maybeTokIPv6Addr :: T.Text -> Maybe [IPv6AddrToken] maybeTokIPv6Addr t = case maybeIPv6AddrTokens t of Just ltks -> if isIPv6Addr ltks then Just $ (ipv4AddrReplacement . toDoubleColon . fromDoubleColon) ltks else Nothing Nothing -> Nothing where ipv4AddrReplacement ltks = if ipv4AddrRewrite ltks then init ltks ++ ipv4AddrToIPv6AddrTokens (last ltks) else ltks -- | Returns 'Just' the list of tokenized pure IPv6 address, always rewriting an -- embedded IPv4 address if present. maybeTokPureIPv6Addr :: T.Text -> Maybe [IPv6AddrToken] maybeTokPureIPv6Addr t = do ltks <- maybeIPv6AddrTokens t if isIPv6Addr ltks then Just $ (toDoubleColon . ipv4AddrReplacement . fromDoubleColon) ltks else Nothing where ipv4AddrReplacement ltks' = init ltks' ++ ipv4AddrToIPv6AddrTokens (last ltks') -- | Tokenize a 'T.Text' into 'Just' a list of 'IPv6AddrToken', or 'Nothing'. maybeIPv6AddrTokens :: T.Text -> Maybe [IPv6AddrToken] maybeIPv6AddrTokens s = case readText s of Done r l -> traceShow (r,l) $ if r==T.empty then Just l else Nothing Fail {} -> Nothing where readText s = feed (parse (many1 $ ipv4Addr <|> sixteenBit <|> doubleColon <|> colon) s) T.empty -- | An embedded IPv4 address have to be rewritten to output a pure IPv6 Address -- text representation in hexadecimal digits. But some well-known prefixed IPv6 -- addresses have to keep visible in their text representation the fact that -- they deals with IPv4 to IPv6 transition process (RFC 5952 Section 5): -- -- IPv4-compatible IPv6 address like "::1.2.3.4" -- -- IPv4-mapped IPv6 address like "::ffff:1.2.3.4" -- -- IPv4-translated address like "::ffff:0:1.2.3.4" -- -- IPv4-translatable address like "64:ff9b::1.2.3.4" -- -- ISATAP address like "fe80::5efe:1.2.3.4" -- ipv4AddrRewrite :: [IPv6AddrToken] -> Bool ipv4AddrRewrite tks = case last tks of IPv4Addr _ -> do let itks = init tks not (itks == [DoubleColon] || itks == [DoubleColon,SixteenBit tokffff,Colon] || itks == [DoubleColon,SixteenBit tokffff,Colon,AllZeros,Colon] || itks == [SixteenBit "64",Colon,SixteenBit "ff9b",DoubleColon] || [SixteenBit "200",Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks || [AllZeros,Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks || [DoubleColon,SixteenBit tok5efe,Colon] `isSuffixOf` itks) _ -> False where tokffff = "ffff" tok5efe = "5efe" -- | Rewrites an embedded 'IPv4Addr' into the corresponding list of pure 'IPv6Addr' tokens. -- -- > ipv4AddrToIPv6AddrTokens (IPv4Addr "127.0.0.1") == [SixteenBits "7f0",Colon,SixteenBits "1"] -- ipv4AddrToIPv6AddrTokens :: IPv6AddrToken -> [IPv6AddrToken] ipv4AddrToIPv6AddrTokens t = case t of IPv4Addr a -> do let m = toHex a [ SixteenBit ((!!) m 0 <> addZero ((!!) m 1)) , Colon , SixteenBit ((!!) m 2 <> addZero ((!!) m 3)) ] _ -> [t] where toHex a = map (\x -> T.pack $ showHex (read (T.unpack x)::Int) "") $ T.split (=='.') a addZero d = if T.length d == 1 then tok0 <> d else d expandTokens :: [IPv6AddrToken] -> [IPv6AddrToken] expandTokens = map expandToken where expandToken (SixteenBit s) = SixteenBit $ T.justifyRight 4 '0' s expandToken AllZeros = SixteenBit "0000" expandToken t = t fromDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken] fromDoubleColon tks = if DoubleColon `notElem` tks then tks else do let s = splitAt (fromJust $ elemIndex DoubleColon tks) tks let fsts = fst s let snds = if not (null (snd s)) then tail(snd s) else [] let fste = if null fsts then [] else fsts ++ [Colon] let snde = if null snds then [] else Colon : snds fste ++ allZerosTokensReplacement(quantityOfAllZerosTokenToReplace tks) ++ snde where allZerosTokensReplacement x = intersperse Colon (replicate x AllZeros) quantityOfAllZerosTokenToReplace x = ntks tks - foldl (\c x -> if (x /= DoubleColon) && (x /= Colon) then c+1 else c) 0 x where ntks tks = if countIPv4Addr tks == 1 then 7 else 8 toDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken] toDoubleColon tks = zerosToDoubleColon tks (zerosRunToReplace $ zerosRunsList tks) where zerosToDoubleColon :: [IPv6AddrToken] -> (Int,Int) -> [IPv6AddrToken] -- No all zeros token, so no double colon replacement... zerosToDoubleColon ls (_,0) = ls -- "The symbol '::' MUST NOT be used to shorten just one 16-bit 0 field" (RFC 5952 4.2.2) zerosToDoubleColon ls (_,1) = ls zerosToDoubleColon ls (i,l) = let ls' = filter (/= Colon) ls in intersperse Colon (Prelude.take i ls') ++ [DoubleColon] ++ intersperse Colon (drop (i+l) ls') zerosRunToReplace t = let l = longestLengthZerosRun t in (firstLongestZerosRunIndex t l,l) where firstLongestZerosRunIndex x y = sum . snd . unzip $ Prelude.takeWhile (/=(True,y)) x longestLengthZerosRun x = maximum $ map longest x where longest t = case t of (True,i) -> i _ -> 0 zerosRunsList x = map helper $ groupZerosRuns x where helper h = (head h == AllZeros, lh) where lh = length h groupZerosRuns = group . filter (/= Colon) ipv6TokensToIPv6Addr :: [IPv6AddrToken] -> Maybe IPv6Addr ipv6TokensToIPv6Addr l = Just $ IPv6Addr $ ipv6TokensToText l fullSixteenBit :: T.Text -> Maybe IPv6AddrToken fullSixteenBit t = case parse ipv6AddrFullChunk t of Done a b -> if a==T.empty then Just $ SixteenBit $ T.pack b else Nothing _ -> Nothing macAddr :: Parser (Maybe [IPv6AddrToken]) macAddr = do n1 <- count 2 hexaChar <* ":" n2 <- count 2 hexaChar <* ":" n3 <- count 2 hexaChar <* ":" n4 <- count 2 hexaChar <* ":" n5 <- count 2 hexaChar <* ":" n6 <- count 2 hexaChar return $ maybeIPv6AddrTokens $ T.pack $ concat [n1,n2,n3,n4,n5,n6] sixteenBit :: Parser IPv6AddrToken sixteenBit = do r <- ipv6AddrFullChunk <|> count 3 hexaChar <|> count 2 hexaChar <|> count 1 hexaChar -- "Leading zeros MUST be suppressed" (RFC 5952, 4.1) let r' = T.dropWhile (=='0') $ T.pack r return $ if T.null r' then AllZeros -- Hexadecimal digits MUST be in lowercase (RFC 5952 4.3) else SixteenBit $ T.toLower r' ipv4Addr :: Parser IPv6AddrToken ipv4Addr = do n1 <- manyDigits <* "." if n1 /= T.empty then do n2 <- manyDigits <* "." if n2 /= T.empty then do n3 <- manyDigits <* "." if n3 /= T.empty then do n4 <- manyDigits if n4 /= T.empty then return $ IPv4Addr $ T.intercalate "." [n1,n2,n3,n4] else parserFailure else parserFailure else parserFailure else parserFailure where parserFailure = fail "ipv4Addr parsing failure" manyDigits = do ds <- takeWhile1 isDigit case R.decimal ds of Right (n,_) -> return (if n < 256 then T.pack $ show n else T.empty) Left _ -> return T.empty doubleColon :: Parser IPv6AddrToken doubleColon = do string "::" return DoubleColon colon :: Parser IPv6AddrToken colon = do string ":" return Colon ipv6AddrFullChunk :: Parser String ipv6AddrFullChunk = count 4 hexaChar hexaChar :: Parser Char hexaChar = satisfy (inClass "0-9a-fA-F") attoparsec-0.13.2.4/tests/QC/IPv6/Internal.hs0000755000000000000000000002774307346545000016656 0ustar0000000000000000-- ----------------------------------------------------------------------------- -- | -- Module : Text.IPv6Addr -- Copyright : Copyright © Michel Boucey 2011-2015 -- License : BSD-Style -- Maintainer : michel.boucey@gmail.com -- -- Dealing with IPv6 address text representations, canonization and manipulations. -- -- ----------------------------------------------------------------------------- {-# LANGUAGE OverloadedStrings #-} module QC.IPv6.Internal where {- ( expandTokens , macAddr , maybeIPv6AddrTokens , ipv4AddrToIPv6AddrTokens , ipv6TokensToText , ipv6TokensToIPv6Addr , isIPv6Addr , maybeTokIPv6Addr , maybeTokPureIPv6Addr , fromDoubleColon , fromIPv6Addr , toDoubleColon ) where -} import Debug.Trace import Control.Monad (replicateM) import Data.Attoparsec.Text import Data.Char (isDigit,isHexDigit,toLower) import Data.Monoid ((<>)) import Control.Applicative ((<|>),(<*)) import Data.List (group,isSuffixOf,elemIndex,elemIndices,intersperse) import Data.Word (Word32) import Numeric (showHex) import qualified Data.Text as T import qualified Data.Text.Read as R (decimal) import Data.Maybe (fromJust) import QC.IPv6.Types tok0 = "0" -- | Returns the 'T.Text' of an IPv6 address. fromIPv6Addr :: IPv6Addr -> T.Text fromIPv6Addr (IPv6Addr t) = t -- | Given an arbitrary list of 'IPv6AddrToken', returns the corresponding 'T.Text'. ipv6TokensToText :: [IPv6AddrToken] -> T.Text ipv6TokensToText l = T.concat $ map ipv6TokenToText l -- | Returns the corresponding 'T.Text' of an IPv6 address token. ipv6TokenToText :: IPv6AddrToken -> T.Text ipv6TokenToText (SixteenBit s) = s ipv6TokenToText Colon = ":" ipv6TokenToText DoubleColon = "::" ipv6TokenToText AllZeros = tok0 -- "A single 16-bit 0000 field MUST be represented as 0" (RFC 5952, 4.1) ipv6TokenToText (IPv4Addr a) = a -- | Returns 'True' if a list of 'IPv6AddrToken' constitutes a valid IPv6 Address. isIPv6Addr :: [IPv6AddrToken] -> Bool isIPv6Addr [] = False isIPv6Addr [DoubleColon] = True isIPv6Addr [DoubleColon,SixteenBit tok1] = True isIPv6Addr tks = diffNext tks && (do let cdctks = countDoubleColon tks let lentks = length tks let lasttk = last tks let lenconst = (lentks == 15 && cdctks == 0) || (lentks < 15 && cdctks == 1) firstValidToken tks && (case countIPv4Addr tks of 0 -> case lasttk of SixteenBit _ -> lenconst DoubleColon -> lenconst AllZeros -> lenconst _ -> False 1 -> case lasttk of IPv4Addr _ -> (lentks == 13 && cdctks == 0) || (lentks < 12 && cdctks == 1) _ -> False otherwise -> False)) where diffNext [] = False diffNext [_] = True diffNext (t:ts) = do let h = head ts case t of SixteenBit _ -> case h of SixteenBit _ -> False AllZeros -> False _ -> diffNext ts AllZeros -> case h of SixteenBit _ -> False AllZeros -> False _ -> diffNext ts _ -> diffNext ts firstValidToken l = case head l of SixteenBit _ -> True DoubleColon -> True AllZeros -> True _ -> False countDoubleColon l = length $ elemIndices DoubleColon l tok1 = "1" countIPv4Addr = foldr oneMoreIPv4Addr 0 where oneMoreIPv4Addr t c = case t of IPv4Addr _ -> c + 1 otherwise -> c -- | This is the main function which returns 'Just' the list of a tokenized IPv6 -- address text representation validated against RFC 4291 and canonized -- in conformation with RFC 5952, or 'Nothing'. maybeTokIPv6Addr :: T.Text -> Maybe [IPv6AddrToken] maybeTokIPv6Addr t = case maybeIPv6AddrTokens t of Just ltks -> if isIPv6Addr ltks then Just $ (ipv4AddrReplacement . toDoubleColon . fromDoubleColon) ltks else Nothing Nothing -> Nothing where ipv4AddrReplacement ltks = if ipv4AddrRewrite ltks then init ltks ++ ipv4AddrToIPv6AddrTokens (last ltks) else ltks -- | Returns 'Just' the list of tokenized pure IPv6 address, always rewriting an -- embedded IPv4 address if present. maybeTokPureIPv6Addr :: T.Text -> Maybe [IPv6AddrToken] maybeTokPureIPv6Addr t = do ltks <- maybeIPv6AddrTokens t if isIPv6Addr ltks then Just $ (toDoubleColon . ipv4AddrReplacement . fromDoubleColon) ltks else Nothing where ipv4AddrReplacement ltks' = init ltks' ++ ipv4AddrToIPv6AddrTokens (last ltks') -- | Tokenize a 'T.Text' into 'Just' a list of 'IPv6AddrToken', or 'Nothing'. maybeIPv6AddrTokens :: T.Text -> Maybe [IPv6AddrToken] maybeIPv6AddrTokens s = case readText s of Done r l -> traceShow (r,l) $ if r==T.empty then Just l else Nothing Fail {} -> Nothing where readText s = feed (parse (many1 $ ipv4Addr <|> sixteenBit <|> doubleColon <|> colon) s) T.empty -- | An embedded IPv4 address have to be rewritten to output a pure IPv6 Address -- text representation in hexadecimal digits. But some well-known prefixed IPv6 -- addresses have to keep visible in their text representation the fact that -- they deals with IPv4 to IPv6 transition process (RFC 5952 Section 5): -- -- IPv4-compatible IPv6 address like "::1.2.3.4" -- -- IPv4-mapped IPv6 address like "::ffff:1.2.3.4" -- -- IPv4-translated address like "::ffff:0:1.2.3.4" -- -- IPv4-translatable address like "64:ff9b::1.2.3.4" -- -- ISATAP address like "fe80::5efe:1.2.3.4" -- ipv4AddrRewrite :: [IPv6AddrToken] -> Bool ipv4AddrRewrite tks = case last tks of IPv4Addr _ -> do let itks = init tks not (itks == [DoubleColon] || itks == [DoubleColon,SixteenBit tokffff,Colon] || itks == [DoubleColon,SixteenBit tokffff,Colon,AllZeros,Colon] || itks == [SixteenBit "64",Colon,SixteenBit "ff9b",DoubleColon] || [SixteenBit "200",Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks || [AllZeros,Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks || [DoubleColon,SixteenBit tok5efe,Colon] `isSuffixOf` itks) _ -> False where tokffff = "ffff" tok5efe = "5efe" -- | Rewrites an embedded 'IPv4Addr' into the corresponding list of pure 'IPv6Addr' tokens. -- -- > ipv4AddrToIPv6AddrTokens (IPv4Addr "127.0.0.1") == [SixteenBits "7f0",Colon,SixteenBits "1"] -- ipv4AddrToIPv6AddrTokens :: IPv6AddrToken -> [IPv6AddrToken] ipv4AddrToIPv6AddrTokens t = case t of IPv4Addr a -> do let m = toHex a [ SixteenBit ((!!) m 0 <> addZero ((!!) m 1)) , Colon , SixteenBit ((!!) m 2 <> addZero ((!!) m 3)) ] _ -> [t] where toHex a = map (\x -> T.pack $ showHex (read (T.unpack x)::Int) "") $ T.split (=='.') a addZero d = if T.length d == 1 then tok0 <> d else d expandTokens :: [IPv6AddrToken] -> [IPv6AddrToken] expandTokens = map expandToken where expandToken (SixteenBit s) = SixteenBit $ T.justifyRight 4 '0' s expandToken AllZeros = SixteenBit "0000" expandToken t = t fromDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken] fromDoubleColon tks = if DoubleColon `notElem` tks then tks else do let s = splitAt (fromJust $ elemIndex DoubleColon tks) tks let fsts = fst s let snds = if not (null (snd s)) then tail(snd s) else [] let fste = if null fsts then [] else fsts ++ [Colon] let snde = if null snds then [] else Colon : snds fste ++ allZerosTokensReplacement(quantityOfAllZerosTokenToReplace tks) ++ snde where allZerosTokensReplacement x = intersperse Colon (replicate x AllZeros) quantityOfAllZerosTokenToReplace x = ntks tks - foldl (\c x -> if (x /= DoubleColon) && (x /= Colon) then c+1 else c) 0 x where ntks tks = if countIPv4Addr tks == 1 then 7 else 8 toDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken] toDoubleColon tks = zerosToDoubleColon tks (zerosRunToReplace $ zerosRunsList tks) where zerosToDoubleColon :: [IPv6AddrToken] -> (Int,Int) -> [IPv6AddrToken] -- No all zeros token, so no double colon replacement... zerosToDoubleColon ls (_,0) = ls -- "The symbol '::' MUST NOT be used to shorten just one 16-bit 0 field" (RFC 5952 4.2.2) zerosToDoubleColon ls (_,1) = ls zerosToDoubleColon ls (i,l) = let ls' = filter (/= Colon) ls in intersperse Colon (Prelude.take i ls') ++ [DoubleColon] ++ intersperse Colon (drop (i+l) ls') zerosRunToReplace t = let l = longestLengthZerosRun t in (firstLongestZerosRunIndex t l,l) where firstLongestZerosRunIndex x y = sum . snd . unzip $ Prelude.takeWhile (/=(True,y)) x longestLengthZerosRun x = maximum $ map longest x where longest t = case t of (True,i) -> i _ -> 0 zerosRunsList x = map helper $ groupZerosRuns x where helper h = (head h == AllZeros, lh) where lh = length h groupZerosRuns = group . filter (/= Colon) ipv6TokensToIPv6Addr :: [IPv6AddrToken] -> Maybe IPv6Addr ipv6TokensToIPv6Addr l = Just $ IPv6Addr $ ipv6TokensToText l fullSixteenBit :: T.Text -> Maybe IPv6AddrToken fullSixteenBit t = case parse ipv6AddrFullChunk t of Done a b -> if a==T.empty then Just $ SixteenBit $ T.pack b else Nothing _ -> Nothing macAddr :: Parser (Maybe [IPv6AddrToken]) macAddr = do n1 <- count 2 hexaChar <* ":" n2 <- count 2 hexaChar <* ":" n3 <- count 2 hexaChar <* ":" n4 <- count 2 hexaChar <* ":" n5 <- count 2 hexaChar <* ":" n6 <- count 2 hexaChar return $ maybeIPv6AddrTokens $ T.pack $ concat [n1,n2,n3,n4,n5,n6] sixteenBit :: Parser IPv6AddrToken sixteenBit = do r <- ipv6AddrFullChunk <|> count 3 hexaChar <|> count 2 hexaChar <|> count 1 hexaChar -- "Leading zeros MUST be suppressed" (RFC 5952, 4.1) let r' = T.dropWhile (=='0') $ T.pack r return $ if T.null r' then AllZeros -- Hexadecimal digits MUST be in lowercase (RFC 5952 4.3) else SixteenBit $ T.toLower r' ipv4Addr :: Parser IPv6AddrToken ipv4Addr = do n1 <- manyDigits <* "." if n1 /= T.empty then do n2 <- manyDigits <* "." if n2 /= T.empty then do n3 <- manyDigits <* "." if n3 /= T.empty then do n4 <- manyDigits if n4 /= T.empty then return $ IPv4Addr $ T.intercalate "." [n1,n2,n3,n4] else parserFailure else parserFailure else parserFailure else parserFailure where parserFailure = fail "ipv4Addr parsing failure" manyDigits = do ds <- takeWhile1 isDigit case R.decimal ds of Right (n,_) -> return (if n < 256 then T.pack $ show n else T.empty) Left _ -> return T.empty doubleColon :: Parser IPv6AddrToken doubleColon = do string "::" return DoubleColon colon :: Parser IPv6AddrToken colon = do string ":" return Colon ipv6AddrFullChunk :: Parser String ipv6AddrFullChunk = count 4 hexaChar hexaChar :: Parser Char hexaChar = satisfy (inClass "0-9a-fA-F") attoparsec-0.13.2.4/tests/QC/IPv6/Types.hs0000644000000000000000000000201407346545000016163 0ustar0000000000000000-- ----------------------------------------------------------------------------- -- | -- Module : Text.IPv6Addr -- Copyright : Copyright © Michel Boucey 2011-2015 -- License : BSD-Style -- Maintainer : michel.boucey@gmail.com -- -- Dealing with IPv6 address text representations, canonization and manipulations. -- -- ----------------------------------------------------------------------------- module QC.IPv6.Types where import qualified Data.Text as T data IPv6Addr = IPv6Addr T.Text instance Show IPv6Addr where show (IPv6Addr addr) = T.unpack addr data IPv6AddrToken = SixteenBit T.Text -- ^ A four hexadecimal digits group representing a 16-Bit chunk | AllZeros -- ^ An all zeros 16-Bit chunk | Colon -- ^ A separator between 16-Bit chunks | DoubleColon -- ^ A double-colon stands for a unique compression of many consecutive 16-Bit chunks | IPv4Addr T.Text -- ^ An embedded IPv4 address as representation of the last 32-Bit deriving (Eq,Show) attoparsec-0.13.2.4/tests/QC/IPv6/Types.hs0000755000000000000000000000201407346545000016166 0ustar0000000000000000-- ----------------------------------------------------------------------------- -- | -- Module : Text.IPv6Addr -- Copyright : Copyright © Michel Boucey 2011-2015 -- License : BSD-Style -- Maintainer : michel.boucey@gmail.com -- -- Dealing with IPv6 address text representations, canonization and manipulations. -- -- ----------------------------------------------------------------------------- module QC.IPv6.Types where import qualified Data.Text as T data IPv6Addr = IPv6Addr T.Text instance Show IPv6Addr where show (IPv6Addr addr) = T.unpack addr data IPv6AddrToken = SixteenBit T.Text -- ^ A four hexadecimal digits group representing a 16-Bit chunk | AllZeros -- ^ An all zeros 16-Bit chunk | Colon -- ^ A separator between 16-Bit chunks | DoubleColon -- ^ A double-colon stands for a unique compression of many consecutive 16-Bit chunks | IPv4Addr T.Text -- ^ An embedded IPv4 address as representation of the last 32-Bit deriving (Eq,Show) attoparsec-0.13.2.4/tests/QC/Rechunked.hs0000644000000000000000000000341507346545000016211 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} module QC.Rechunked ( rechunkBS , rechunkT ) where import Control.Monad (forM, forM_) import Control.Monad.ST (ST, runST) import Data.List (unfoldr) import Test.QuickCheck (Gen, choose) import qualified Data.ByteString as B import qualified Data.Text as T import qualified Data.Vector as V import qualified Data.Vector.Generic as G import qualified Data.Vector.Generic.Mutable as M rechunkBS :: B.ByteString -> Gen [B.ByteString] rechunkBS = fmap (map B.copy) . rechunk_ B.splitAt B.length rechunkT :: T.Text -> Gen [T.Text] rechunkT = fmap (map T.copy) . rechunk_ T.splitAt T.length rechunk_ :: (Int -> a -> (a,a)) -> (a -> Int) -> a -> Gen [a] rechunk_ split len xs = (unfoldr go . (,) xs) `fmap` rechunkSizes (len xs) where go (b,r:rs) = Just (h, (t,rs)) where (h,t) = split r b go (_,_) = Nothing rechunkSizes :: Int -> Gen [Int] rechunkSizes n0 = shuffle =<< loop [] (0:repeat 1) n0 where loop _ [] _ = error "it's 2015, where's my Stream type?" loop acc (lb:lbs) n | n <= 0 = shuffle (reverse acc) | otherwise = do !i <- choose (lb,n) loop (i:acc) lbs (n-i) shuffle :: [Int] -> Gen [Int] shuffle (0:xs) = (0:) `fmap` shuffle xs shuffle xs = fisherYates xs fisherYates :: [a] -> Gen [a] fisherYates xs = (V.toList . V.backpermute v) `fmap` swapIndices (G.length v) where v = V.fromList xs swapIndices n0 = do swaps <- forM [0..n] $ \i -> ((,) i) `fmap` choose (i,n) return (runST (swapAll swaps)) where n = n0 - 1 swapAll :: [(Int,Int)] -> ST s (V.Vector Int) swapAll ijs = do mv <- G.unsafeThaw (G.enumFromTo 0 n :: V.Vector Int) forM_ ijs $ uncurry (M.swap mv) G.unsafeFreeze mv attoparsec-0.13.2.4/tests/QC/Rechunked.hs0000755000000000000000000000341507346545000016214 0ustar0000000000000000{-# LANGUAGE BangPatterns #-} module QC.Rechunked ( rechunkBS , rechunkT ) where import Control.Monad (forM, forM_) import Control.Monad.ST (ST, runST) import Data.List (unfoldr) import Test.QuickCheck (Gen, choose) import qualified Data.ByteString as B import qualified Data.Text as T import qualified Data.Vector as V import qualified Data.Vector.Generic as G import qualified Data.Vector.Generic.Mutable as M rechunkBS :: B.ByteString -> Gen [B.ByteString] rechunkBS = fmap (map B.copy) . rechunk_ B.splitAt B.length rechunkT :: T.Text -> Gen [T.Text] rechunkT = fmap (map T.copy) . rechunk_ T.splitAt T.length rechunk_ :: (Int -> a -> (a,a)) -> (a -> Int) -> a -> Gen [a] rechunk_ split len xs = (unfoldr go . (,) xs) `fmap` rechunkSizes (len xs) where go (b,r:rs) = Just (h, (t,rs)) where (h,t) = split r b go (_,_) = Nothing rechunkSizes :: Int -> Gen [Int] rechunkSizes n0 = shuffle =<< loop [] (0:repeat 1) n0 where loop _ [] _ = error "it's 2015, where's my Stream type?" loop acc (lb:lbs) n | n <= 0 = shuffle (reverse acc) | otherwise = do !i <- choose (lb,n) loop (i:acc) lbs (n-i) shuffle :: [Int] -> Gen [Int] shuffle (0:xs) = (0:) `fmap` shuffle xs shuffle xs = fisherYates xs fisherYates :: [a] -> Gen [a] fisherYates xs = (V.toList . V.backpermute v) `fmap` swapIndices (G.length v) where v = V.fromList xs swapIndices n0 = do swaps <- forM [0..n] $ \i -> ((,) i) `fmap` choose (i,n) return (runST (swapAll swaps)) where n = n0 - 1 swapAll :: [(Int,Int)] -> ST s (V.Vector Int) swapAll ijs = do mv <- G.unsafeThaw (G.enumFromTo 0 n :: V.Vector Int) forM_ ijs $ uncurry (M.swap mv) G.unsafeFreeze mv attoparsec-0.13.2.4/tests/QC/Simple.hs0000644000000000000000000000206507346545000015532 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} {-# OPTIONS_GHC -fno-warn-missing-signatures #-} module QC.Simple ( tests ) where import Control.Applicative ((<|>)) import Data.ByteString (ByteString) import Data.List (foldl') import Data.Maybe (fromMaybe) import QC.Rechunked (rechunkBS) import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck (Property, counterexample, forAll) import qualified Data.Attoparsec.ByteString.Char8 as A t_issue75 = expect issue75 "ab" (A.Done "" "b") issue75 :: A.Parser ByteString issue75 = "a" >> ("b" <|> "") expect :: (Show r, Eq r) => A.Parser r -> ByteString -> A.Result r -> Property expect p input wanted = forAll (rechunkBS input) $ \in' -> let result = parse p in' in counterexample (show result ++ " /= " ++ show wanted) $ fromMaybe False (A.compareResults result wanted) parse :: A.Parser r -> [ByteString] -> A.Result r parse p (x:xs) = foldl' A.feed (A.parse p x) xs parse p [] = A.parse p "" tests :: [TestTree] tests = [ testProperty "issue75" t_issue75 ] attoparsec-0.13.2.4/tests/QC/Simple.hs0000755000000000000000000000206507346545000015535 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} {-# OPTIONS_GHC -fno-warn-missing-signatures #-} module QC.Simple ( tests ) where import Control.Applicative ((<|>)) import Data.ByteString (ByteString) import Data.List (foldl') import Data.Maybe (fromMaybe) import QC.Rechunked (rechunkBS) import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck (Property, counterexample, forAll) import qualified Data.Attoparsec.ByteString.Char8 as A t_issue75 = expect issue75 "ab" (A.Done "" "b") issue75 :: A.Parser ByteString issue75 = "a" >> ("b" <|> "") expect :: (Show r, Eq r) => A.Parser r -> ByteString -> A.Result r -> Property expect p input wanted = forAll (rechunkBS input) $ \in' -> let result = parse p in' in counterexample (show result ++ " /= " ++ show wanted) $ fromMaybe False (A.compareResults result wanted) parse :: A.Parser r -> [ByteString] -> A.Result r parse p (x:xs) = foldl' A.feed (A.parse p x) xs parse p [] = A.parse p "" tests :: [TestTree] tests = [ testProperty "issue75" t_issue75 ] attoparsec-0.13.2.4/tests/QC/Text.hs0000644000000000000000000001565207346545000015233 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-} {-# OPTIONS_GHC -fno-warn-warnings-deprecations #-} module QC.Text (tests) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<*>), (<$>)) #endif import Data.Int (Int64) import Data.Word (Word8) import Prelude hiding (take, takeWhile) import QC.Common (liftOp, parseT) import qualified QC.Text.FastSet as FastSet import qualified QC.Text.Regressions as Regressions import Test.Tasty (TestTree, testGroup) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.Text as P import qualified Data.Attoparsec.Text.Lazy as PL import qualified Data.Attoparsec.Text.FastSet as S import qualified Data.ByteString as BS import qualified Data.Char as Char import qualified Data.Text as T import qualified Data.Text.Encoding as TE import qualified Data.Text.Lazy as L -- Basic byte-level combinators. satisfy :: Char -> L.Text -> Property satisfy w s = parseT (P.satisfy (<=w)) (L.cons w s) === Just w satisfyWith :: Char -> L.Text -> Property satisfyWith c s = parseT (P.satisfyWith id (<=c)) (L.cons c s) === Just c char :: Char -> L.Text -> Property char w s = parseT (P.char w) (L.cons w s) === Just w skip :: Char -> L.Text -> Property skip w s = case (parseT (P.skip ( maybe (property True) (expectFailure . it) mcs (Just _, mcs) -> maybe (property False) it mcs where it cs = liftOp "<" (<) (fst cs) w anyChar :: L.Text -> Property anyChar s | L.null s = p === Nothing | otherwise = p === Just (L.head s) where p = parseT P.anyChar s notChar :: Char -> NonEmptyList Char -> Property notChar w (NonEmpty s) = parseT (P.notChar w) bs === if v == w then Nothing else Just v where v = L.head bs bs = L.pack s peekChar :: L.Text -> Property peekChar s | L.null s = p === Just (Nothing, s) | otherwise = p === Just (Just (L.head s), s) where p = parseT ((,) <$> P.peekChar <*> P.takeLazyText) s peekChar' :: L.Text -> Property peekChar' s = parseT P.peekChar' s === (fst <$> L.uncons s) string :: L.Text -> L.Text -> Property string s t = parseT (P.string s') (s `L.append` t) === Just s' where s' = toStrict s strings :: L.Text -> L.Text -> L.Text -> Property strings s t u = parseT (P.string (toStrict s) >> P.string t') (L.concat [s,t,u]) === Just t' where t' = toStrict t -- | Note: "simple, and efficient" works for well formed input... -- i.e. e.g. Latin1 texts stringCI :: [Word8] -> Property stringCI ws = P.parseOnly (P.stringCI fs) s === Right s where fs = T.toCaseFold s s = TE.decodeLatin1 (BS.pack ws) asciiCI :: T.Text -> Gen Bool asciiCI x = (\s i -> P.parseOnly (P.asciiCI s) i == Right i) <$> maybeModifyCase x <*> maybeModifyCase x where maybeModifyCase s = elements [s, toLower s, toUpper s] toLower = T.map (\c -> if c < Char.chr 127 then Char.toLower c else c) toUpper = T.map (\c -> if c < Char.chr 127 then Char.toUpper c else c) toStrict :: L.Text -> T.Text toStrict = T.concat . L.toChunks skipWhile :: Char -> L.Text -> Property skipWhile w s = let t = L.dropWhile (<=w) s in case PL.parse (P.skipWhile (<=w)) s of PL.Done t' () -> t === t' _ -> property False take :: Int -> L.Text -> Property take n s = maybe (liftOp "<" (<) (L.length s) (fromIntegral n)) (=== T.take n (toStrict s)) $ parseT (P.take n) s takeText :: L.Text -> Property takeText s = maybe (property False) (=== toStrict s) . parseT P.takeText $ s takeLazyText :: L.Text -> Property takeLazyText s = maybe (property False) (=== s) . parseT P.takeLazyText $ s takeCount :: Positive Int -> L.Text -> Property takeCount (Positive k) s = case parseT (P.take k) s of Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s) Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s) takeWhile :: Char -> L.Text -> Property takeWhile w s = let (h,t) = L.span (==w) s in case PL.parse (P.takeWhile (==w)) s of PL.Done t' h' -> t === t' .&&. toStrict h === h' _ -> property False takeWhile1 :: Char -> L.Text -> Property takeWhile1 w s = let s' = L.cons w s (h,t) = L.span (<=w) s' in case PL.parse (P.takeWhile1 (<=w)) s' of PL.Done t' h' -> t === t' .&&. toStrict h === h' _ -> property False takeTill :: Char -> L.Text -> Property takeTill w s = let (h,t) = L.break (==w) s in case PL.parse (P.takeTill (==w)) s of PL.Done t' h' -> t === t' .&&. toStrict h === h' _ -> property False takeWhile1_empty :: Property takeWhile1_empty = parseT (P.takeWhile1 undefined) L.empty === Nothing endOfInput :: L.Text -> Property endOfInput s = parseT P.endOfInput s === if L.null s then Just () else Nothing endOfLine :: L.Text -> Property endOfLine s = case (parseT P.endOfLine s, L.uncons s) of (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs (Just _, mcs) -> maybe (property False) eol mcs where eol (c,s') = c === '\n' .||. (c, fst <$> L.uncons s') === ('\r', Just '\n') scan :: L.Text -> Positive Int64 -> Property -- for some reason, if counterexample is removed, this test fails? scan s (Positive k) = counterexample (show s) $ parseT p s === Just (toStrict $ L.take k s) where p = P.scan k $ \ n _ -> if n > 0 then let !n' = n - 1 in Just n' else Nothing members :: String -> Property members s = property $ all (`S.member` set) s where set = S.fromList s nonmembers :: String -> String -> Property nonmembers s s' = property . not . any (`S.member` set) $ filter (not . (`elem` s)) s' where set = S.fromList s tests :: [TestTree] tests = [ testProperty "anyChar" anyChar , testProperty "asciiCI" asciiCI , testProperty "char" char , testProperty "endOfInput" endOfInput , testProperty "endOfLine" endOfLine , testProperty "notChar" notChar , testProperty "peekChar" peekChar , testProperty "peekChar'" peekChar' , testProperty "satisfy" satisfy , testProperty "satisfyWith" satisfyWith , testProperty "scan" scan , testProperty "skip" skip , testProperty "skipWhile" skipWhile , testProperty "string" string , testProperty "strings" strings , testProperty "stringCI" stringCI , testProperty "take" take , testProperty "takeText" takeText , testProperty "takeCount" takeCount , testProperty "takeLazyText" takeLazyText , testProperty "takeTill" takeTill , testProperty "takeWhile" takeWhile , testProperty "takeWhile1" takeWhile1 , testProperty "takeWhile1_empty" takeWhile1_empty , testProperty "members" members , testProperty "nonmembers" nonmembers , testGroup "FastSet" FastSet.tests , testGroup "Regressions" Regressions.tests ] attoparsec-0.13.2.4/tests/QC/Text.hs0000755000000000000000000001565207346545000015236 0ustar0000000000000000{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-} {-# OPTIONS_GHC -fno-warn-warnings-deprecations #-} module QC.Text (tests) where #if !MIN_VERSION_base(4,8,0) import Control.Applicative ((<*>), (<$>)) #endif import Data.Int (Int64) import Data.Word (Word8) import Prelude hiding (take, takeWhile) import QC.Common (liftOp, parseT) import qualified QC.Text.FastSet as FastSet import qualified QC.Text.Regressions as Regressions import Test.Tasty (TestTree, testGroup) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.Text as P import qualified Data.Attoparsec.Text.Lazy as PL import qualified Data.Attoparsec.Text.FastSet as S import qualified Data.ByteString as BS import qualified Data.Char as Char import qualified Data.Text as T import qualified Data.Text.Encoding as TE import qualified Data.Text.Lazy as L -- Basic byte-level combinators. satisfy :: Char -> L.Text -> Property satisfy w s = parseT (P.satisfy (<=w)) (L.cons w s) === Just w satisfyWith :: Char -> L.Text -> Property satisfyWith c s = parseT (P.satisfyWith id (<=c)) (L.cons c s) === Just c char :: Char -> L.Text -> Property char w s = parseT (P.char w) (L.cons w s) === Just w skip :: Char -> L.Text -> Property skip w s = case (parseT (P.skip ( maybe (property True) (expectFailure . it) mcs (Just _, mcs) -> maybe (property False) it mcs where it cs = liftOp "<" (<) (fst cs) w anyChar :: L.Text -> Property anyChar s | L.null s = p === Nothing | otherwise = p === Just (L.head s) where p = parseT P.anyChar s notChar :: Char -> NonEmptyList Char -> Property notChar w (NonEmpty s) = parseT (P.notChar w) bs === if v == w then Nothing else Just v where v = L.head bs bs = L.pack s peekChar :: L.Text -> Property peekChar s | L.null s = p === Just (Nothing, s) | otherwise = p === Just (Just (L.head s), s) where p = parseT ((,) <$> P.peekChar <*> P.takeLazyText) s peekChar' :: L.Text -> Property peekChar' s = parseT P.peekChar' s === (fst <$> L.uncons s) string :: L.Text -> L.Text -> Property string s t = parseT (P.string s') (s `L.append` t) === Just s' where s' = toStrict s strings :: L.Text -> L.Text -> L.Text -> Property strings s t u = parseT (P.string (toStrict s) >> P.string t') (L.concat [s,t,u]) === Just t' where t' = toStrict t -- | Note: "simple, and efficient" works for well formed input... -- i.e. e.g. Latin1 texts stringCI :: [Word8] -> Property stringCI ws = P.parseOnly (P.stringCI fs) s === Right s where fs = T.toCaseFold s s = TE.decodeLatin1 (BS.pack ws) asciiCI :: T.Text -> Gen Bool asciiCI x = (\s i -> P.parseOnly (P.asciiCI s) i == Right i) <$> maybeModifyCase x <*> maybeModifyCase x where maybeModifyCase s = elements [s, toLower s, toUpper s] toLower = T.map (\c -> if c < Char.chr 127 then Char.toLower c else c) toUpper = T.map (\c -> if c < Char.chr 127 then Char.toUpper c else c) toStrict :: L.Text -> T.Text toStrict = T.concat . L.toChunks skipWhile :: Char -> L.Text -> Property skipWhile w s = let t = L.dropWhile (<=w) s in case PL.parse (P.skipWhile (<=w)) s of PL.Done t' () -> t === t' _ -> property False take :: Int -> L.Text -> Property take n s = maybe (liftOp "<" (<) (L.length s) (fromIntegral n)) (=== T.take n (toStrict s)) $ parseT (P.take n) s takeText :: L.Text -> Property takeText s = maybe (property False) (=== toStrict s) . parseT P.takeText $ s takeLazyText :: L.Text -> Property takeLazyText s = maybe (property False) (=== s) . parseT P.takeLazyText $ s takeCount :: Positive Int -> L.Text -> Property takeCount (Positive k) s = case parseT (P.take k) s of Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s) Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s) takeWhile :: Char -> L.Text -> Property takeWhile w s = let (h,t) = L.span (==w) s in case PL.parse (P.takeWhile (==w)) s of PL.Done t' h' -> t === t' .&&. toStrict h === h' _ -> property False takeWhile1 :: Char -> L.Text -> Property takeWhile1 w s = let s' = L.cons w s (h,t) = L.span (<=w) s' in case PL.parse (P.takeWhile1 (<=w)) s' of PL.Done t' h' -> t === t' .&&. toStrict h === h' _ -> property False takeTill :: Char -> L.Text -> Property takeTill w s = let (h,t) = L.break (==w) s in case PL.parse (P.takeTill (==w)) s of PL.Done t' h' -> t === t' .&&. toStrict h === h' _ -> property False takeWhile1_empty :: Property takeWhile1_empty = parseT (P.takeWhile1 undefined) L.empty === Nothing endOfInput :: L.Text -> Property endOfInput s = parseT P.endOfInput s === if L.null s then Just () else Nothing endOfLine :: L.Text -> Property endOfLine s = case (parseT P.endOfLine s, L.uncons s) of (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs (Just _, mcs) -> maybe (property False) eol mcs where eol (c,s') = c === '\n' .||. (c, fst <$> L.uncons s') === ('\r', Just '\n') scan :: L.Text -> Positive Int64 -> Property -- for some reason, if counterexample is removed, this test fails? scan s (Positive k) = counterexample (show s) $ parseT p s === Just (toStrict $ L.take k s) where p = P.scan k $ \ n _ -> if n > 0 then let !n' = n - 1 in Just n' else Nothing members :: String -> Property members s = property $ all (`S.member` set) s where set = S.fromList s nonmembers :: String -> String -> Property nonmembers s s' = property . not . any (`S.member` set) $ filter (not . (`elem` s)) s' where set = S.fromList s tests :: [TestTree] tests = [ testProperty "anyChar" anyChar , testProperty "asciiCI" asciiCI , testProperty "char" char , testProperty "endOfInput" endOfInput , testProperty "endOfLine" endOfLine , testProperty "notChar" notChar , testProperty "peekChar" peekChar , testProperty "peekChar'" peekChar' , testProperty "satisfy" satisfy , testProperty "satisfyWith" satisfyWith , testProperty "scan" scan , testProperty "skip" skip , testProperty "skipWhile" skipWhile , testProperty "string" string , testProperty "strings" strings , testProperty "stringCI" stringCI , testProperty "take" take , testProperty "takeText" takeText , testProperty "takeCount" takeCount , testProperty "takeLazyText" takeLazyText , testProperty "takeTill" takeTill , testProperty "takeWhile" takeWhile , testProperty "takeWhile1" takeWhile1 , testProperty "takeWhile1_empty" takeWhile1_empty , testProperty "members" members , testProperty "nonmembers" nonmembers , testGroup "FastSet" FastSet.tests , testGroup "Regressions" Regressions.tests ] attoparsec-0.13.2.4/tests/QC/Text/0000755000000000000000000000000007346545000014666 5ustar0000000000000000attoparsec-0.13.2.4/tests/QC/Text/FastSet.hs0000644000000000000000000000077707346545000016606 0ustar0000000000000000module QC.Text.FastSet where import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck import qualified Data.Attoparsec.Text.FastSet as FastSet membershipCorrect :: String -> String -> Property membershipCorrect members others = let fs = FastSet.fromList members correct c = (c `FastSet.member` fs) == (c `elem` members) in property $ all correct (members ++ others) tests :: [TestTree] tests = [ testProperty "membership is correct" membershipCorrect ] attoparsec-0.13.2.4/tests/QC/Text/Regressions.hs0000644000000000000000000000276707346545000017541 0ustar0000000000000000{-# LANGUAGE OverloadedStrings #-} module QC.Text.Regressions ( tests ) where import Data.Text (Text) import qualified Data.Text as T import Data.List (foldl') import Data.Maybe (fromMaybe) import Data.Char (isLower) import Data.Monoid ((<>)) import QC.Rechunked (rechunkT) import Test.Tasty (TestTree) import Test.Tasty.QuickCheck (testProperty) import Test.QuickCheck (Property, counterexample, forAll) import qualified Data.Attoparsec.Text as A -------------------------------------------------------------------------------- -- 105 was about runScanner not always returning the final state. The result -- did depend on how the data was fed to the parser. t_issue105 :: Property t_issue105 = expect issue105 "lowER" (A.Done "ER" "low") issue105 :: A.Parser Text issue105 = do (_, firstFourLowercaseLetters) <- A.runScanner "" f return $ firstFourLowercaseLetters where f :: Text -> Char -> Maybe Text f acc c = if T.length acc < 4 && isLower c then Just $ acc <> T.singleton c else Nothing expect :: (Show r, Eq r) => A.Parser r -> Text -> A.Result r -> Property expect p input wanted = forAll (rechunkT input) $ \in' -> let result = parse p in' in counterexample (show result ++ " /= " ++ show wanted) $ fromMaybe False (A.compareResults result wanted) parse :: A.Parser r -> [Text] -> A.Result r parse p (x:xs) = foldl' A.feed (A.parse p x) xs parse p [] = A.parse p "" tests :: [TestTree] tests = [ testProperty "issue105" t_issue105 ]