pax_global_header00006660000000000000000000000064137155417630014526gustar00rootroot0000000000000052 comment=12a62cca41430629f49aa4907455df5650c11720 ntHash-2.2.0/000077500000000000000000000000001371554176300127545ustar00rootroot00000000000000ntHash-2.2.0/CITATION.bib000066400000000000000000000007431371554176300146500ustar00rootroot00000000000000@article{doi:10.1093/bioinformatics/btw397, author = {Mohamadi, Hamid and Chu, Justin and Vandervalk, Benjamin P. and Birol, Inanc}, title = {ntHash: recursive nucleotide hashing}, journal = {Bioinformatics}, volume = {32}, number = {22}, pages = {3492}, year = {2016}, doi = {10.1093/bioinformatics/btw397}, URL = { + http://dx.doi.org/10.1093/bioinformatics/btw397}, eprint = {/oup/backfile/Content_public/Journal/bioinformatics/32/22/10.1093_bioinformatics_btw397/3/btw397.pdf} } ntHash-2.2.0/ChangeLog000066400000000000000000000003671371554176300145340ustar00rootroot000000000000002020-01-21 Johnathan Wong * Release version 2.1.0 * Added support for RNA sequences * stHashIterator is now able to produce multiple hashes for each seed 2017-03-08 Hamid Mohamadi * Automake version ntHash-2.2.0/LICENSE000066400000000000000000000020571371554176300137650ustar00rootroot00000000000000MIT License Copyright (c) 2018 Hamid Mohamadi Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ntHash-2.2.0/Makefile.am000066400000000000000000000006571371554176300150200ustar00rootroot00000000000000bin_PROGRAMS = nttest nttest_CPPFLAGS = -I$(top_srcdir)/lib nttest_SOURCES = \ lib/BloomFilter.hpp \ lib/city.cc \ lib/city.h \ lib/murmur.hpp \ lib/seedgen.cpp \ lib/seqgen.hpp \ lib/xxhash.c \ lib/xxhash.h \ nthash.hpp \ ntHashIterator.hpp \ nttest.cpp dist_doc_DATA = \ ChangeLog \ CITATION.bib \ LICENSE \ README.md EXTRA_DIST=autogen.sh noinst_HEADERS = stHashIterator.hpp SUBDIRS = \ unittest \ vendor ntHash-2.2.0/README.md000066400000000000000000000114761371554176300142440ustar00rootroot00000000000000[![Release](https://img.shields.io/github/release/bcgsc/ntHash.svg)](https://github.com/bcgsc/ntHash/releases) [![Downloads](https://img.shields.io/github/downloads/bcgsc/ntHash/total?logo=github)](https://github.com/bcgsc/ntHash/archive/master.zip) [![Issues](https://img.shields.io/github/issues/bcgsc/ntHash.svg)](https://github.com/bcgsc/ntHash/issues) ![Logo](https://github.com/bcgsc/ntHash/blob/master/nthash-logo.png) ntHash = ntHash is a recursive hash function for hashing all possible k-mers in a DNA/RNA sequence. # Build the test suite ``` $ ./autogen.sh $ ./configure $ make $ sudo make install ``` To install nttest in a specified directory: ``` $ ./autogen.sh $ ./configure --prefix=/opt/ntHash/ $ make $ make install ``` The nttest suite has the options for *runtime* and *uniformity* tests. ## Runtime test For the runtime test the program has the following options: ``` nttest [OPTIONS] ... [FILE] ``` Parameters: * `-k`, `--kmer=SIZE`: the length of k-mer used for runtime test hashing `[50]` * `-h`, `--hash=SIZE`: the number of generated hashes for each k-mer `[1]` * `FILE`: is the input fasta or fastq file For example to evaluate the runtime of different hash methods on the test file `reads.fa` in DATA/ folder for k-mer length `50`, run: ``` $ nttest -k50 reads.fa ``` ## Uniformity test For the uniformity test using the Bloom filter data structure the program has the following options: ``` nttest --uniformity [OPTIONS] ... [REF_FILE] [QUERY_FILE] ``` Parameters: * `-q`, `--qnum=SIZE`: number of queries in query file * `-l`, `--qlen=SIZE`: length of reads in query file * `-t`, `--tnum=SIZE`: number of sequences in reference file * `-g`, `--tlen=SIZE`: length of reference sequence * `-i`, `--input`: generate random query and reference files * `-j`, `threads=SIZE`: number of threads to run uniformity test `[1]` * `REF_FILE`: the reference file name * `QUERY_FILE`: the query file name For example, to evaluate the uniformity of different hash methods using the Bloom filter data structure on randomly generated data sets with following options: * `100` genes of length `5,000,000bp` as reference in file `genes.fa` * `4,000,000` reads of length `250bp` as query in file `reads.fa` * `12` threads run: ``` $ nttest --uniformity --input -q4000000 -l250 -t100 -g5000000 -j12 genes.fa reads.fa ``` ## Code samples To hash all k-mers of length `k` in a given sequence `seq`: ```bash string kmer = seq.substr(0, k); uint64_t hVal=0; hVal = NTF64(kmer.c_str(), k); // initial hash value ... for (size_t i = 0; i < seq.length() - k; i++) { hVal = NTF64(hVal, seq[i], seq[i+k], k); // consecutive hash values ... } ``` To canonical hash all k-mers of length `k` in a given sequence `seq`: ```bash string kmer = seq.substr(0, k); uint64_t hVal, fhVal=0, rhVal=0; // canonical, forward, and reverse-strand hash values hVal = NTC64(kmer.c_str(), k, fhVal, rhVal); // initial hash value ... for (size_t i = 0; i < seq.length() - k; i++) { hVal = NTC64(seq[i], seq[i+k], k, fhVal, rhVal); // consecutive hash values ... } ``` To multi-hash with `h` hash values all k-mers of length `k` in a given sequence `seq`: ```bash string kmer = seq.substr(0, k); uint64_t hVec[h]; NTM64(kmer.c_str(), k, h, hVec); // initial hash vector ... for (size_t i = 0; i < seq.length() - k; i++) { NTM64(seq[i], seq[i+k], k, h, hVec); // consecutive hash vectors ... } ``` # ntHashIterator Enables ntHash on sequences To hash all k-mers of length `k` in a given sequence `seq` with `h` hash values using ntHashIterator: ```bash ntHashIterator itr(seq, h, k); while (itr != itr.end()) { ... use *itr ... ++itr; } ``` ## Usage example (C++) Outputing hash values of all k-mers in a sequence ```C++ #include #include #include "ntHashIterator.hpp" int main(int argc, const char* argv[]) { /* test sequence */ std::string seq = "GAGTGTCAAACATTCAGACAACAGCAGGGGTGCTCTGGAATCCTATGTGAGGAACAAACATTCAGGCCACAGTAG"; /* k is the k-mer length */ unsigned k = 70; /* h is the number of hashes for each k-mer */ unsigned h = 1; /* init ntHash state and compute hash values for first k-mer */ ntHashIterator itr(seq, h, k); while (itr != itr.end()) { std::cout << (*itr)[0] << std::endl; ++itr; } return 0; } ``` Publications ============ ## [ntHash](http://bioinformatics.oxfordjournals.org/content/early/2016/08/01/bioinformatics.btw397) Hamid Mohamadi, Justin Chu, Benjamin P Vandervalk, and Inanc Birol. **ntHash: recursive nucleotide hashing**. *Bioinformatics* (2016) 32 (22): 3492-3494. [doi:10.1093/bioinformatics/btw397 ](http://dx.doi.org/10.1093/bioinformatics/btw397) # acknowledgements This projects uses: * [CATCH](https://github.com/philsquared/Catch) unit test framework for C/C++ ntHash-2.2.0/autogen.sh000077500000000000000000000000721371554176300147540ustar00rootroot00000000000000#!/bin/sh set -ex aclocal autoconf autoheader automake -a ntHash-2.2.0/azure-pipelines.yml000066400000000000000000000007201371554176300166120ustar00rootroot00000000000000jobs: - job: linux pool: vmImage: Ubuntu 16.04 steps: - script: | sudo apt-get update -qq sudo apt-get install -qq software-properties-common sudo add-apt-repository -y ppa:ubuntu-toolchain-r/test sudo apt-get update -qq sudo apt-get install -qq autoconf automake gcc g++ make displayName: Install common - script: | ./autogen.sh ./configure make distcheck displayName: Compilation and unit test ntHash-2.2.0/configure.ac000066400000000000000000000036151371554176300152470ustar00rootroot00000000000000AC_PREREQ(2.62) AC_INIT(NTHASH, 2.1.0, hmohamadi@bcgsc.ca, ntHash, https://github.com/bcgsc/ntHash) # add 'foreign' to allow README.md instead of README AM_INIT_AUTOMAKE([foreign subdir-objects]) AC_CONFIG_SRCDIR([nttest.cpp]) AC_CONFIG_HEADER([config.h]) if test -z $CXXFLAGS; then CXXFLAGS='-O3' fi if test -z $CCFLAGS; then CCFLAGS='-O3' fi # Checks for programs. AC_PROG_AWK AC_PROG_CC AC_PROG_CPP AC_PROG_CXX AC_PROG_INSTALL AC_PROG_RANLIB # Checks for header files. AC_CHECK_HEADERS([dlfcn.h fcntl.h float.h limits.h \ stddef.h stdint.h stdlib.h sys/param.h zlib.h]) AC_HEADER_STDBOOL AC_HEADER_STDC # Checks for library functions. AC_CHECK_FUNCS([dup2 gethostname getopt_long getpagesize \ memset strdup strerror strtoul]) AC_FUNC_FORK AC_FUNC_MALLOC AC_FUNC_MEMCMP AC_FUNC_REALLOC AC_FUNC_SETVBUF_REVERSED AC_FUNC_VPRINTF # Checks for typedefs, structures, and compiler characteristics. AC_C_BIGENDIAN AC_C_CONST AC_C_INLINE AC_CHECK_TYPES([ptrdiff_t]) AC_TYPE_MODE_T AC_TYPE_PID_T AC_TYPE_SIZE_T AC_TYPE_SSIZE_T AC_TYPE_INT64_T AC_TYPE_UINT8_T AC_TYPE_UINT16_T AC_TYPE_UINT32_T AC_TYPE_UINT64_T # Check for the math library. AC_CHECK_LIB([m], [sqrt]) AC_CHECK_FUNCS([pow sqrt]) AC_CHECK_FUNC(ceilf, [], AC_DEFINE(ceilf, [ceil], [Define if the system does not provide ceilf])) # Check for the dynamic linking library. AC_CHECK_LIB([dl], [dlsym]) # zlib (optional) AC_CHECK_LIB([z], [gzwrite]) AM_CONDITIONAL([HAVE_LIBZ], [test $ac_cv_header_zlib_h = yes -a $ac_cv_lib_z_gzwrite = yes]) # Check for OpenMP. AC_LANG_PUSH([C++]) AC_OPENMP AC_LANG_POP([C++]) # Find the absolute path to the source. my_abs_srcdir=$(cd $srcdir; pwd) # Set compiler flags AC_SUBST(CPPFLAGS, "-I$my_abs_srcdir $OPENMP_CXXFLAGS $CPPFLAGS") AC_SUBST(LDFLAGS, "$OPENMP_CXXFLAGS $LDFLAGS") AC_SUBST(AM_CXXFLAGS, '-Wall -Wextra -Werror') AC_CONFIG_FILES([ Makefile unittest/Makefile vendor/Makefile ]) AC_OUTPUT ntHash-2.2.0/lib/000077500000000000000000000000001371554176300135225ustar00rootroot00000000000000ntHash-2.2.0/lib/BloomFilter.hpp000066400000000000000000000244051371554176300164560ustar00rootroot00000000000000/* * * BloomFilter.hpp * Author: Hamid Mohamadi * Genome Sciences Centre, * British Columbia Cancer Agency */ #ifndef BLOOMFILTER_H_ #define BLOOMFILTER_H_ #include #include #include #include #include #include #include #include #include #include #include #include "nthash.hpp" #include "city.h" #include "xxhash.h" #include "murmur.hpp" using namespace std; inline unsigned popCnt(unsigned char x) { return ((0x876543210 >> (((0x4332322132212110 >> ((x & 0xF) << 2)) & 0xF) << 2)) >> ((0x4332322132212110 >> (((x & 0xF0) >> 2)) & 0xF) << 2)) & 0xf; } class BloomFilter { public: BloomFilter(size_t filterSize, unsigned hashNum, unsigned kmerSize, const char * fPath): m_size(filterSize), m_hashNum(hashNum), m_kmerSize(kmerSize) { m_filter = new unsigned char [(m_size + 7)/8]; ifstream myFile(fPath, ios::in | ios::binary); myFile.seekg (0, ios::beg); myFile.read ((char *)m_filter, (m_size + 7)/8); myFile.close(); } BloomFilter(size_t filterSize, unsigned hashNum, unsigned kmerSize): m_size(filterSize), m_hashNum(hashNum), m_kmerSize(kmerSize) { m_filter = new unsigned char [(m_size + 7)/8]; for(size_t i = 0; i < (m_size + 7)/8; i++) m_filter[i]=0; } void insertF(const char* kmer) { uint64_t hVal = NTF64(kmer, m_kmerSize); size_t hLoc = hVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } void insertF(const char * kmer, uint64_t& hVal) { hVal = NTF64(kmer, m_kmerSize); size_t hLoc = hVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } void insertF(uint64_t& hVal, const char charOut, const char charIn) { hVal = NTF64(hVal, m_kmerSize, charOut, charIn); size_t hLoc = hVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } void insert(const char* kmer) { uint64_t hVal = NTC64(kmer, m_kmerSize); size_t hLoc = hVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } void insert(const char * kmer, uint64_t& fhVal, uint64_t& rhVal) { uint64_t hVal = NTC64(kmer, m_kmerSize, fhVal, rhVal); size_t hLoc = hVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } void insert(uint64_t& fhVal, uint64_t& rhVal, const char charOut, const char charIn) { uint64_t hVal = NTC64(charOut, charIn, m_kmerSize, fhVal, rhVal); size_t hLoc = hVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } void insertMur(const char* kmer) { for (unsigned i = 0; i < m_hashNum; i++) { size_t hLoc = MurmurHash64A(kmer, m_kmerSize, i) % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } void insertCit(const char* kmer) { for (unsigned i = 0; i < m_hashNum; i++) { size_t hLoc = CityHash64WithSeed(kmer, m_kmerSize, i) % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } void insertXxh(const char* kmer) { for (unsigned i = 0; i < m_hashNum; i++) { size_t hLoc = XXH64(kmer, m_kmerSize, i) % m_size; __sync_or_and_fetch(&m_filter[hLoc / 8], (1 << (7 - hLoc % 8))); } } bool containsF(const char* kmer) const { uint64_t hVal = NTF64(kmer, m_kmerSize); size_t hLoc = hVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } bool containsF(const char * kmer, uint64_t& hVal) { hVal = NTF64(kmer, m_kmerSize); size_t hLoc = hVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } bool containsF(uint64_t& hVal, const char charOut, const char charIn) { hVal = NTF64(hVal, m_kmerSize, charOut, charIn); size_t hLoc = hVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } bool contains(const char* kmer) const { uint64_t hVal = NTC64(kmer, m_kmerSize); size_t hLoc = hVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } bool contains(const char * kmer, uint64_t& fhVal, uint64_t& rhVal) { uint64_t hVal = NTC64(kmer, m_kmerSize, fhVal, rhVal); size_t hLoc = hVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } bool contains(uint64_t& fhVal, uint64_t& rhVal, const char charOut, const char charIn) { uint64_t hVal = NTC64(charOut, charIn, m_kmerSize, fhVal, rhVal); size_t hLoc = hVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; for (unsigned i = 1; i < m_hashNum; i++) { uint64_t mhVal = hVal * (i ^ m_kmerSize * multiSeed); mhVal ^= mhVal >> multiShift; size_t hLoc = mhVal % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } bool containsMur(const char* kmer) const { for (unsigned i = 0; i < m_hashNum; i++) { size_t hLoc = MurmurHash64A(kmer, m_kmerSize, i) % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } bool containsCit(const char* kmer) const { for (unsigned i = 0; i < m_hashNum; i++) { size_t hLoc = CityHash64WithSeed(kmer, m_kmerSize, i) % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } bool containsXxh(const char* kmer) const { for (unsigned i = 0; i < m_hashNum; i++) { size_t hLoc = XXH64(kmer, m_kmerSize, i) % m_size; if ((m_filter[hLoc / 8] & (1 << (7 - hLoc % 8))) == 0) return false; } return true; } void storeFilter(const char * fPath) const { ofstream myFile(fPath, ios::out | ios::binary); myFile.write(reinterpret_cast(m_filter), (m_size + 7)/8); myFile.close(); } size_t getPop() const { size_t i, popBF=0; #ifdef _OPENMP #pragma omp parallel for reduction(+:popBF) #endif for(i=0; i<(m_size + 7)/8; i++) popBF = popBF + popCnt(m_filter[i]); return popBF; } unsigned getHashNum() const { return m_hashNum; } unsigned getKmerSize() const { return m_kmerSize; } ~BloomFilter() { delete[] m_filter; } private: BloomFilter(const BloomFilter& that); //to prevent copy construction unsigned char * m_filter; size_t m_size; unsigned m_hashNum; unsigned m_kmerSize; }; #endif /* BLOOMFILTER_H_ */ ntHash-2.2.0/lib/city.cc000066400000000000000000000371341371554176300150110ustar00rootroot00000000000000// Copyright (c) 2011 Google, Inc. // // Permission is hereby granted, free of charge, to any person obtaining a copy // of this software and associated documentation files (the "Software"), to deal // in the Software without restriction, including without limitation the rights // to use, copy, modify, merge, publish, distribute, sublicense, and/or sell // copies of the Software, and to permit persons to whom the Software is // furnished to do so, subject to the following conditions: // // The above copyright notice and this permission notice shall be included in // all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR // IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, // FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE // AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER // LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, // OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN // THE SOFTWARE. // // CityHash, by Geoff Pike and Jyrki Alakuijala // // This file provides CityHash64() and related functions. // // It's probably possible to create even faster hash functions by // writing a program that systematically explores some of the space of // possible hash functions, by using SIMD instructions, or by // compromising on hash quality. #include #include #include // for memcpy and memset using namespace std; static uint64 UNALIGNED_LOAD64(const char *p) { uint64 result; memcpy(&result, p, sizeof(result)); return result; } static uint32 UNALIGNED_LOAD32(const char *p) { uint32 result; memcpy(&result, p, sizeof(result)); return result; } #if !defined(WORDS_BIGENDIAN) #define uint32_in_expected_order(x) (x) #define uint64_in_expected_order(x) (x) #else #ifdef _MSC_VER #include #define bswap_32(x) _byteswap_ulong(x) #define bswap_64(x) _byteswap_uint64(x) #elif defined(__APPLE__) // Mac OS X / Darwin features #include #define bswap_32(x) OSSwapInt32(x) #define bswap_64(x) OSSwapInt64(x) #else #include #endif #define uint32_in_expected_order(x) (bswap_32(x)) #define uint64_in_expected_order(x) (bswap_64(x)) #endif // WORDS_BIGENDIAN #if !defined(LIKELY) #if HAVE_BUILTIN_EXPECT #define LIKELY(x) (__builtin_expect(!!(x), 1)) #else #define LIKELY(x) (x) #endif #endif static uint64 Fetch64(const char *p) { return uint64_in_expected_order(UNALIGNED_LOAD64(p)); } static uint32 Fetch32(const char *p) { return uint32_in_expected_order(UNALIGNED_LOAD32(p)); } // Some primes between 2^63 and 2^64 for various uses. static const uint64 k0 = 0xc3a5c85c97cb3127ULL; static const uint64 k1 = 0xb492b66fbe98f273ULL; static const uint64 k2 = 0x9ae16a3b2f90404fULL; static const uint64 k3 = 0xc949d7c7509e6557ULL; // Bitwise right rotate. Normally this will compile to a single // instruction, especially if the shift is a manifest constant. static uint64 Rotate(uint64 val, int shift) { // Avoid shifting by 64: doing so yields an undefined result. return shift == 0 ? val : ((val >> shift) | (val << (64 - shift))); } // Equivalent to Rotate(), but requires the second arg to be non-zero. // On x86-64, and probably others, it's possible for this to compile // to a single instruction if both args are already in registers. static uint64 RotateByAtLeast1(uint64 val, int shift) { return (val >> shift) | (val << (64 - shift)); } static uint64 ShiftMix(uint64 val) { return val ^ (val >> 47); } static uint64 HashLen16(uint64 u, uint64 v) { return Hash128to64(uint128(u, v)); } static uint64 HashLen0to16(const char *s, size_t len) { if (len > 8) { uint64 a = Fetch64(s); uint64 b = Fetch64(s + len - 8); return HashLen16(a, RotateByAtLeast1(b + len, len)) ^ b; } if (len >= 4) { uint64 a = Fetch32(s); return HashLen16(len + (a << 3), Fetch32(s + len - 4)); } if (len > 0) { uint8 a = s[0]; uint8 b = s[len >> 1]; uint8 c = s[len - 1]; uint32 y = static_cast(a) + (static_cast(b) << 8); uint32 z = len + (static_cast(c) << 2); return ShiftMix(y * k2 ^ z * k3) * k2; } return k2; } // This probably works well for 16-byte strings as well, but it may be overkill // in that case. static uint64 HashLen17to32(const char *s, size_t len) { uint64 a = Fetch64(s) * k1; uint64 b = Fetch64(s + 8); uint64 c = Fetch64(s + len - 8) * k2; uint64 d = Fetch64(s + len - 16) * k0; return HashLen16(Rotate(a - b, 43) + Rotate(c, 30) + d, a + Rotate(b ^ k3, 20) - c + len); } // Return a 16-byte hash for 48 bytes. Quick and dirty. // Callers do best to use "random-looking" values for a and b. static pair WeakHashLen32WithSeeds( uint64 w, uint64 x, uint64 y, uint64 z, uint64 a, uint64 b) { a += w; b = Rotate(b + a + z, 21); uint64 c = a; a += x; a += y; b += Rotate(a, 44); return make_pair(a + z, b + c); } // Return a 16-byte hash for s[0] ... s[31], a, and b. Quick and dirty. static pair WeakHashLen32WithSeeds( const char* s, uint64 a, uint64 b) { return WeakHashLen32WithSeeds(Fetch64(s), Fetch64(s + 8), Fetch64(s + 16), Fetch64(s + 24), a, b); } // Return an 8-byte hash for 33 to 64 bytes. static uint64 HashLen33to64(const char *s, size_t len) { uint64 z = Fetch64(s + 24); uint64 a = Fetch64(s) + (len + Fetch64(s + len - 16)) * k0; uint64 b = Rotate(a + z, 52); uint64 c = Rotate(a, 37); a += Fetch64(s + 8); c += Rotate(a, 7); a += Fetch64(s + 16); uint64 vf = a + z; uint64 vs = b + Rotate(a, 31) + c; a = Fetch64(s + 16) + Fetch64(s + len - 32); z = Fetch64(s + len - 8); b = Rotate(a + z, 52); c = Rotate(a, 37); a += Fetch64(s + len - 24); c += Rotate(a, 7); a += Fetch64(s + len - 16); uint64 wf = a + z; uint64 ws = b + Rotate(a, 31) + c; uint64 r = ShiftMix((vf + ws) * k2 + (wf + vs) * k0); return ShiftMix(r * k0 + vs) * k2; } uint64 CityHash64(const char *s, size_t len) { if (len <= 32) { if (len <= 16) { return HashLen0to16(s, len); } else { return HashLen17to32(s, len); } } else if (len <= 64) { return HashLen33to64(s, len); } // For strings over 64 bytes we hash the end first, and then as we // loop we keep 56 bytes of state: v, w, x, y, and z. uint64 x = Fetch64(s + len - 40); uint64 y = Fetch64(s + len - 16) + Fetch64(s + len - 56); uint64 z = HashLen16(Fetch64(s + len - 48) + len, Fetch64(s + len - 24)); pair v = WeakHashLen32WithSeeds(s + len - 64, len, z); pair w = WeakHashLen32WithSeeds(s + len - 32, y + k1, x); x = x * k1 + Fetch64(s); // Decrease len to the nearest multiple of 64, and operate on 64-byte chunks. len = (len - 1) & ~static_cast(63); do { x = Rotate(x + y + v.first + Fetch64(s + 8), 37) * k1; y = Rotate(y + v.second + Fetch64(s + 48), 42) * k1; x ^= w.second; y += v.first + Fetch64(s + 40); z = Rotate(z + w.first, 33) * k1; v = WeakHashLen32WithSeeds(s, v.second * k1, x + w.first); w = WeakHashLen32WithSeeds(s + 32, z + w.second, y + Fetch64(s + 16)); std::swap(z, x); s += 64; len -= 64; } while (len != 0); return HashLen16(HashLen16(v.first, w.first) + ShiftMix(y) * k1 + z, HashLen16(v.second, w.second) + x); } uint64 CityHash64WithSeed(const char *s, size_t len, uint64 seed) { return CityHash64WithSeeds(s, len, k2, seed); } uint64 CityHash64WithSeeds(const char *s, size_t len, uint64 seed0, uint64 seed1) { return HashLen16(CityHash64(s, len) - seed0, seed1); } // A subroutine for CityHash128(). Returns a decent 128-bit hash for strings // of any length representable in signed long. Based on City and Murmur. static uint128 CityMurmur(const char *s, size_t len, uint128 seed) { uint64 a = Uint128Low64(seed); uint64 b = Uint128High64(seed); uint64 c = 0; uint64 d = 0; signed long l = len - 16; if (l <= 0) { // len <= 16 a = ShiftMix(a * k1) * k1; c = b * k1 + HashLen0to16(s, len); d = ShiftMix(a + (len >= 8 ? Fetch64(s) : c)); } else { // len > 16 c = HashLen16(Fetch64(s + len - 8) + k1, a); d = HashLen16(b + len, c + Fetch64(s + len - 16)); a += d; do { a ^= ShiftMix(Fetch64(s) * k1) * k1; a *= k1; b ^= a; c ^= ShiftMix(Fetch64(s + 8) * k1) * k1; c *= k1; d ^= c; s += 16; l -= 16; } while (l > 0); } a = HashLen16(a, c); b = HashLen16(d, b); return uint128(a ^ b, HashLen16(b, a)); } uint128 CityHash128WithSeed(const char *s, size_t len, uint128 seed) { if (len < 128) { return CityMurmur(s, len, seed); } // We expect len >= 128 to be the common case. Keep 56 bytes of state: // v, w, x, y, and z. pair v, w; uint64 x = Uint128Low64(seed); uint64 y = Uint128High64(seed); uint64 z = len * k1; v.first = Rotate(y ^ k1, 49) * k1 + Fetch64(s); v.second = Rotate(v.first, 42) * k1 + Fetch64(s + 8); w.first = Rotate(y + z, 35) * k1 + x; w.second = Rotate(x + Fetch64(s + 88), 53) * k1; // This is the same inner loop as CityHash64(), manually unrolled. do { x = Rotate(x + y + v.first + Fetch64(s + 8), 37) * k1; y = Rotate(y + v.second + Fetch64(s + 48), 42) * k1; x ^= w.second; y += v.first + Fetch64(s + 40); z = Rotate(z + w.first, 33) * k1; v = WeakHashLen32WithSeeds(s, v.second * k1, x + w.first); w = WeakHashLen32WithSeeds(s + 32, z + w.second, y + Fetch64(s + 16)); std::swap(z, x); s += 64; x = Rotate(x + y + v.first + Fetch64(s + 8), 37) * k1; y = Rotate(y + v.second + Fetch64(s + 48), 42) * k1; x ^= w.second; y += v.first + Fetch64(s + 40); z = Rotate(z + w.first, 33) * k1; v = WeakHashLen32WithSeeds(s, v.second * k1, x + w.first); w = WeakHashLen32WithSeeds(s + 32, z + w.second, y + Fetch64(s + 16)); std::swap(z, x); s += 64; len -= 128; } while (LIKELY(len >= 128)); x += Rotate(v.first + z, 49) * k0; z += Rotate(w.first, 37) * k0; // If 0 < len < 128, hash up to 4 chunks of 32 bytes each from the end of s. for (size_t tail_done = 0; tail_done < len; ) { tail_done += 32; y = Rotate(x + y, 42) * k0 + v.second; w.first += Fetch64(s + len - tail_done + 16); x = x * k0 + w.first; z += w.second + Fetch64(s + len - tail_done); w.second += v.first; v = WeakHashLen32WithSeeds(s + len - tail_done, v.first + z, v.second); } // At this point our 56 bytes of state should contain more than // enough information for a strong 128-bit hash. We use two // different 56-byte-to-8-byte hashes to get a 16-byte final result. x = HashLen16(x, v.first); y = HashLen16(y + z, w.first); return uint128(HashLen16(x + v.second, w.second) + y, HashLen16(x + w.second, y + v.second)); } uint128 CityHash128(const char *s, size_t len) { if (len >= 16) { return CityHash128WithSeed(s + 16, len - 16, uint128(Fetch64(s) ^ k3, Fetch64(s + 8))); } else if (len >= 8) { return CityHash128WithSeed(NULL, 0, uint128(Fetch64(s) ^ (len * k0), Fetch64(s + len - 8) ^ k1)); } else { return CityHash128WithSeed(s, len, uint128(k0, k1)); } } #if 0 // #ifdef __SSE4_2__ #include #include // Requires len >= 240. static void CityHashCrc256Long(const char *s, size_t len, uint32 seed, uint64 *result) { uint64 a = Fetch64(s + 56) + k0; uint64 b = Fetch64(s + 96) + k0; uint64 c = result[0] = HashLen16(b, len); uint64 d = result[1] = Fetch64(s + 120) * k0 + len; uint64 e = Fetch64(s + 184) + seed; uint64 f = seed; uint64 g = 0; uint64 h = 0; uint64 i = 0; uint64 j = 0; uint64 t = c + d; // 240 bytes of input per iter. size_t iters = len / 240; len -= iters * 240; do { #define CHUNK(multiplier, z) \ { \ uint64 old_a = a; \ a = Rotate(b, 41 ^ z) * multiplier + Fetch64(s); \ b = Rotate(c, 27 ^ z) * multiplier + Fetch64(s + 8); \ c = Rotate(d, 41 ^ z) * multiplier + Fetch64(s + 16); \ d = Rotate(e, 33 ^ z) * multiplier + Fetch64(s + 24); \ e = Rotate(t, 25 ^ z) * multiplier + Fetch64(s + 32); \ t = old_a; \ } \ f = _mm_crc32_u64(f, a); \ g = _mm_crc32_u64(g, b); \ h = _mm_crc32_u64(h, c); \ i = _mm_crc32_u64(i, d); \ j = _mm_crc32_u64(j, e); \ s += 40 CHUNK(1, 1); CHUNK(k0, 0); CHUNK(1, 1); CHUNK(k0, 0); CHUNK(1, 1); CHUNK(k0, 0); } while (--iters > 0); while (len >= 40) { CHUNK(k0, 0); len -= 40; } if (len > 0) { s = s + len - 40; CHUNK(k0, 0); } j += i << 32; a = HashLen16(a, j); h += g << 32; b += h; c = HashLen16(c, f) + i; d = HashLen16(d, e + result[0]); j += e; i += HashLen16(h, t); e = HashLen16(a, d) + j; f = HashLen16(b, c) + a; g = HashLen16(j, i) + c; result[0] = e + f + g + h; a = ShiftMix((a + g) * k0) * k0 + b; result[1] += a + result[0]; a = ShiftMix(a * k0) * k0 + c; result[2] = a + result[1]; a = ShiftMix((a + e) * k0) * k0; result[3] = a + result[2]; } // Requires len < 240. static void CityHashCrc256Short(const char *s, size_t len, uint64 *result) { char buf[240]; memcpy(buf, s, len); memset(buf + len, 0, 240 - len); CityHashCrc256Long(buf, 240, ~static_cast(len), result); } void CityHashCrc256(const char *s, size_t len, uint64 *result) { if (LIKELY(len >= 240)) { CityHashCrc256Long(s, len, 0, result); } else { CityHashCrc256Short(s, len, result); } } uint128 CityHashCrc128WithSeed(const char *s, size_t len, uint128 seed) { if (len <= 900) { return CityHash128WithSeed(s, len, seed); } else { uint64 result[4]; CityHashCrc256(s, len, result); uint64 u = Uint128High64(seed) + result[0]; uint64 v = Uint128Low64(seed) + result[1]; return uint128(HashLen16(u, v + result[2]), HashLen16(Rotate(v, 32), u * k0 + result[3])); } } uint128 CityHashCrc128(const char *s, size_t len) { if (len <= 900) { return CityHash128(s, len); } else { uint64 result[4]; CityHashCrc256(s, len, result); return uint128(result[2], result[3]); } } #endif ntHash-2.2.0/lib/city.h000066400000000000000000000071551371554176300146530ustar00rootroot00000000000000// Copyright (c) 2011 Google, Inc. // // Permission is hereby granted, free of charge, to any person obtaining a copy // of this software and associated documentation files (the "Software"), to deal // in the Software without restriction, including without limitation the rights // to use, copy, modify, merge, publish, distribute, sublicense, and/or sell // copies of the Software, and to permit persons to whom the Software is // furnished to do so, subject to the following conditions: // // The above copyright notice and this permission notice shall be included in // all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR // IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, // FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE // AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER // LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, // OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN // THE SOFTWARE. // // CityHash, by Geoff Pike and Jyrki Alakuijala // // This file provides a few functions for hashing strings. On x86-64 // hardware in 2011, CityHash64() is faster than other high-quality // hash functions, such as Murmur. This is largely due to higher // instruction-level parallelism. CityHash64() and CityHash128() also perform // well on hash-quality tests. // // CityHash128() is optimized for relatively long strings and returns // a 128-bit hash. For strings more than about 2000 bytes it can be // faster than CityHash64(). // // Functions in the CityHash family are not suitable for cryptography. // // WARNING: This code has not been tested on big-endian platforms! // It is known to work well on little-endian platforms that have a small penalty // for unaligned reads, such as current Intel and AMD moderate-to-high-end CPUs. // // By the way, for some hash functions, given strings a and b, the hash // of a+b is easily derived from the hashes of a and b. This property // doesn't hold for any hash functions in this file. #ifndef CITY_HASH_H_ #define CITY_HASH_H_ #include // for size_t. #include #include typedef uint8_t uint8; typedef uint32_t uint32; typedef uint64_t uint64; typedef std::pair uint128; inline uint64 Uint128Low64(const uint128& x) { return x.first; } inline uint64 Uint128High64(const uint128& x) { return x.second; } // Hash function for a byte array. uint64 CityHash64(const char *buf, size_t len); // Hash function for a byte array. For convenience, a 64-bit seed is also // hashed into the result. uint64 CityHash64WithSeed(const char *buf, size_t len, uint64 seed); // Hash function for a byte array. For convenience, two seeds are also // hashed into the result. uint64 CityHash64WithSeeds(const char *buf, size_t len, uint64 seed0, uint64 seed1); // Hash function for a byte array. uint128 CityHash128(const char *s, size_t len); // Hash function for a byte array. For convenience, a 128-bit seed is also // hashed into the result. uint128 CityHash128WithSeed(const char *s, size_t len, uint128 seed); // Hash 128 input bits down to 64 bits of output. // This is intended to be a reasonably good hash function. inline uint64 Hash128to64(const uint128& x) { // Murmur-inspired hashing. const uint64 kMul = 0x9ddfea08eb382d69ULL; uint64 a = (Uint128Low64(x) ^ Uint128High64(x)) * kMul; a ^= (a >> 47); uint64 b = (Uint128High64(x) ^ a) * kMul; b ^= (b >> 47); b *= kMul; return b; } #endif // CITY_HASH_H_ ntHash-2.2.0/lib/murmur.hpp000066400000000000000000000026161371554176300155670ustar00rootroot00000000000000#ifndef MURMUR_HASH_H #define MURMUR_HASH_H #include //----------------------------------------------------------------------------- // MurmurHash2, 64-bit versions, by Austin Appleby // The same caveats as 32-bit MurmurHash2 apply here - beware of alignment // and endian-ness issues if used across multiple platforms. // 64-bit hash for 64-bit platforms uint64_t MurmurHash64A ( const void * key, int len, unsigned int seed ) { const uint64_t m = 0xc6a4a7935bd1e995; const int r = 47; uint64_t h = seed ^ (len * m); const uint64_t * data = (const uint64_t *)key; const uint64_t * end = data + (len/8); while (data != end) { uint64_t k = *data++; k *= m; k ^= k >> r; k *= m; h ^= k; h *= m; } const unsigned char * data2 = (const unsigned char*)data; switch(len & 7) { case 7: h ^= uint64_t(data2[6]) << 48; // fallthrough case 6: h ^= uint64_t(data2[5]) << 40; // fallthrough case 5: h ^= uint64_t(data2[4]) << 32; // fallthrough case 4: h ^= uint64_t(data2[3]) << 24; // fallthrough case 3: h ^= uint64_t(data2[2]) << 16; // fallthrough case 2: h ^= uint64_t(data2[1]) << 8; // fallthrough case 1: h ^= uint64_t(data2[0]); h *= m; }; h ^= h >> r; h *= m; h ^= h >> r; return h; } #endif ntHash-2.2.0/lib/seedgen.cpp000066400000000000000000000105331371554176300156420ustar00rootroot00000000000000#include #include #include #define __STDC_FORMAT_MACROS #include void printBin(uint64_t n) { int count=0,count1=0; while (++count<=64) { if (n & ((uint64_t)1<<63)) { printf("1 "); ++count1; } else printf("0 "); n <<= 1; } printf(" count1=%d\n",count1); } void balanceSeed() { srand(time(NULL)); int r1[4]= {32,32,32,32}; const int seedNum=4; int hashSeed[seedNum][64]; for (int i=0; i0 && r1[ranVec[1]]>0) { hashSeed[ranVec[0]][j] = 1; r1[ranVec[0]]--; hashSeed[ranVec[1]][j] = 1; r1[ranVec[1]]--; } else if(r1[ranVec[0]]<0 && r1[ranVec[1]]>0) { hashSeed[ranVec[1]][j] = 1; r1[ranVec[1]]--; if(r1[ranVec[2]]>0) { hashSeed[ranVec[2]][j] = 1; r1[ranVec[2]]--; } else hashSeed[ranVec[3]][j] = 1; r1[ranVec[3]]--; } else if(r1[ranVec[0]]>0 && r1[ranVec[1]]<0) { hashSeed[ranVec[0]][j] = 1; r1[ranVec[0]]--; if(r1[ranVec[2]]>0) { hashSeed[ranVec[2]][j] = 1; r1[ranVec[2]]--; } else hashSeed[ranVec[3]][j] = 1; r1[ranVec[3]]--; } else { hashSeed[ranVec[2]][j] = 1; r1[ranVec[2]]--; hashSeed[ranVec[3]][j] = 1; r1[ranVec[3]]--; } } for (int i=0; i #include #include #include using namespace std; const int alphNum = 4; const char iTb[alphNum] = {'A', 'C', 'G', 'T'}; size_t sequenceLen; void makeRead(const size_t rNum, const size_t rLen) { srand(time(NULL)); size_t bTc[alphNum] = {0, 0, 0, 0}; string myrSeq; myrSeq.resize(rLen); ofstream rFile("reads.fa"); for (size_t j=0; j < rNum; j++) { for (size_t i=0; i< rLen; i++) { int ranInd = rand() % alphNum; myrSeq[i] = iTb[ranInd]; ++bTc[ranInd]; } rFile << ">f" << j << "\n" << myrSeq << "\n"; } //for (size_t i=0; i< alphNum; i++) // cerr << bTc[i] << "\n"; rFile.close(); } void makeGenome(const size_t seqLen) { srand(time(NULL)); size_t bTc[alphNum] = {0, 0, 0, 0}; string mygSeq; mygSeq.resize(seqLen); for (size_t i=0; i< seqLen; i++) { int ranInd = rand() % alphNum; mygSeq[i] = iTb[ranInd]; ++bTc[ranInd]; } ofstream gFile("genome.fa"); gFile << ">1\n" << mygSeq << "\n"; //for (int i=0; i< alphNum; i++) // cerr << bTc[i] << "\n"; gFile.close(); } void makeGene(const size_t gNum, const size_t gLen) { srand(time(NULL)); size_t bTc[alphNum] = {0, 0, 0, 0}; string mygSeq; mygSeq.resize(gLen); ofstream gFile("genes.fa"); for (size_t j=0; j < gNum; j++) { for (size_t i=0; i< gLen; i++) { int ranInd = rand() % alphNum; mygSeq[i] = iTb[ranInd]; ++bTc[ranInd]; } } gFile.close(); } void makeGene(const size_t gNum, const size_t gLen, const size_t rNum, const size_t rLen) { srand(time(NULL)); size_t bTc[alphNum] = {0, 0, 0, 0}; string mygSeq; mygSeq.resize(gLen); ofstream gFile("genes.fa"); ofstream rFile("treads.fa"); for (size_t j=0; j < gNum; j++) { for (size_t i=0; i< gLen; i++) { int ranInd = rand() % alphNum; mygSeq[i] = iTb[ranInd]; ++bTc[ranInd]; } gFile << ">g" << j << "\n" << mygSeq << "\n"; for(size_t k=0; kt" << k << "\n" << mygSeq.substr(ranR, rLen) << "\n"; } } gFile.close(); rFile.close(); } int testseqgen() { //makeGenome(3000000000+32-1); makeRead(1000000000, 32); makeGene(50, 2000000+32-1); //makeGene(6, 50+32-1); return 0; } #endifntHash-2.2.0/lib/xxhash.c000066400000000000000000000637551371554176300152110ustar00rootroot00000000000000/* xxHash - Fast Hash algorithm Copyright (C) 2012-2015, Yann Collet BSD 2-Clause License (http://www.opensource.org/licenses/bsd-license.php) Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. You can contact the author at : - xxHash source repository : https://github.com/Cyan4973/xxHash */ /************************************** * Tuning parameters **************************************/ /* Unaligned memory access is automatically enabled for "common" CPU, such as x86. * For others CPU, the compiler will be more cautious, and insert extra code to ensure aligned access is respected. * If you know your target CPU supports unaligned memory access, you want to force this option manually to improve performance. * You can also enable this parameter if you know your input data will always be aligned (boundaries of 4, for U32). */ #if defined(__ARM_FEATURE_UNALIGNED) || defined(__i386) || defined(_M_IX86) || defined(__x86_64__) || defined(_M_X64) # define XXH_USE_UNALIGNED_ACCESS 1 #endif /* XXH_ACCEPT_NULL_INPUT_POINTER : * If the input pointer is a null pointer, xxHash default behavior is to trigger a memory access error, since it is a bad pointer. * When this option is enabled, xxHash output for null input pointers will be the same as a null-length input. * By default, this option is disabled. To enable it, uncomment below define : */ /* #define XXH_ACCEPT_NULL_INPUT_POINTER 1 */ /* XXH_FORCE_NATIVE_FORMAT : * By default, xxHash library provides endian-independant Hash values, based on little-endian convention. * Results are therefore identical for little-endian and big-endian CPU. * This comes at a performance cost for big-endian CPU, since some swapping is required to emulate little-endian format. * Should endian-independance be of no importance for your application, you may set the #define below to 1. * It will improve speed for Big-endian CPU. * This option has no impact on Little_Endian CPU. */ #define XXH_FORCE_NATIVE_FORMAT 0 /************************************** * Compiler Specific Options ***************************************/ #ifdef _MSC_VER /* Visual Studio */ # pragma warning(disable : 4127) /* disable: C4127: conditional expression is constant */ # define FORCE_INLINE static __forceinline #else # if defined (__STDC_VERSION__) && __STDC_VERSION__ >= 199901L /* C99 */ # ifdef __GNUC__ # define FORCE_INLINE static inline __attribute__((always_inline)) # else # define FORCE_INLINE static inline # endif # else # define FORCE_INLINE static # endif /* __STDC_VERSION__ */ #endif /************************************** * Includes & Memory related functions ***************************************/ #include "xxhash.h" /* Modify the local functions below should you wish to use some other memory routines */ /* for malloc(), free() */ #include static void* XXH_malloc(size_t s) { return malloc(s); } static void XXH_free (void* p) { free(p); } /* for memcpy() */ #include static void* XXH_memcpy(void* dest, const void* src, size_t size) { return memcpy(dest,src,size); } /************************************** * Basic Types ***************************************/ #if defined (__STDC_VERSION__) && __STDC_VERSION__ >= 199901L /* C99 */ # include typedef uint8_t BYTE; typedef uint16_t U16; typedef uint32_t U32; typedef int32_t S32; typedef uint64_t U64; #else typedef unsigned char BYTE; typedef unsigned short U16; typedef unsigned int U32; typedef signed int S32; typedef unsigned long long U64; #endif static U32 XXH_read32(const void* memPtr) { U32 val32; memcpy(&val32, memPtr, 4); return val32; } static U64 XXH_read64(const void* memPtr) { U64 val64; memcpy(&val64, memPtr, 8); return val64; } /****************************************** * Compiler-specific Functions and Macros ******************************************/ #define GCC_VERSION (__GNUC__ * 100 + __GNUC_MINOR__) /* Note : although _rotl exists for minGW (GCC under windows), performance seems poor */ #if defined(_MSC_VER) # define XXH_rotl32(x,r) _rotl(x,r) # define XXH_rotl64(x,r) _rotl64(x,r) #else # define XXH_rotl32(x,r) ((x << r) | (x >> (32 - r))) # define XXH_rotl64(x,r) ((x << r) | (x >> (64 - r))) #endif #if defined(_MSC_VER) /* Visual Studio */ # define XXH_swap32 _byteswap_ulong # define XXH_swap64 _byteswap_uint64 #elif GCC_VERSION >= 403 # define XXH_swap32 __builtin_bswap32 # define XXH_swap64 __builtin_bswap64 #else static U32 XXH_swap32 (U32 x) { return ((x << 24) & 0xff000000 ) | ((x << 8) & 0x00ff0000 ) | ((x >> 8) & 0x0000ff00 ) | ((x >> 24) & 0x000000ff ); } static U64 XXH_swap64 (U64 x) { return ((x << 56) & 0xff00000000000000ULL) | ((x << 40) & 0x00ff000000000000ULL) | ((x << 24) & 0x0000ff0000000000ULL) | ((x << 8) & 0x000000ff00000000ULL) | ((x >> 8) & 0x00000000ff000000ULL) | ((x >> 24) & 0x0000000000ff0000ULL) | ((x >> 40) & 0x000000000000ff00ULL) | ((x >> 56) & 0x00000000000000ffULL); } #endif /*************************************** * Architecture Macros ***************************************/ typedef enum { XXH_bigEndian=0, XXH_littleEndian=1 } XXH_endianess; #ifndef XXH_CPU_LITTLE_ENDIAN /* XXH_CPU_LITTLE_ENDIAN can be defined externally, for example using a compiler switch */ static const int one = 1; # define XXH_CPU_LITTLE_ENDIAN (*(const char*)(&one)) #endif /***************************** * Memory reads *****************************/ typedef enum { XXH_aligned, XXH_unaligned } XXH_alignment; FORCE_INLINE U32 XXH_readLE32_align(const void* ptr, XXH_endianess endian, XXH_alignment align) { if (align==XXH_unaligned) return endian==XXH_littleEndian ? XXH_read32(ptr) : XXH_swap32(XXH_read32(ptr)); else return endian==XXH_littleEndian ? *(const U32*)ptr : XXH_swap32(*(const U32*)ptr); } FORCE_INLINE U32 XXH_readLE32(const void* ptr, XXH_endianess endian) { return XXH_readLE32_align(ptr, endian, XXH_unaligned); } FORCE_INLINE U64 XXH_readLE64_align(const void* ptr, XXH_endianess endian, XXH_alignment align) { if (align==XXH_unaligned) return endian==XXH_littleEndian ? XXH_read64(ptr) : XXH_swap64(XXH_read64(ptr)); else return endian==XXH_littleEndian ? *(const U64*)ptr : XXH_swap64(*(const U64*)ptr); } FORCE_INLINE U64 XXH_readLE64(const void* ptr, XXH_endianess endian) { return XXH_readLE64_align(ptr, endian, XXH_unaligned); } /*************************************** * Macros ***************************************/ #define XXH_STATIC_ASSERT(c) { enum { XXH_static_assert = 1/(!!(c)) }; } /* use only *after* variable declarations */ /*************************************** * Constants ***************************************/ #define PRIME32_1 2654435761U #define PRIME32_2 2246822519U #define PRIME32_3 3266489917U #define PRIME32_4 668265263U #define PRIME32_5 374761393U #define PRIME64_1 11400714785074694791ULL #define PRIME64_2 14029467366897019727ULL #define PRIME64_3 1609587929392839161ULL #define PRIME64_4 9650029242287828579ULL #define PRIME64_5 2870177450012600261ULL /***************************** * Simple Hash Functions *****************************/ FORCE_INLINE U32 XXH32_endian_align(const void* input, size_t len, U32 seed, XXH_endianess endian, XXH_alignment align) { const BYTE* p = (const BYTE*)input; const BYTE* bEnd = p + len; U32 h32; #define XXH_get32bits(p) XXH_readLE32_align(p, endian, align) #ifdef XXH_ACCEPT_NULL_INPUT_POINTER if (p==NULL) { len=0; bEnd=p=(const BYTE*)(size_t)16; } #endif if (len>=16) { const BYTE* const limit = bEnd - 16; U32 v1 = seed + PRIME32_1 + PRIME32_2; U32 v2 = seed + PRIME32_2; U32 v3 = seed + 0; U32 v4 = seed - PRIME32_1; do { v1 += XXH_get32bits(p) * PRIME32_2; v1 = XXH_rotl32(v1, 13); v1 *= PRIME32_1; p+=4; v2 += XXH_get32bits(p) * PRIME32_2; v2 = XXH_rotl32(v2, 13); v2 *= PRIME32_1; p+=4; v3 += XXH_get32bits(p) * PRIME32_2; v3 = XXH_rotl32(v3, 13); v3 *= PRIME32_1; p+=4; v4 += XXH_get32bits(p) * PRIME32_2; v4 = XXH_rotl32(v4, 13); v4 *= PRIME32_1; p+=4; } while (p<=limit); h32 = XXH_rotl32(v1, 1) + XXH_rotl32(v2, 7) + XXH_rotl32(v3, 12) + XXH_rotl32(v4, 18); } else { h32 = seed + PRIME32_5; } h32 += (U32) len; while (p+4<=bEnd) { h32 += XXH_get32bits(p) * PRIME32_3; h32 = XXH_rotl32(h32, 17) * PRIME32_4 ; p+=4; } while (p> 15; h32 *= PRIME32_2; h32 ^= h32 >> 13; h32 *= PRIME32_3; h32 ^= h32 >> 16; return h32; } unsigned XXH32 (const void* input, size_t len, unsigned seed) { #if 0 /* Simple version, good for code maintenance, but unfortunately slow for small inputs */ XXH32_state_t state; XXH32_reset(&state, seed); XXH32_update(&state, input, len); return XXH32_digest(&state); #else XXH_endianess endian_detected = (XXH_endianess)XXH_CPU_LITTLE_ENDIAN; # if !defined(XXH_USE_UNALIGNED_ACCESS) if ((((size_t)input) & 3) == 0) /* Input is 4-bytes aligned, leverage the speed benefit */ { if ((endian_detected==XXH_littleEndian) || XXH_FORCE_NATIVE_FORMAT) return XXH32_endian_align(input, len, seed, XXH_littleEndian, XXH_aligned); else return XXH32_endian_align(input, len, seed, XXH_bigEndian, XXH_aligned); } # endif if ((endian_detected==XXH_littleEndian) || XXH_FORCE_NATIVE_FORMAT) return XXH32_endian_align(input, len, seed, XXH_littleEndian, XXH_unaligned); else return XXH32_endian_align(input, len, seed, XXH_bigEndian, XXH_unaligned); #endif } FORCE_INLINE U64 XXH64_endian_align(const void* input, size_t len, U64 seed, XXH_endianess endian, XXH_alignment align) { const BYTE* p = (const BYTE*)input; const BYTE* bEnd = p + len; U64 h64; #define XXH_get64bits(p) XXH_readLE64_align(p, endian, align) #ifdef XXH_ACCEPT_NULL_INPUT_POINTER if (p==NULL) { len=0; bEnd=p=(const BYTE*)(size_t)32; } #endif if (len>=32) { const BYTE* const limit = bEnd - 32; U64 v1 = seed + PRIME64_1 + PRIME64_2; U64 v2 = seed + PRIME64_2; U64 v3 = seed + 0; U64 v4 = seed - PRIME64_1; do { v1 += XXH_get64bits(p) * PRIME64_2; p+=8; v1 = XXH_rotl64(v1, 31); v1 *= PRIME64_1; v2 += XXH_get64bits(p) * PRIME64_2; p+=8; v2 = XXH_rotl64(v2, 31); v2 *= PRIME64_1; v3 += XXH_get64bits(p) * PRIME64_2; p+=8; v3 = XXH_rotl64(v3, 31); v3 *= PRIME64_1; v4 += XXH_get64bits(p) * PRIME64_2; p+=8; v4 = XXH_rotl64(v4, 31); v4 *= PRIME64_1; } while (p<=limit); h64 = XXH_rotl64(v1, 1) + XXH_rotl64(v2, 7) + XXH_rotl64(v3, 12) + XXH_rotl64(v4, 18); v1 *= PRIME64_2; v1 = XXH_rotl64(v1, 31); v1 *= PRIME64_1; h64 ^= v1; h64 = h64 * PRIME64_1 + PRIME64_4; v2 *= PRIME64_2; v2 = XXH_rotl64(v2, 31); v2 *= PRIME64_1; h64 ^= v2; h64 = h64 * PRIME64_1 + PRIME64_4; v3 *= PRIME64_2; v3 = XXH_rotl64(v3, 31); v3 *= PRIME64_1; h64 ^= v3; h64 = h64 * PRIME64_1 + PRIME64_4; v4 *= PRIME64_2; v4 = XXH_rotl64(v4, 31); v4 *= PRIME64_1; h64 ^= v4; h64 = h64 * PRIME64_1 + PRIME64_4; } else { h64 = seed + PRIME64_5; } h64 += (U64) len; while (p+8<=bEnd) { U64 k1 = XXH_get64bits(p); k1 *= PRIME64_2; k1 = XXH_rotl64(k1,31); k1 *= PRIME64_1; h64 ^= k1; h64 = XXH_rotl64(h64,27) * PRIME64_1 + PRIME64_4; p+=8; } if (p+4<=bEnd) { h64 ^= (U64)(XXH_get32bits(p)) * PRIME64_1; h64 = XXH_rotl64(h64, 23) * PRIME64_2 + PRIME64_3; p+=4; } while (p> 33; h64 *= PRIME64_2; h64 ^= h64 >> 29; h64 *= PRIME64_3; h64 ^= h64 >> 32; return h64; } unsigned long long XXH64 (const void* input, size_t len, unsigned long long seed) { #if 0 /* Simple version, good for code maintenance, but unfortunately slow for small inputs */ XXH64_state_t state; XXH64_reset(&state, seed); XXH64_update(&state, input, len); return XXH64_digest(&state); #else XXH_endianess endian_detected = (XXH_endianess)XXH_CPU_LITTLE_ENDIAN; # if !defined(XXH_USE_UNALIGNED_ACCESS) if ((((size_t)input) & 7)==0) /* Input is aligned, let's leverage the speed advantage */ { if ((endian_detected==XXH_littleEndian) || XXH_FORCE_NATIVE_FORMAT) return XXH64_endian_align(input, len, seed, XXH_littleEndian, XXH_aligned); else return XXH64_endian_align(input, len, seed, XXH_bigEndian, XXH_aligned); } # endif if ((endian_detected==XXH_littleEndian) || XXH_FORCE_NATIVE_FORMAT) return XXH64_endian_align(input, len, seed, XXH_littleEndian, XXH_unaligned); else return XXH64_endian_align(input, len, seed, XXH_bigEndian, XXH_unaligned); #endif } /**************************************************** * Advanced Hash Functions ****************************************************/ /*** Allocation ***/ typedef struct { U64 total_len; U32 seed; U32 v1; U32 v2; U32 v3; U32 v4; U32 mem32[4]; /* defined as U32 for alignment */ U32 memsize; } XXH_istate32_t; typedef struct { U64 total_len; U64 seed; U64 v1; U64 v2; U64 v3; U64 v4; U64 mem64[4]; /* defined as U64 for alignment */ U32 memsize; } XXH_istate64_t; XXH32_state_t* XXH32_createState(void) { XXH_STATIC_ASSERT(sizeof(XXH32_state_t) >= sizeof(XXH_istate32_t)); /* A compilation error here means XXH32_state_t is not large enough */ return (XXH32_state_t*)XXH_malloc(sizeof(XXH32_state_t)); } XXH_errorcode XXH32_freeState(XXH32_state_t* statePtr) { XXH_free(statePtr); return XXH_OK; } XXH64_state_t* XXH64_createState(void) { XXH_STATIC_ASSERT(sizeof(XXH64_state_t) >= sizeof(XXH_istate64_t)); /* A compilation error here means XXH64_state_t is not large enough */ return (XXH64_state_t*)XXH_malloc(sizeof(XXH64_state_t)); } XXH_errorcode XXH64_freeState(XXH64_state_t* statePtr) { XXH_free(statePtr); return XXH_OK; } /*** Hash feed ***/ XXH_errorcode XXH32_reset(XXH32_state_t* state_in, U32 seed) { XXH_istate32_t* state = (XXH_istate32_t*) state_in; state->seed = seed; state->v1 = seed + PRIME32_1 + PRIME32_2; state->v2 = seed + PRIME32_2; state->v3 = seed + 0; state->v4 = seed - PRIME32_1; state->total_len = 0; state->memsize = 0; return XXH_OK; } XXH_errorcode XXH64_reset(XXH64_state_t* state_in, unsigned long long seed) { XXH_istate64_t* state = (XXH_istate64_t*) state_in; state->seed = seed; state->v1 = seed + PRIME64_1 + PRIME64_2; state->v2 = seed + PRIME64_2; state->v3 = seed + 0; state->v4 = seed - PRIME64_1; state->total_len = 0; state->memsize = 0; return XXH_OK; } FORCE_INLINE XXH_errorcode XXH32_update_endian (XXH32_state_t* state_in, const void* input, size_t len, XXH_endianess endian) { XXH_istate32_t* state = (XXH_istate32_t *) state_in; const BYTE* p = (const BYTE*)input; const BYTE* const bEnd = p + len; #ifdef XXH_ACCEPT_NULL_INPUT_POINTER if (input==NULL) return XXH_ERROR; #endif state->total_len += len; if (state->memsize + len < 16) /* fill in tmp buffer */ { XXH_memcpy((BYTE*)(state->mem32) + state->memsize, input, len); state->memsize += (U32)len; return XXH_OK; } if (state->memsize) /* some data left from previous update */ { XXH_memcpy((BYTE*)(state->mem32) + state->memsize, input, 16-state->memsize); { const U32* p32 = state->mem32; state->v1 += XXH_readLE32(p32, endian) * PRIME32_2; state->v1 = XXH_rotl32(state->v1, 13); state->v1 *= PRIME32_1; p32++; state->v2 += XXH_readLE32(p32, endian) * PRIME32_2; state->v2 = XXH_rotl32(state->v2, 13); state->v2 *= PRIME32_1; p32++; state->v3 += XXH_readLE32(p32, endian) * PRIME32_2; state->v3 = XXH_rotl32(state->v3, 13); state->v3 *= PRIME32_1; p32++; state->v4 += XXH_readLE32(p32, endian) * PRIME32_2; state->v4 = XXH_rotl32(state->v4, 13); state->v4 *= PRIME32_1; p32++; } p += 16-state->memsize; state->memsize = 0; } if (p <= bEnd-16) { const BYTE* const limit = bEnd - 16; U32 v1 = state->v1; U32 v2 = state->v2; U32 v3 = state->v3; U32 v4 = state->v4; do { v1 += XXH_readLE32(p, endian) * PRIME32_2; v1 = XXH_rotl32(v1, 13); v1 *= PRIME32_1; p+=4; v2 += XXH_readLE32(p, endian) * PRIME32_2; v2 = XXH_rotl32(v2, 13); v2 *= PRIME32_1; p+=4; v3 += XXH_readLE32(p, endian) * PRIME32_2; v3 = XXH_rotl32(v3, 13); v3 *= PRIME32_1; p+=4; v4 += XXH_readLE32(p, endian) * PRIME32_2; v4 = XXH_rotl32(v4, 13); v4 *= PRIME32_1; p+=4; } while (p<=limit); state->v1 = v1; state->v2 = v2; state->v3 = v3; state->v4 = v4; } if (p < bEnd) { XXH_memcpy(state->mem32, p, bEnd-p); state->memsize = (int)(bEnd-p); } return XXH_OK; } XXH_errorcode XXH32_update (XXH32_state_t* state_in, const void* input, size_t len) { XXH_endianess endian_detected = (XXH_endianess)XXH_CPU_LITTLE_ENDIAN; if ((endian_detected==XXH_littleEndian) || XXH_FORCE_NATIVE_FORMAT) return XXH32_update_endian(state_in, input, len, XXH_littleEndian); else return XXH32_update_endian(state_in, input, len, XXH_bigEndian); } FORCE_INLINE U32 XXH32_digest_endian (const XXH32_state_t* state_in, XXH_endianess endian) { const XXH_istate32_t* state = (const XXH_istate32_t*) state_in; const BYTE * p = (const BYTE*)state->mem32; const BYTE* bEnd = (const BYTE*)(state->mem32) + state->memsize; U32 h32; if (state->total_len >= 16) { h32 = XXH_rotl32(state->v1, 1) + XXH_rotl32(state->v2, 7) + XXH_rotl32(state->v3, 12) + XXH_rotl32(state->v4, 18); } else { h32 = state->seed + PRIME32_5; } h32 += (U32) state->total_len; while (p+4<=bEnd) { h32 += XXH_readLE32(p, endian) * PRIME32_3; h32 = XXH_rotl32(h32, 17) * PRIME32_4; p+=4; } while (p> 15; h32 *= PRIME32_2; h32 ^= h32 >> 13; h32 *= PRIME32_3; h32 ^= h32 >> 16; return h32; } U32 XXH32_digest (const XXH32_state_t* state_in) { XXH_endianess endian_detected = (XXH_endianess)XXH_CPU_LITTLE_ENDIAN; if ((endian_detected==XXH_littleEndian) || XXH_FORCE_NATIVE_FORMAT) return XXH32_digest_endian(state_in, XXH_littleEndian); else return XXH32_digest_endian(state_in, XXH_bigEndian); } FORCE_INLINE XXH_errorcode XXH64_update_endian (XXH64_state_t* state_in, const void* input, size_t len, XXH_endianess endian) { XXH_istate64_t * state = (XXH_istate64_t *) state_in; const BYTE* p = (const BYTE*)input; const BYTE* const bEnd = p + len; #ifdef XXH_ACCEPT_NULL_INPUT_POINTER if (input==NULL) return XXH_ERROR; #endif state->total_len += len; if (state->memsize + len < 32) /* fill in tmp buffer */ { XXH_memcpy(((BYTE*)state->mem64) + state->memsize, input, len); state->memsize += (U32)len; return XXH_OK; } if (state->memsize) /* some data left from previous update */ { XXH_memcpy(((BYTE*)state->mem64) + state->memsize, input, 32-state->memsize); { const U64* p64 = state->mem64; state->v1 += XXH_readLE64(p64, endian) * PRIME64_2; state->v1 = XXH_rotl64(state->v1, 31); state->v1 *= PRIME64_1; p64++; state->v2 += XXH_readLE64(p64, endian) * PRIME64_2; state->v2 = XXH_rotl64(state->v2, 31); state->v2 *= PRIME64_1; p64++; state->v3 += XXH_readLE64(p64, endian) * PRIME64_2; state->v3 = XXH_rotl64(state->v3, 31); state->v3 *= PRIME64_1; p64++; state->v4 += XXH_readLE64(p64, endian) * PRIME64_2; state->v4 = XXH_rotl64(state->v4, 31); state->v4 *= PRIME64_1; p64++; } p += 32-state->memsize; state->memsize = 0; } if (p+32 <= bEnd) { const BYTE* const limit = bEnd - 32; U64 v1 = state->v1; U64 v2 = state->v2; U64 v3 = state->v3; U64 v4 = state->v4; do { v1 += XXH_readLE64(p, endian) * PRIME64_2; v1 = XXH_rotl64(v1, 31); v1 *= PRIME64_1; p+=8; v2 += XXH_readLE64(p, endian) * PRIME64_2; v2 = XXH_rotl64(v2, 31); v2 *= PRIME64_1; p+=8; v3 += XXH_readLE64(p, endian) * PRIME64_2; v3 = XXH_rotl64(v3, 31); v3 *= PRIME64_1; p+=8; v4 += XXH_readLE64(p, endian) * PRIME64_2; v4 = XXH_rotl64(v4, 31); v4 *= PRIME64_1; p+=8; } while (p<=limit); state->v1 = v1; state->v2 = v2; state->v3 = v3; state->v4 = v4; } if (p < bEnd) { XXH_memcpy(state->mem64, p, bEnd-p); state->memsize = (int)(bEnd-p); } return XXH_OK; } XXH_errorcode XXH64_update (XXH64_state_t* state_in, const void* input, size_t len) { XXH_endianess endian_detected = (XXH_endianess)XXH_CPU_LITTLE_ENDIAN; if ((endian_detected==XXH_littleEndian) || XXH_FORCE_NATIVE_FORMAT) return XXH64_update_endian(state_in, input, len, XXH_littleEndian); else return XXH64_update_endian(state_in, input, len, XXH_bigEndian); } FORCE_INLINE U64 XXH64_digest_endian (const XXH64_state_t* state_in, XXH_endianess endian) { const XXH_istate64_t * state = (const XXH_istate64_t *) state_in; const BYTE * p = (const BYTE*)state->mem64; const BYTE* bEnd = (const BYTE*)state->mem64 + state->memsize; U64 h64; if (state->total_len >= 32) { U64 v1 = state->v1; U64 v2 = state->v2; U64 v3 = state->v3; U64 v4 = state->v4; h64 = XXH_rotl64(v1, 1) + XXH_rotl64(v2, 7) + XXH_rotl64(v3, 12) + XXH_rotl64(v4, 18); v1 *= PRIME64_2; v1 = XXH_rotl64(v1, 31); v1 *= PRIME64_1; h64 ^= v1; h64 = h64*PRIME64_1 + PRIME64_4; v2 *= PRIME64_2; v2 = XXH_rotl64(v2, 31); v2 *= PRIME64_1; h64 ^= v2; h64 = h64*PRIME64_1 + PRIME64_4; v3 *= PRIME64_2; v3 = XXH_rotl64(v3, 31); v3 *= PRIME64_1; h64 ^= v3; h64 = h64*PRIME64_1 + PRIME64_4; v4 *= PRIME64_2; v4 = XXH_rotl64(v4, 31); v4 *= PRIME64_1; h64 ^= v4; h64 = h64*PRIME64_1 + PRIME64_4; } else { h64 = state->seed + PRIME64_5; } h64 += (U64) state->total_len; while (p+8<=bEnd) { U64 k1 = XXH_readLE64(p, endian); k1 *= PRIME64_2; k1 = XXH_rotl64(k1,31); k1 *= PRIME64_1; h64 ^= k1; h64 = XXH_rotl64(h64,27) * PRIME64_1 + PRIME64_4; p+=8; } if (p+4<=bEnd) { h64 ^= (U64)(XXH_readLE32(p, endian)) * PRIME64_1; h64 = XXH_rotl64(h64, 23) * PRIME64_2 + PRIME64_3; p+=4; } while (p> 33; h64 *= PRIME64_2; h64 ^= h64 >> 29; h64 *= PRIME64_3; h64 ^= h64 >> 32; return h64; } unsigned long long XXH64_digest (const XXH64_state_t* state_in) { XXH_endianess endian_detected = (XXH_endianess)XXH_CPU_LITTLE_ENDIAN; if ((endian_detected==XXH_littleEndian) || XXH_FORCE_NATIVE_FORMAT) return XXH64_digest_endian(state_in, XXH_littleEndian); else return XXH64_digest_endian(state_in, XXH_bigEndian); } ntHash-2.2.0/lib/xxhash.h000066400000000000000000000165501371554176300152050ustar00rootroot00000000000000/* xxHash - Extremely Fast Hash algorithm Header File Copyright (C) 2012-2015, Yann Collet. BSD 2-Clause License (http://www.opensource.org/licenses/bsd-license.php) Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. You can contact the author at : - xxHash source repository : https://github.com/Cyan4973/xxHash */ /* Notice extracted from xxHash homepage : xxHash is an extremely fast Hash algorithm, running at RAM speed limits. It also successfully passes all tests from the SMHasher suite. Comparison (single thread, Windows Seven 32 bits, using SMHasher on a Core 2 Duo @3GHz) Name Speed Q.Score Author xxHash 5.4 GB/s 10 CrapWow 3.2 GB/s 2 Andrew MumurHash 3a 2.7 GB/s 10 Austin Appleby SpookyHash 2.0 GB/s 10 Bob Jenkins SBox 1.4 GB/s 9 Bret Mulvey Lookup3 1.2 GB/s 9 Bob Jenkins SuperFastHash 1.2 GB/s 1 Paul Hsieh CityHash64 1.05 GB/s 10 Pike & Alakuijala FNV 0.55 GB/s 5 Fowler, Noll, Vo CRC32 0.43 GB/s 9 MD5-32 0.33 GB/s 10 Ronald L. Rivest SHA1-32 0.28 GB/s 10 Q.Score is a measure of quality of the hash function. It depends on successfully passing SMHasher test set. 10 is a perfect score. A 64-bits version, named XXH64, is available since r35. It offers much better speed, but for 64-bits applications only. Name Speed on 64 bits Speed on 32 bits XXH64 13.8 GB/s 1.9 GB/s XXH32 6.8 GB/s 6.0 GB/s */ #pragma once #if defined (__cplusplus) extern "C" { #endif /***************************** * Definitions *****************************/ #include /* size_t */ typedef enum { XXH_OK=0, XXH_ERROR } XXH_errorcode; /***************************** * Namespace Emulation *****************************/ /* Motivations : If you need to include xxHash into your library, but wish to avoid xxHash symbols to be present on your library interface in an effort to avoid potential name collision if another library also includes xxHash, you can use XXH_NAMESPACE, which will automatically prefix any symbol from xxHash with the value of XXH_NAMESPACE (so avoid to keep it NULL, and avoid numeric values). Note that no change is required within the calling program : it can still call xxHash functions using their regular name. They will be automatically translated by this header. */ #ifdef XXH_NAMESPACE # define XXH_CAT(A,B) A##B # define XXH_NAME2(A,B) XXH_CAT(A,B) # define XXH32 XXH_NAME2(XXH_NAMESPACE, XXH32) # define XXH64 XXH_NAME2(XXH_NAMESPACE, XXH64) # define XXH32_createState XXH_NAME2(XXH_NAMESPACE, XXH32_createState) # define XXH64_createState XXH_NAME2(XXH_NAMESPACE, XXH64_createState) # define XXH32_freeState XXH_NAME2(XXH_NAMESPACE, XXH32_freeState) # define XXH64_freeState XXH_NAME2(XXH_NAMESPACE, XXH64_freeState) # define XXH32_reset XXH_NAME2(XXH_NAMESPACE, XXH32_reset) # define XXH64_reset XXH_NAME2(XXH_NAMESPACE, XXH64_reset) # define XXH32_update XXH_NAME2(XXH_NAMESPACE, XXH32_update) # define XXH64_update XXH_NAME2(XXH_NAMESPACE, XXH64_update) # define XXH32_digest XXH_NAME2(XXH_NAMESPACE, XXH32_digest) # define XXH64_digest XXH_NAME2(XXH_NAMESPACE, XXH64_digest) #endif /***************************** * Simple Hash Functions *****************************/ unsigned int XXH32 (const void* input, size_t length, unsigned seed); unsigned long long XXH64 (const void* input, size_t length, unsigned long long seed); /* XXH32() : Calculate the 32-bits hash of sequence "length" bytes stored at memory address "input". The memory between input & input+length must be valid (allocated and read-accessible). "seed" can be used to alter the result predictably. This function successfully passes all SMHasher tests. Speed on Core 2 Duo @ 3 GHz (single thread, SMHasher benchmark) : 5.4 GB/s XXH64() : Calculate the 64-bits hash of sequence of length "len" stored at memory address "input". Faster on 64-bits systems. Slower on 32-bits systems. */ /***************************** * Advanced Hash Functions *****************************/ typedef struct { long long ll[ 6]; } XXH32_state_t; typedef struct { long long ll[11]; } XXH64_state_t; /* These structures allow static allocation of XXH states. States must then be initialized using XXHnn_reset() before first use. If you prefer dynamic allocation, please refer to functions below. */ XXH32_state_t* XXH32_createState(void); XXH_errorcode XXH32_freeState(XXH32_state_t* statePtr); XXH64_state_t* XXH64_createState(void); XXH_errorcode XXH64_freeState(XXH64_state_t* statePtr); /* These functions create and release memory for XXH state. States must then be initialized using XXHnn_reset() before first use. */ XXH_errorcode XXH32_reset (XXH32_state_t* statePtr, unsigned seed); XXH_errorcode XXH32_update (XXH32_state_t* statePtr, const void* input, size_t length); unsigned int XXH32_digest (const XXH32_state_t* statePtr); XXH_errorcode XXH64_reset (XXH64_state_t* statePtr, unsigned long long seed); XXH_errorcode XXH64_update (XXH64_state_t* statePtr, const void* input, size_t length); unsigned long long XXH64_digest (const XXH64_state_t* statePtr); /* These functions calculate the xxHash of an input provided in multiple smaller packets, as opposed to an input provided as a single block. XXH state space must first be allocated, using either static or dynamic method provided above. Start a new hash by initializing state with a seed, using XXHnn_reset(). Then, feed the hash state by calling XXHnn_update() as many times as necessary. Obviously, input must be valid, meaning allocated and read accessible. The function returns an error code, with 0 meaning OK, and any other value meaning there is an error. Finally, you can produce a hash anytime, by using XXHnn_digest(). This function returns the final nn-bits hash. You can nonetheless continue feeding the hash state with more input, and therefore get some new hashes, by calling again XXHnn_digest(). When you are done, don't forget to free XXH state space, using typically XXHnn_freeState(). */ #if defined (__cplusplus) } #endif ntHash-2.2.0/ntHash-logo.jpg000066400000000000000000000451471371554176300156540ustar00rootroot00000000000000ÿØÿàJFIFHHÿátExifMM*>F(‡iNHH N ÿí8Photoshop 3.08BIM8BIM%ÔŒÙ²é€ ˜ìøB~ÿâ¸ICC_PROFILE¨appl mntrRGB XYZ Ù  acspAPPLapplöÖÓ-appl descodscmxlcprtä8wtptrXYZ0gXYZDbXYZXrTRClchad|,bTRClgTRCldescGeneric RGB ProfileGeneric RGB Profilemluc skSK(xhrHR( caES$ÈptBR&ìukUA*frFU(Vaeobecný RGB profilGeneri ki RGB profilPerfil RGB genèricPerfil RGB Genérico030;L=89 ?@>D09; RGBProfil générique RVBu( RGB ‚r_icÏðProfilo RGB genericoGenerisk RGB-profilÇ|¼ RGB Õ¸\Ó Ç|Obecný RGB profiläèÕäÙÜ RGB ÛÜÜÙAllgemeines RGB-ProfilÁltalános RGB profilfn RGB cÏðe‡NöN‚, RGB 0×0í0Õ0¡0¤0ëProfil RGB generic“µ½¹ºÌ ÀÁ¿Æ¯» RGBPerfil RGB genéricoAlgemeen RGB-profielB#D%L RGB 1H'DGenel RGB ProfiliYleinen RGB-profiiliUniwersalny profil RGB1I89 ?@>D8;L RGBEDA *91JA RGB 'D9'EGeneric RGB ProfileGenerel RGB-beskrivelsetextCopyright 2007 Apple Inc., all rights reserved.XYZ óRÏXYZ tM=îÐXYZ Zu¬s4XYZ (Ÿ¸6curvÍsf32 BÞÿÿó&’ý‘ÿÿû¢ÿÿý£ÜÀlÿÀN"ÿÄ ÿĵ}!1AQa"q2‘¡#B±ÁRÑð$3br‚ %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖרÙÚáâãäåæçèéêñòóôõö÷øùúÿÄ ÿĵw!1AQaq"2B‘¡±Á #3RðbrÑ $4á%ñ&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz‚ƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖרÙÚâãäåæçèéêòóôõö÷øùúÿÛC  ÿÛC ÿÝÿÚ ?ýü¢Š(¢Š(¢Š(¢Š(¢Š(®HRN'ÝÜó@KvëMÜýñúÔöÖ5ÍÔ‰)Ë<ŒGÔœYÚo‰4h²èú­û'ÞN’‘õÆØØbØ€ýsJaÅ.1Ú Ë玔¥Ÿ(ph>;“Ÿjd§jä6 õ§¹Ú~µç|Iqá/†ž&ñ=£çÓtë‰ãcÀWD$Àó@f¥ñ'Åž ׯ¼/ð›LƒT›K*ûSÔ$x´ÛY@É„y`É<£ø• Ÿ™â º×~=øF?ím{MÒ|Y¦Ä7O‘çÚ_"÷h£¸i#›ÝÞŒ{W…ø â'ŒuO é~ýž|8·Öl*—^ Ô3¤·OóO$`àÊÏ!f-Ï^˜Åw'ßµõ² È|U¡ÝH96ÒÀBm˰ú‚+©a´ÖI¯hųé_ x¯Gñ®‡kâ=çí7@•le*pÈêyVV2žAÓ.2pI¯~ë^>Ó~+x¯Â~<ðì~—V¶THíçYÍ:7•4°ʇK©ç#=ëìx‰$æ¹å;Q’jäÔQEHŠ( Š( Š( Š( Š( Š( Š( Š( ÿÐýü¢Š(¢Š(¢Š(¢Š(¢Š( p¿üggà ^xŽî'»hŒpÛÚŃ-ÕÔî#‚ÿÚ’F nIàîˆÎ+á/Û_Ä7ºdÓì/ä°‘µïL‘0Gf€¢zŽeàŽAéÍtàð®µHÒ‹³g.7¥VZÙ\èï4ï‡v— ®þÒ^#²ÕõÙ†ó¥I)“LÓóÒ+{5ݼ¨ÀieVf9#h é³'ÄW~»ÓtMz1›[½ . ƒî²ac.ꬥHàŒùKŸ¾'øNû~á¹cŽãçóï$[o7?ÅûÃæú•çÖ¼ßâ?Ãø1yâý { u9[¥+$ ݈š"BôÉS_kÁ?ݬRçíÐøXñvaÍÎð­C¿_¸ý\ø;âíWÅþ ·¾ñOí›)î4ûãÛ\ÙJa‘Ôv´0³Šõpr+æïÙSK¸Ó¾xfâúY'»ÕRmBi%bîïu+I¹˜òNë_HŽ‚¾¤ydã}С>h©wŠ(¨(Jà>)èãÄ|K¢öÝ:ê rÑ0­wǨªZ”k5”зI—ó  ð—Ä¿xCá/ƒµ=wPµÑíîô›)#…F– â@Xœç…Zçî?k/…òylš“ßõÂÉ‚ë†!ÿñÜûWæo†´ûˆco´ÜųžæÑg½™‹”·âÛ$Ì«·*í÷®£S‹Ie"]ZfãïG¦¹_ÎI£sÿ|×è8.ÂJšu*I·ü¨üË2ã d+¸R§ÅwzŸxØüSð޾8ø"ûÁšÄWïqg©ÚM9“‰†øäTq÷=+ë˜È#_Œ ®•ñçÀ÷Ö½ç›zöìž\Ð\*Í©ÊH˜+ÏUs_³pð¸ô¯”ΰÃWtéɵæ}¾Kž&‚©R6~DÔQEy'¬QEQEQEQEQEQEQEQEÿÑýü¢Š(¢Š(¢Š(¢Š(¢Š(®p+à?ÚKÇ~øãà÷—Ãëâ=B×F»—O·™#ºžâ4YJ(frª´'=ÇQ÷㌌WÄŸþ]üSý£e²mvçEÓ´ï [-гÂÍ:My9òćî)+–래®œ$á©Oc—Nr¦ã Ùå·ÿ?hÍYÄÓj–ú+Èr–þu©Ólò4Ÿƒ`Ö7‰¿hoŒðÆ«¦|Wðúêún§iqW"8ÔoxØ/ÏûyFO+ò“Ôd×Õšì¥ðBÒÐYI¢5Û0ÃI4ò4îH#ŸÂ¾~øíû3éøq¯ë? õÛý"ÚHãŽëM–O´YÜÅ,È…v°%XnÈnpkÛ–c†”yyÝoÆç‡Ë1P—3¨þûþÜ¿t8ü=à èJ6;L´ƒñªZíñéL(U`T•óoWsêR (¢€‘š‚䈊±ŒÔ7˜ž€ü?Ñô»›kÚ^‡c-õÐÕµ3åÚÂÒ¿7ržvëÞ½6ÿáoÅ ‹6/ê%qÿ¦°5ÿÚ#â5ÿ†.¼â[Èçô:QUí§Kˆ’xŽèåPê}U†AüªÅ~6~ÜQE—­\-¦—utç NçèªMjdW•ümÕ[GøQâ»ø›®p‘óÏ™"L~,( Š^‹O»Óá¿Ô§°·{³%ÀyÞyä"wi2"·'Þþ1œ×G{o¡íÄZ¦™qþİÝÀ¶åDÇÔ‘_®~ ü;ðW†4Í>ËÖ+s¬),ÒB²Ë$vi$ÜÄ“žÿN+²ÔþxV‡ÉÔü9§])ÃÚÄxúíâ¾–ž{Ù(»'W‡g)9s#òà›-ÇÇOéÐ$Ööâââè¤Wisdßf·wÊì<0=›'Þ¿f"åï_!é þøOöÐï<£E¥K‘}=À„°Œ™"O’«÷@+ëÔû¾µãcñJ­Nt Àaý•5ôQEqEPEPEPEPEPEPEPEPÿÓýü¢Š(¢Š(¢Š(¢Š(¢Š(­È¯”þ>xEñÄ…ÃÄhÏ¦Í¨ÞØÎˆÅ<Ã5«Í3B—‡œM}Z}ë¿hTš×áäž*µ]×¾°Ö£Ç]¶wgüà2Æ´¥RP’”]™ZQœyf®RÐü7¡øzÎ; Æ hÆÑ1¬côëY^?ð埊<­èW°$É{eq °^6PFzœ×™xãö‹øwàÙΘ—/«ê*k  a•29!Žp[>ÕàÚí±¬¥Âo$CþŸq@¤ν N*´}¤bìúž]\ÛJ~ÉÉ]t>²ø9®7ˆ~øKXs—¸Òí<Ïúê‘„üxôÑÍ|¡û!xÆËÅ î"´ˆÛ.‘ªßÛ$,C4q<¿h‰I}É@ü+êÄ'=«Íœdã-ÑêÂjIJ;1ôQEIc¯’ÿkß\xwᾟgf®µ]ZÎ%Y2P¬/ö‰7A ¬X<÷¯¬ä zøsãïüyø¯aá-#R‡NÓ|bn®å• €Üß±HÐ.0XG<ö5Óƒpö±u>§.5Tt¥ì~+hx”¿´GÅ­Ižcâ(¬óÈK{h•G°ß¼þf­èÿµoÅÎW6¾!´æI[ËŽûdåÏÕOÖ½Ic+ˆ­vAãç{Ú.Ìýf¼â?ìÙñOÁ–SêÚAâ u.òéÿº¸GRÐç OûU÷ôó ¢¯îåI%ß©ùÏöfsJ~×Û7ëk`|ñÍ—Åïx£â6o-­­µ¥ž˜‘Ì0Ë(/4Ã#‚ËÈë_X¯ ¥|¥ûøqô?ún¡p….µé§Ô$`•‘¶ÇŸøŠú¹yõ¯Ïñj ¤•?†úz¥aå7N.§ÅmE¢Š+œØ(¢Š(¢Š(¢Š(¢Š(¢Š(¢Š(¢Š(¢ŠÿÔýü¢Š(¢Š(¢Š(¢Š(¢Š( `øƒF¶ñ¢_&ûmF måºJ…èkxô¨ÙIùíû5þÏ^ ¶±ã°5;í2òïN’ÅÉX-ä±™¡&AÖG`Æã·k‚y¯ 5_‹³ï€·i·:Ž•jѦ+x–B¸ìDJÜ×É´òxÃÁŸ®t.ú{o xí£$7’¯l‰o:< îшܢòÇ9Ç&¼+Kk-?+ ¶ôÇþ×ç#Ó,}«íòÌ‹˜ÃÛÔŸ»¶¯CàsŽ Âeu=:~ó×Es럵­'ÀzŒW^(Òá¾1GE²öÁÌ2¬«þ²C‘ýÃ_d©Ü3ɯÂï ø¦oxïÃÿm^îæ=ñ$Ÿt“Ì «ü— ó–ÆIú_¸ºeä7ö±^[H%·H™z28È#؃šð3¼«ê•y”—–§Òäy¯×(ûGS@t¥¢šÄŒWŽ{%-BößN³žöåÄq[£HìzQ’!_|?ðÆŸ.«ñOñ¬~²ñ­ãjÛÇf³\%¨U°g~bEpMƽö¤ñ埆¼máy$‘gñ]ÊÙ1w˦C]:ùg•ì+•ƒö²ð~‘½—†u%²¶EŠ<ÔAµ@S&xê`²ÌUUÏF›’<ŒÃ6ÂQ~νEênßxö—ðêµç†ü{k⟳j6«ñè1Á5Çë?µ}GÂzÏÃïéx{âÂÇemfÜ¥Ó]8‰d·âPNO'Ö½Ëá÷ÇŸ‡ß®N›¢^5¾¤q´¹_*bR ðøÿdšç¸™ÜQEQEQEQEQEQEQEQEQEÿÕýü¢Š(¢Š(¢Š(¢Š(¢Š(ÆiÅ=©2hæ/Ú£áý×>Ý_éqoÕü5 Ôí02Íå)GÇ$#¸¶Õ$ÔíḊîñDí9•Co<R}Nkëû…R¡àƒÐçÖ¿1u_€zùøë?€`¿û6‰sš†—=Ë™m'ïmm£'¬NÙ :)\ñŠöòºÜëØUªáOwæxΗý¢%:›+ž¥âÏÚÏBŽÆ}+Kðœ×–2ÆÑ0¹t¶ãa´ƒyÚAèq]—ìñ2/ü>›Â× Qð¤Æ×Ëßæ±9/jÛ¸'j~ìœuJî|1û7ü-ÐcŽK­3ûnït÷çÎ$ÿ²œF£Ø-r_"ðÀ[CøÃcoo¢é0Ký—­%¼KKiw‘ •@2ñNo³0£1­ƒ’äÃÁß»êVÏŠšµ¶KCêå|Œõ¨î,{ŽsÇðå§í½¢]Â’[x[‘Sû€H= ™sŸl{3à=wÖ4f–Êâ8ï%´pË$ecwØì@ G8¬%“b£ySvô:aŸ`å.HÕMúžñ{â}¯Ä¿Šz–­op$Ót’Úu‚¯Ì ÆÇΔcþz8ÀÿeG­rWWvòF±¤€>:ë_}xöPøeáM,A¢Éveµ…̯w9,΀–p>bsX;ý‘ô{‹ î<ª\i÷* [;Ù Ýœ‡Ó÷™xóê­‘_i“q´pÔã‡P÷WãøŸÄ,]yb]OyýÇç]ö¥w¢ÝE­iÓµ­Ýƒ ¢™9È?ÌWë'ìç¦ëòø'þ¯"ÿÂAã]BëhÀTØòA»‹üâð?½[Åÿ´ÿ…Þ!²–ͬåk^ù¼›kr“ø£™°¨Üž ç¯Ù˜aXcHa@‘   è;WÆ™½ \éº+e¯ùïeð”çÏ®…°r9¥¦ö¥+ⵊ( Š( Š( Š( ¾[ý«¿iOøfèþ5“çÄvúž¤ºsÄ·_dhËÃ,ÁÃ¥ þ¨Œ`uÎkêJüÎÿ‚¬[ùß³Ž.?ÔxšÍÿ;KµÿÙ««N3«Ëfa‰›6Ñéß²í¡íIâohv^Ûh6‘\¤½-+M!@›1…ÀçqÏ¥}Ç_ˆßðH‹}ÚßÄ뼫·ÒS?ï½ÉÿÙköæµÌ¨Æg- ÁÔ”©©Kp¢Š+€é (¢€ (¢€?ÿÖýü¢Šâ~$øÖ†ÿüEñêÑïàðå…ÅüFÁ^HíÈʤðëN1mÙ »+³¶¢¿=~ ÿÁD¾|nøáÿ…Þð¶­g®´ãϺhQyò\1ýÛ»6Ddtk­ý¢o/ƒß5ü+‰|Uâ˜ï4ûA»ö[›†ÊÆÇûª®ãŒ¨Ôð5yù9u1Xš|¼×ÐûvŠüAðW_ý¼H~Úý‹þyj?›ÿ>Ï·ÿ¯µ¿g/Ûçá/Çý^Ío7„üSqŸ"ÊñÖHnH•·¸P¡Ü÷]ð†çUË+ÁsJ:ONNÉŸtQE|‘ñ“öÕø)ð#ÇÀQ‡RÑ]n·µó¢1͸/Ì9ùNFÚä¥JSv‚»7Ey3ñÓ_ý¸?hŽ_|=á{gþÿV³¶:~ºØ2É:!YfÉšLƒ†Âý!WòðïÄz‡þ4øgÅÚ¼Œš&›â +ë‡T,âÖ´•ÈAÉ!8ž•ûåqÿ6ý–aŽÿUŸÙ4÷úZ÷ó\¼U(iäyxJ÷I ŒsŸÂ›ïQZ\Ç}gä ùw².x8q‘Ÿ~j|JùÃ×8ï^gñÀ0xÚÎÑíî_LÖ4©~ѧ_–Þl`ñÑ‘ÇÊèxa^–Ä3T¯u]>ÚK»É!RÎîBª¨êI<(Âm~#|Að´cOøƒá»©¢ù~ߣ'ÚífÞ™õV^;_||ø›©üqñE·Â[MëKÐt)­õM¯$—ÞZÃåä•U8‘ƒ`œ-}ˆ>*ø£Æ28øSáÏí==X Ôïåû%”‡Ö©’UÿiW†¾ø¬¿>x·]ñW‰ô x,ügq¶×6“››xuM²+³*²‰A@ÃÕïðÔ)X”n‘¾‚¼¯Ä¡Õ¬.ôk #cwÃ'Ú>mèã=«Én®oõ›Ç¿Ô¦k‰å9fcŸËÐU”´URí¯$žÂ¿|yz”}©ø]tèü:³îÙ_ö§ÓaðÏü+?‰^m÷†8`Ô ÛÜY‘¶îÚêÆÝ€pkêíKãß™E„¦j“ Ci¦¡™»nqò"ú³|%û(|9ø·s©j¿ô&ÂÓOÔ :}ƪòšØ6é$H#V,€ [#­}°ž6ñ¯Ã•ó~!øbÖ=!›jz!2Cþôð”I}Xs_ÏÍ*1ÅTîßCú+«RxhJ®’hê~øWÒ®õOøÌDþ(ñ—ö…‹æŽÒÞ,ù6¨ßÄ$±èX’8Å{8V^™©Xê–0ê:uÂ]Zܢɱ°dtaTŽ5ª+Ë;‚Š( Šø·ã¿íÝð?àuüþ’ê_øž±ôÝ,,žT™ÆÙç$Gg‚ ³ŽéÍ|•­ÿÁI>8[[¾¹gð*òËE,g»kÆMƒ©2‹hÐzú í¥—VšºèsON.ÍŸ°ôWæÁ_ø*ÂÏê‘hô§ð%ÌøXîÚµØ31$‚8Þö,¥;œWéÜ3Cs \[ºËªHeeaAGCX×ÃN“´Õ)VŒÕâÉ(¢¼ãÏí)ð¯ötÐâÕ~!j .ï}“NµQ-íÎÞ¥#%@QÝܪƒÆr@9Ó§)>X«²å%v{åù3üã×­^øOû?꺶‚¹Ùy‹»¥)ÁÁ·¶ ŸUVlTžÿ‚§ø^ë[ÿ„gâç5 ^¬¾C=››Í’çd·t†d ðBïlö®×•ֶߊ9þ»O¹úÅ_œðTx÷þ̱7üó×l[ÿ!Î?­~#Ep Á<úƒÒ¿;¿à¨?³ŸMjÀþ’VyñáêV/ørô>oÿ‚BGÇÅyý@Ôäñ5ûG_‹ßðHë‹k-+âÍíä©ä’F ˆˆ·¥™˜ð’zW¯|bÿ‚¤|+ð>«>ƒðÓDŸÇ®c’ïÏvŽ ŠM’¼ áOUb9®Üà R®&J û~HçÂÖŒ(ÅÉÿW?Pè¯Ä½þ 몭օ¢Š+Œè (¢€?ÿ×ýü¯)øïfš‡Áˆv ­Ï‡uhÏÑí%Ö½Z¼÷ââ >øÑFÑuùÛIWKâDÏf)_ü]ãüJÒ5¯†‰¿ÅSyú~…Üëq©BöJÑŽž`ó‰Lð‚8¯é'àì‰ð«à§‡­ãH¶ñ‹æQ.£­_F·72Ý?2šPÆ$ÜHpHÁrÍ“_„°nŠš÷ígðúÒ@ AsstsØÚÚM:ÿãÈ+ú¯=®Ô”#ÛSÊË)'&yǾü3ø¡ Ïá¿ønËV²™ ,*$#¢”ñ°ìÈAµüÁ~Ñu_ٷ㎭à‹ÉŒz\Ñ^éW ì•­¤Ä°I¹q‰#?+2àoBF+úįÀ¿ø+5„|gð†¦Š·:‰ÈêDWSÏýök’¼•OgÑšæT—'7T~ÃþÍÿ'øÅð3Á¿¯HkÝ^Å~ÖTmSwnÍÁQØcra]oˆ~|+ñv¨ÚçŠü¢ëZ“¢Æ×7ºuµÌåî©’HÙ°3ÀÎ|¹ÿå2ŸÙÁâC•ê{=—íóÿ\×Üuæb%Y(ôlì¢ù¡ûÊ¿ÁïhúïíáÏ^XÁq¥ËâÕGµx• x#»$ÆÑ‘´¡UÁR1Ž1Šþ’¤ýŸ~J¥%øká§SÔ6dGë:Ÿ³ ÿÛKÂ3uó‡ÓþÉþ_üe+ºMö~€Î?º×w Ç=ŽÕÜãÐà×Ûñ&_—Kñ˜K'l|Oæ9’Ŭ.2í=îdÛ~È´*ìô™YF ÂßxÏ¥s~;ýšþ5ø{æó\·Ó­4é.mmîe†èÉ"Åq:DûWhç ëÅ~Ï" õ¯2øÑá9ükð¿Äž±cÝ唢ÙÁÁK„âaôu¾:|_Žœ}›žCî× à£%QBíj|Ûñ ã}Ö‹~~|‚ t8V ‹ÆÈ´H@R ’l–c€}Oòö¡ã¯ßÏ*·Ž5[ùŸ;ÖÂ&–>z›ËVAƒZ?<ñ!ÐIJZhVL³ë÷<ù×Wí’m·Ï•‚B·6í½@rR;‚k蟇þ3°ñiÄyzœ )PAØý ÝlŠñ±TçÍÍ(rÜúhJ6ŒùŽß5âK½WÚ®™`â;«ËI቉*I#*¤‘ÈÁ#‘[\Ò×*gQñ¯ì«ûøözðÍþ§em¬øòáßꮾiŽFäÅj\f8צà¤Ææì«öUÎx‹Æð…·ÛU2¢I¼.T62Ìkë_ø&'ÆsâÁÍOÀþ#¸k»ŸÜCmm+rß`¹F0FÇ©òÚ9OdÚ¿Ã^ÿý¨> |Iøk§|.ø{®Câ]V-Zéæ´ ö°E3'à#» nÉfÿü>ý—>>][Ù—Ó5ÿjf[)YNÉbW&?~)£##£+{ŠÃ%ý¢_´þ¾ãLÆVå¾×?¬›[[kh¬¬¡K{xcŽ8Ô""(ª¨À ù‹â÷ì©à?‹ü ñjê8쵟 _ÅstËoíx>x¡—3¡J± òîB#oËÿਿüS¦ÚØ|`µŸÁúß 4ðÄ÷Zsž›Ç¾hò…‘‚ÿ|õ¯Ñ?|Bð/Ä}(k~×ìµûŒËe:LŸáp¤”oöX;ŠóçJµ ]¦Ž¸Ô§QYjv5ùÝÿ?ÿ“`“þÃ6ÊJý¯Îßø)ÿü›Ÿö°þRQ—ÿ¡Šþ½É/ØûÃþ:ø¹â+ÿÙÓÃײi~ñ”¶·Þ$º·œiÚP”ùaŽ@Y`¼ƒ—)Ÿ—p?Ñ_ÿ‚ ¾ihÞ𵆕 Ê«\HGñK;ƒ,îÌOá_“ðH­&×¾%ø‰€Ýim¦Z©ï‹‡¸‘¿ôJ×íÝvç5ßµp[Ùu%ìÔžçÊß´‡ì›ðÏö€ðv¡cq¤Úé¾(X´íZ–)â¸(%d’<:6x$®;Ÿ¾#øƒözøñ¡ø¢F{4mCìz¬ø­ZO*îÈ]Äg8uVêY•üœþÕöiŸ´·ÄË[u‡_¿—¦f•¤?«éÉ*¹©R–¨Ç2‚‹HîXÔVvem&ɦ;¤0G¸ú¶ÑŸÖ´kçYë…Q@ÿÐýü¯?ø²qð³ÆDÿÐQÿÒi+Ð+Í~3Ê!ø=㩉ÀAÔÛ?KY ]?‰=™üîÿÁ:üeç‚ëž©ÿ¦ëŠþ›+ù‰ÿ‚yÊ"ý°<“€ßÚ‹ùé—Xýkúv¯c>þ2ôýYçåÃ~¡_‚ßðV™øµà¨»®†íÿ}\È?¥~ô×àü’pßü)mžcðäO÷ï.GþËYd«÷ëæi˜ÿ Ÿ¤ÿðO¼¿ÙÀ‡¼‡Toü©Ýé_j<_ÿÁ?Ô/ì‡ðøùç¨ÏQ¹5ö Äo-¼±F@gVž€‘Åqc??WùáÇÑËwì]1¼ý­¾Ü·YuIóŠS_Ô½)_²~¢žý¨þ˪þçÉ×mí$Ï^w6üû~kúµ¯S>_¼¡Å•üÔCÒ“µ:ªÝM´/4Î8Ô³1èFI?…x,ôχj›/üSÖtÏ„> °—PLòõWÊ`ª¼²ZDä‘÷Ž÷#ý•5òö«ð‡Æþ³iµ ËäÆ9a6®èØÿè&¿C¾Äú¾«|N½B—^8¾–ùVÆ#äY'ÓÉ@ÿW5î,WžE{x áááìù_Þxy–H±çö?+[î?ü?ñƒ^ðT3iÿh:¶"²Ýèú«yм`|ËÌ2­Ž•q_ ß²—ƒ¬ü;ðº-z 6±—Å—ê¾L¹á·˜ÿ¢ÂÍßË„(ú“\7í5ðsÀþ%Ó´—·³[=]Õl´Ød€­Ä£ÎóTpÁaÄõâ¾ÈÓ,í´ë(4û4ÛÛF‘F p¨ŠGà,ÏJª^ÉZû£L¯R•ý«NÛ>¥å¨æ@Ê©¸¤<ã׌{À¾-ø‰ÿ å­x·ÀúFž¯qâK£¬èÇn"V»ù.üÒ1Ÿ*E }àt¯•¯5KíjîmoÄ—qÉ–c¸çû¨½z*ר߶Ÿ…ÄÞÒ| '‡nÖ9›¦-}Êjø×NÖ#±T‡CÚÓ‘‰¯ÝC1?Ý·VáxŒšý?ƒ(Ñr¥Oš«}z#ò.?U¥UF¥NJItêÌCÃúÝô~l\Í t2(Œ§˜E}wûø‡VЛUøWâ w´(N¥§o+µ¡rd]¤ýÖÃ~&¾UÕc7 Éy#ܹ䴮ÎZÍð7Š›á÷ÄxÆ6eŠÆåc¸]ăm1Ù(ûþîñ.IŠÄa[Ÿ.šèƒsÜ5 JP½žšŸ·Êr+Á¿hïÚÂß³‡Ã{øŽ&½äÖ1¸I.îœT AØ )g|ª8ˆSî6³$ñ,±èàaЂ8"¿?à®ój~wà ˜iåufãöÈSÇÔû×ãÙ}V¬a#öìU^JnQ<Ûáç¿lÛÛÇºŽ“¤øºx>̾}3}½­¤O‘f6In%“åy0pIÚ  û÷Á?ðN?ÙÃÛ/|Ye}ãmT€d¹Õo%ÃI܈ 1®=ïÀîz׎ÿÁ&u=&_ƒ~0Ñ¡Ùý§m¯çþDö°¬$ޏݘíœã½~«×naŠœ*:týÔ»ahFPSž­÷?&¿à£ þ|1ý™¬­üá]3Ãÿhñ”LÖV‘A#"å°îª¾ïñ\·ü&êù’¢ŒãqÎ3µ±ÌÿÁ#ÿÂ'ñƒó}·NÈöò¦Çõ®„ßÔ}_êŒl¾´’þ´?`«Á>8~Í?h]>_ˆú?yh¥-µ gò/`S“µeî\’v8dÏ;sÍ{Ýqžø…àÏ6²žÕbÔŸÃÚ…Æ•¨*V·½µm²ÄÊáO£ «uRG5áÓ”¢ù£Ðôæ¢ýÙ‹Ÿ¿à”7ÒÌ÷ÿ|Sm®ÛŒ²Yjjm.±ÙdÝîÂ!_œªß?gˆ¡±¨x+ź;ç1I·?÷ı>?ÚǨ¯ë¿?à®6Þ_ |<¼’$ëÝÞÇ€ æÑcC*“Ô#F@è >¦½ü»4©Rj•MnyX¼c8icô#ö`øÎ~>|ð÷Ä{˜RÛQ»G‚ú(Á—vîc” $á\€ê2pr |ÍÿDpŸ³©þ=rÀã“é]Çü¿Á·‚¿e¿ÿlÆÐϯMsª¬n+ ËâƒÙãE{0¯5ÿ‚©N!ý›tØÏü·ñ’~V×Mÿ²×EbÔcµÎª’owØð¯ø$#ƒÅhû†ÐÏæ/¿Â¿gëñ;þ 8]G╯y"ÑŸþøkÁÿ³WíNoþñ/—䇀þþº…(¿µÛùß´÷IJ¿ô»_Å_Ò¿«ªþO?iyVëö øŽÝGü$úŠøÓ!þUÛ/ÞKÐçÍ>WñF"‰"BþC%W€zEPÿÑýü¯,øå¤kþ!ø1ã¿xVÐßë:¶‡¨ÙÙÀ¬¨džæÝâŒnrª>f’½zP•šb’º±øû)þÇ_´ï¿ÚÁ<ñg‚žÇGÓ®¤ûLâúÆ_*) ’b‘\;ñ¿ Rk÷âŠ+§Œ•i)Iáðêš´B¿à _²ïÇߎôïü4ð«k:M–…mdgûe¸¥Å̬»n&Žƒ Ç5û-EN*3çŽã¯ET+>cýü âÿ†³wƒü ãÝ8é:î”·ËqlÒG)O2úy#ùâgCº6Vá\s_NQEcV£œœŸSHG•(®‡à÷ígû|SѾ$j_¾ií«èú­Ù¾vrl¾Óî\ùŽQI]Ñù™hÌd²giP1úÇáímûM&gáÏ~Ïž&ÔüCeC-ô1=½Û¨Ì>HËum®Ëž@úaEwO1s‚H§cš8NY9AÚç-à½_Ä:ÿ…4ÍgÅz!ðÞ¯w’çMiÒé­\ÿË34`+1Èæÿ´£©[|2Ô´m O/Xñ4è¶$ö›PB[ùç;Ÿe¯pbɯœü{¨Øj?ü  _ÝG®…m}®Ï溢—Ûö;o¼G!¤r>•Àž·GKµ½í%Ó¿fн–•ñq¤kQꊈ6ªŒvU+«OÚÇáÛ»[˜ü[§ÇÖ"C¾Ñ؆¯°áñ¿ƒ¦“ɇZ²gç§ø×C¶× ²Á"ȇÊAè¼}M§þG•ýJOšœÚ~LøÃá÷ÅŽ¼?§j:,ú5Ï‚­o5 È&Rí…¶·d'£JyéŠûeÛšð‡C«|Tø‘â…Aû‹‹&ªÙÁçIÿ‘.å^ð1Ž+ϨâäùU‘êS„”m'v?æŒp¢ ³Î¾)øNøÄ¹@é©YÍ‘¸©ÚÁøááû’Ö6ò\|²ãË+ŒŸ1~R uÎàx¯ÜÙ•JyÍ|uðOá7„´Ÿˆ_.uQu¨išÔj²€R kÔ[”(§Œ—wôWÕðÇgûOv÷ÛÔù,ᇙ*iJÖzú;xà‡Äï@“Øé«§Z¸âkÖòòuO¼EOâØãâ—Ød{+Û Ù ŸÝ†hÉöñšýBØŠ­HÁJç©­qoœ›RIv2Àp›}îx¿ìý®jzßÂý&=qLZ¶N½BrV{6òÈ'ÝBœûÖ7í5û<ø{ö‘øiuà^E³Ô­Ûí:]öÜ›[µ@å£pvȽÁÈù‚‘oÁñNü_ñ§†‰Ù±¶±n½â<‰ð>ª„ýkß‘žµòЬ”ùÖçØºk—•ì9ø)ûoþÇÿfñ€¼-yª2/“,še»j–…¶àÛ^8‡™´‘‘•I¨ÛœŸ»ô?ÿðP‰¶«¢øcàퟄnæP²êzºOmŽ<ÄŠåÕŽßî…”ÿ²zWêUßW2çÖpM÷9iàùtŒÌÏÿÁ=WÆß |M7üPÞ(ø¿âÏü$¡„K ¶ÐĹò­ÈÊ«œ`… uógìÇð7öñý˜<[«Ÿ øMÕ4­qaŠño5;AlþC1ŠhÚ;2²ïqÌg*Ç+¤~ãQQΧ+„¬ÓîSÁÂêKFŒMOIá» uøm¡×ZÒ&ºŽf¶[³2,lÃqŒI¤Œíç¯ÁK_‚ß·×ìÇñ;Vø‹à­&Mvm^yf½“KÆ¡e¨y’Kk•Ÿï1 ˜Õ×'kkú¢²Âã+«&ŸrëaÔí­¬~Y韶ísf4Ñû3ëÛ ./­íå%µõ›§~õÏøKö:ø×ûE|N¶øËûe]AiifZøvÍÕ¿uoXÆÎ‘BIË#Êù!™O5úÙE_×¹o좢ß^¤ýZÿ®Eoo¤ÚÚÆ°Ã „D@UT`*Àp¯‚ÿà¡ß~'|køIáÿ|.Ñ\¿·×b½ž5ž6E­Ä{‹O$k÷¥æ¾ù¢¹¨Vt榷FÕi©EÅŸ”ðNŸÙÛãoÀŸøÒ_Š~mÏW²µX$7V· òÃ#’¿èòÈGÊùç¿W被ˆ•Y¹ËqQ¤¡Tüæü\ýˆÿjß|`ñ¯ô=Οªëúý¼ŸÚz™"žêIQ‚5Àq¹H8+ŸQ_Ñ•¦* ¸­ÈÄa£Q% QEqEPÿÒýü¢Š(¢Š(¢Š(¢Š(¢Š()Žñ¯ÈßÚ#R)øýâ9c…î“D·²ÒÔF ÇÚdéÇÞ˜~Uúã7ÝQ_±|?ø“ñÅ>%ñ–…áû»Ë kY¿' åÇ"‰š%+’26 ö¯¤áiB8¯iRIYuØùn.…Iá)Å¶ÚØãî-íÓmÍ“Ãþôd*f‰ñ3ÆÞº[ ë“[ì9ò]Œ‘;~Õ麇ÁoаÀð¥Ûc©Ž@ä~«Ã|aáxmõí"îÉ›»w ÇûXñÍ~õÜ=xÚ\“üÊð~&„Ô’œž¨ýCý•/5-káRxÃX/¼O¨ßêSRÒÌP`vP úgt¯ ý›4ÏìϵõÓ ”û™s!?øõ{¨êkñöö’åVW?y£ÍȹشQEfhFû‰ö¯•&xKÃúÇdžچ¿gäm©n‹ ʉ„I!Ò´‹~øËàÍgâ»m¯i7ßiÑÖxã1Ìá7Ä=Atñ¯¸" ðÿÐ4^Mv5>ne¨!¼‰•‰ü³^á©4k4gr8 ¤w‘\Õ&äîÎèC•r¢j(¢³((¢Š(¢Š(¢Š(¢Š(¢Š(¢Š(¢Š(¢ŠÿÓýü¢Š(¢Š(¢Š(¢Š(¢Š(+\º[ öùŽ´2Ë“þÂþ•å_-§Á_«ýé´Ë{†÷i×ÍoÕ«©ø³wö…þ.¾ÉgÑõ 2?ض‘¿¥~Fh^?ñ¼º—¥ßxš÷ɳ´‚n H©a@Ú¤¯w$áú˜ç/g$­½ÏŸÏ¸Š–_ʤ[¿cö¨í"¸ÿElÞ ×d¹…&T±¹l2‚8‰zü»ñ.§îݣú‹·ÎïªÂÔ~/üLÓô»Û;/Þ¸;ë_uG*…­ óiŸšb3ªŽ~þ"ÞI£Ð»‡ñΪ’u9­ýt=êŠ(¯œ>Œ(¢Š(¢Š(¢Š(¢Š(¢Š(¢Š(¢Š(¢ŠÿÔýü¢Š(¢Š(¢Š(¢Š(¢Š(Ê>ææO~±½‰ ºÒþÓc4r :Io;©Vˆâ¾’¯ÈjÖrWê~ÍJWŠaET|wûiN‘ü0Òãoùm¬Ú(úáÏô¯°‹`ë_1þÑž°ø…wàjË ŽºeÂÛ_˶³¸àÿ½ŠìËëªUáR[&™Ç˜P•Z§ÚhüåÓqÆ;â®êC¾á?±ï†bÏØ|CG>?ñÚ­7ì§Ïþ³Ä÷xöŠ/þ&¿g‡ˆ8º¯‘øMO ³iukzŸœZ¦zýWý® ÿü>X^î?ûæáëOدÁ’²ý¿^Ôfõ c@$Íz—ìÁ¤C |3“Bµfk};UÕ-â.rÅ#ºus_ÆI‡ÆÂ¢žŒýƒøwru­ª>‰¢Š+àO» (¢€ (¢€ (¢€ (¢€ (¢€ (¢€ (¢€ (¢€?ÿÕýü¢Š(¢Š(¢Š(¢Š(¢Š(›ñ…ˆÔü-«éÌ2.lî"ÿ¿‘2ÿZò¯ƒZ7‡uÿƒ¾ ½¾Ó-®$“G² ^$c¹aU=G¨¯s‘ì#!¸?C_¿ ¿j áæŽß üU¢Ý,~½½Ó–ò :²Áq"®Qöà€Ç¦k§ F¤ÛT·9qUéÁ/k±÷U¿‚ü#lÁ­´{HÛÕ`Aý+r;KaûˆR?÷Tä+ç¨?jŸƒwÿjþѹAÇÒlóþê‘ú×âÛ+Ápî¶ðf}â ÆÈDÙå.îÜ òûæº =_ÌæY†I|Yø:›¯|DðËpl|C%Ò˜P‚+鸵{½~}þÎüIã/>,ƒÅ±ÚÙ]ëzU´églÛŒ&ÂF@²à¶$).HfÝ€2À¯Ð1Ô×jNå–ç}*ªqRBÑE™ Ò2zâ¾8ø÷ñ:Ïá×Ň÷×Öo¨Ck§;Å…u2"B®àãsqÇÖ¾Ç kå]_Àþø©ñÃĶž+³PƒÃú=•´jÌCÅ-Ô’Jì¤TíUäWNTÕDê¦ãÖÇ>-UtÚ¢Ò—™ØøcöˆøSâXÑWWlÏÝ^©„ƒþñùZö-{EÔ>Ÿ¨[Ü+r<¹Qÿ‘¯“uŸÙÃÎí/…µë­<ܪÝÃù²ãõæZì…ãØÙ›MÕôù3Ð…–ùÕí,_SXVqõOô>uf¥7j”—tÿF~‡I4I;2€ ž¾•㿳ØÏÃ׸‹SU”]×’×ÅW¿²'Åsi=ÅÖ¿go hìÄM;ð£<+íÙŸMm+àg„-ƒ7Ù ’;™$v'žyÍyØüI{*ªê{8 Mj—ö´Ü=Zg»QE枈QEQEQEQEQEQEQEQEÿÖýü¢Š(¢Š(¢Š(¢Š(¢Š(’ ®+àÝ?àƒ<[㿉Z}Ä÷ZˆàÖN¡ͤ¥K-Jåž3”u,Ë’26ã"¾ô=+þ$øCÄpkV_>¢Iâ="#m5œ¶=NÅ›s[;ºêß<.xVÈ?)5p¨âïgR”f¹d´>{ŸöPñ¼aâë+ˆÏCu¥ÛË ìáÍli²f¡q _øÎæêÌŸÞZiÑ‹äŒcçLz÷¿|hð/‹fT—ŸØšâ M¥êxµ½‰û®Ç#xÿj2ÊG ×y®ø§Ã°}Kĺ­®—j€“%ÌÉñèXŒŸ¥vË2¬Õ¹ŽyMË›”ðÛï‡>ø{⿆cÁVé1Cª]ÚºF0ÒÇqc;¾öêíº$$’Oô Éõ¯˜´MOQøÍñ;Dñf“ö¾ðižk{™£1OPž&€4HÃw‘nØcÌxý=\“nìôR¶ˆ(¢ŠCøØIé_˜ZÇÃï‹%ñ/ˆ~<ü>º–OíRæ"µ*åm,¶WL²«§™Ð…JvÒîº~ý©üyáçOŽ4Èuâù[ÌSauÇ÷©R~€ ö Ú÷áÉAý·a©i®xÇ’³¯çÔ u¯ÇŸ€à6~(Hí¥,jv ”oî–Ãø‘Q?ïÙ;[ýí¤Ú<ú‹{ñmŸø H¿Ê½š•0“Ö­ð¿ó<=|7Ó<åÀž]SXÕK}¨Ü×2cÄpª½G 8é YÎnNíšÆ *É¢Š*J (¢€ (¢€ (¢€ (¢€ (¢€ (¢€ (¢€ (¢€?ÿÙntHash-2.2.0/ntHashIterator.hpp000066400000000000000000000065561371554176300164400ustar00rootroot00000000000000#ifndef NTHASH__ITERATOR_H #define NTHASH__ITERATOR_H 1 #include #include #include "nthash.hpp" /** * Iterate over hash values for k-mers in a * given DNA sequence. * * This implementation uses ntHash * function to efficiently calculate * hash values for successive k-mers. */ class ntHashIterator { public: /** * Default constructor. Creates an iterator pointing to * the end of the iterator range. */ ntHashIterator(): m_hVec(NULL), m_pos(std::numeric_limits::max()) {} /** * Constructor. * @param seq address of DNA sequence to be hashed * @param k k-mer size * @param h number of hashes */ ntHashIterator(const std::string& seq, unsigned h, unsigned k, size_t pos = 0): m_seq(seq), m_h(h), m_k(k), m_hVec(new uint64_t[h]), m_pos(pos) { init(); } /** Copy constructor */ ntHashIterator(const ntHashIterator &nth) { m_seq = nth.m_seq; m_h = nth.m_h; m_k = nth.m_k; m_hVec = new uint64_t[m_h]; for (unsigned i=0; i m_seq.length()) { m_pos = std::numeric_limits::max(); return; } unsigned locN=0; while (m_pos= m_seq.length()-m_k+1) m_pos = std::numeric_limits::max(); } /** Advance iterator right to the next valid k-mer */ void next() { ++m_pos; if (m_pos >= m_seq.length()-m_k+1) { m_pos = std::numeric_limits::max(); return; } if(seedTab[(unsigned char)(m_seq.at(m_pos+m_k-1))]==seedN) { m_pos+=m_k; init(); } else NTMC64(m_seq.at(m_pos-1), m_seq.at(m_pos-1+m_k), m_k, m_h, m_fhVal, m_rhVal, m_hVec); } size_t pos() const{ return m_pos; } /** get pointer to hash values for current k-mer */ const uint64_t* operator*() const { return m_hVec; } /** test equality with another iterator */ bool operator==(const ntHashIterator& it) const { return m_pos == it.m_pos; } /** test inequality with another iterator */ bool operator!=(const ntHashIterator& it) const { return !(*this == it); } /** pre-increment operator */ ntHashIterator& operator++() { next(); return *this; } /** iterator pointing to one past last element */ static const ntHashIterator end() { return ntHashIterator(); } /** destructor */ ~ntHashIterator() { if(m_hVec!=NULL) delete [] m_hVec; } private: /** DNA sequence */ std::string m_seq; /** number of hashes */ unsigned m_h; /** k-mer size */ unsigned m_k; /** hash values */ uint64_t *m_hVec; /** position of current k-mer */ size_t m_pos; /** forward-strand k-mer hash value */ uint64_t m_fhVal; /** reverse-complement k-mer hash value */ uint64_t m_rhVal; }; #endif ntHash-2.2.0/nthash-logo.png000066400000000000000000002364341371554176300157210ustar00rootroot00000000000000‰PNG  IHDRNß×îðiCCPICC Profile8UÝoÛT?‰o\¤? ±Ž‹¯US[¹­ÆI“¥éB¹ÍØ*¤ÉunS×6¶ÓmUŸöo ø€²xB Äö²í´ISAÕ$¤=tÚ@h“ö‚ªp®¯S»]Ƹ‘¯9çw>ïÑ5@ÇWšã˜I`Þò]5Ÿ‘Ÿ˜–;V! ÏA'ô@§¦{Nº\..Æ…GÖÃ_!ÁÞ7ÚëÿsuV©§$žBlW=}ñi€”©;® ÞFùð)ßAÜñ<â.&ˆXax–ã,Ã38Sê(b–‹¤×µ*â%Äý31ùl ó‚µ#O-êºÌzQvíšaÒXºOPÿÏ5o6Zñzñéòæ&â»Õ^wÇÔ®k¹IÄ/#¾æø&ñ½Æ\%x/@ò™š{¤ÂùÉ7ëSï Þ‰¸jø…©P¾hÍ”&¸mryÎ>ª†œkº7Š=ƒߪÓB‘ç#@•fs¬_ˆ{ë±Ð¿0î-LæZ~ë£%îGpßÓÆËˆ{èÚêÏYX¦f^åþ…+Ž_sÖ-³Tä>‰D½ Æ@îקƸ-9àã!r[2]3ŽBþ’c³ˆ¹‘ónC­„œš›Ës?ä>µ*¡ÏÔ®ª–e½D|Ž%4 `à î:X°2¨‡ ¾pQSL”PÔR”‰§aeíyå€ÃqĘ ¬×™5FiÏáî„›t…ìÇç )’Cd˜Œ€LÞ$o‘Ã$‹ÒrpÓ¶‹ÏbÝÙôó>4Ð+ãƒÌ¹žF_ï¬{ÒЯô÷kû‘œi+ŸxÀô˜ñú¯.ý°+ò±B.¼{³ëêL<©¿©Û©õÔ î«©µˆ‘ú=µ†¿UHcnfÑ<>F‡Ë ^Ãe||ÐpÿyvŒ·%bÍ:×iX'襇%8ÛI•ß”?•å å¼rw[—ÛvIøTøVøQøNø^ødá’pYøI¸"|#\ŒÕãçcóìƒz[Õ2M»^S0¥Œ´[zIÊJ/H¯HÅÈŸÔ- IcÒÔìÞ<·x¼x-œÀ½ÕÕö±8¯‚ZNxA‡-8³mþCkÒK†HaÛÔ³Yn1Äœ˜Ó ‹{ÅqHg¸•Ÿ¸u#¸ç¶Lþ˜ hŒ¯s ˜:6«Ìz!Ðy@}zÚgí¨íœqÙº/ïS”×å4~ª¨\°ôÁ~Y3M9Py²K=ê.Ðê °ï ¿¢¨Á÷-±óz$óß8ôÞY7"Ùtàk ûµHÖ‡wⳟ\8 7Ü…ðÎO$~ðjû÷ñ]¼›n5›ð¾êø`ããfóŸåfsãKô¿pÉüYqxµá†xeXIfMM*JR(‡iZHH N §šõ pHYs  šœ:iTXtXML:com.adobe.xmp 1 2 334 272 ñ O@IDATxì½çwGšæù^\Ü ïHÐ{ŠEI”·%©Œª¤ª63=íª»wv§wúìÎîÙž³söË~˜³šî™s¦§vgÛUow•ªËªËµJŽr%‘=A‚ @‚„·×ï$@@R¢ª3€¼™ùfÆ“o¼.b’Eé¥@˜ä±XlöÚ>?œ7{p‰¾Žpñ…õ©ŒÏ —÷yás—²®Ã—_X—Ê„¯«r•JÙâñŠ•KE‹'’¬ÙgmîŒ[©X´D’}¥92qž2ü=hÇ¿Â1+Š–J¥¬T*Y"‘PA—|¶ËÖ–C/”ë–s^Töðd]¬£úcª"||±üpÞµ.éëðeýZùÚÖzam_öFu‡/vŽÏók_>»6ø}­}»œ¥RÁjjj,Ÿ/X¹\Hã["žpÛSšä•Ëe·$qŽÅܶPªCå´¾¶Úå˄۠¼(EX.ªŸóåž•¿__IÿzIç‡ëX¸Þ¿V=á2Ú¾˜„Ë/¬ÓŸëËøu¸œîMùZJ•˜ÍJ–g©«ËÀe–¬&•´Bž5 ãèÄ$§VÒ¸ÕÖÖV¹É¢UÀÕõTŸ8Mq˜ZŠpªÊ×¶¿Ž®ïÛâÛnS´Q`9ˆ€s9ÔZBYß9ý:|Êbyáã~Û—ÓZ N ;½öæùóÃçùmìZçøã*¯2á}_‡Ö>ß×£µß— oë¿ì`­¦6 è•(Vâ^Å–­ïìy{kÿ~;qâ„ ¹aw*·¦¦&Û±}»=þøc¶yËf«PÇôLÞ¤ÿÀäóy¨º®®æ:•ncx[Ç¢Q`©ˆ†êK¥ÔËy`Pqm{9›¶KÊ_ØÖ±ð¼py¿í×ásužòý1íûv,Ì Ÿçi­|¿¯ó•|ÚÖ1¿hÿFIçÎqœ§Y´t]š¡zÑFFFíµ×^³—ôCkii±®Õ«lÛ¶ml7[>7c'Ož°ãGÚÔÔ”=ôЃöµ_ùëZ³ÖJ ðÌÌŒe³Y·N§Óó›±8éiüübÑ^D¥R Î¥Rj‰å¤mÏ -ñtWl1`ºÖù¡0°…¯¯s^aÝáýðv¸ÎÅ®íË.¬ß—õǵ¿XÕf%•‰#ËÌåòÖÓÓcþçnƒƒƒöüóÏÛ¾ðyËf2®œ~Š…¼%—ò9ûÅ/^±W^yÅÆÆ'ì·~çwmߺûL¢H _×µM Éuæ%À~6Yi”" ,—p.—b7(ï;®_߀nPÝ< XXV×ð ä¯£<¿øòþ˜öÃíR¾ß÷eÃk<|~¸m‡ùºüÚW_—ŽùE•›ž¶Þó=öo|Ã2™¬ý7ÿê_Ùº  ¶Ô‰)ı h¥*0 æ%kkìüÙ³öƒ¾l§»ÏÚ /~Õžyæ†ü…à8ê®Ç°ß_WmQÒþ¼çz̵¥kU‡}ñK_²wíĦ3ciÀ² 7ªÏ—–dCÛevšSY³öÛ±mƒ=ýôSvæÌiûη¿m£cã6…mhsS£»†ƒpÑÔ9@}û¢uDåR ÎåRìªòw5—æm‚\ø:·1¯du'DÀdÒ>Çlb|Òz{{­¿¿ß.]ºÈ á8ÛÛÛlýúõ¶vM—Õ74àICø4dˆ1±Wª³Z‚ë†à ©¢si”çòßà…ëY¼”š”ÓZ`铸fo Žspðнò?³u79ÿógŸyÆ:ÚZœÜrIc¬H°ŒD"b1¢ó’´0o^[¿ã¹OÕì¹O§>Íçç>ÿyÛ{÷0LJ2‚di@°¡Š(Çbq¼¸·8ãtÉ7]=bÌ©C¦FÅ`Ì&R1>0)†ôeÀsð•8@,A-‰ûÖ­û[ÊîHôQ`Ùˆ€sÙ$[p‚"×%g¹uÑŠØÇÐÄœ9ÀÂuaXÁB¡Õ¥ë(ƒ’$W´ï~÷ûöÍÿïoì©§ž²¿ú¢mݾ2Óp]DE/£aÎÜWkG‹µ¶?lwï¹ÛvìÜeñ—nÙ¦ûõ_ÿ5À³Ö¸Wµæ*ÐTcfÛºànã®Î…kE2jnj¶‘¡K‹k®àRIûü&¶P\§c‘ŠótÜ'®š2\Bðƒ¾1½½E8lþÄÑgj+–¬älb个ˆÄ ª/pߤVgö¤Û 4à·Y”¥ˆK¤@œK$ÔâÅÈê/Ç\XN²0Š*ÂOœ›®IbR3IçMØŸüÉ´·ß~×þý¿ÿßlë¶-ë­A[Ü·’àU÷­»WÒZç}r”ÐU£ôËBê8æ—åv>ÙûPç`Ò=g;¤oA¤’ÏɆ’Œ3Å÷ W¦3K[ž€Ëük{ÿ£ìßþ/ÿÎî¾÷n¢þÔZžá»î+³š bO–Ë\Y¿í¸­r*a“ÌîûïµÍ;¶3ÌÛÇi7d/K Í5ŠÅ<`ƒÒÉý©UAkµ¥mµøêVGoåo8=xª~qàÍö DRÎÒ X —³À}O#–[ėֹ¦H>Ÿ›‚‚åx†OIM@щÊ´<\|ûëN"úøÞ/ÀC U¢6XD‡(E¸9 DçÍÑoŽ®â\ªýS¡Ž«8’ ¸IØN®˜°÷´þäÇöGÿýÛžöÙ_2¹d"­@@ŽR‰L­áª   –ùÉ«v÷έvÿž]¶sóF«oluñ)Ç'ÄF0¦nÎn•H­ZˆÚ¯6tñ»e¹KœˆÀ®¼ æCùX­ N—m Bí¹`¯ø±}pê¬Uêê-ݼښ»ùîH[ÎÄl0>:EÂÎUP"Õe –­ä­ohÀºÿñ]k«G><Ðc]ø¾;¾ž¡¥ˆFÞ¨û­Þ·>$þö’æ–ÝyTÑ/3"à¼É§È é’ã(µR§”.B‰Ž™Àذ‚ÙL%QK4 ³ýìu{ìÙ¬j´¿þîvèØi…Ójê\k©5;bÖz’w"çè24­CFÏMZalØÞ<Øm|Ôm{·o´GîÙ†\ò,y®!ûG™é®=â´´ÓA³nb„¹J/  4%¶ÐZûR^¥š-Þ´Ê~þÁIεwùxLõ«·Zº¥ƒØ›)ä›u”­ØÖqlÇãÐ3!EIpÖ´$­¾©Ý¦†ú,‡ãL¦áT 9×äs%ofà8O÷d¢Ÿˆ+¦@œ+&çãBÒ2!‹ï›Õ]Ççèð©tÂÎö Zß•1K­ÎÙÿñ¿²¡É²eZºÍ,¾ÖJé,{S6My©3R™z8Õ)4häáªZãM ÚþOÚǰ‰Ë¬±©Єã„‹#ÏÓ¼ã®!2ã©b¤ÎYÈTÆìÎMb™§ P݂ƻoxÒŽïÇÖºn£5t®·l=³A‡i8E¼ÎLá ÀÇ Řa£Yfþõ ŠÃ)¤<®Ê ¿“€rº¾ÁâÅf”G%G©ÖŒ­hRL—Ü­ê^?…û]&y¢âŸ DÀy“i¶zTªÖ§]a–ãÀ´!ïÆ. Yïå?Õc k1?Z½ È¢Ƹ†©!*h†¤$‘Åa Ì<‘‚JhŒ+¬á¦F‰ì+f+Ý´Öê)?|òmkom·Ö¶¢§s=8º)¡€Š \ È4-hᢙÁ¡[ùë¹N¿öuk_œøª ›lb`ÜZ:V£ÝAÎ9™³d6…ɰX‰¯h~œ{É;‘Gœ{’ù’À°({OÀ7ç†Ày&Å–q"±¡‘+¶y &]вÌP].šîÏ=0qáAÒ®Ëò ‹Ö–@8—@¤ë¿y½ŽWB£ž ÁMçW=4:aÙÆ6kYµž!f§cø­ÎŸDdJ$í{ ¼`§)4¬A1Ru5ÌM©à¡Hè1ä ©º¬uu5XKk AKá¼*hžP8TD,ÒÂE²®wŸ·ò˜ã6¹?iþe›)åW-6œ9Dih‘@,‘›ÓWÑÆ4 挓õz÷!5ÎÉk(ÕàD%ÈAB¢…d¦€­-G}DDwÏhzª|Šd¸•$êú„)çM<è’8«]°º“)+ÊÀˆ›¡3à@Ÿ¶¾þK(E𬡵ÃFéü±™Åi+ON[-šõ†Û“Ä™œCJ‰ ’\ÇóïT5nj‰)†ã1¶¥YŸž´Ææu–Â.TÀ)/qgø,2Ôõ&Iׂ7A„%žºãÔiµp“kð†:M,7Žål8cv±ïœlýmõêN&o[…¡|Úšê,Ãüëq}hvžC¾ç¦¡ÝåÞ³v¥÷´M _Fm¿ù{¿mØmbB4%›Mäž9”>“¸Yj‘æ\¶‰«ˆÉÙØ€wÍ8ã ÍÁ››¶­:ìóO?jßù΀Ârm1$((ˆ8.qº#•ë€-Œám Üd zðœŽ×»Vp–õ»7vl°‰Ú6›©‰¡×W;qœJ˜b WÔ0å™>HqäÁëÇå×·¢„’î¾T!*>åsøºK“ ç.ÀT­>­ èåó¢uD¥R Î¥Rêšåè‚ü« Î%/C£ch¢@ôŸ=w‚¹p›[íË/~ÕæÖFDn?Ý}ÎΜ뱑±I@3gã“p¨gô] çØˆLtÏ]ÛlóÚÕ¶au»óUžÈYÿÀekkow3@úk ´ xÛî˜CPwdà”9Wî&~–Z—k£€¸×µZ)Õb“EA(|*X@2ŽUš¤øšÀ\´†ëIdÅé¤ÑÀó±QàãÊ#Y¤ù8)>|”YSÛNÉPý@ÝÝkõÞD…à‰ÍjÕÃÑ*¢À )ç ItƒA/œ-¤ÝÙî—§˜²½Ôdc}‡¥ .OÛ/ö¿m‡Oœ1lÚyŠÈG5x¥[™hŒó4î Ð×sÑŽê¶F"œß»k»=÷ô¶¦³Þ®Ày¶¶#¬õÃn™/±-ñÀže茒«‚‹i±Œ×Üy ®;ÁGFLºãÚˆŠÊV>ûŠvƒkþ …òàÞg&gÀRŽ¢1¬j4«´‡¬˜8ù'2÷ ‚­Ù§t‡S*jÞH8oÃSqŽQ]³\ÏR `€Kš€£|ý­wì_ßo©ú&«©o!<Óß2•m´¿ù4¦Jò7×P½„À³µµ“*ÆÝp_¿xë#{ûÀÇöèÃÚ±³öäý;Ýh$.ÐN¸Pv³÷5>Ës†~híóovíëóõ_«>¼BcÅIÊ2 §Ç%ˆ9÷ ·-¿tÖ) ³AÀ’ã2qàc"-Z™ðyú¸(bRŠu v­ƒBoü×9Çû¦ëxþ_íá™ ÖWÓH%¢QàZˆ€óZ”YF¾º ’ºŸƒËjÆì¾rÙ‘yMOï4â¯YSû*K`Øž&'Æl­p6“uK-Se”ð’$OÔ#aEž@Åâ#Waß8ŠmçO¨côR¯ýÚ—žÒ¥]ÿhÎ)c|«‚Ëýz[ìØróOE´ç?Jn"à¼IR^OÊ ½tÑMù BÀ¡ü!o[;î‘íxüàB˜ËÛÆ-lÛŽ­¶iãFNœfSch¸©Ž¯ÉÈúûú­gÎt³œ$Œ:êmt hí­(X¤dšÏqÞä Þàô0`†‹^+ß—h+:{-žSÙTÞ’…a›ƒFã(Á˜Ý“)½äƒ_‡EA¦®͘fnÊan495Mlžhï²ÑÁaÂÍù8¯€(Ć8gÁRÏÄïøµËÐÎl†oZ´Ž(pC DÀyC-¯€º¡S~%)70§‘¹à•¡!v†ê†«Í-Í †ð€¦4ëÞ‹3Â,ihðŠå¦&­ÿü9»pú¸øè}ÇyfÀÅV¦Ò¡»À2à8uå¹$ó€5—{gl©]âcLs±u]—=ûèÌ!Tï@r†PzŠ(%»U”åpë@¸G}‹°Ñ‚VšÜŠñR¾Ë‰ Q$~ 1Ê4iá5œ#Ž ézUÖÜí:(vÕé`”" ,™p.™T×*tAu?[Ú`’ÔG%¬aVÊ¡ÑI†á#62ÑÇôµØwÖØÚÎÛ±c³­!HÇš5k-ÃÐ\œc’ñ{ ĘÁ~ŒáûåK—¬ûÌi»p¾ÇΟ;k?þÉÐ4côŸzŠº]ÐbwE]3¸vuwñÕ\“?~ s՞ŸPå‹'ŽóEI¢ÔÉ “TœÑ\h#`çf‡Çß\—Ôf ŠåVŇÈiÇÑÀkЮ;Ncÿ !ˆQŠ–žMɈª®ì8M=ÒÚ¨Ê%PKgF)¢À< DÀ9ËÝQ× P(è€ánl—a…4z’!gš"âûF ÙŸ}öó¶eÛ7›bõÊo[5 h•b-ÞD¬Ibm·­³ÒcØØØ˜=Êï¾k¯¼òŠmÞ°–Þ8H 9Ì…û®TµþÙmrµŽ›]-¸=˜ üjJ'øÔA€Cêl£7ÀijX#(‡b‹:ê¨íz+‘¥óev$…ÛA#_ ~ç ºË J¿î>)çàÚ?µph;¢ÀÒ)çÒiµhÉy¸%17.qùU2$ÏÏLÚçž|Ô¾þ»¿oMMY ¾ÕÿQ ápŠ»Ò¾¦¿•ˆ4œ2Îu†ý 2RÆ·<úˆí¼kЦ Ì’®¸6 $T~aº Ä)³ðœÛ±U;B)"ŸÃ¡g‰µ™‚“”7´ã„9f:å”s Ðø=F(îêõÄ|˜ÐK®­’gºÙ<VÙ‡¦ë2îCänYÇ´1 žUð µ#ÚŒ(° DÀ¹j-ZÖ£Ñ< JÒƒÑ!Úudy ™´í„Ël"”Za¸d™’ 5eì-£n§@4¦|€B²: 9Knâ6¹HI)k[6®·tøñÍ"Ãl+ç–oæìÑOg÷Iq×3šµPÔÄt5à`·JÙd–±DÐ@\ÊÁ#ÑHÜñ‹î£Ä¶ÀxÇ™æùø¤øÐÈÉ@ANÒõÌáDýºŽèéÐV+Á)yjÇBתèç³EpÏûlµüŽi­ï~ZÓCµªnº]¶SpŽ‹„›J©cÈ!ÜåSà¸ÂÁ Š’É9À<@–²PqZ%@µ†ÄÂTûø%äzygr£ zmºkÃC› ! E<lã3pœuMÌ3Ô`Ä™øýôD@Z±é©²(È1SghFK>3–ªʳ$Ú±ZDYl;¥]wôc‡U°”fâJD"s0}”òÄ=÷#We§w­¢æ|6(ç-{NBK±CÂÏj?ÕnAcre²¤‰$ßõZsM‘›ÄݰDá<(â8+º¸àQî–@)@*[ÇÀÜHÃÍ!k³ 17å`hjPr.-*wD—WÃIyŸprœžî‰EÀ9§ˆØ×Î2‰Ýù¾>dö΋—¯ØØdÞ†Æ&‚*ÒZòâŒÒ'J)÷‘wUÎ}3žTëW¯²5̹´~õjË!ÍQq’é•u»¢™ž#?× ˆð)Üø'Lçèr·—pÞ úºJEUpRÿt ¨|’†Ÿ±ê|:¦{ÈÓ¹Ëò­F8'œÆà·À äÄÃWMX&¹]­ãFáDÉ«»JÕfmffÊÆ‰7ÙÜÜpQ‡ Áµôë9º¹œêÖ§„¾=úPÈ«I ©”gÿÂàê¿hÿé/ÿÚ&fà¤!@‘¡ºæTRÈ9/=¡€É}jÖ`)ÆFóvixÚŽžì#2Rº0–_¿ºN“(û§³‡å:0ëî䎻ýˆêAòëên´Š(°$ DÀ¹$2]§€+àm‚BÕžèréóÉÞ0Ò¤kÊ„Œt~gY€”chzôÔi;}îðÝFS^aÖF¹v¶¶Ú¶Í[°ÙlÆýÐ<Êq8V€X6Ž‚+ßñ¿@=pj=‰ûd-fXSpàÎ ™B±ÓŒ[ªâlÖcØ.s+ùí+<ŸŒýKpàÓ„èÓ$^“uaó/LÔ¹×b…)7‡Ñ#î > ú‚…>,úTyà¬>ª;žnQï< DÀy³ÏÄuÊ 3†AÌåð#3$ÛK ^Š!¶:þ 1cÌ«súlíç í°iêid¸©h?S“toM ̰SJ$wUK»=úÈÃvϽw3Y ©¹w˜‚ÃEºÙ{ø„ÏwfFܯ8Бáa ª'6n±†–6âiÜÐ']9ñˆ5(ÉÒÙ:Ö¦×;P"àÉàåK6t±úÂÅV®‚­¡Èp«bˆgu H#à5õt¢Q`刀så´ãÌpœÛvXꆣRB¨Õj*”=#ø¢ˆ×Ðwø²]a²±tƒÕà£]GX¹ ý4LÍ4ÁaleR²¾Îrx¾0`½ß}ÙÞ<ð¾=tßgö­¡¬…›º‡Oîä0Ç©mÍ>ɤ™Y*›šš™ÅrÐNÔy厌Ük¹¿4J´<¢ .ÖP½/Ï"‘W@ÙFДµÈ6w`ÓZœ·³ÇÛØ`yˆš½ÀÔ= BõŒªÏI„Sš{lÁ~ôQ` ˆ€s Dº^‘`è7Wb¶VtZõ®€ŠìþÒw¿oÌähÉZÂÊ52)YÆ U³òH7¢]– ç0CRtó<A†/´¢Â´Â M?aÎÙÅSGíÙ'ýLõ{œ‹(Ü4CïI¢DM2—ÒÉSgœF\Ãô¦&èÀ‡¦ÛN}„jjZPò †ûžfzà”k9üø ý.Ø¥Þ󖆳W„|q£i\W3„ì«e";7¹T ¤É³OgîE[V@8W@´žR5ÌV9uY17Ò¤gêáª&s6EüÈF†¤ë7l¶ÍÛwX#÷ˀ•ÑqÜ2G]”¤æGŠ|Ô°n¿ç‚õVìbÏY;{æ(@3fÓÌA.üg‰ã=$×€:ù&÷,ûËÆ¦V”9Ì'¿aƒ­#¼^î;Epgç. Öih_„ Õ·(‰ÒHë14îŠKÚ‹\¸”›¶a†ëÇ>´¦ ^ÛÑjmȆ!a0D×…£QàR Î[HÌ«ª€b”­(ç8¦ÊœLs§=úì—­¡cu÷]´Ÿ¿ó¡õ2DA^YÏ|D5p¢5LP†Ó.!ã;‹ÆùÝNX-Ãü-k»lǽYq|ÐÉôFaçœmçÏž¶‰!æm‚Æ„—ã‚üó!âÓuMfI<1ªŽRD%S Î%“êú˜ — @ÔåÈÀĦ ®eøXðÐËiJ\qaÈè‣_¸L7.CY9TŠCÓL;1Æ´EâVÊ,GrÐDMÆÍ3ˆ€“÷[¿ ,ÂÍû„¶Õ ËÕ&qÅJÚˆÊþòËÏ=iÿÝý;»i0‚µ÷Tʉ,¥Ðqú ˆ>¶q$²¦V\U‘ Çâ­vß݉¨ôŒ9ü‘}ÿ;/aŠÄI hjÆKÑÈÑ–óÙT-î×ïUw¢UD%S §,™T×(èz³Ž]R[®[ª·V³`²Ü¼ê) ¸å·žc¨*>Uf›Švs )p ¸/K p¨ÑxÄ€)oM­Ã\©(—M†õcÓºœKž³óûwÒ: äO'ßÄ6S†þ]hÀcE”\xaoRzÅØŽ3o<µÕð1Iè8…œ3Á°<ýRpãiÞ^ù¢+¬\ y\Rù­"@tRBN= ž¿QŠ(pK)ç-!ç|ÐTGÕ|ê:·*Âü¨D[kNP|Nun¡†ä’û•Xbšîã÷A- 3›¤8P@Æq¡®­UÀÅÿ=‡’’çêžÚÖúNR¥O¾mš˜.‡r¨‹á¹¦Åà™*ƒè÷J¼zœ{?aÔɧʇC4”¼³F.©Ð)»¦øPE?BcĤmSä—0ã “ü2ZyÇnº3uö‚EçE)¢À ( ÕW@´¹SÔ•‚a¹º¡ëŠü„ˆùÄ5Ñ¡+¸ØÈ±I¸ª ó‚'kðÏÖ"ΔãÌ^æâpªÖ œemRf9¦œÕáÂÄ}Å™`)¤5Ãz…‡Áª;a˜Î]ºäÁ\œ§µoˆ?•ßÄ|Kq)À˜°Nãõ`Úq×ÌÀ&bj¨-§ÊºDžû(±£ù„‚ܲÍÂãØÀ*tss³+*Ï"I8çh០‡hj?”çΊ~" ܘpÞ˜F7(1×ñh†J øtÉg#î“Eq‘ ?K€Hhõu`ˆ%LWÞŠã©@ËL Ê 33]@® ßUâQ©³Ç$óÓð/ ^¶–u ±'«2D5ÁƒÕh„ö oª j›Ú¨ä³ÿô5ë60Ëç4štâqâ[>E|Ît5@³nÇ}côCr>È„AG.ŒI_¤4bÈ3gð²ªÅ)@óÒËSr_É9ÙðÎ=«Y ªŽ~# ,‹p.‹\‹÷ÅÐaÉÞ”dg©`Å8V[{K“e‘Å%à(SqÂÂ32™ŸÂ_{Ȧð³Nƒ+±hiM[= ¢ 1ÂÐ <§&5;n›ãS61:h“ØtŽ]>Ox¹a3€S@ ˜Öe¸f bxFÍ5Æý„<—¹â-qJª5\sÐq‡(¹à$eƒ ¾!Â,h8ç¼£êp¯ŒcËZC¨<§Ë¡†@sr©Ýn¡^É0©‰ûâ~Ã$tÝ"®Aµ°ée>@Íè#º56`ãÊ9Šs*uõTת)Jn–pÞ$Õ§=hx°t½V+¯!…x­6€³†Hæ±É!K«³ %¯ÌØÝºl׎]¶qÍ*ëD#Ü”eÈJ¥â¸\ýœ,¦ ³Md¡²¼h}½ö—ÿåvéR¿•w猪Ôrº®;Oè ‡µ’ö•‚ãÁ–ËXÑ¿–N–LÒ]*øQ¬(@BÔƒû“¬Òщ/In:g.\°uë70—fYRvIÌIÅ÷Ð ÀÎ:K§³Ìà yp ŽU“ßU0l—™Ò0¾ªX*ã·>64lí«˜‚mhõúX)Üœ¬Ô5XbƒãÚ Z¥¼(EX:"à\:­®Y2è€þ°ïâû0!ýÒL:Æ`Ü2È%W5×[ßå>ÌiJ¶ ýÊŸÃð»Ñ:Zꬔ=8¸Ù…ÄÄÝTCÉb;kߺÚ&:ëí­WÖØÈРã¨nU"k~›\·ågö:B=5BIhWmAЫ³ŽWõCEXË1¸æþËC¶u×^« ð,s| Ü{…Ž&§Ó”º1Àgö‘EΙP˜8@69–ê—Œ¸™fŠ(ñ ø1†¯¿BÓɤIÓgÄ$1‚MRÓ>1긋E?¿„ˆ€ó&ª`¢ A×T€(W†ìt~i5pH­ ‡Cê?o¿ò•¯ØcÝÏ<àfu<=§}–¹8E…—sµ¢è=ÒS†îÓÊ\©­!mÍY»ÔwÞ•âjp¨ )W%µéö¤ù5û=QEÛD°—¸-i¸aá&S9a.¡)’ðyÏZï%üöÇjÏ`£¥xœ3°Ö¢Gy¥\*[ëÓ¶uÝÛ¾a-±I-ËW¦6EÈ=Sbè?FÔ¤"å[‰/bII—í«ð×ߺÛðmSæì_"ZGXëeK:1*4ŸáîèAC%*Fs¢\W-¬PgK=óätØsOÜo„š„Ãëत,’?¶I j!ƒo:Æì–pNÒΗ¨KeãŒå5Uă‡œïv P—Vi®=ש¶Ì‡‡ù{óïbù{ªm^º0ÿ’G*•0Òf Y¦>úœé½h'zúí¯ì·±Ê{V@އ>©t–)5ÌÆ?NTÓýá¿®!ùùÁ;x´ÇÐ¥mìê°{vn·»¶o¶Î61mCãÓ.š| Zz]‹Wçu%Q‰k é8â ]n¬îZýDX>"à\>Í=ÃwG72ô\'@!¢Œ‚Ói¥^ÓÞdçNÀ°9è0Q£–3=õÂ[Á5J©#ÛNiS$Ë“ŒT3eJs\衧 á\ׯí²W_}Ý™á4Ái‰Qu*"Älš“g*ËòëÙb+Øðu¸µ~ªDB;ú…éã^Ä5sÿp““…˜ëî±Ú–NË¥ bÒº/¨¬Nôà€(jB­ ¥d#óÑã^©i°4‘¥frãv gÀv÷YÇ›ïÙSÞo;7v1ÿÐ8Y5Ö±ª«â뫪̘Üó Ç%‰>\#Õ²9Z¸è'¢À2( ^”n1n}Ó™ÄÈ/» €J¼cËFæT'XrÎ,Hw\dÙi‚¤yF.'.ÉÁNP‰›ñ÷ ¼u¬„ñ{}}ƒÎ^Æç[Ü” hQ,ÏñºèYL»Åwº|x›<4GØì%§ |ÆÍ¦i÷És½€ Þ= L“·8倪iKpŸ°žøð'l9åØ4ÑßqOglZÝÕ¶ë­Ò¸Êú&Êö½Ÿï·—~ø3;x䨵­Zm à¦üûñÀ‚}×ÇD©ŠéÁNôQà&)çMP}2àçæwKq9¿ÅQ‰ktA‡Ñ.7Ó±%“g\¥$žC6”qCÃt€S6nª8Oï²G>X–º€‰'묡© #ð”]¼x‘“¹¢]»:dZ´P×Òþ\KçïéøÊõÌU:ŸÃ£B¹ÀKòJÝÇ(Š!M¢éBŠ1‚cŸšdI¼$Í'>ƒE?–TaÒekF–)ó­"^A¢6Rc+%1cʶ[º¥Ëq¢;ÍdwÝ.¦§Är2ˆIO¤)Çdr¦>$ÁÇäVÝ÷ʨõËAh¨~SÏ1è„Ð ÍmyHÕpQrNÅ”¸­éZÃÔ5n~í;…€ T’½£ò$Ó”·Ó®“ò“¡;\gÅH Sžæ­9àT®Á¶–4=®…[ç.vÓ?a jŸŸ´ÃEr¯^kàÊ›bÚ‹6"Ûçá>ËL²˜ée9÷Â=c´Y‡Z-ï\4BL6­I¦VFŒL¸Ì 1DuÐ! 7Z›š±ÕÐV(­‡Z#ƒyjtÛ‹Ý*ä¿ è+åEXHˆã\H‘e„NW‡ Ä—8%8I¸Ã Ã뮵ëìø‰“®×ª¬ãÊàÆ@¶Å¡j´‰½'PÂÈ;ðJK¬²`À‚ù ôzÂË5!èÔ™nìÉ4åÿ­« ?ÏSÀãÚärƒvÍËp;7ùãP*¸€.,€úˆ«v¾ø4þÃ:í¿>&“£#VƒIQñF0ØjN¬%Y´æøŒ5Ä&­!>…ƒÀ°åG°Ub6ÌiyUMâ¿àL!¦R¢¥3[Ç„mJñZFÕk»ïˆËÕ½´Ð®ÛR»£Q`ˆ8Îmþ)¾3j}uO”Ž'&4d]a®R›6o±“'O”"£J¡¸œÕIŠ ä×o·KЍ÷ÄT2TFëN¸jí"¨ŸÃnQ.†)ÇÍ:Ôtr>ÅùtU¹m^ݹã+Ûª^À!uP¿š»ÊY–²Ð%2Ä8Lj‰2ÆDo÷X=îª%E–âk¥úœ¼SMp•©Z]$hQŠ(°b DÀ¹bÒù}Ï @ÂçjírôCÒ°µ€LOŠŸÍ[·:09ß{ÁVu4£,’]&ÃK…˜C†Y(²3Ì·QrÀxH¶G¦&+Ó:ždúÜ82¦ÎsNÿ¥+ÖÕµÚ ƒ…Aðßàº*ôSm‹ÚsëRrîcQÅ$}44”Ž)š=î>s†áù°µ1ÑZVÿqŒãë™Í2ƒA«@?÷ IÄ|”gÃObÔž N§zLŒÚ‰÷ß&€¢ŽUkmíúºb—'P$!'ÝÀT8Á†ë#CPh@Rî‹AvÐÊ[w×QMÿ´)çM?Ô"nf.yðp<¢ákQÃg†ÚM YkkkcŽôãöðC÷ÂE- ä#‘ôñ`¸2cƒLÛßßw5j#ÃÃÎÇ;#q`I€"ai‚†\ƆñÄ™³öà¾= k J lÓ%xVÇnÎoß\KW¾%œ¬be˜ü]«NÇðqýCìcGŽØ:æzì‰GlÍ–-˜5Z{s.©LZç)3,¹ZJi4Å|ë3ˆ2. \±s˜/ °á>GÑÈœ>âÄõLŸŸ²ŽÆZ[×Ùîž:x…äÁ¬å ;—¬Õ±ÿúz8”·]íRD¥S Î¥Ój‘’~8*ˆ%&dý™¸H†Û’rJƒ¾sÇv;qâ8Ü¡ä$6èºpÅÞûè˜?ÓãT^6›²M”¹‘"Éž3Ïð·ŒbEQÒ'™cýT÷9Ç¥J“î’KÈMp¦RЏ&XjèÍnV¹MW;•ëÒê’‚kâÉ|éjÿ&FÃCöÅgŸ±_ýg¿*[ÿ M”Õiú hWÆfðk‚'ÝgYÞ·ËÀQ;zì¤9zÌΞë±~†ý#W.[n|Èvn¸ËÚ˜ôM´Ñå]]ԪswW?Ú©æW·]FôQ`ˆ€sÄZXTýÜõõÐYç—”8pçr«T¨¸=»ï²¿ûÖ»Œ+aSG§:Ñm¯0Çúñ ƒÎ ¼¾µËjêˆDç®+Ë(¡1/ÈÎàLÕÀ½"Ï+¢mnåü /ÛàÈ´µ0Æ‚Ñq¸I¹a <"n5K­qL—Ë€Dù+Ióî«€ r]6ø¨ÈEœ>Óí̃öܵÃr–©P‘û‚î}LÜB…Š~$“,ÉH“ìKÁUO̽‡Ün{÷m·s.ÚþwÞ±ß?`Ó3¶ÅP}ï,qÛ$ju¢]÷ñ†œ:à8omI :û¡ñ™Ñ:¢À(爴²"‚I0^wÕ¸€¾ Áºukš—íèÙ~9Þk?~ímBÃܾ~+6‰âRÖÛ4l–æÃm 8µ(r’ pb“3½FmLZffŒ¼t ŽnÐ:6­uÇœ–^Ú|¸\q­o¨&xö«Ú>[+Ïxà˜aÕâjréš, ™NÁwŸ=GœÑVÛ¶};WÄý%Ž€öI„!nÑÙ¬²ÖiÛÙfQ/¥ UŸÿ ÞíeGû‰4•µ—¿sŶlX‡ì“ÉÛé8â 5BíP3ú»ÁzéŽè@Ð^mE)¢Àr)çr)*¯ÎéÓì¶6´—´¼M)—Ë9ù¦<}òÈý¤Èiîè²ÿóÿý¶5¬ÙjÉl—µv² Àq¨÷”5 íXÇâD÷AQ âZì;ë1dÏfêa”Eúƒf ’\‹ÌM…Mà952dƒûqam´FÝŸDr&pkÚ ö]+]ïØµÎ‰ò# x DÀé)q›ÖêÄZ¤M¸.–Lg GxÏ®¶á½ÃV»Èœ;õ6…mã¦kìwþù?g d›€A-`š`‰+¤9Iaèݦ >0O"#ÍÚÎ=»í¥o¿dCxã´´´0Üå|€Hó°Ï‚¤qwšÃÑê«*ÊÍe,yK\¬š“0’zdz$S EDÒ`x‚)-ŽžøØz°ß|çà{åÍ7˜~ÌiÛiª@R÷$íz+ÁÛá®W¯^ͲÊq“rДÈÁ}­nt*7iç/œ³Í[¶WS£rè—¨‡ô%ßJT0¢À’)ç’Iµ²‚çÏ\‡V§öà¹uóF«eR¶âð%kL•íW^ü’íƒÓdÍp=gú¾ä™ò0b G†ù y#°{Ф$£ø’mßq2ÑÜ]¯u ,ª ?•í§ÀZ2 Y­Ù+¹?A£Úpz>¹O]I÷X³¡þÀŽèÊ𨠌\¶KØ|öÁ… 2›ãøä¸M¡­ÖŒ<8®†LÚ&LJíB_¿é>c÷`'ê°®Ó±\ÌÛ4j|/|suA×Í$*` Ÿi›ˆÄíö|û.Ø‹_ýšs‡œaîx•ˆ!¬TS`¢];ôªn.tĵé¸e7®¶U¶¡øþýoÛ÷Ø{,ò–’ 4Gx¨ûîÛm¹8Pš ×7sgѹ®E8¯E™[”¯Ž¼XgVž¸Ðµë»lÜæo¼jÛwnÃÓ†¡ë4ðÂv|rÆ>8tÄŽI©“£)Lm4‰™›È „’+c .µ Lá–94Ðg“È9œ8e÷ÀÉ–Åiªœ€-´p–û»¸)y¥$ЧYáG2Nà æW=½=ÜG NøîÀÆجaê©©àˆgFø(“¤ôQŒQ<Ìi+Š%<¡’†:¢*­j…Ë|ž ëìå—_¶×ßø‰ bŽf» czùÀKÆ©’¥h˜îÈýÜF DÀy‰ë«ö:ܹƒ<ü©ù{ìéGíûßÿž?ƒ‰·1zÞŽŸ>k¿xm¿uŸ¿€Ö¼_v8FææY³F18›)†ðÂ¥Rs•ó(JˆkyèÀ[öç>3:b<æ< P »ã0…pBS­\NUí[º¼µ`Jáí$wU€ $ª.@‡ “Æg&íÀGmïý÷©¥—/(2;÷‘Hà=ÅÚýI ¡v`—él5Ùk±àãA[eX_€îÙµ•¹›¾lßøÏf§N²ë7­±¡ÎE” ‹ADW}”<ÍýGkyw•Ž(p} DÀy}úÜö£jÞ)Ñ7¾ñ ëîîfNž²½ü³Wí­÷Û 2ÉŽµëÒÖÙºµxÇoR “3—FðÝ.0%î´ ''fÒÍÚÕ§+6x¢ÇNöXûÞí€CÃ-Q§SÁV4‘òOwÞ îЃ’*î–wKf*γNRÔ8}ÊðdúÊ /Ð~´Þp¿qæ’¾”u#lq‰pŒѤ&Œ‡L[u;ší³Œ,³†‚ãÖÒÐ`Û6opÜç~P°{÷Þ —ŠŒW<.Èðö n/:%¢À )ç It; `Ô ¯¹ƒvïÜmßúÖKÖºz½}ˆßz¶s­mÙ¼Ó*L—;81müÃ⣠q³VÉ®¶ 0šW§ÐŒJĤŒå&0oš¶î#ïÛ»‡NÙý§Ì+kð¤ÉågÜ|ì¬ëÐÉý¦´,-Í‚&Åu–S'O@-¹†æy\üК[p±Ü±“c8!Ogä7p ‹—çÉ€_ª¸Lù¯K6êBâQJÁL剙‚‘iNáóÎü騩®Ã~óÆÍäã©7%ÄŠÒ'J8?QrÏ]ÌuvX%…[ËŽ÷íÝgòŸ¾a—Fmý®{­}Ën;syÌ._±TC³¥Û×2á[€ƒYãã2Ü(±œ!y™i‡™}‡¹ËúSg}ó*ûðÈ f‰üŠeyÞ(X°dž 6]xu'ÎÒSwà‡Ãbc“ ^Ãõ À¨aõ J›l1ë-ã=4í¸K(–ª»dˆRžÔeü½“Àˆ(Iò_¯Ò°Ô£ :°ÿM{ôîH9*’A’4ƒˆì{¨a+ØŒnøC"3­Å*(†9Ô¨ýìÍ÷æ‘¶×>8n߯=²à†èS33ÎÃ'¡¹€hf&DvYc›˜Sh+ZóuL#ÒÙ\oi€XÚù<ÚuqËò"Å(þ ¡zÛ¶e çkXÏ€OO¿^ÁmD§DX"à\¹–_x±Îì9N3N¦,]_ç|±÷Ü·×þþ•w¬½³ËJÙ›‰§Ñ(×£š"6g²Saj”©"M†Ù¹)¼gð2R¸¹Ê¡J1g)btV(#ÎCï½eÝO=l»wl6Mæî©ªdEüJn'€Ôåß—;C\pð/1dž„™}çÈqëž´Vè¾h)¸ßrºÑDi¯‘<í.¢š!ÈG åÎ$€xöÂQ{ó#¶±«Ý¹w·=¼÷.kÍÖå)Op‘Å•Á;}ú¸=þØãpìDšJC38Ø$/I1µWxWÑinH8oH¢[_@܃§l§sÓ ;Óvÿ¾½v×®íÖw©Ïš³˜úä0M*-(c)@ÆPÕ“—ŸÁMqƲÄÔº(}Xgò¶´Ô¨T¹– Ì2væØ0Ãõm÷öM(nP¤0ü•5’l$…£N÷h_I(zݤ‚~ *ÒQYš]bà~àx·eº6[vŠ©†6+8€æÚ€¦&_SظÓY–˜JÉ€ N5ͪ²´§àlŽ«%wÁyW òïðß8?¥p€ 3ƒ’§МÈí…石o¿ü¦Ï=o-kk]°â²Á©¡1Û´ªÑ¾ç!Û¾¡Ó:˜oÏDé…a‚lÇ×¹2Nšš¤L2Óƒ²÷>üÀ¾ü…/ZßvÉ õÖ¦¼²›ÙýëplhŠH€¼d¤ôÅ«JÙÄ ¨`ؾ÷á+½>ÍÌ›ãE<€à¢Vþ¤Ó)êf ©,ù$Û ó%f¢ë´ó©«a®¡é¡ vøäykʼc/<÷°õ]`Š‘!û¾à4íÎø_`®zæuˆs£Cž´ÐX )ZË›M^1kÈýîõqBžl! t]W]GÀªL« |&2"༠éF6MqC(¼Å=ñ^Ê«&'˜{ôþ½(VŽYWG;ò͋ֈ¢ç©Çï4wZÓáH·W8QÑ~ðÈ}ìõòj(^Š1 Fq´fënÛ¸c½þÎA{ú©çÜKî´)(]RNÞè”×ÂÀ`á|µI»JáW;È¿ ³¦`/îÌšp¯Ä6ót÷y{ïàÖºí^Äšæ—¶8E ‹§*­hXXAA–˘‰£O•(ZTnX-I¸¹Qì5ßÅ  1³Q>" ÀoÙ²ÉEB’â(‰ºKÂpr”VD=Éðs¾ª’©c#ëÏP@ªç¬ øþóîÄ™Ý@³ÏF£™”ÍKîbÊÓ¢Çç¾sw¢WîSz6¸(?bLA†ä Ÿ&*{þÙg,ÃPôò™mcsÒþè·¾b¿úÄN[K¡@Ø!ºl†¬%›DŠ82ÊÆºr‰¹¯zí÷÷7íßýÏÿ†gƒp~ŠͽC ›ÌK1d%¾ʸ=ýèƒvéüik">§¦4«e"´<\éØ &8Ì€9ÄËÚOÜÍ7±3çûmøÊ/:3=2„U `iãé8^[o›pç|ï£ÃDM:o{·¯'Þe PBöÈP»Œ@ß ì¹¾3’wýΗ}÷Ò«ÇhË!Ã4úƒì?ÅMˆ¯”\ö篽®L8Â:¸OL…Ü9%¸u6ä.3ù%L¢œi”&T“2ESgL3Ü/1vO"G­¸¡¾\7Ë–eZØk« 1'%…°^À ãSmk×ÐOñAþÒ^ºŠp!w®ZƒC–åqBŽƒ½îîS|Q‹ØëÖãÑ¥âF!)ޯЩsTÒóªV=—ùÙÚŠ€óS}^xÊ uÖ°&…=¢8(f¹e8dv/¡Ø^þa½ýÖ~§m'¤¦D € åÎÑSývàð)ûàd·êpÔB¦³ãw”, “š-Íp7¡ 3c.PÆÈù{ûwm×–õ(ˆ°½„åtÃ)Þlq˜y9N´J'ÉJ9M©¸‡¹N$-ºÜPù(3kï>ÎŒëˆ\?`ñ:¦ù˜à~SŠÛÔdm1i†ÃÀ†TQßÓÜ/ ¨š›šA\‘ÆØ]~ìbƒË€:ÿ ÇgrSÖBÐûQ:o·‰!4ˆ/Ú1?ÕgúÙ¼øõ¾=š¡5ÉÇñ%sca“KЙ³ÄâŒ~¤à“œžgÓ²Útƽ)5Uùw@ ½;ó¯à¾­Wå~vhç§ý¬À ™ô¸Ä»%œÒ^ks£}î©'í?ú=ÿâ׬­£Ã. À|õýìƒc3Y±¶µ¬ެ,#[Ò›O é¤žütî•Y$ üQš·†Ú´½gø…ÇÂó†ˆK\Ó…c“_×Ïì†2HB%'Ë J®^¡UYä4@÷‹W_ÄhÜ2õhö¹6\cye Û5€]u?›€"Sc¶¸Ï2o€} Oœ*-6·\}fcÿrÜ2s±çf&lǽ›‰ Õ…Ùí¤·© â’NMOÕ'£tÛ( wDÏQd–eQ ïZ‰gW8CÞTMé’"Æj¡8å>xÍ­­nT o®û¨¹¯ož{Á~)Yœþ™~k½z—O·)s"qQ,3 ÉyìQûÅoÚÏ~ñ–ÝýГöów>°ýpš™ÎuÖØÑb¼gÞÏb”Ÿ³hûÌ rÁÓiàN€¦Úv+Ž·ØñÞ·÷÷ï·íë»`þ˜ÜŒN‘„KÒ)Xªì[¤Ó¾ŒæÕ. ¥¼Ò¬™ÚÏã'„ÁNî¶÷Þ~ŸöÒyÈpÚ~@Zæ+‰Ò´•&hC#ö™t²,v¤©Lƒ1œ»<:f£ñÏÀEg²MN.ª !r#EØ@ûK6|¹×Ú²IûÜ“[c}Ú)p)Ü4!CAd§ˆ <ǹВÁÝå|ZxÜçGëëS@J Åí—JO©¡QæGˆYø–«ÈÂ"˜ÛJ#¥¢eëëÝ;|„yIdòárªßàyˆªÎÏbŠ€óNxjÌê{$;9½lŠYÙÜÔ`Ï<óœý§?ÿ{ÿÄEëŸ(ZS×F‹×3S$‘’¤ÏòROö÷[irÌ:³¶uÏ[·ºÝVµ7®®ÁÚaPÄǰá|ëÕµöÆkÿhO!?]·q­ã8ó’™jh¬¡´OUXàfÂ5"•4%W”Ù”RŸ8ö± ئ-Û-£iŠ±Ê¬#¸°†òˆ@]Àé‘‹6@Pe%IÀ­4wSþ®Çµo`ІûP 5XC¶ì¸Õ1D¯äqÍ3ƒåZ"!m(ÕKaR¹g5H“À¥°FÀñ³Ý=Éï¼µè*ЛKnlµ—™9PæGþh;ΰ=˜û‰3)LÕ¢³æ×ѹJ?£[¡Þò½ƒ;°Ùan纜Ž{7A­Ý»¤ ~dòÃ~ô¢Ãÿä ;vô”í|?mC“Ø}¤P®L _†3±Ýë;íž§öÚöMk­£m6çS«ûØË”å4Ãy&†Ã¤ç•Ÿ½l¯1dÿúÖߣ‡ÌT…5_PEvI€$ï¿K² £!uJRÀ*Ržø˜‡¾k_ýüÓö¥ç _G´ùºl­5·713´3’êòå\&{ìÔ™sÖÛÎ÷|lM­-¶vÓV[ÓÚe‡ ¼<Å=ÛÐj¥©!ëhHÙãîµ&¬Ê¸c–1=ŠË{…ïJdD¯Ðs|âùÑzYð æ^À9Œs»ú D9¾”H­éO SzÃôÞpœ½$:9¥Ó¼lÿRœ·ø!‡ASU/Ü_Îi³ç exõ ĸ‹ûÌð"~åK_´o~÷§ø¨£uN"¿dΞ\­Ý½¶Óž¹ÿqÛ¶¦ÑpS×i›FÇ G&9¦¾ü²%ÁúÑVuuØ—¾ü¼}ïûß³/¼ðeæ-oCƒ2I ÂH )e¼3LxVß§§n5M‹Å@¨Úi‚Œ<ÿì—ì¡}»Ý¹nŽ#iWŠëàRÑ®®_Õa÷íÙÎ$sSvþ|¯:|Ø>>vÔN}ð®5®Zo÷n¿ËÎö é}€(ö1»4pΞطà¼×iÒk5$W€&—wŠ+³k…ZBf”V@÷rTÏ[@ÃkU¥Ò(ì&™ÊYô×>oYuDΨCJ¼«Ò‚º¯:þÙˈ€óS}f¼ q…n’!é]ÕpÇÙI"ó“"D±*ï»gîŒcÄ~ÂZ1Ù¾i£mß¶Å{€¾|à ï0®‚Ýf­ü.ãÈ ÏÉ Êi=ñæ(`©|ÿCØK?ü>13ØãO=mGNu;mvAl¥Lt}nŒ¹ŽÛ$êR\6™Ò”°1ÖyÆî---{KÛ5Y›“¹r\Ãyq´äMc à·7g¬µq‡íܲÕoÝj¯¼þ¦À8rlÌvíÙgW˜½³ûÌ[Õ˜´'M¹”¦ó;CjêÎò2kÒÇÅM 'm…û(|ªñ3~q½uJZ/8h+R«7"ØJcúQ©`þÆ[&‡ZYeH>-ôÔ”×sµhK‹¯[5ø<²?Ã)Î[üð44¿—¾\ð*ò"‰‹ãÔK¦sµ°4/º¸¿Ž¶&{ü‘ûíðLJ#6ÛóOÞø¬FÄÀža³Ó8²z˜Rô(ð¯^VçgÎË\Ãp\õI]ßÔÈ ˜÷Ù¡Y,Ûlúÿü•åáæòN¶ª iJÊ'Yu¨y›ëyK£®OÂé¥AÎÕí­6%í*²O'÷Ta+%ÉK±ñdœ/»L™#ÅUíhTÎ>ÉlÂöìÞmmíöòON´úíäá÷0rßmÇÇú± hµ][7X†ëÉ^Fïu‰\7X_*Ý¢tsðÀyZxyy‚wº*ÃI+:•ÿ0ë=sEø —¹£Ÿå­8oÃÓ Ë5o¢Î÷Ïû»o2Þ7ŽË8%S”ïïãï³|ígL‘±ë[­Мžž@áÂnN RbXœäå–|T¾ÃJE†ürQ,a0ŸÀLH¦J[áøþï¿ü+;vaÐúpÑl]¿ÑZÐz­ð€&€(èÖ°Kpö!S%„'+þç±1?èîµ<þ䃘 •ËT¤ÓÄQ¨º´8µ»ÐfàPÄç0ŽO¢aט¿6“²רoþ³_'æh½þö›vìлp™yûòçŸ$¬ž”_èÂEaÒoj<ÉýÒF‡¢î£ã²£ŸeS@#8õÄ«” 誺rWkõåxøXdçlž»¶¦02I¸wF@*±‘{y8rU ªZPÿU¥î茛ÎÅiàs¯uïóžÈµ ]'ß×_­G»óªôÇ«b^A ø²Á«ã÷t¦J.,­ü[—Þ:Ç_raÒH—10–]$˜ ˆò²‚I¿ó¿jÿñOþ/{ÿ­×ð,zȲuiâ`bŽ+§)5CëôÒV/SQÌpky­Ñl×`t…LÝDʺîšÖmÁÀ¹†EElòðLjY® .œ¤dÀ8AHjÔ £Ñz¿òóÛÙžnd“í1z‰&NÓ¸9ƒhƒ:”ƒOn@‹uou´AqÍ—$›Ì2âö–¬=÷ôãü„½ôÒ·lß¾ûìaâ’Š«-â•$ÑA-ÊqªágãÚç8 pîJžÌõÎ_ÊÓ_ìü¥œ·’¶ÞŽsBmõ·Ê ^J½¡Aâ1¸ñ\KtŒ£(+Ý{ÊGÚ—+3·å.¡âÚÐâ /vá¹sæoù²>÷zWóenýºú:ú»Xبë_0|–ߨá÷Ôy‹Ï¾ss{׿Îü£á³Ø^°Ë˜‚â~ _[Û>ß×Ⱦû4b§HçV é´ôŒØþ·º3fO Úô•]µ¾·œPåÐx:ðÔ¶@¶Qûeq´î®Í‰×¹Ç~òò?Øy&D“=e’a6ƒã jÔ0¦Ñpw!¹%7•Äà¼ÂP¼Îo ÎsŒózG‘®Ùmkï²|MÑæ3 ÑÚ1L/ÀÁ&PJi¶Z8¿DCö“Y|ɱL{›í{ê)«kk·#ÇN)@;Zv@™!z ?ó òЄ“m²À:N,rk©d(ŸB¾«Y2×ù}û¦õÖŽùÔóÏ=‡ Ý¼¦ÃB©ÙG§n¢%» æð9ä’ò‹ϟ¿ÖSôO]k¿ø§^Ï?sn/|~¸¼ß®–ô»‹­)ruvÀ úßÅJys-YÞ–®è(É:…ë“Ä-”QIw• ‡eæ<ƒË'ÝÍ4Š‘&¬#Œjˆ*é\—ª¸/'š)C‹öçþ\ÙkþÌôR_Ï5O¸m¸=ߘ›»†jùä’ÍÒµZ>—m¸Éôb oe§øÖ{Gìø·ÿ«½ðµ_·oÿý÷uæ®t}Zyù¤¼-$÷ÓÚçÝhíÐw帪ŒŽõJi˜íd”M=ÚÌžÞZQÈüõ7ÿ†ù}úÝðH )‘\åqÃ=xÃÅÝ!ï—'¾`åJ™áú«ï´¶M;lãîû]ÌÌ Ãç6’I8Í4žH™l½Õe²aæL8ÑäVYætÏ44b€ž¥\ÖÚV­µy YéiLz)›e* <€àNË.Q‡§(eNULñºI–ʽÐß :Ê:Úå~;qôc´óûlÏ®]Ô„—“öV]Ê}LX»ËÜø[®‹SzyxQ¾Oü3÷ëðe•w“‰ËÜ‚Z–Ùˆðõá^Јꮿc_ZÑ¢‘ˆ’Þ)wŒ$Q“˜ÁqW,ôdðòµú«„Š]sSW¿3R@G5hy ó„œ+>Wëð˨íð±ùg-}Ï×Q­Ïïήg7ª×[؆¹+©CKï@ûæßþÔ~í7þÐþð_ÿOöÓŸ½¹¦@Ì—#îSâ´ éœàÆþ+9ÿ¥s>áí¹+.+ € òÞ¸q£½øâ‹®¢¿ø‹ÿŸ¹÷Ð먶V+­z³ºdKV±ånãŠmˆql:$”$%$$¤éÉŸB>$ð“„4Ò¡Æ\po¸YÅêÅêÒjW»ÚÝÿyμ³ûîjeÉõûg÷¾÷Þ¹SÏœ9sæÌ™3ŸG—?–ÖÞ“»Â×Å–´á»YôAòÏê@úíÎûŽ›îºEùSbìT !r)æßcá(Çͪ¨'Pr^KLžy4†ÝEcGA0á{08¼wW'jO³9³«»5¾}åb'6픑j,Yã]CÙ»ÐÁL«ìQÀ.ºW•%¹Iín>òÈ#±f 'r^xaL‡Û ±vqð©p¬÷§Á§ŽQ:áž|N6kžÚø:;xå.U…jpõVŽm(~W¤á“®¾¹KJJÚõž¡3B!i Â64ÊÖàG}7]½—·§óë`XÛ_­º–¸ú˜AhÖ¢Z¼êrª•¯}Ò÷¸%¯‘{7¼ù7Ãü°Ÿ·ùŽé7Õôif×S žf&‡ ž’ÄÌ5çZ¢z&2û—õ¯ñµÿýß­‚ÈàXàÓê:ÐŽR÷”Ah]R+¨^àUjÛœz°Â"5{?ígÓ‘xHD<‚@©ë@OÓÕg¿_síµñù/~!.¾èÂ8ûÌ39xb†S/Sû–ª"u22¸íBûãOlŒÿò7¢wìÄXxʩѲËÑL«G±¥e¢ÑÄõX^ m´Â!ŠžûØùƒÁN,Ëïåpµ(«èìˆÞöÝ1qÊܸcéâÅñÆ×]šú§c½ºm3e¦£ÚÒøð¸Ì„8xßëØC›™Æ]÷Ü×\sMœþùY/ëè@¡“p6wÒô|>~šš1›Þú…žCQ¯¡ßžú½¤æo½šqµâqSÃeßÿy¸5½¡ßj~5r Wß½-¸X²FZrœjaж®SZ§²èyhZ‡Â«ä?4ábö;r¹‡nßP•\€·¡šq­ð€Qï_Яú äS}†Þ‡¦Ò£ñ)Ý~Ä«ñk¸z/þù6$I_ÿýó_V?&º1ÇÖƒ5rç…»öîOYÍ”©, Ì@´’fiäú\ó}îï9‹0¾“ã3ÜÎ&1醃\¶lYLÅ Â7¯øVÜpà ±æñq'@N™6.rlŒŸ2n™Ö…øvp¢äª5ëãŠïÿ0îytUÎÅ1ròä˜G­…îV8ˆÑŠà,Ç`©(­ÃÃTõ²XôäÖmp˜»S×r{;å\øéQî ·Ñ:vFìî\Ï*ý×cæ dŸ§-bÐÙÍT«çÔØŸÈC5ˆç~ð(ÎSß¾íɸçžÅ-7Ü”u¹üòËc2er°~î@©ô¹‡ì›Q…gÛ»ÙëÐÎ>$þS¼àN T|~Yl|:„x¹&Òtwñª©ÔOõ}h"Cßkø£¿×AÜ=F fªª¡)‚‚©×r5‚q«x>æÐ§Ã•º)µC#=>…9$ƒZÌz`øâê{¸ý) àä T¯æÍÏUJ( Ú•§þ܆h$cØ‘pD0CšAëêÆR9=}<Ç4ôpl¯Va;#–Èþ¨K¥…ó9ÕŠ†:ÊwãK(ËþßÂV¤Ù¦qûÛîíñøcÅMßÿ>‡³ýwÌ™· &³h3‚…ÉÓ¦Dû¾=œ×³3îyàѸþ®cñù/‹ãO>#ºY=‰Ì6T|FA8ÇMÛi;³so{ìxrGìÞ¾;v¢”ÞÍÖI厽(å«ê4 ™h«á‚Û4g/89¸óÚøØ_}&Þó¶×ǹg³f1mÇøò„q˜­fF§ÑæöÎöXÃ÷»ï¿7–/_§,9)Þú–·bËs\M‰¥\ö F4ûñÌFhßÃ6Ñp^£6ÒàÃ%Q¤…·2ôp'Óx3NR+îMñûÃ6û M´ù[„#> à£AI\ìcá‚`ux½³X~hùjO'±çù½C8káëý( PƒR¿§¬b†«kº5Fõ÷^¯¦ÞkØú^ïÃûâ{ˆ“  ÛO‡vŠiÖûÚ÷APzã“Îhµ¹ˆúõ0Qsès~<ÂOu›ÓÐO$•ˆ´5ˆ¸rÎÖû„ñãì§ŸpB¬Æ>çòk1ž!—¸'6büCYÜ´Ys¢«5³-‰ËNÈ-ÇbW±•4µhäîÕƒ@0÷îÚ‹e¢±kÆ9Tg.fßF{|&ÓwËã0ÕÉôl4+òmSú8Ûè´X¿ö,9ÝkV/Çðð1qÂÒ¥1‘#0ïÝKº»w`¡~m¬\ƒfVæßð“oˆ ^t^nžFÉ£?ÞS|ÊU|bÛ˜\Þë4dŸ.mŠˆ±”,kÆ•;®ï¬ì;ý"·»B˜šá›â< ¤÷쟘ª¸b5û|/O¡ò½9è!•iþØœNõ’V?Á¬ßëÝp>{5Åáuh‡ª_ûÛ f[?ô§cZ#1“5>vmÞrWŠÓ`ÎóAiRýÅ1U£eTƒëê½ù¹‘v-K½„êÏ8£é§Æ­áꉄÄô*!õ} Ó_øÀTÝ \vú±ìÔ30üÁôœE™l`ŽjÛ‘I^sçý1oÑ☳pQôbÊåo8ÆQèe²#‡´ö·wÄ“œ&¹eãä˜û’“lcÚÞ‡‘ØŸxÜThô¸ýy¨r,õ÷Æ¢Æ4•UöÖÞ=X]:>fÏ™Ôñ\õeƒc–CM¹X°si|¼ü²WÄÉgœÊÀt -Àó;‰¦u“C¯D³ÂÀû3esü§ÿ\º6n#…ê]¶yk z/üÕg ŠOõ2Áæg߇q‰ØÍé¤6LèC½àÐïGðI<âJiÁ (¤v´£ ëSÿ"Z‡Šôlüè—¥o¤Ñü­<׺ù6ô¹jXϲ.TžÑmŽsp:¹3 WDå8Ú€ ÈúË ôR}¤/ŽSdT­ù>Pq÷0çËBžK½Â,@856½J0ŒQ@[ã–{/á=›Çi‰‚h-N¸2ùþÔhd^¦^äJÊ4Ç"oS•ǽ՚ikEæ§b´ÄÔ™g~×4-÷|·þÖ­Që!±“øl‡?’«u7\ _ …DD‚Òü­rb®h ?¿ç^aa w8†9ôh,¬[þ½ñ•+®ˆMÛ¶ÆK/¾ŒFˆPÁ‡ú‘–Zcîxr{l@/tSú. "X£#*t‘I)o¦’ A6l¥³LÛ'rM×î ±f݆xÛO½Ž=鯊í[ŸÄÖŽ°»9™åT,"MžÂÀãX5—X²«Èzšf¨ooÇ ×ÀsþC¥¨c/º¤i%ªÑÚ¶§åöõ”Æìð‰«pYvzŸ!â£|—ßkyËÝ­¯ ¼2-¥½D%L¢;û“x\qį‡ºŒ ¼zu8Ⱦ(˜™‡°«øaÚŠ‡J:5-ý—x%í„9嶆É8–ÁB5œ%JÿêEÀü̇º`9R[®|O ‰'µKˆ˜.òìÄÿ¬[Md õ^¾k—aÀ5‡1÷Á®À¿ä®§ô#éÁàp/Ô[?ál.vsæZ\ ! m}àNñÌ{‹ Wà]¢Ù2züA ’ÏVÞ€y.vh"¦Izå¶Ãl‚`úJÍjÃw£â2 Ù\u5ÛzOk¸Š°–G„2?­™žå FQ6yÛ÷w°(1šN>–ÅmÕ±Y­’6‰æhÏ›ÛXtÜÌJl&~~ò½™ ê÷t\MO¢('÷·EI_($;(½Bü9ÄM$h‹;L¥‰ß…Š:‘#Q’˜î#Ì8̱±¨ë×lŒ­pšÛžÜ–´À"õ-m*»‚ÄÁ)W‚T…üFÄ_ýF¹²§È/–JˆÓ ’Ó¦`¤:Òë…€¦-Oü 35|«D˜úIltÖÛgïÏ/ÑÌìÌ‘2O–»ApÄÕ.±6ÔO?”çñÆ ´£è´RÛI]Y忆Ïrç·?=S‡•»'“j Z?5 Ÿ€Èû0?Àhp7‚é`FäMÆ1®eUýK:n-¹ÀÏ][…hZ=‰U–­‘ædú5­lp³'~Þò±ä›Ãý€¸–Ó”©ñR…·[†îd³}K)õVk…R»ëk4q(Nº´v6CœlkGl*&Ž[w§™&žÀ„‹ÌFˆ÷é™I½`?I ¨Ÿ}WbäÈVKLê˜JãÒÕ]|Ï ©HöÞ©# ›MŠÔ &'ê©Ò¹\ðJ}ÉLƒçÂÝyX€ Ëå5 U™Ú¸I02e~̧^‡+)P2u¹4œ¦0¼´Wùš?•cª\§H|¸«9žÏ†kv–_Χ¦é³„E ³…³3Hª3ÉŽ£^¦Ç]á:”;¿ø¢‹b꤉±ŠE™ÑpÓÇbD£ ‹DëV<ëP^ßùänô3ä\$d´p¯0K"IZ"«8Ç (b fôq8;•Fp ðŽö¸èÂÇ䉓cã†-±aƒDyòR¬½c /wC =ˆ&¼,\±‡Óug=².än=­õ¬m× çúY..©õëFS@*[Ô…qZŸ›Tñòpczm>+5PLa¯ƒr®Ü;‰_/3¾‘néâ!ñªã›­=¸Åñ°‰_´=DZç.*½G—æç æÙæ9Ù.ô+:’eh!-\ù¬¿wûšÓçRÖ¿œa,€ÔKܯÄ/‰Ûá\3Žº£H­Œ}cb%STpO;–ÕS w|NM€ vžá!-PUÍù qÊÀmXò`VCÂ…IàKpÉCMçÿ‚k˜M°HÍη ¸Â¥ñ›>2 :˜ÏNdÈä ¹ûMscr…úg[pOC 4¨ÀQbêvs°×V¸ ·bM\7“ .\È}RIÛ´¤ ZIè€/áhóÔÎ)½HPäqÇ ÉÔL­†EƒÈ (^0LÖáyç-I` lZðÓ`kÖµ ãçÉÜ›‰›þ:‰À³íüÆO.ô*1©9§·ø‹îîqOún`Ú]ß±+6oÙÂê:nsáìÙqÇCċκ˜EÔ6íŽMëYDÚÝžH9^£T.‰2ée§g Iø1²Ø®9;H®,þ‚Ñ8»ö›Ö„íÆÐÆ×±Â¿mëfêÎmÕŒ\h›KŽ?Ÿ…)¨£C9Í·nrJÖ­¹CÖ©»p|>[æM&¬£<¾)ë'zQÇí»»cåÊU±mÛ6dÁí±k×®,·&õÔl8éä“â˜)”RrçÑÄ#i¤0+b+ÚÉ:J üÞÄy¦‡]N'‚•Ÿ¼ 9JñÏ{r®Êþ#plS>ïØÙ™}h m¾›£I4 ­˜E9òtâN=õT™Ð)%ÇÒäÜÙ[ŠD¶dNCk¬# a†s• ÈÙ õ³m/ý-~¢÷*NÓÏ+áÂ]ØîÚ×ëP‘Ûú䓨_Ý€u æÍ›K–,¡ÌS‘ßøÜâu1 ¶Ã’¢5àRR­€3ä çú ç@–$«_¼òQ‚ýwÊÀ¿lÍÚñÝï]s]3fÎf× ŠÎèèmÚ°6Ö®YoûÙ·ÄT“À¹_Yób9vòþä΃ñ¥/5¾óÝ+cíÚu]F•³5ÀÅ-ŽaÊwÞ¹gÇ›ßøú¸àÜeÉÙŠ{†”­§ÏGØâü¢ë÷èoPp5‰¦ è%—ìq I˜@˜ýè;ŠlmLß»90lâDÛ-yY:xdÞf71f¯ÄÒ{31(1žÞ¯Cgçöª²7uíDî–ØiTxÍ«ãaìlnb5ý2º(›æâF0ÚwR·ÎÍã±ÛnŽyKÏ"L{ì٠Ñ#º‘’Ë€K’€Øä½r–(§pÏÎk§U‰Õ~8Îýv¢Gú`œ4z<òÀ}1ŠÓ(™>•óŽ8cˆ#=V>±’A¯+¦Ó‰7?NZvr,:~ ;³ÆçB“í,¬¬k妭ç áÒªõ•{ËÓ;ÉÔ5°Ûïz8¾{åUqç]?Vtlà)nÈÁ‘”÷â,Umsñ·à°mdPgýÛ¶wÆgþæïâ{W?q»ÈcÝaVD8±P者ɦæ…ñûK^ú´^¯¼ôü˜4N"Ôœ'â”,£LŒVú%Èiõ‡>ò™øï¯_Éî/‰rh§6Ž®ž‰¥«[¯ûBÎå¨ZÎ07lÜŸùÌßÇ÷¯¿Ñã¯`P<úe4} ãÚ.6‹$ö´}¶?áZµå­O9iiüÉÿ~œvòq@ÃRЧ™]yL-/¨L8+욊àèZ¦h¥9% àt¬^³%^óú7GWËDä.4(ëbUÚ³¼!2·Üx}Lšˆ’44ÕÆ¾íÎã·~çb/«¬ž¡Ý §gƒ§ 8çù HÉ‚ED.LƒISžÖÍŽž‘ñ«¿òÞxÏ»ß €Ab‚©ˆ±j*Âù¥¸o}çúø½?ø…ØrYäÕMN<Â>‘#&þ.uA =º’- SË$wœDjÒgõ¥ûLœsÆIÙÑ+‘«®‘õSÞJ'êï5ýÄ·9R%À†mî{÷îKŽè–[nÁ¿;.ýñ‹s&œg[Ó&Ê,MYÉ¥“vnÞÿùµ+âóß½1&raŒž±"ïEÐ$ä4éÖÀBî •,ˆD´Ô½taå¦ypº4NsÏú{Ùì¿1~ñ-oŒ—_t>‡Ã1ÇJJL‡ú½ÎiˆsÁGNbÛæ'ãÚ«®?_—]þ2îeà‘3ªzœv¢Z×fX<—Ïb‹c†8}í÷ïŒ⓱výF ÄL¶/w¹ö$”G—V‚ÀÛDˆ€ÂI˜º!š,éë錃èŸyúÉñ;¿ù~fK§¤HCº¤1gq´î[s¦ÉÔM4c ç öOá8´¢¯³Õ¸íöGâwïco;3DM ‚˜9à¯3fæ~Å NÛ¸Ï"—h:k8¾ŒEûâW~-fNLßòèì;àOŠ¡”šZó,OÊ#%œ_úÆ÷x¶mY´Eïëi‰YÓ&ÆÍ×þWŽDÊÂ-ïÍ·Ýú“ÄæÍ;RûbðôlöŽ=i¾°Y¹uKxò`žÊ®%¨íÀ 'ƒÒ,2Œ_|Ï;â½ïùÙŒ“05èÿ W¡UòZ &aS£ÀYèÕ‚ŽÇŠŽˆãÞ†ƒ)çÓ;^[9°¾ƒ»œòˆXŸû—ÿŽ¿ý» 3ÃÊlWòöµïL+ÿ…/1û©X¼øøÌSÎ,; <+ô›á$¤ŠìÛð<Ê›ilßÙúáÅ®»‚¦ºŠþp” œÇ;?.¹ôe1sÖ¬$òÊ4ÛÙ!Qz«õ×\ûdt;sv¢%(¹:µZÜztU¼ç—~5þú“ÿ'.»ôÅ)KÊPÕ$OÍPùyøÅ EÞèYP_úŸ«âãù×…˜RNïúFˆ…˜üùŸÿy¦á/Åh4Ñp&µ¯=âÆûìg1C¸ŽðŠv˜)Grò^x.„v Ç1 Ϊ!#ܕ˛\i=쥑¡¿h:P޶Z§:œåý—ûyÿù‰7Ô¼§Ów°[²eqöO¹jvRÒÔN+…Ȳ¸x{ qí`|泟Ë:ÿ‚L“Ù‚—/œ£g›»nP¥•ƦI$}¦®Ù %¢¼&¹ÔÝÕÙ0 Ãø«O}.¾ðù/Ð.€˜Æ‡mÇÓàÐ^Æ4ÁssŽ™2 «æSR¶±m~wßý£øÎ•×Äã«×¦LcRjíª›«áÝTLo‹~ìÓÈVçÄk^qN–>»Ε΄ªeoô9fÇöõÁИÅ(”Þg&·ÛÂñ;÷vÄö]í ÖÓi*\£8œÃÒ…óI "ј #Zõ”N«êÖLi%’wß ‘@IDATIð”#ÿÑÍ,º8Û?¤›ÜýåÁnÓHH ]<ä cKKlØòd|ÿ‡·ÆÝìõ~5–’41ªÝtˆ•Œ€TxCv‰Ëà„pÈp<Çò¾ò/kþì1jÁÂ=i~t1mÒ`pŸÈxCH4*½Ê^òu!áàAöñ³mbdìEö÷Xœyâܸ”£<8 Å{¦´Ä×BxÓ[‡ÌÕwícÊ í°Š@´Â4‹s“^ÆÁqW#*QN÷¶·"òX²0ËZ,:–íI¾86hy\^Õ5¾Ô×AwÁVp—¤!¿+Säq×ÝůÿÎGâÉX±§ýÇPngKozý+ã'âµqúi‹3ûš~Ésy/Ž7¿æüøÐï¾;>ÿßW€ãŸAÎÛápA”Õw8ø\`Aþû§ýxœrÚÅüYÉ_ˆP' •ƒµ & %“2cmä¦Î¢Â¸ñ¶‡ã/ØÒÚþi'µNÔì—~áñKï}}‚E-ûF¶_O «¯åyñš—ŸŸýûÏÇ?î_iK‰¶m9*ÞôÆ7gÿÍbz¹Õ5JAjþ•š÷ß*®|+ij…ÂïÞ»7¥v(hÄÇ?ùO´ë©§ÜùA¦ÚâœsÎŽ—\übDm böŒ1u5§íO¬YË_É!‚ßG–¯HfË£¤0A=€¸iÚé“ù©¿‰¹sçÄ+/»(ÅuYö,Í ûCMòž`0ëˆJu^ND„Ëi;Ÿä$_ü’WÆÞ®VV!­.ñÁ.&Êî¸åëñ­+~úþˆF)øSo~cüÚ¯¿ã%ílÁéOÍÏüeñ¯¼ú¦øóÿ5„ Ù"ï#aUÑr„Lk;S&ï}÷+1•ôF2õÈ~á2¿Ó”ûµXuºA5’Ë´ÝEHªŸúÌWâþå?¡4ªyÀe©ïɲÈìiã㺫¿œ+Å–-Û;—Î\|Qµ&å°Â$)ˆRžåœiŸÒY$ädKÇR'ÉGÂ]eß^s/œrˆÿµ+®Œk®¿%.ºø¥qƧA¤ávØpï]qã˜ÖÌà`´± ãáÔG%åˆ @žôàcOÄ/ÿÆïFëä¹1ÿÔ‹££eb ÊIØ‘ u/нLÕ)W'p×,]”sĽ1¡¥;öoY›ÿQüÚ»~2ÞøêËhê T”Êatƒì[YÙß´uglÞ¶â„r=+§ŃîhB×oJñ#ŽŒ›¯¿!-š¿üKï‰c¦báI9X™&í^€“RùJé[‚®ñ~¸›m/t Ðþ?¿øµøÈ'þzM‚~âÒ…ñWÿh,[ŠÜ•p2Âa ÕíL¨ÛÍëæ;î‹ßü?DCä °Â†(Ü×HÀÞÞf.=qñgÇ?ÿÝÇŠÌÓ1c¡aahU”‘é”{ézdæ Ú¶}Éÿd´3{pÆ1 Dïï~ò5/OþŸßNâç¢U”u*Ÿ¶èZJ L%fÿùùÿ&÷–˜ÄQ)7ÝðÕãîR¦|+|­¡5Î"ó$3T§ê1ŒÓM›ŽGK£šgpÕÕWýG|ûŠ[ã#þ³¢GþïzçÏÅÏ¿ëèõ"%~iÞ²IÄÆ† xBúÛWÞñ—ŸŠ-;ö€«ãÀkVÓ™ÝZ7E Ú“9v庫¿•ܵíT Çà 膘£Èt€E§òÔ~º[×mgZÎÁ]û•YŒslg5}b<øÈÖøÈG> ukL¢âÿðw§Ÿ2¯4&yI"T&v÷Jª5PýBt n”êU¯¼8N<ùÔxû»Þ;1˜é”Oùš„Mev¹ƒÝ{öÆþ×ãýï{+B$:eï ™•nò(€nM#ÉÄèD( èA”€µâ³—醟œnŒ S©÷ˆÈ T)ø›œ¶úÙXv@§hH]…Oº‘hf¬’–Èc‡ýO¼C,G0]6u —²¤n½3¾üí«cÔÄéñøŽŽxàª[—gçŸ+Ý8rá¼éqòâ1•ì…ltÛ£Æ:FS‘)LÙ'²­ô‰5+cÚü%1aæÒgšE'AÈr 7ˆ·²>iƒgd—êE#ÿ>áÚ1‡ƒß~ìÜ Ùj9"Ú‰;нþ{˜ul§½V­ÙÌtuulB®ªœÐîá)œYPKN’rhپⱠ½Ù-wßËn¾=^ÿÚWæ4yŒÛ^E2 ±ýovvf‰HrnÍóœŒ+ß ±bá Ž|4Ó`Éžžs^ô‡èŸêÚ¶Åõ?ðê³Pø¢|ôÂóΈ¯|é‹ñŽw¿/ÖmÚ[p›ò¥î'íwã7Ç¿ýû7â=ïz³(‰ÈŸDò˜ÂâjùaDüÍß0Ý'¦ì\=ãäeñ'òÛY$û’3AgVÊž‹( ôq'Çn²ù½ß~o<¾üaä¤wÆ_òbfMLDÒ<7Fã,tª>¦ùæýè#Ûâ/>úç¬ìG#fJ|îŸÿ‰òÙ¹nµ]~ãWß^&$ϦÏ0®e9j7€L%Šúy.  ³(3éäøÏ«é„ýþà>4\oý—ŠÓN—‘ä  —‹ÙØÊñ¢#¥î7Ã-^È)ŒûÿÒ Á¹iSÆFžÂ[U’ÿøÏÏ£òzX8©ágÚ•Ÿ•s6]/л2$9!9œr^h˜S * ’_gð’5ýVYκ9 K§éOÏYI¦Näwjì…/—2H¹Ä½°Ýp@Ú—¾uuLš¿4Ž;ó‚1ý¸h›¿,Zçœms—ÅÈéÇÅ6¸žëî~,þå+߉o\{3V‘–Çft[˜"wãV`5cêä˜É ðö«X4ZíÛ×FçŽuѱmmtí\Ý»6DÇÖ'à,WF÷ŽõÑ»kcäÞ½ccì\·"¶>±<ϛšjÌeí¾ýÆûW¬ˆïÞpc|éÛ߉ՈF#ŠÉG#´.σIÇÌŠé³çcxd>Vœfaìcvœóâ‹cÆ}çšÄCËW&vÑÅ wt¨üdoRvM_†}”XÖ«ÌZgÚmekíygŸÊªí»Ñ¾ÀܶÎ,úSÃòAYfûólr¦xìœÉñžŸ§­Ç›8sp`ðƒªÎgÿþs)s´Ÿ¸Õ°?ý:0CW0ÁüJVû÷÷Æ×¿~}KM ð•Y…‘/ûñKy~’r‹%#R¸Î¾Äi‡agfâ¬uòþ[üµ\À=ïìÓb"ñKN|x&ŽÈîË–Vïûßÿi·u&ÿùÿM˜¢iÙ‡˜"/ gXj_Ð¥abð£"‹Lþ‡Ï"Np³De”Ž´1еÁ=3 °†ò__ø ¢‰£gRôg‡âÙUNª†ÌFh.YSWY"s?nBìݳ›Ê„{RèWÞÿÁ8a ‹Ì ph@Z0wµÐЪ ¹uMd(#eiL½äÏ8uN¼÷ÞÿÿšáF¡èÝCgr§LrŠHÀï¾çÞ¸ì%/;HÀ&V:óhÙ‰Š4­plb˜("• É€ðÅ6¥»>žƒØODóÞ0†÷&]æ1þúé]xf¸N¢YaUåùá°?N–‰YÂÒ©MÝ$Ç©:ùíê8ßCп½{T,=ç‚ØËî•£' —lƒËÇZýø œ6‰Åõý»°ì>.¦ŒÃzýþÝñÀ[cÍFŒwlß—]|nÌäÌrŠ™X_†>åýk7£Ï¹ósÛD›PNVf•û‰aÚµ[ÛÜß|ZºöÇ$¦ëKÌ㦴ýÉ{ã¾GV ît_lÇ`Ȥ™³ð‡E¼0ƒÅ•‰àƈÆV/$xNãF@ÔTš_râÒ¸ýÖÆUß¿>–œ°˜qLÝE•¾ 1£8  ûÀeãê¸7žÊû _q@¼*p•ksàÕIÔ&Á̓HãSŸühÿìÂo£FÞJøÃeb¹l9ÅBoxý+âo?û¯±ƒcq:‰ ³ÛÇv¼îúÛâu¯¹ “²M­cj•˜i“Ëúø¿ë®¿‰ÅËÍ¢D3Õp€Ûi§.Ë’Éh¤ú¡5Dm,묜ÙçÂi#>qÀ$þIKÇßø*vŽéǶ¦¬ŸÖ£õs¿xneAr_û~¶*ïÌÅ¡w¼ý­qʲyÙ‡-¨ãÅJpòše43·Sú]ê ೚VN:af¼ã­?ÿò_d‡Šo rmàg ‹Eî†Ú³¯ÃâòKN3™ÜáLªAѬx6jãÙDë­ÖÿHõ™z¹SÄébO÷^d“ã§Þô“2žI4ÝÖ¨å!¸Nx¢Ä¦ûTº¢€©Òë{ßó6V_¿Èjx|/#8Ç8¨KÇ”},Bä\wcü¸„“T³³Ó˜µ‘4$¡aÞÊHŒÖè²SÒ®¢j(XâІ€_Üx†sÓ¨¤,#XÿLX(P‡lðB å8­G3çyT Dø‹Ëg~–Ë|2+ÑYÜ÷Øê¸ö–{bÞéÄ®^¬Mò\s8pF_Æèa1©×ãyiåkœŽHy&bñkküðî)__¼þÇ™¢1TK/}É…ñRLÌmÇV¦€ îèQ¤!7ÞCÝNU°ZtrÈèß±{g\ûÝo¥d[ZGîO<?û–w 3òˆÙ‚Ê­t*¶ª4ëV4ሩ*„2­œj¦Ä6•¬8ÅûË.yi|ë»W3=auðP¡´g‹ßy÷½™Ž õE?® »åleħUø^ˆuÑSVRž½beec8B¢â)רn¨ÊµV36> «‡Sÿ"W³yqøW9[%š®²›Î‘eœ…ø6J›ù™§Hf‰®»š½eGg܈âîÑÈ*§Ì‰Î1“cÛ~)´Tצh¸@G…=ÞWÓxîïoÍÎX¡QSf²Mp#g Ý‹eUxï΄ƒãÆdN˜”ÞÚ2¶…‹Í”åà&…vç7;Âöž?|Ï-|`_?ßï~ô±¸öÆÛ8A“¸c&°®Ü/>猘ÊùA-_kžX»wîaC¦HêúŽ©\ †-;c'í¹†iŠÓ²ƒÈÆnýá qþ™pP3ÈR2KÔä ÍÓä=ôÑö–»´=ä`åÀÜ Ób½)H\È­·Æ–mGÛ¹:áÒÈnØ G) ÇyêèE¨øŒGÅ@û®î+w‹ïhÄ{Û`9jceÃæy÷ŽNêˆZP1ópc70[èb ;j¼øˆjœ×D69´1(Z “ðîŒÏº bx˜Ö‹ÒA‹ªƒ íU¤¨6¶y¦¿6¥þ’)Dðm?ûs)FМTÐþ-×oXg§…hTDÇU$Ÿx϶Ў&9xõ·+¯¹žö@@ÝÇ1¸z¢Óö[︓¿lÄÜ™ã´rýXSKu©0„.G4Æ­R.Yq&RÁ·¿õgSf¤rvÓ12HÙLT¦DÀËÕ8Šåư\r—]zI\}íu±n©µm\žºè¾á1pˆë7lÎÞf@Â{Tíh¸áæ¢Ûq´€ä„Üí(ZQˆ?÷.ˆÝ@™X`¡üÙ®¥Q‘\§™ø‘ËAÃÇì|ÔO®SNÓ«"FFî'ÁaºvþHG7²‘¶" ŽßýÐã1{ÑéÑÑ;Š³Ô™Š1õUß­h=°å-¬p:èt#s’SÙ6Ð~¸hö…C8ÆM×>7°=oö8¸#Î'š6uJÖ&ç™ä©AcW´I–‹©„Qz:¦ƒ¤\E.®Ð#«ìg‘bÃ6¸Ï›ncAˆ3šPlžÉöÛsÏ;=>E®å7äžÂb2Ùhà>‰É” í1–Uz;-í¢ÎÃÝöÂÉ®a Ý°f5û˜WÅI'žŒ¸êsÂ*_üxXW³J,ëâuÌ&…’x/ºÁÈä¢SÉè°éægË ·DÅÛ1àð Kf²ýu/JÇ".³áÂAÚ-н•ÌXíb샲fÓÿÐÿ¤Ïšµëic7‹¸Ã†xpʷ½/b‹«o\päú+H[R¯T5"\¥õ-õÈuPì§õ"n°S„8}Ép¼åg~ |,å²€âQÎV(»®Ìx_ ¬²!ot2\¯zÅå¹ÓPù§ÌŒ³ YW™§›7—€ÿ~L8­˜™{>RÈF¿NB#˜£¹ ¤ Œ$º‚—³z›ˆ¹¨“£‘(‘#¹²Ác³0•_`Bç*þ%¬)8u=çì3Séz¤;(@Ú:dëÔ\ ¤={»cÆd2Æ)ßÉ"Û!x7mÍ€éúE‰ÂÈJAH‡]èw“]r®VˆY°ZºR‹âÅo£ÑSÔÐx&FºJ4ýv8’x3ÎΤٵ ˆRÊ)×Î=]¹’Þ‚±à±“§Ç•Ù¹T”—Àv3úŽQî#ÇÂe\§Ži'3õ3¤àБA™8-_ܹ9Þ|ùe¬¨²pÕÏLËÞ‡ª© HÒ9_¹ÌD~žU„wAp,ûÐ׳ ¨ÀöûSi2 NgŸ}rnΤ¿õŽØƒ±‰‰ɱèîΘ6!;'ŽŸ7[LË! “ÆSOÀ£©@îvnߎU¥õqí5×Ä?º+ŒÇ/œÍ.œWŧ/‹™¬œŒf—ÕH[íÐÔ_¢©ñ”ƒpÃî.±ÃËéŸzêi„‘q×]w§ØE™fÿt¶µxhä!}ŸáO6Ÿ?MWâçÀÀ8\Û äf)pD;´¾Y¶)(—Ë) Óâ  m“‚e”<¯ýe(ïµ³gO§äòË@¨ng ëÖoŽ¿üÄßäÖF{ž¶N5Ì!atV•Æ3hFû;¿Ôÿä‰?¹7eºhHÐÏΉaä ¡vp¥]µ•ÐLØ&Dž2‹a2Ò ð*Ìž 1¦.E^Í J0¹\ašý^ ¿ÀŽâ¹d³ìtó¬ãYVÜJs‰ÌHÅÉsq8 X¾TYš2=З"—Ü̾ã)±~õªX¿juLEŸôDö¡_¢¥$¡ä‚[!Щ¸ 1Q±ý [a[±œ„±Ô},xav7zXi…÷²½hÙi1 Åñ[î¸mÚˆöPta[eyîƒÐ>kgbºL´<6ÿêmt€v!P®Þå´\‹gl&÷Žˆ#Ây¿ÍXÃ§Þ ½á2 - ûĬ¾ø”š”ˆÛ:ßÎ?ïE,ºÂHôè­c€Ït—G¶º—»5[¹!Þõ‹¿† Ôgcææ’ûdÚLK%UÄ!‘×G+ëµ—h}Ÿše<<#g9D½ç¶lžç`¬Ú¾š5°IÔòá< Sjj8?÷¿ù’o¶¹úân)5í3ŸŒPb3°áÍWûs}OÏçø§©%Ÿ~ÊEkr!8•+úùÆO?üðΜýîˆ%¡¬"Dr>¤íÄþʃeí÷:|Òƒ¾®ñª¿ À¶w7˜ 0 ò/‡Û||åJ„í—ÅñËNbahR.Œgu¶‡m{]èþ´³0´m§.Ò¬ÝôdìÞ±#2 ‰a¶ê°Ð£i9rÇ‘L‹ûX\8óüScÆ1“ȳ(û—ó¢¬U£föNÓ§Ñ4å <¹VVó!`ýËBÊ‹Î8#îGá}ÆÌ©˜»5®¾8cÙ (y¿‚…ˆ-á=AÓÅ9uA[!¨û‰Ý¶i"ägØÇ16§„ÆÅÀ‰ãF°“h1§vž¥;â¸Î¥†0\T¡V9XÚpYÆFAAþè^²Ö5£ “T¶»ùfGÖI|/G£¤öÃÚµ;ãÏÿüÓàg:aëµ¹d9cÉE8®_‘i{'F6œVŸuÚ)¬~:`°[ŠFê²îüåŠ|œŠ‚”µ~åŽ훞xx¦ô8àIË–Å|V¾¿ý½oÓÞmX>Ÿ³•Oƒƒcá,{¡&î¯wçVxqb½{_wlCßwV©öPÏm;w¢ãèÜ\˜ºž³ÐÿœNýä8;HcùŠÕ±ð¸ãr0ëFÕ,70ØVÙ@Gí¡!I!Q¯Ù¿tY}JÍÅí‚ça+Ñ4þ vfÝqçÝqÍÕ×Äîyˆ£5èÐ \аÊâi#à—{ïkfz÷C¹z–{–Áïጿím?ŸþìXõgÐT«Nýg89+j{ xGúÙNv,Ý|ë}qÓÍw‘×'âäeKãe—¼$÷ÿ;w "4ut ³á‰®IÔK5àhß(£"ˆÝ‚GöA4†²VYk~ŠæÀS%˜! àà³®ÞË“ý@Xv3j¹€êû§(©>§ÓxRÛ)éBã®ßóå„mc&¦Ö‡Æht¥Í¥Òò”ŸÊMn`ÈÊlóË/ÿâ;cÅêÍ Pב ÌŽú‚ÃC$ÌÅ‘¥5´<Ùy1‹„>²*BØ}ò/‚}ë[~ …ò QÐ'>áK}Kæ¥úàÈÃjûÖ\žüÖÿÃW·÷оþÙõrúß ¿O ø”4}7?¯FŽ7nérèÈ'¿»®QàhßTDBÛ“ojÈHQÿç“H–2 þe>Kñ­Ááœl8Êša+PS®_ ë‘™¹ï¹4I*KÁßx2zp ¼6< ãcbƒ‡Ž™-a<ÌUbyÛ‘,8ôÐÌ›N7š¤šKÖÇÔ,,M½ÈÒ )ƒÇ:ÐÉ]°ÈÆwuP;ç*óë²l>H^uÕc &éý?u,AJ¼$Ô¤ØÜ\AW&ÅêÓØ–¸½÷k6n‰9Ç.ŒÕë6£µ©Wоcßng+ÅYu›7kZœ¸t³‘+ωSNùÓ_÷Ì|(®ùÁé@;!’±B´5Î<í,T‚¨°É£Vɲ•ü”וQ¥n¶¯O^¥Íõ€S!lªŸ CsÊ Û'°÷ÿâ—½<¾þÍ+cÅŠ iDÚíÙÈÓó­tú¤~g~#c\?ÞÛòÜ(‹L5¨Ÿü‹ßc`iÇxòõL80LJg׿ïÉ´Ô¯ü™À. ѱ_95&+ÃEýo½wyÜq/Öʈ÷Ο{küü»ÞŽå!>ã$E ´›e ü=÷)u®M›úJ`+Zï|zÎ]™ªgŸIÚF,W%+ 6ÏüÄ Ž~7è¥á;(ß‚@¤n|ó¦³Ýăä8¹ôTæ• ÏF*ãT#£¼ ÈŒ^Ò㱤gg+Ôã¬ü–_ˆ”#\#ª7ýŸ;WsâŽÐ_‚¯ÚN@’«p 'P¸¶É1¥õÑìBÅTXÄPM?Õ¿x~tõ†xôñÕ1ó˜)qêÉ'æÂÏâE âÒóO‹™ì~ºêšïÇêÕ±ò=*Î9ýDiéÈ­Q# p(5ów ŽO–Õ7ˆ¦ð†ËHä§3Ê™/Yx\,c±i'NàŒuWV´4 ÒËÌcùú-q=ö*ï_µ1F`~pü¬Eˆ_'Ò©©3I»Ã¨ÂúýÐh”Ñ<£1.®¯ýɸÿá•qÞé§ZNLÓìH¶ @,J pÆ¥(Ä ±“[ö$Jµ&:aׯÀ9'ï@O¸îÆ{âG÷?üoˆ•Ò¶ÞrÛÚ10¼×Õ˜Ì*ïI'‹?6^tÚ ±tñ±\ éÄì¦"Öu7Ý}CŒ…hOAð%^A< \yKĶÕU8×÷ÆÁG4šðŸþä‡ã»ß½.>ò狽ÀÙÅžˆp$–©iBñBâŸÐáîN(¹_SWIÅýÏþó¿3¨ÞþÓ?Œ¹0Eš†kµƒ1-6pÿν!Åñµ(«eªÖ¨àHy«þ†ÆùÚäåcº&¿ü®g6F>d|¢\…ã,ЫÒží3ÔØõ}nß á|nÓ|^Rd9¥ã^“ HSù^Õ‡žnæª1™N¶xMÛ×DìšZm°z¯þÏò.B˜7«Ý£G‡ë?¾ngL³$&ÎZ 熌ä÷ ¤¸UQ­–^:Ìô=[‰¶£0¾eçŽØ~ÓñS³Ó±Õx6 Ï8áøÑùÒø»ûïSN<+N˜? %äC¹º ±¡ŽÉ-÷·”0nt.·£zèZ9o L‘ă¯…}4{|e’`cË¥¸•Á`;¬ÎaGԹ眠äúé ͦ Úf(eØ$ßv(ñÉ?q«ljÀ—"òxt¿¤iòÖÓ´e%_óê—añÿÅñ½«¾ßøæ·c9œ¸'mÚZ?ÂHy¾Ïìÿ—#“SÓ9#hEkaÕšuñÞ_ùõø·Ïý-¶=äL+wC™aƒ1qpJyr£¾¹¦a©(_ã.‡WÉ–rÙàp}Ðet;èC"6%û¬m\‘ZNŽnw-ÜÎ1³æÄijá>™v!7Òšzû>‡vÒ;UO‚7»p´¼3ñ )ܶiClY·½Çíθ9¶ Kø2N2œÁÖȉÌu.<ëL$`ª\ê,|]Ý„‰m[ac;LÂÃi'ŸwÞòøËF—¿ê5”³%®¿í±¸â‡wŶƒ£cܬ¬U±#™$”NWYœzL¿h“)U6 ÃNË«SWM“òÞÑÞ¼ny,[8ƒ2Ž}Ô‹GKo[×rñ:à¬p:  H4 íTæÓ˜úã«ß¼"7B´8HÁ¹ï[eî93§ç±ÔoǼÙÌcÝŸ³ki»´¸QÔ¼;¥¶:·IÚõºå¹M:áv(ŽÖ²¢ùÙ÷âJлdpQïÒ<\-ÇÛ^?Çuïýëâ¾úµ¸öÚkÓ°·‹()vb¬]×qˆœÒ^&ppkýJcÊ‚¥•©_z߯Ç׿òù8vÖ$ü¨}ÌQ@"šD˜b•~È $ l `9› g-ÿsq¯ý¾¦ÕL_ê4½~k¾‹ÍžÅó³&œ5ïæUýžë»•tÃdĤô¤ :‘¨¨Œ_Óc Q~%œ–=¹1ˆò‚›³S#†pÚºfË–øÑƒ÷Æ”9 b,sÒýìòüm„ ,`˜£mJvxÏvÚΑ»Ý»ÛãáUâvª,à–Y³æÅ¶õkbÃÊåt¨‡bëÆ pK£r…úÔ—Àn0u£S¸=¯t0å‡éÍò<ö!Òœ={k—aî®8û¢KâQQ¾}Ãí±£o|Œ™³8:ঠ=˜ciL+¡–m@Nè`È´³‡£†Q²"7¦îp›ÊÏ]N°Çôÿž{ïŽ _´ ¥zV’5ž-õ†¥L¶ø¡.EÔ±]PåÖ.¦í‘ÇÖs¼õ¯Çf,OåQ#‘Ÿ!6 q•£ÿÌýóí?œä–˜4¢ ÔT“0&GQOÔâÇ»Mê„–E±€qª«zœâåÀ~øáJ݈‘ òL^m Ί¤Kú¹Ý³N=6Î>ýÑþûÈO¿ù­+âvÚaFWhº®øØç2%îÒ\ýõ‘×}Šze¨úsäp GÓ­à¹âaµôdjÕÏççÛ=+ÂY)Þ‡ÔœG¨B£1JCøÑ«”á…h„´ôËÔq”‹¹êš«°J¾/¦O›GL„+ìÁB¹–Ð=ä ª8tÆbLbdš›2a;‚v'76ÙÝ4LŽ-;ã¬Ø¿ck¬~äþxrý*N¶|F{ÇÑYAi«'ìÀù´Džµ.uæñä{*8È¡0›‹)XY:ëœóâîû·¸Š©û×<»ºÐ'ÅÂû^ TÈ5·¡¢ÖBÏìƒk¶]”Ùõb“³cuû ‚B·UÚ†r.Ÿ> ªÛ79ô¬‹x+žØ·ÝuGûúWå€å¤]a%EÒ³n'j[»ŸY£mMÔ¥ «×ÿ…_†ãd ¨²d9M¦»c€_÷~ðœ úª\4†–æ±ÂFñD—LÉ"$Òá*ZIF|V7زäÔוNUC#x¥^À"-syÉâ—LaÒäš'Í/½ð¬¸ä¥gå]7Üxg|ã¿?¸á&%$Ô¶‡ˆÒ6aä™fÚÆ`æ+_ýfüÖû߇aébyº©òÿC¹ä2 dý‚S_åï WúfÓÇgùXû}–×¾ïà3ÜL=qàYæy¤èψp 41Ä uÃù ó´Þˆ{8Gž’eÃ#;Jùö”¿²CŠjçTÆfš#Ô0LÃÕ†©ïÃßÂÿýȾŽËò&më–­ñèƒ÷Ç+ìÅqÞù@FçÔ²îÐmˆ{÷w§Þã¦W;÷¶Çæ'·a“-˜àêXTxÆ`>nÿþvT}¶Ä^,iÆmVzöq„ïéì>é…hÁÑ“`ç›>Y…&¸4à <ÅaêöwlDZ‹–ÆTŽÃ¸âêë£eúÂ9ciôŽcå|ä¸ärZ8¶x¶6YÎ`%zã> ,c™¸PzGpÌ ¶`ºr-GœŒÙqpόغzy¬X³ kó;8ŒNVúP‡ÒB—ÓGØ)³]:§ÙÜÿèC\ØŒg­rRMÜõaÙþWé=ñî·C˜á…Q‘"S¥LBQ1BDÝ©³Vº|/;×ÊP²M"zð]7DßÂø'Ê2:bçŸêÇÁ®„)mâ@G›QNóÊv«õkTN¢jÒLNâòKÏK¹nátÌüÅÇs±«…Å:¹Î”Ò‘´¡«¬œ! ¾óÝÄO¿áÒì_æ%÷Xˆ¦€,®¬žËY&àe¨@?Çi'ð®ÑŸæ} q…jfMu¤DlO`AªG×_ŸföGþŒçÒ|Þ>Û0C ³ˆU;|àa²h‡ `X‰Î€\Æ\xr˜„š¼ ;$ݦ¯G|4*4#;õý?º›ª]qù]K-ÎΑtY?úŒSyôÅú»9ci#çùldÇЪµëbzŸûYí0 …qÔ€v²˜ÒÑÞƒÅõ-±pÑñ1KUý–•LJZw‹_gê†G,t#€ð“F%¸è°#é„'ÃéÞüð7cgEµÃÅ! ½øíAY2¶…e¡îöhߌ!eâÎ@…gÞ± šmiȤÂÔÁ”z?ÊÝ)—#¯±(NBådÂŒ©É™nxâñX½~ªI,t5v[•"Q’¦A6ýð’dñð~íuwÇ=÷a †È[­¿Ü¦Æ Ï;÷œøµ÷½%xc‰ÀwWá`Ó2DF½ÉVÔ€ âYå Lž«Sv›–ôµÂOü☞W`W/ï&Ò¦>ë©kÜ“(ÃÒvpÕTÜ šñåH“¬¦J  Ïçâ Nޝ|ñ?â_ÿãóœsþ_ìcw°)0‘ˆ:ëèdãûf-]ÀrqeÒëºRP‹c¦†'Ë̾ô'êû<¸þ~ŸÙËq–L*0\–…”ò÷ýÙú=#Âéà'ˆªÌÑBºR«}<©Èc(žmÉñm˜Út"¯À*êC¶?S\(ÀxL—éÒ–§sGTU©€&Ò€££¿ß¬Cž‚``ðqíºõøç¦k¹U+³¬1wåQš;ëW«_„íkˆ•€™2Ø1 &ÃVÐÏÄ OópãƒÜ®¸'·¥™AÊ×ÐÔ‡óøúìŸ@ù£w–¯6§w¥³iT#ïÊ:Š~|Ž~̯LÕy²½μÉB6¹üðO¸òAr¡žZJ¼$N‰à4H4 kž¿†oJîi?–gÚ Hdt>+ˆ7q¶mÙÌôêRp×BrQ>îÕy·gù%þ’Â…³'Æü¹gÄ©l¯»óÞâVž·B@»Ù92‡£O^ ˜$g;K„‹a®ùyÀ÷pOÞ&áBJ½e4Ôsþüy1{îìxtãh íñp¢Áñ&ì\šõ?aɘÉÖ̽G¹Í£¹©¡L›I .°û†¥êbñîL¬öAt‡º8oiÍÆ]±aëžXz,+Á½¢08gçEìÁyŶUÅÏ6%!š4óð`?("áÉŠv ÇæŽ%ý /º eÍÎÓ“hº*”pj†~)× ØÁAÒèƒ{nŽD_.΃Ål8Ë‘í-·´ ‚””P}ÛÚ$íhB‘­K 6I/Ë•÷§ÍúæÝ¼³Zßw¾í'⪫0ÍF7yxd´eSì ³#3š" ²/òX±¬à+ÉЛ®[÷ë\I Œ@C<›^ À›<r•IÛo’Pfù 3o~ã ¦ÞÒ=g:ö•šGÞÉO¼|*U¤g“çÑĵžÚ5¥9 íØO8­L%<†y>8N›F–]"YXË3häi´áÐ0µ•xYÆÂÁ‚ AÕôlx¤éšÃ3¿WN³æ[ËoþöÇökß}çâ¼sÎç˜ Œ3½³ìîÿ•K°:¥J¢Cw[ O‰V+ÓáVâ[ 4Ó'´ÄÙ'¯BN: 5¤ã1ü<}"ÖVj¥¨`sM± ß‘j6ŽƒÂ 8”ÖUqêKáq»–¦w' ?£1mçýxŒ”œ|Ò‰¹Sç¶»ïçD̕юI´ñÓçEËŽ©ˆn&»Š¶MâhöY÷qlËH\û9I®‡¦à€ºQ§ÇèIÓSiýáO°;‰,…“åR³P¾Ä§Ç¶½ÐÛõ(¹ÁT‡ ¨×ÙÂtÄÝóÛù®à ‘rÎkÂ\V(0¬P(D£È>…'øcQàh=˜Lb³s‘*‹V Ôü±é¹Ä*ÄÊÃÞäÆÍÞ)¿ßÄõL£BùXË×x³&¦à@«óÆØÃ‘Ð'梖b*gZh5HØç2SHG8@‘.õ|È–ZñF”¼ÏÍ7qÅ~£bÏ•³ß›víC¦ëó ~ÿ\ev”é™p6² 6ºWuÉ­Õ—¦{õe›|ôX‘spœæü†Î È#qœÙùÉZ6‰q”‘üJÌL¯6ÐÆl\”#Uà)¿×´ dÌw$àãËWÅ–ÍÛãâ _*þ½±|9M[šp)^r+À½"Ñ’Êß4Êä¹;MkTpr½L•…NBÚÚÓÉË“Rfg¯©‹ …—ô’Ð|òyçž™dÝH†° ý)æ´Þµ¾¯ßò?×Nb\÷@šó|®ó;šôM}4A #wV;Q%8€ ‰Ÿ¾ ˜¡ñëh6Ô8Â9ˆh75ºåË?îfÏ–A;K­GîöÑV¬X14›güžyš/Wr `g.úÐùn¿ë®˜Æª÷,¦ØvŽà³ßË-€¥p‰øB'-‡ó]Õ?ÉAIˆÝïíñË#1üØ#÷‘Ïþ8åä%„â¨ÙìüÐùtà a†ª÷Ó¼["fÒ&Ws jB'\tíÁÐrtljp ›7oŠ»YÉÞÁ‘ÆcŽ™=p»»[ †ÄGEFËP#àò[¼˜SkÔÄ»j3£˜òb&ã'î¢b'g´ašéYð÷?ò˜c @ÐB¼Ýn;&©’°ùL…%Õ–©Î™†j-Â΃íÆiïÿå=–0÷¨Ý`²A$š…pš`/.ï MurgÒËÍ[<\ÍY=Hf™2V-&eÓÎôó­ñS<ê'ï™'w¹NƦ\ÅïBìâ·ª7éK-V#¡åª¤è®yÈ›Çh{d±GlK˜=&ùÔS'>)ÒH—x7LóSG2tP¨.áÎûsM8­—žÎþSû©ïÍϾ¿îÈ„³ 8âHO²Œr€:+`¥DÐú~àÀ3¢œ¿ÿG„hÂÅ<šVóndÜõ‡F7Ye:sçÎí/wc]Ö­[‡^d©ÏS erØ{sY TaäóÔ…YñHœqÁYѧ1\޼8€^!‡J¤íJÖá¾ñÖË ›†@IDATN(8rö%åã_¹`+ÄÇoqè@©ü‘åÄñK‹qSØ)c Ss ‰Ôè º…ž†wCËo(á“âÓ‹ÌQÂy»™OÄ[q:Óò¶Tr!¬{bu¬_¿=Ò¶˜ŒžgŸ\&2ÆÔyZÐÙÌ÷ ú}Ã` *¡w‘G•-IäŽèâ”îtÙi/;}~|Ulßµ¢¢ìOË,D«ÖS®ZÛ¹ N–]QŒíà1"Ú§tï»ÜúÚÕ«¶£G7â“`k!`bC^V_pÉÝš¯é’T¼ÿý }¸PåhU¾yÏc|¨®ÆòZ[¢Þk Û/yE|ô£ŸÌ|üªåØ_â J.£ãßðt—“„÷áGMCÈÊaÕKÕí«_ýª{g÷ͤŒ×ˆX…ô*)¨ý¾–°GRÄ•%­_ŸýÝ~_óð.¬½ªß³Ïáé§Ð¿ˆÛµ¹š;º0­—ýö€+‰´ŒW²Ò»ÂQ1ù›þÄjÌ#ƒ5gZ[¸Ù¯¶~æ—iòàsr8È’jò¦Þ¼ö¬~óO¹:ÝØ\…8nÞ¶•åAy€œÎö]{c-¦Ýì(™„ÉàJºúp%KïÃþÔÆM™¦¡èÈê+vÁ!­Û´%væœ| êøwéOÞ¡èÞó’3‚ yƺ;„ž¥ð¯—MNÅ\`J»oO<±ze,Yrˆ&H+å[¾rm|âÓŸ¥mðkD—B$1—×…`¦U’cPcÑ bû¾`òíšiá,t!’#àö‰«÷àíÃ-Ïþ ÷,~³3€ørÓY4Êao)­$®[õ#ñ{PñÛø¡øÁï)}*KÑ( IçëâŒ}ïáX%\/y‹Ç¿óûf` a­ø÷7ÞÇ.3õ3ð6{\åȤ Ö§r&M¾q힪g/µÂý÷`ö¯—K`ÛfZ¡·8^ê[—'ß|¦Ê\&í›ý5ïþ f[¥o5 ›1¥3)ôï5˜® ¼^û(ý¢¤J Øõ1Ãæk©mã´ÀWi‚MîÆ£9õOY@J¥aCN»…ö;U­\#©FVMoMù”%†¨@]%kWP•?‰LP%ç6¦Dœö8vÞôœ§ (Û B%`¹·!ÉWù[›Ž9 k2;h¦Nœ3°ú.77ïâ–DÆ:ZóÑèîL»ÍBÁüܬӸ’°u¢Y>ë^ê?€Êx=C§|UÎ ’)1v"áü–,f æ4N_¤“Ž`Š­íËä•Nc5ªá€&÷Û‹Aã­tN]a“NNÛsP`Ÿz+NÝÙDdÐ"¯$LÀÐþ- ÷ì9 ä¬T)gH"§ðÔ÷Q¶ÑûÝï|K|ëŠïÄë6Pu¸EÁâtbûsÌ„Iñů|=N>õäxãO\’Ñ‹,Ôí‡."¨ 9˜|éO¬X»'~ëw~?{ôQÊÙ¿ø ¿È¿7¾ð¥¯Äh¶ÂZoOD0æV‡—o‰SOÀ€3¸T-‰)×<ì`}½äãž= dÙ¶ÚQêˆ÷ÿæïÇŸ~èã ¯»$‰Š?îiÐ¥†ƒ u.µG„Â(`²ÿõ…ï`˜ù¶äÛ õ‚ï}ååÔóå©»ÙÍ 1ó'­T°'=m{ÚÿÄÛK~ľhú6] fž3tu1wqg›¯¸ORÙïåhû!Ö(cÁÂâk™œ%²9¤÷{»ÖÔ†öC'_µ´qô….ªýÒð~,Vå)œ@ój8aQß:;°ˆ 6º××áJ=/ÓÛÅY2ƒÓõÍKìãzJWÃÒÀ$m×,ºÙeÃ9â¼»ÒÃ>Û œ×½wÏ.ˆh£˜Âµ87£LC qH®‹ÌŽwÿÜ;!†, sÁT²©äH¸ç¦–ðûÒ?}“îIúàvûètN•äþœJ¤(€ÔËJ5…  l~û¹ÑŠG&[Xµ_½r5dL¬\±&|u¬Y»)V¯ÙH§Þk6`¤cÓñÀò5qã]`mèÖøßëo‰oÝx[\uǽqÛŠu±b[{ì‡( S \;Qmz|õš8vᢘ>ce“˜g!úï²r5Í“BËùÌ_V–™Gfêì”xÖÌ©ž¢õztpÍe?²oÓñz ‚©bÃKn/œ ‚‰Q-ø÷±ÞÞ»—‰ûñpšçÁ=àF9FB8ݺ٠¾Á)=ùä–\|2=¯œÎ1€¸0#ÑLdÅ?Å[íŸþñ‡?ïýÕÅÊu{‹`„…A4d} âÁåkÙóþñxÓ_+—?ˆç‘ñ±þiüÖÞçŸsf3e2e‡K¶ Ä"¶¢Võá"‹äB’¨*WF)³ìú¨fä¾wèZNZn¹åNª1ÔóDê5:þøC¿ô+÷= ìþ’zyÞAqaäðr,ÄËÝFÒûâÿøoⓜÁžrNÒ>ˆšØùçŸý‹f_Ò˜Ç(û-idwOæ@æìBVÐ9 ´ÚK°9 ,ÚjÅ8 ¢¦XìÚ¾ÝaÔGbî½ü–§|öÇïõ’6 „?€ZEÚE… Kgz˜¡ ÌlFGûžÝM!‡Møyó|jŽÓl¦!/žkõlø½ü@f¸Æjp)‡j ¡\î]Ù @PŸê½©Ný^õA”*ÏŽòr{vï§'&ŒC÷Ž~ª|µ—ÆsZ:rbá6ì8‰r( ÿêQÓmʳñ(þµ÷½#ß‹-;8V—‘ÕÝ*о¹ªÜéT•¸Ô+7EÑM/Rïn7S–O}‚ó~¦Å,¬-›?;NX0Ÿ÷)t쑱¹ìK/¾˜ ÀÐò%ÑÎ{‰ãz–_Ÿ…ËlLÈ ;&=‚yáÄñccÞìY±ómcfC9èü-½ML®P½O8–ƒÂ§,*õQÇÎïeÊßà܃õ‰Šê4e.Úð'þø‡Ó?ûÅéÕ7*,Q¼äëêå—¾™>þñŸd•Ø'Ò®ÓÅËÇÓÿò?ÿ´]ñ\-rhÅ]È‹/àúÅ_¤¿ÓbÈà §úâ—^H_þÒsìhùñô‰Oà߀çèà¡ý<‰½‘X‘uú|úÚ×^HÿâWÿuÐeÑEGwKúñÿìGÓßü›%ÀÍ~pšÐYúùt@Žüh@?_°NÁ¹÷Çñƒ HºåË4ŠHmn݆ØAQñœ'ùã%jYQªÇ;Z‹©óìÖói4êŠqÚÎZp¡€‚Qèêw¾CÁ‰QUõmÀ¥Šr 胘a3Ù%¼ù¨LégÅS­Y¼ØtA±.öUQÖuáìŠþH X‹ÉEÝZGæÊÊýBÒUãÞà)r^Û¾ý¦ùqä¦$¢oʸPó G3Iô¨–6žRf>VÅRa®ÃŸK.äïýŸ'ý•¿ö7ÒuñrÍN\Ãî²ÈßÿƒÏ¦Ï}ö÷Ó3x:ß¹kgÚµ{ûž¤sgN¤·_{1ý×ìßò3?ó§ã´üÐðÒPWz8­ÑôH€„€êóñ_JxúÉôƒ¬%_D^ÔÅFl3¤Ñ„{õŒóÀ¸ý¯{"ñ¹12Šli Ùñ{ßL„‰†Ë4/œ<ù›´9ÌZäÒΦCÈ7mÄÐ0i²î¶’)°ß”Ð,ËŒˆê«ÜoŽk>ûaiŠx§ÅƒÞÅÀ: í <”€‹ôÏäˆéwâœnm‹ü¦­"ÏÌâ$/.c/¿ë†þ®4ŒßÍ^Ä-¢$æÔ IÉ‘¯ ¾Ø7±½É_ÿ‰í›?ôIÇuõĵc/\õI7 ƒrOv®R9¿Srw^µ½]1óšIׯ]Žô’Â:-«*ú4®WœDbr¯üLòÌ/¸jÌf@CWzõ0¾5íºÁŽw,’,ïU¨€óÎÕÇZnšèÀðí#'ySš.ßslv†Ü¯›§FÅ Úô޹©Ø»4Ûxœw»´ã&GñÍ£ÛCôÒº\ÚQB„¦š‡¤…§Äž1CÛèD idä{u°øx 8"i„ùž}j_úüü«ôw~îÒ?ûå_e*à4ÄT ”ÚÂE¶ýzj}A;Ün˜ñ#v,ññ'],WÎR®Ó†gY€É¹Ÿ"—¹Êrë¸û/~ò?OOc?3ÀCÉTœóA晇®ù¥™ÏªÞk7o¦+×®bÂt%]¹z•Áw ?œ7Óü šë§N…gøÖ†ïع‹öR(tR”"mš1À.»š2·^7ç»õ.1¶{Èà˜ù­ÜúÂ߀՗éܰù€äÞIÓ˜'i£cN”q S%œç"îܺ½lÅ©ä.ö0Ú>ÜŸvnÂó €‚û3¹X^.‚™kÀ§˜e\†ΞNG_O×@Wxw²RÊßÜß!~aêò˜_d¹z:2ølþWæ?MŸþSŸNÿüãôo>óë€ «ˆÆ¦9ywj¦/ÒJ3"_¦>oäïàMû$ûýµ¿úß§ÇÙëõc’#Éù1]¯~äà¶ô™_û¥ôOþ𥯤7ßz‡—9³^f;¶ofö²=}ˆ­”ÿø÷}4ž'eŸŸÅ´ñÉ'¦ßý_eѯ¥ÿï·~'}õ¹çƒZ(çU¹§ÿ=4ÍB›PÆÐF͸T ºÄsÓNóÏÿ¹?~â'ÿ$¢-)b@fˆ˜Â9³’Ω9?&aÏ¡\}Œ%ž!_滆h¤›³)™™%AU®³oPÓ“cØ]žž>1Ë™³çÒù —ñ³x&ÁÞHçÏœLŸúøGÓ_ýK?‹Vó å´*SnÊãáÏ/+ÀrD»D>Ë_#Fâæ/Œ­…¿¹j6àôòÔåñô¿ÿ£_J×Ro>ü>t½r\¼$à2Û§™òábn.p+@¹gÇÖthÏŽ´Ç{Çó¤Ü€8iW½}îl·\«ÏƒÛ‰¼üÒóé?ÿùôÉO~"ý±?ö©TrÚ‚€\›ÁæµO€´ŒÍä¦0E"‰gùzú1ù¹pá*SÝ‹(N¤LÒúQÄmÆYÊÐÐ@€Ý'?ùqêú8Ü=ùÉ'gޏ*\*ðû9Ûñ¹µ½¾­||r‰—ÿò“NÕÁ G÷¢aäÉëïoó¦yq¶ã¥Ãó6µüò—¿‚¹ÙIöxz>9ëA®}sd„,ðpÂ*O¶lf§Ó;ÓûŸ}6}äÃNO?µ¿ú•m3Y‚5V ¤T+ÛJã¡È/ª£<éF|y68œ^d{–Kiæ­è'}?ÇŠ¤©‰Qp 3mÁûU^#o™–Ôˆ2ø¬4cÑùV•Á¶d .^¾Ž¢qc\+í±¾±±¹4rãJ:rhg•/nÛ¾î œY³–@¹)e5¾á|h/»é¹St•ˆ su\&†)3d­ìñÞÉ)ã"GÅ©_ÒЗŸŸ g•ÔÓ‡ÏK[˜é­0\šæ“ åò=3–ó'FogJ©bˆç"I™~©òÍg^Ó¬“¨8Ê é,¡¼­½_Bp0 b9P=ñü½¿ûs±ZågÿâϢؑ›uê'w  G¥šX¦\ñÆ—Ó§‚µ[·GE ãpßÇT$>“NŸ:ž¾ô…?ÀÛûO¤Ÿø±eê§I¹"¶:€“¸(Ç>ØÿŠnï8çâ“æ™A¸ÿØb™ ¿¡ÿèŸÿzzþèù´ñá'1òÏ^è'®]LC(xÞ¹%=ÊN‘‡öîJ;¶ô-Ý&¸“‹ª7á‚P,½qùJÙ>ñT|ñâ%ì/ÿEÚ²e â’ŸVÈñ|Yñ'‡(]£eœKÿÂõ‡ë¹¸V´í©Â~X•d·:~ªx®a<ãè Ân‚QgÞGGl áÙ‹ç*€4g–ÁY"E4‚”g2MÿsÊTÌ!* åT˜×ßuYüæ3Ø>ŸË\N>ú|J*üh£é8`ñNßåÐ8‹6º‚W ç*€ljI”gc}aU ³o†° ©ê vËâª0ÇïíÖÃF•òèðÈUyŒ<6¥Vim>«z‡HX°<^rþ&fåzrÊ|ïÛõŸªæÚVµ"³ïö$O=ý1¼Š™pÄæ·.§â™á¬ù™¹ªGKXUIälúòvÉR¥öáôctù”’L¿ªšÞrqÛcÉEi¶Â¦!s&ž5hα´h„œ®ª³Š4 >¼¦\&½ç¡w +o“ëÔÑĉ'ÒOþÄO0P5Ýà‰ç¡ e#ד )ÙZx¢>÷>7x®,K®¶‡ oc_êx(~h?r¾M饯~7ðC!C\Dñ¢ay4¥ñcdW~ B£î%Ø4Ë‹é€ò5ä–´šÒeiÂeêij92駉—Èà³Ú&ü°´5^Ôáo®Ñ‡}Ò­© I>äfL08VÖq*™Úåy·_¶æ¬¼ë¹­3d y®¢ÜøåVí`¾O«±[ÍùªTå§‹r,ËOóxŒ²"?7ª#ïˆhA.C¸ä‹r†(Ç(14 074ú–ÓæÜžªH³w뻎àwõÔ½ hF²êË ØV•Ù ‰[ùž‰ýÙJpÍ}®mùXî}»ŽMpp·*KÇ–;s»¥Cùžyʧ¤öÁòÁX™²Ü½åX%kNíùrkrŽæû¥ìœ&?®Õ/qKñ%m¾Q=Ì·i[)¿¹nó”øæ‚3NùøPeª(¸;v,Þ¢{÷ï °QæçHÈSyM J…DÆÅ(‘ 2´!7 Ù›¦¼ydm8õXDæ¤LpÛæ d…[ðI#ßò¯•[Zè– |0ߥÌB ]é-çxxïŽÔxòÒ©ÔÁšðý8üøøŸJîÞ’6õòøñB À”d–¿´&-,Ó!nÂAÇ8%á¾v1-}áùçÑ$ŸÆióæèÊZå6¦¢ñ•+hÔB)UtãH”e/ß(×ËÇæ³Õ)—éÝ\pŽ-€bÙ¹QQ|™:×ë¥g9EÎSî–cêUµ²D›5ò™¾|Œ3AÓÇ[%ÓàEncó­ª%eÑ\Õ­çͽ²¤æËÅ”³|·¹Æ¦óhW.#§[YÖÊ«Râ·ï¸à̺µÁv.wp%¡J|éL!B‰/%•cIWß5Úü9,'Y>+mÈ©šë4M¾.ùM[¦wËã½|?Ÿ5JB›ޏ‘ïúë\Î-煮r¥P°qþÆ[oÆv;÷ìÎÓ7L‘|ã›_S¨F!Fœ€ŸŽcgdÊ*5êÊ…³i; ¹Íi¨TdW .`¼Ü´8³Š,Çç<–rÚ#yWùlݰmêK7®œJýÞïMýÐÒá}›SBÊ8ÀJšK_ìT¦—Š à9éoõÊRØÖØ`ŽÛ;Z (zغu+Ê›NħÒ3ÏD¢í Ð>Ç^¼mß¾÷|—BNòà̽×27oL”’o•Óê˜ëòbe0Þ_›ù~‰+Eäû~—˜ªœÒÕG“® ¹Lò hªå¼JxKF(”lî«ô_•¯Ê~ÛC®tÅ­ÛD5îSråSE5šJ(ws®2:ó/\JâXúé3@ç4Rßr˧Qà·ý 7uð¾ª//…”ëêG,ÑAêÆÅN qš%yUv<\Ä•$ÕiI•¦5”c¾z×ï5‘£ô-'.?m©%j –‡šAÀ €]¹z ûÏ›éÑÇçÙà±QC¦KNÉ< ÎërÃ{2?â£,Ò;…:ȨÁ÷»[^¼p!íÝ»—»Ô‡LÕ‚C )#u<ž­þuß¡pÍ™"ü怡ε]|âÈáÔ‡š|Û »X fÈ9£ã®dˆ©¸!­ŠÌ´ŸcãC §E~|’J¼J æ Åe{öìeÕÊulzÙe†/Ívä>sïIOÈC/sV©Œ²ñ‰û‘Œ¯¨£ ¾ ìRÏfFS9Zö2·Å¡q¿T\Žùvþ&ÎtùV)-ßZyÕHÔÈWUZ*Ïñ+"‰*…Ü®î*GJºFœùϵùïVFä-‰Ê±Q`>¹%:Gøë4~¡xŒçãyTœÓ­,ívq+S¼×W>±Ôq õÖYoéäí²y¯<„¹.ºkÕ%A9Z~E´F“›ïyÿv=ªòÜþfäYþºµ¼¸gMÅ”¸eÐl4ˆpî?À&hGI†woN`çºï¡‡‚G˜Æ¾†Ur8íEÔGÙqxŽFsh4½Ú¢êDU³®-©¸£h?;ï ˆu»Î)VÚìÚµ+s©¤(ùhùã9¬ºà@9è .%zt_¥ÿN·Hkâ‚ì•ïDaÂtõÜi¶ñX@‘ÀÌIœAh§Sè´•h™{Š6'9š“-£ª\ŸÌ·Š@׿«E¿|™…Ð\­y^¹EVã›§ æô#ö®¥®üÄ:ñ^þ”{¥¤|B… g‰/å{ŒÆ—cS \ˆ$%Gn—É›ï{½‚4.X62ÊäËþy^BÄsq§cI»\=1å¢ùX®>Vš4BsJÜŽMé˺"¹OAùä^/wjEâoëźeœÖb5¦‚Õïeƒ.¥³ÜŒû9“qUTsöEä”Ëé㬩ÜÛä/e­ª­¹¤¦sS;”šsñdV® ²åçÓt~,}Õ1nñÅ(ŸÃLI9g'öm§Q^lbyÞÎòá8GXµ¢×$½òK9H5¿~<—³j'>d›Œ–pP¼œªµŸ‡ÛÔþs#&90©ÚߥŒ>2ùV—+\Q— 9”ç÷ì/eû‰µÍÀˆ"ÛÚ ´¿¯/•\8Fë߯úüVTÖ6§Ð5.Ô>+Y5Ä2¸}ŽþPlÔC.Óq¡üX® Ø×nÄÖïäÉ“Ø->• ¨¦ê6/ÿDÂ|𔑂š*î'_.'¹ÍY£¹q‘"·m9q.†DŸ– µO­ýÏ-Êç%…GïÅ1d*RÉ+)œs˜ßTE6ÌEF7B®i™Ê9Ofd¨³TÒH_NJKš k:Í©ªˆ’´d­Ž«£oÉ^D#š2¿"ñòE¾eÿ3½šr}ÛON¶Ü¸Û·àn÷oŸë–ØÛ¾UîTýZëÍéÊoqK½Í·-ÒœUî÷sœ?Tsȯ1åô~Nã82WÉá:[ëõ*óöÉsi¶òµSYB9‚AMkìö(ç©üSó¡.ä™~tbà2¶ÍÂ0FØðˆ$¯ gJy£"dœ:Téa ÿ Þ“Gµ÷Y£ ç‰v†Û´øNñëL~§¢â^õµ\ìòYóý[Ë)én¦-w›ÏšËË÷Kªr\™¢9vezÓñ“V/!/£ÖV¦œ.‰[åÚáÏݘJoœeßóžÁô¯>ÿ dc˜çô§9–'.&p—á.I;H%èRgãPÚÆê¢í¬ÆÐ©Çn–ÏmÝ0Ķ»ìµz.M/¥3§N°öÉűŒ.¸NÊsÖ+7–ºÌ ¢ö¡¥Ò(P5wwçA‹L:1.ÊÎT‰’Ä7§Î[Yiu…ÕW®ÿ­|ÌÑ©3× \g=ËK@CúVüt†ŸW䤻 €s(À\VèB·plÌô\KÁWÇýÃiã¶]éèÉS¬í¾’e¥Ü¾/®v6Fÿ©£y æ×Qé87íÄê°"®\4§ÍqåNÎ^žIcWÞ/w–«Y³\NÉ»|eIË%¬<+©|Å.÷¶´£q\®(²çZš#›Ï—kX{›‹QËÙ–ÏV'X}]¥\ŽÎgË×ËE}'Î*Žó;Qõƒªs%)W^­§Ž;ç¼õnSfÔÄóéeÐ,åÓ1²`z•õrWÆgÓä 3>ž.Œ]M]§XæÆðíØj ž‡ö²âf²CxÏiL{\ c“r…¡®§¼m²Nû<·üW‘åÄ÷*®ÐÌqÊWá;]m¢í©KTß9z,ö|ת@—r‚žë«9؇E€RO÷Ó¬³»Óêë86¹†²GÏPîs/W.ðÚtqt"+ÀOé–MÓðà`죣ôö&ùfát݈LYgy9„œÓV/ÜYK{—p‡[™€ï’èå¬å¬›ïÝš9U¹Wbò±\•»w>–ÔåxçÔùîzÒ®¥¼“æ»­U÷.ã|0ôø£”@¥Õ€ñ/ɯ­“…¥Ž>vd¼¾7íØ‹Õú`êbMñ¼œÞr–¹§,Ç”ãĵÀ¢7¨œ`̱ÆëÿgÆfq€|#ú+lÑp!íc}þÞ-ýé r?ùȇ)§  `Õà£ã EØ §«ñàÅWnllúõ«¦ßÓï`^Ë6„lPZY“`—ëÑm-uŽrsd,mßÅKŽw˜[aÈ1¯xZ`;|’²„ô*¢Œë|&q°1‰›¿)_$–ÏG¹¦uñ’èå1 xnâÅáËæ2ÎS.]¼H‹žŒÆÙ.Åó†# Ï#¦¢Ku^j ¬•5p®•RëIWi†Í"7å =zâþ6‘[â|häZ4Ça+ú˜†Y(G@Å)*r7x&"˜]x.Ò“» ¨‰V(…8ô.9sh$xêCG.ú]… ¿ÉçÚÕ+¾:ÒÀs ³¯žX pOݪ3Õ¸#jà¼#yÖp³ „IÐ’\¢@ЯÝOçÙ hãæ=áä" ÜQt¾•}ô6¥oÃpÎŒoS§­¹ L“°ç„Ϥp9(À”SàBûŽá·Óó¡¾-©op˜$°rCä«–]樥ä7ùðv5Êõ<ƒ¶K»YÝc{/ ²Pžù@ùê;GÓ«¸H»Êô]uå™{p}`ï>¬ 6²|tSêÜ©·GÏ>©€­ªð7š/-t^1…«³¦ó7ðWú2>9Ÿÿú×ÂKûÃŽÛŸ$ä›UÛ2Ä?øÞ×%þÑ¡@ œ÷õ[ “ò…SnÏ4Í€…À©“çkW.à¸ø ¾& «c¢ÞÁöhÚÕ(·ãy¦Œ|xOB)´ÈV‹Gñ, *&Å„hÞóJ Ñ‚)0KhÙ Á ³ú7â•é¼åð§BDÑb¸TSV RHÔ‰ O(‚”ÏýÁHän*ÊÓª¨ ê„“i(×¹eë¶ôZﯽðbzåÕ×Ò)8ÃIÚ¿•½‰`ë‡ýûÓG1]Òƒ¼«„|„ƒ!‹uo Ž­:”ò„¾-²‚@wi]È9ûö„ãÛ·ßz9ðÑôÈ#-Íd;Ï8r^‡š÷C8ï‡z1 O¡È‘ìÇàQÞ¨)ãÞÉÕ Ï§¡á©ihKOv—ýl7Âþ,ØfÆpVßÁT{ž©ù,igQ¤hƒ™79co%@Õ­5ÂÇ$Úd}%.-L0e…#ëJÝî\(* Lê†%[B< ?ÎX=Ó@ òD9æê6Â÷J—É^8ÌêhŒ/\¹!ŸT ¹ ÏEÿþ³ŸO‹¿÷û8åˆéûû,= ÀØ·ÀÌžlw/b‰X@ùº“Ó¡‡æZ±õuùÒ±¾0‘™º»µÃö®}€è9ä¥EÞjς㌿êPSàþ(Pç}ÐO¸¹rèÁÙÈþµ2EMéÍ£'CÙÞÕŸ¦Ñ"O³ÜÐÝgBØMm-;HËîl-M‰ar£šc8ÚÊÓ_g/¬—[3LMÝÄk<ÊéWnv™ ûùÐyÞn2©—Ál‘]³…€NüÈùÐð]BD—‹tÌ@•9Í`Ãp’ržÊ2wìÞ“ÞÏNï{ø^6…çð·*¡1*‘x´Ón•[zK ö“¶‰Çb¾46±¾¢€.ŒZu´-pº»æÑ£GyùÌÂÙg¿“¶'€X¢[œÄUýUS`}¨s}ôZ•ZÈñã÷2 Jš"‰dàcºrs4uö ¥Ë7Øh Íú, ©³b•ÊK•WV,9Ù pŽ ‘÷<êt.‡µèê"q¥ÇN‚[ØØlŠýÀûYΉ¼iå8(7Zšƒíä†÷šÑ³9ÉzÎ-cu=7k1¡ä¢/î éê!9Æûö¦ïùÞOàtù`D†Ûφl½\£é[ÂØ“[a¦rÙFù´óXMTÅN4ƒ³J5œ³ÒÊkFïØ±#¸^Ó²ëPSàAP Îû bžæÆþ„ p9£ÿœ"{‹ûâ€egÑölÞ‚=gwêb…‹¶‹š×ô3r…c¬!NÒ­–²Nãùhʽ¤]1ò&é8&=SÙ§ùØknìæÑå ÿ„E>6¦Œž—à9Ÿš¹¤ª¬æ:J]ÖDk˜jÛ® ì5>„EÀÃJ|ö}x6ÏŒ$˜Ü û>¸eDx„‚®&²©AX‹Cù´ÉeVí Ëp¨BŸÝÒm44º×á‡ÀY8^iâ¹ÇX¥e™u¨)p¨óˆÖœ%ƒgã`ü@¾N(Ø_~ô&ÛÙŽ¦ÁmbP;Õj[9ibÇö™hÇ Ü¬.GTé#øºš¨w` @Ta+œÛâÔ ›~±%+Ë;æÆb•ëØå¥Ü2VPÉ_¹±JýwøâvÔãõƒÑùÅ:%vêíªŸ¸ëMpn"'ÐÏÀY ž¼f¢QÁF¿yAKócýÜòªÑ–´á%ŸÓÐàäÙ$gNѯ]»mñžÓtÁ´„üb)Wõ±¦Àú(PçúèuûÔM(”‡µ†CF.¦Ñ›×X 4 §ˆc‹ñ›i| Ùg{ m».äZu“A¯S…¹[C‹ŽiÀÓêü]˜ùÚð =h&òìô§v~pÕº‡ âŠ[Ü 6™œHdºh[niC·ï×bsY[z¾\¢galVç½l]ìA71ÒÝK'6e“cÜ´o]â%"7Ø ¢ú 0Îû2ˆÆóíµêv»qv‹‡Ž{ئ㺾9M ]H@YÐÒézä«òú&©CMuR Îuluò˜Ž½j0 $qÙ;åo“#7YÝ2š'G˜žw¦!z05ï¦Æ=©—8ªÄx\·= P̉¡'üPÀìäˆC §LÜ ¾€Ü[Æâ§J¦ ‹‚¤²\šØ™kòN¾!gû^„\*pWÉC]ÌmÄ ý:FûnDç~I:A±w6·•¾ëùžËP ŸÜè îÓ®Ùz>vÚcÐD–Óg1t–&®sŸ…Sw/tÅ#jâËïdŸcgJå¨u¨)°N ÔÀ¹N‚5'wØf€ˆá·Òbš3u¹Î˧O¥~Ææ=”6îÜúðp¤Á;û«¥þ^l9+nkIÛM@Äm†'Ùöw?Sh–oŒŽ³f{,ŽOFü/t`õ`ޤ¯NM›?ÙðÊ`!” ‹„–Å _ˆðn9\ËõmC!€X–i±bœë‘Ý@SÑxofý›x.šd *fJZ¨Iã¦m€ \ª  ¼\sØäA Ñãš‚©\|6æW]lK2„iÓ)ö e‰ç&œ€È‰/ž* - ž#ëïšk§@ œk§Õ»¦t)¼Ê9N—>zè@úéû“8ïÅ‘‡ËϹíÎßúßt"*®è.ÍÁ]f’*Öå:ÁÑÐÌO ž¿rõz:sþBº„1ýÙ³gÓ…S—YÍ>ƒ— =Â[+å‘§°â2²í¢Þ|í]ÛèñÞƒ¡®ó–C@[”l¬ÜŸSèX7Žâje—~2'Y_>Ë  ‘E ©œ£*\³Ur—ÚªVÈQ6·Y: ~öÉ-uå^3gÛfI.ÉG¾<<4ˆH„ÖQº¼L˜ªôúPS`í¨sí´º%eƒŽÇàŒÌEV·àq2@ccô‹W/²Î~Ln˜l£$ÖÊHÅ+f2—ÅÜ)¨Ëc¢ \—n71@At©¯=íÚšÛ»!M°?ùÄäãé Ÿûƒô*Ûâq/;_B1=«Ë½`Qfn§ßòÀÂ+¡<«¼ŸfW\vSa2´^*†˜[˜‰š;xܵc˜˜NƒÃ®ÇGiÓ•¹Òy€N/Qbš Y^L”| †…hŠ SÑD0³T$]ƒ{æ¼{®w×2aœ=ž:öí·SLñ_ßNu¨)p¨ó>ˆgV¹?QÈõþÉ=¹úgb g(D`ˆ2¸'®§$SÖg °,­lœ Æ*xÚcÞÏ>: S 2Í ½hÚzÓ…½ÛÓÛ/a(NÙjÔÍÝ¢]ˆrïާ梪“à(©3€8_ÄÂÌYãÆø¶/UÐHÅÍ&Tcˆ¶“` PT)­ãÍ2ï”Ú†óˆÕQ¼<æâ&i)§ˆ5­3&ñÄyÛxµï:6d]/òŽŒŽ‘@K$Æ"qiœ-†{R‡šë£@ œë£×-©ËØó˜!€cà{>55Æ6¬ìË9çÉõ, kÓRN׺óxš‚\•ÀËeìËR'Ä(™ä¬Â zpdb”É¢ž|öú®ÚÒ‰õP¤ª.—.ÐWÓÍÒ¯ðOZób{œ˜´ ãMir|>ÜÐMâÄx.[ÀÕ»½4T;Ù¡ÞN ÓÄ$k˜­ˆ;(C¯DÏAŸK¸¨Ã „„žÒ޼:ì‹—õú~‡¨TWû(jà¼ÏNÆO‚ P‡$À ’Â)õ$7“]€ujgn*¹!׋GÖâqå¹·)4LtàN=f\Íé㚸Hj³Ãâª,òVED9ߎ¯ÜŸª¦Üüè—íœg5“=Æ/ /¶Ô˪´ci 0dÛ!@ ^T™ayîéó×Ò™‹WÒ¥k7Ó5”bSy§X:)÷ZsÊ\„&‹(ÁÚø ²jJ[ÐnlÇð}çö­ißî]¼¤°`غ‹U[ãp´-ôV:ÖB í]ÉDX¦Z\Ö_5ÖD8×D¦;%ªÂ©² ÂÉ:0§à6•Õ ±oƒU¯ð­- /F¡m&c9£©'qåI€gLלà’,ŸfK‚〞㹿:„…Å SR÷÷^B;¼Äts‘)úW­¯^ÚUT¡ 2?MmˆqÍ—ÜQ)Se‡€"‚û¢’YÖi:A²e¬‰©q¤Ž<ïÕ—].4XQ‡±ÝØ iWFívÙo+`w[ÔV¦åó-ݬìéA–9›F‘kv èÙºm{:ŒsŽ ‡cÛŒnÖǡ)¿ÿ*…¤rÏ4nãh’f[œ?w.9y2a;;79£f1´÷³´4HÝЈ?Éèvz@ñíÛ¾¢#õEM[)Pç­4¹÷Q„O+¦£óÊ͉Էq{jØ”FˆÃUÒ<}njfнràH]b9ÃT'h0p`eàÒÅRÁÌjzQ|ô¡éÃ5›ûµ÷õà¯õz[äL]Ïn…Á}Fëm1Iãʈh^¹z Gå‹PN=†6‹vðûLä•κçi«V­×Gx©°÷ÜùÆýp„?ùTÚ¹s+Ø[ s/õɉ1œu\LccìŠ9ËZ¡]—NÊOõ†Ôׇ6½³;=r`OzôÀÞ4;5‘.Ÿ;^yá9ạ̈佉I×vÀ[ç)´-ÄÚ´æçïF/ꓚw¥@ œw%Ñݬx€ƒ8¦ÆxdŠÕ>8âøü o`3‚¦øàéþà®péSíUöd–‘‰¿ì*`ªºGë×scŽŒŽMÌðl®ïÍ­,!ÔüæÜõ ä€(PZQI™è2[z›vs»çn“b}Q¢PþÏ[~ Ï ´0Xìäš;qôa5/ÚÊ\zïîý85Þ‡;4 à:q”Õ>#$ΞÙÍS‡´Q£îËEGξ(2àÞ¹×ѼґNÀS0ÕuÝ{Ð<ðP:{ü-œ£¸Õ2ü=tu‘¯Ø{>ZÇWj ¬“5p®“`ÍÉ……2õã$ƒ¦½&[†§l"öÖ¹ëé÷ž{-#S›Ãvs±µ+ÖhwxóØè´ ÛX,KpP ¯Ä­nAö×YHóÓ¬ëÖÅÚeäÄu·ŸGØ™Î};={ps`¥kÞ|£–æ%å—ù}Ä<د\K.³œSeL‰5Îë+ú¯EpŸî?ôÌÓOx]éæõ+éäÑ7à0‘mžr™Pƒ)>Ä$è–Nîp‡ ”ÎLäUË3EOK3±Æaq,, ºxãhß97q3MÂÙŽÜÀ#Up™4&3ç÷K42j©¿j ¬5p®V·M)C”G¡'Õ9ãÙÝ&˜‡vôoLcóì!ÞÉö¸=øÍ„+Rk1  -òñZ罯k«cÊ€Ê!-Á¥àÃTÈõÑ/q=GºQ¸Ù)÷ZGû\ÕœëÿvSyHNü÷‚˜l`ËK¦×rØmhf4ŸÒW¦Ûg¼ýÖ›é:^ñ¾/ ìQÔ »ÎOú°÷ìÖk<¾5ûúØGh`(u²IÞ Ôýˆ ]B‘4Ëê,¡ŒŒŒâézšd}úüäh8F™XÇÆÆóoªþܦ SÆå8­¿j ¬‡5p®‡Z·I[ ©5D€#öÃ!í[ÖöoJí=¬›nc¿!¸+ Añ¥-²›a´°S£Aíºk·[08\ZÂð}׿‘ÅÁyÉQ.Ì£Gѩಖ:U×k3õ”㌠—é1J( ù*Ÿ7_—ûËwÖsVdœÁiFFASjd€r_õìÑÉ4 i;å‚oܸÁþçgS74Ø‚«¹Ml¬£ÍÛ¶²òæ áL(¿ÚxQ¨ÃÕÇœƒ,-ÍÂÓ#EøèÄHssϦ´‘½†ö->ÇŽg©‘éÚ…Séõ¿’¦eUhCzUí¨S{ƒ"‘Õ”‰õWM;P Î;g-·„‡x~…©ò<¸!47p:N9qÕ‹"G®²OF keš.—ÕÂ:ô¼Îî3à}¯2<+“cßÊžëúªT!æD* {(›º(kAQëNL !BhŽ(7ô±ÂÝ"p&l¨¢ã¼ %—æviуà9ÄvÆO¼ïÉ´cûÎ{7kzuöêHzãôÅ4 §h¿'J§èóÈ…g?!ã„ÆôºÀ©R ¥FùÙa2«©ˆŸaú<¬ÿNEJ×°ûR‹µð²5î‘5pÞ#áÌ&8€ˆaè—9àl˜t¢ÑÁ©ÅŽX;=‹¼;YÊë´‘Æ][°6Ô˜Û}Âå‚„`Ap>Œ½U|(ÒH£ãßv÷^9– o‚±?ÜXg(=(‚²M[SS¡ì½‰¥J"Ä#kæ¸\d¥v—´NÙ©ºëëUæÌ#ëTQvùÓaľHü4ý˜%mrÅrÍv½&âÞš5ØIDAT%6^ÓøòÄ6 ¯ZõÅ^:¦…Ö¦¼TbÛÄ##“˜iMóÒb‹‘©ÙÖtsà9ݯIoúK€wX>¼g”¡à:üGM8ïóçuÊȘ$D ÁNÈSΔIvÀYγ…ï<Ó˸Bwîø˜^ÎMO¡èÑ;¹0cj*Š«nB¡ÁQ[H»@aüÖdz̲¸Ž^L¿àv‡R/­.ÄÊ”  ×QNýõG5pÞÇo.H¨øuf¨€œi»¯Ð5 áRûµÔÒ?÷Ô‹MfêÅ™q/J"m5;s¾jÚ¨b(¦è¨Ò)´ìÈõ¬@sžy¦¬3lÖ†`ÏKSøµÄFqûH“ª®ª!£@¬øìEÛø¢±¶3k.¿Ä}O!Ê“úmÖ{$vî£$ZôÞ¬9tigÚ>uAï¦}i¶kKšëdÛ¦äÓÒlCq4ÇQÅÙÓ÷EÊ8¥‹~NÕºñ2B@àЬlYdª”2½¢ÔÁK§k ÝœD‘7;0Hy”ÓªÜ5Ú-LÏgõwMµQ εÑé]SÜXN §%\€#()0‹Ù·sk€Ã ÝKL!g¦n¦)ÀMÎ'€Ù›¨kÐØ1÷å$ ¶¢êH:˜¾*ÇêëJý-;ÓĵS(ÞáÏЮ3Í·œbßl×)È-¯Hº}g¥ÜÀþJ©¼Sà÷žŒ`Ôå¡¢ ÐÅFuÝXðiíN‹œÇ‹:Œ!‹¤}rÜ‚ å¹kè狼,YPæF¥Óø¥jÊntȘ)gFMpøàváÊ£ ò÷þr6±5ÖB8×B¥;¦©¦¥¤É Âgp:>²—ÙS}ø|()²vwqDfv—Œò%dsÚ% í|önÛ’ö> h†Cã<÷t±°oÀé6ÁðXFl:ƹ–9F9&8=# þid›j¤ÇYŽxîÌ™ôå?üûéMNSrሡ*›äñ¸LóÆj¶Q`²\+º¿Ð\M'”ëµ-9J¾\FÑ/ ûÀFÖ©¶ÖnúmŽÆw\G[-O^•ômá%¢Ô3s©¦’;·6Óy4Ž#Òˆv xiU'¹’h`Uj ¬‘5p®‘PkKæ g¸2]cÝÆçÙ§ß—>þÉLÝ=‚# ɸ©*úpS|ÌS˪‚È[ 2Žã¸6½i¦prnû–ôõç¾Ç9 Yo§˜ž‚a²”sæÌ`x@ ™ ËßRªˆð*ÓB04D íS©f]£x_6Eí8#©2xÏU9¥¼8’Æ?ï)/,€fó´¾´@ÿŸ³ Sl©,ÌZ …1s‰qj5u¨)° ÔÀ¹bÝ>)Cÿ<Ü3¯£pÑ=qœ.áHwÆ ¼&[aþðš‡\«hÁ™U—÷}pú\ʦfŠjЀ孃«ûö…ø–I.aJÅäô(o§ç™»6¿hsn{e|ÅQF*N•r3„f04§·m—›ÁiÁ4u¼’%¨Ð¶j’i›N½¬CM»R λ’è.  $™Ï à"Nù×_úFša¹å >¹BÑÌ»ÂvsŽëE€M/çN¿ÃeZ 'œ#]³¢yÓ-2”Ó ,3Á­1-gê9zí2ë±Ù—Ï^xZj…ÓE!ÔªOd‡rY94Ãçå³Üú’ò^ŽË¥X®W~2ÈÙï®rà n¼ÈnCaÐÏrHŽN×C¶i.:¢ WJÅŸÅ9)§ŽYœãBžKœ¯#AØ·øjBìQΑøhƒYüÐD[[‡šë¥@ œë¥ØªôeÀ¥÷†ïœŠÖª¼sþrºñò·ðŒ„}"€ CÞvæëÓb ÞÐuÒQ´Ç,èa’D.—¹È4SÈK€¯kØT ßÛ[6°~ˆ•1¸_S°l¨°5×Weè„(š[*gV Ãcó={²ö¥=@ʴܬø²åºá+Q’éÉÝ¥“"ü :ÉØÎ¢€Ž6|”.b’Lg'J-5ZZP£ÎK€©vòÅÛŒ>BWTipo͇UXž'@œZähqÒâ¶ÒOqɨ·ô¶£üú«¦À:(Pç:ˆuû¤y4†¬.0H A¦&F]ýi±{0Íð™8•êͱRH@sÝy{ø¦lÊT—‘-ó$@Z”»eÊ…º«£{9ò0 ;æÆÒôå“È Ñ¼“OÈÖÞSàê` ‰BDÃÍI´¨ÎsÌûŽ¢map€¹²h/qÞÜÝòâÆ•‹¤w¦Ñ+çRÛÀf¬ÍlüÞΊ(—dº@’uGôUËè¢JÞ—´ˆc¤úítÊߊÌtÁ àü`zÄôšIS7/¦žÜ«´C/cýþB®o¨ðÀÈYô]L8ïëÇ*™Ã7Ð!dŠ£²½w(M·÷¦©öþ4ÛÑŸðÁ9 Î°”Pó¤Øh-4ð¹a×8Èe:mpÁVÁÈ}ÅÚlÁ•û.ÛdŠ '“q©&Vé¿r‰å…r›Å—e”l3(á ã@ÈhA¹'Ô—YÐÐì+{Õ*@îÓÕçK,E=¼oÚ}h/^òGcÌ7¾„ÓE‘î».iY• )¸ìÌ\Òp_ ÒiØÅÂQ¶¤:Bò©E\/.éz»úÒìÆ”.Ÿ>Šû¹±Ô¢\ºµÂéû»)P¡T‡šë¥@ œë¥ØªôeØÅø 0ÊƒÞ dgO_º‰æ§“uÓ.3d^rOÌà™U³Öí‘‹™CÐŒ²”ÉaÆ4 еÞÊ+ujk´Mr¬«ÍMÉÜÇ®us¤ÙYÊÑ77çá¾Ú+¬Å ž5Z1”ï4s‰VàYpÌÃ>”"¸±Z" ·þègõÓ§>òþôÄ3@Û©þE§‘áÎÓ¿ú:ƒc •‹Öï¦rË ® ¸¤3¨ED+ëÛ;)·ù]õš¯(DŸŸ]Ü;qôÍô;WO¥®´@SEÙ4„Q(×u¨)°N ÔÀ¹N‚Ý>y@F€‘\P̪ ]L;»˜jöÀaNÈGÁéˆßÜipV\ÆrI²àHÚ`¶‚:QëÜ‚¬ÎPÂ}rÁ]-bf#>ŽaÓ915 `°[$×G˜&Y–à%"[§Ðƹ€ MÌ}‡(Ò¯ n¢HZEkàJƒæYîÔ ‡øÐî­éÀVý“ò!» ii7'×Íu¼R8~[Mõ§Å‚éy_X†=,×FGYv›‹©ëƒ(¡ Ü¨Ä©B¬çGDP‡š÷B8ï…jÍyD ƒÀÁAP\ؘ”º?Ðù«c©S/FLÍÉÈÖR.áMŽþ2ìƆ†˜}7tè±ÖçØÁT^x•[Z\šæÞ vÌyàÌç&qôáff¸OÃ0~óÆ>8´™à:…\¾3غêc;äFfŒ»Ÿ`þLÏ­Ì;çTØ~U)xLŒŽ¤Nú?ĆsK®±¯&ãrÊ*‚\RK+#¯ehNÅ¡ QSu-é}/xÙ*ÉiCµé}ešÔÛ‰\9 Ĺ"•œÄ,u¨)°. ÔÀ¹.r­NÃ8F®ƒ8ƳQpTv »-M±Ccëø ¸¢)0ް‡Íʸ ‹S$Óåšb;œ"ƒQSyíQp8èg'Ç#n °dý%šhv¹„[í”{ûÙõ²ç`ºpêítãæÍ´o׿p ,`pXQA!Ú¿ª•MGNï'JÁÚUerÁ8s­ ªà=Ït;CL¿ÇðÌÞË.–C}Ý(kØh ß›rafÒ º’0ÀÒ/A>­Ï‘ùŠs•g.K•û—íFõj­Ÿ¡wx‹âeÀÎ?r©åõ‘¯êïšk£@ œk£ÓR1jc@›Ä¡šLHØ~˜œ KiSN{§GEÂMêéœé<@Ù[æ2˜Ønîæt=8Mî· *ÄmÀáqOÜëpÚÐß“6ö§MÃCxPïg»à®4Á:ø_ýå³éƵ+Ô|(€GÀr]7_´‚B,›¿ÕèÛÄ®Nu·ë =y]ê)€°Ù.Ûí#\ò8[" f]È$CÅ}Í­²í¦æG€\–Ú^FEF‚ùJ/2ˆR.àw£¯9½÷\z"^è`ÛòoÄ-*Î8e×_5ÖC8×C­Û¥uð±JÈCpu"qm 7ÀîÛØ“þÌ~æ7‹iœ¥‘£¡ü˜ÆÌÈÝ0gê1ßt; ׬ (½8q/õnl>‡p ÂÈïloáºWœí¡’kWZÒ`WK»z%¸\ƒÈ‰e'Ñ"Z&lf”°¥Þ÷c£ Eĺ¾MçÊ¿œ™†/Sà̦›‡÷K{ºÆ^óìÃÔŠÜ7ŒÒIЈLúcƒÂv:† §ù?§ðž«O•ŠpÈ-°-ü‹¡ÖMSÆŠÈ#ƒ4J3€™×?™-6gÎm u¨)°V ÔÀ¹VJ½Kº:B”AÐÐûQ£¼)é0žÞ÷náZ^Æs€¥édUÏñULb,é*x °RLŽ¡íðÎC™hÔ%8/¦ÍúS?ë8oœÚ:ª”8Ä”óå3O”"hæ‹ûþ¶ÇÍeŶ€¼²ÚÒÚv\hpfgC{½å»±6èêÁ Hf{è çYaC/m&.Â:@ÆÓ>ç‰|®Ôz8‘ûÿœÄYd¼(Ð4óˆ7ä`åxK›lgÜŒÔDç OêPS`M¨sMdz÷D1¡G-œŒœ _©Ÿ-nÇÇÙû  :†¡ã–<ˆü0‚68ÏEð-æX!âÊç:À0ŽÞFV8¨¡¡Átùò%ªQsÌO ·æšð˜ÎR¸åDÓ86Ÿ›¿ªÊÓ{ %¿tˆÒ©Û:u§È󬨑»•{ìàM0>>š†ÙÍÒ½ÒËEh£Í«m*]åã:­ ¼E‘@L¹ÙúZ™¸ÛE̹P¥Q£ôp*oyýP†òcÍ$p›ñåÉ£²h _ÕÑס¦À:(Gß:2ÔIWR@Ð3Š‹j8 e‡¤CiÆ9a>:ŒÝ8£ P;ŸÀAPEל•&”+ÇÜ'™ÂÌ0Ðòºòqõí;¶¥ñ <Ëã$E Ã¢¾<%LV¡ƒ—«¢ˆY¨Ê)tÐ: >”dœŸvD@ {Ÿ¤+7n¦¾¡€]Jã.Y§?-‡j¾žÍ‘°LUÅFAБý‰æ ¢vÌ™[.Ëøó¨s9áÖ»rô(‰ª—I(ÊJ‡£ ªu¨)°^ Ôçz)ö®éŽtBLÀƒl+˜M¢êC‹î´ðd@³Àî ¨p¾)Èž9ÜcPç8¹§ªH‹œY)·æÒÊ]»v¤¯~eŠ½Ê¯§nV̨h‘uíwºEG¹U!¹¤êâ–͉îr¾²`Å ¹"ûãynÇ‚â\æ…ciìÅWÓBßÖ´ÿ¾´këpdîNÀ‘·„/–@=Ì·¤—¢x H¡(Z±†Üh) ð §€k‹&Fr”ASÅ 8NañAb¥ÐæH¬µŠ¼¶Ìò$£/'¯ëPS`=¨s=ÔºKZ‡¸LƒN…ûûû8[JS¬ì Ö>F¬†ë:òÍÞŽÜ×)¦Ù (ZŽ\›ØciA NU„kÜ帆7£±žKW¯_K;wï )†ÌÕæfyù€ƒ¼5ø)¡º¦}z¬wÓµyä—pF2Í6Á XúÊ+勞¿v<íÚ>”vlÛ”öîÞ•¶oÙ’6²wûÙ…Œ¸Ãé6¬)L)/ðTQ…€Ý;ÙÎøè#÷7McS¸˜eE’/‘vÄ_æ½ã>™<6·Ülu¨)p7 ÔÀy7 ­÷¾€'2º{P€È!MNNÄ`×Å™CµM6Ç)'zžÁí ¢F ÉÂñÉ*æ)¸°0'_`¹¯ pph¦ª#]¹r%ŠÉÊ&ë,¿Q:'¶¡|Çé}|åþXZ b„\|…dTÌ–ð„ižŽ\™À{=kö[ú·¤™Î¡4I†K§¯¦î+7Sÿ±ói˜Ͷ ÒŽÍ›Òî­[ÒÖƒ gù©zêMÉ÷…ÅÛ?74R³î éî5ñ‚é"îøæ\QE.·aî¤ ®" ãwKÈåÄIýUS`¨sĺ[Ò†vœ.¸utv…,Rí±ôÐ9(#[‘žÊWe®‘Ì8n å|ÕÉ]ädM#*»&bâº% 6Ý=½éÚõë(cð R†ùMA x¯‚m žg›Uµ×ê"ŽFË}Ϭ—¯^O£8]îcý}[goXtcà–£È"GoΤs7ð˜tâlêaÚ®µÀöÍÒ`owÚˆCèÞž°]íçZ']°¢}>Á‚¥õQ¿‹‡P´ÃÕc2‹×¨©UGx¢ KœAPMŤ£g™ÿl"¸ ¯CM»P λèn·C®Ë2EV¹Ñß?Àêž~¦Ð×ÁHÙ#ä|Øs:ïŒt[ [ މ¡,WœÙÖ¨~QpÀ“X€„5Ýi TaH¿ÿ¡Céí£Ç‚Óê4•²`ëâ¹,×}-¶Ñò¨ã^¿'í;Ýj”X§je¸6MÒM/ÏOOÄgdîRêèL]Ðg‘4*ˆüȸâÒ$Ðç›ÌÓOœ¾ˆ¬™0¼—Â}¶Å§‹—N,Óä úe#¤ \åÂ4û0ÍLÀÑžH»tt÷æ>CG½Kµð{„â ¯CMõR ~jÖK±;¤Øš¹Îv¦Ï=½p‚h’§f0nGÈé ¨³£‡’ð“D唣\ª€*’+j(,[@VŽ Éõ Æöš =òøûÒ׿þ?&Ó0J©Y¦©=,ï\š-G<€3¡2xáh3§þGP,៚ï6ú5=6’Æ®œOÏ>z0}ô“ŸJç/¥7ŽžJWÎJ-ظvB§ÎþÞÔ7Ù‰ñÿ`ª·¤žþ¡X»¿Èºö™– BÇqlB[cµ»}³sX%(7–ÍTñÖËZÕ´85–æ&fÓü¢¶´»w;í(˜Jóˆ‰ØhsýUS`­¨s­”ºC:p¡ÁÈe0x J~;ÚÜM›·¤+×®!êk O>qsŒ^Ý;ñx¤«µ @pˆ j‡²péoC7÷8@A,¿Ëý7šî´¢¾~},½øò7Ó ”/ç/\J}6@Èf Ï%F¦´å«ûù¶–l™öØ¿+Ç ¨ãठZtãí}iüzúÀ£O¦?þÁ#iË©KÏI‘ož»t%=y2>,óRéLƒÐ­op˜¾ëbO¹1b.dƬCmaÉÕ;xÂq·°”³Uíºœ¹Uø´éc,]ÀG@ßðòá) )†Ó{ÜVfõ—¨CMõQ ÎõÑë.©+ ª¸Æ68AWȼõαtîòH(qܬ]!ÂÍœÞÚÄîF)9˜uHá°Ö G表P iZäà7€9Øm<(ƒ^|é¥ôÆë¯ÅÊ!—o?y:=ñøÃ¬ÖqÕ噣8+Ð0úA„¦â¢.¯­/À‰^A–ï¤éQãàc+ú@´nüÀ ïHwh{ÒØÔéúèX:íz:øŸ<1]=y™©;Ê%€sÑ¥¤¸k×[¼ÊVIiàî"—nß pÎ2Eo™Çã;u,â1jA– ŠB$8 ™ù²Ö >u¨)°> ÔÀ¹>zÝ6µ\V'f3ÁEÔîî;ðPúÝÏ}1ýü?þ§éàáGÒÞ}Ò†›Ò¾};Pz0˜Y¿ º¥ƒ› äéxÆÒŠG8zOgÏ]LçÎO'ON§OŸ §ñÙ9¦¦çP¶´¦c'N2}מ˜ˆé²“}YAÛÖ åÜ’ï-”—¹þ3UG—JÁ1ºdjäÆ(Ì Æú›7bÔˆOìŠ{åúúº[Pö´§mÐåȾM85>˜&ÙÅsŠéù–hNºÆÄo‹‰èëLšžÁ6T.#z‰%§Þ©½&o¥Þ®MiÏQs¸ÜûÖKϧ”ÝE“xØÈ*жrÞèH¹Wk Ü™5pÞ™>ë¼›Gb‘sš¹Q+&9×™F/?•^{ç2<¼mÞŒ,²?íÙ¶1 2È{ûúøô¦®îžPþLâÊ›#|FÓUäêÕk¹°éY˜r£hZJcÓ˜‡/¤G{_½~Íú §  Äœ^;^ÐÑˆÆ ÷V  ×ë j©sþèyh¸€O¢‚ƒæÄe’­¼Fhg7Ê ÁÁ €)«|”}SP!ƒÚÀ¶‘¶nt©3¯e?¸y€—ŠK'á&áY^J®šç#×Ù7º¤SÒtbÅ œXG)(š®\¼®z3mFv*$(Ó´hf¨ù¢þ®)°6 ÔÀ¹6:½kªðeðÅ…L\£ A®Ááaäy3©°ħ&Û­Ýéü•é«h¾ñÆ;xŠg*ÉÀ–kR ¤Ö\ƒv†r¯jÈÝBÃMÌæáP§¸çRN¹¹ý¦'ކËjOÿêŸÿK6çƒ=rh3ÒšÐßµ÷x#ã$°G;so36å‰3uK¸î‰‰9¦ß7RgߦÔ=°…e–Sn9a¡(®t~Ég‰¡8ƒ 7M72bYx“ º S&µíjÚc…‘å†Qùçy©\Y˜`Oõ1^ä²±ÎÐãO®ÞVú—›É¡5ÖL8×LªÛ'T¾¦÷`NͱË~äœCwïØ»{F\ÁÁAjÛè,?ðp^]±t²eh˜Uv,Œ„Y¦¦sìÖèu[5ݸqcÚ±cGÚ»sGZB¦÷ökßLßxñyŒÅ]'—zã9÷q^جªu²‚¥¡6ÎP®óÕú¾Ík™–ç€Q”—IU¯gèóéË×ÓU4Ü7¦pñ6ˆ(Žpíx'ËNȼ]ÅX.L®ÐBÛB(™AUÝO¦7J¹íÜ[„.æõ¿Rñ ðp´s³l-‚†½SÐ*}¹çíâW‹Ñ\îÖ¡¦Àz(Pçz¨µ*m m¹Kâƒ{¨ˆ*vd}Ü…rˆé÷¦Á¾ôÆ+/†‹³ÍÛw¦‡°,t·Å8#=¤O ÈpÓµiö²\7c3ìÚ´3ä•}Lá7`f48ÐÛf\ºp!½ñòóé챷؈l4=óøáôýß÷ÉôïûߦÓ'ާ=ûT–sZ˜ÜoíÉ lf\ÜÛWXŠŠ`!Z-ºÆùá}ž˜9¦ÑóÔ7øŸG„pø_úÌo¦gŸ}6=òèÃiû8hÀ³NQÓ#]À¹Êßä¢ä{á4§Yë®bœ×4ä5ô~äСôþ§4=zè@èM½½L}çÓ‘#GÒ¿ûíßÂP|†•K½QFÈ÷$haÕÐÜÂhæ=ù‚@A!^Ñï|&"ÉÝ …×®^MÇŸHû~<õ nÄ«3½0’Ž_øzúêóϧ§;œžxôÑØ¤ÿ¤tÍ»Jh2G=–§BÝé‡ô‘&®a•Ë_Ð ò§îîÝ4/TËéc©f áY‰ ›]>ùw+)êcM»S λÓè]S”WŽ0c:Œ2"äuŒÎ‡ìK¯|óÌmp:|$íß»-óxzõõ7ÓÌ‹FÙÞw;G÷ä‘ktÜ/Ü"'Ùè­ß­4X28Àêš]ÛK‡z(íݳ‡m5ôþŽœT=õt2½ß³gw8O? ‚1A€“ qžOïû; ÒÎ+š¨ˆ`ûƒ ÀC¾99›®^º€ÉÔd@Î;É´}‘uè}¶}®Ž]Oð›ék¯Lûw!ÆÀÕÜží[Є÷¥Aú&ˆ.°ñZÞ*¹¤ïë¢or¡ Öƒ]f¬²bW–Š?Æ0_ê€v=½z©2í´,ÎIåÄú«¦Àú(PçúèuKê /ˆw4<:@ãŸóÅ´g÷Θbcàí¶[†z…ž´“$Ml&p|1W©m¢nÐfX.9/ˆ2Ð~ ˆ‚æëºÝHÍä€XÝX|ÈZasŸŠÓÌ i[ˆ 3Èày…quŸ_1}¦<@ËH˜Q‡5QÐ\Ö¸;jà¼;îœB *!FaЏ4'Ú€Û·¼ Ÿ9u"=ñÄ“2KxÿA!‚ýa'ŠŠþîA¸ÑA¦ç(5Hož0MBæW‰ë,Üõ2€AœÂDIŽOãð.€ Dq÷Ë>oL›×„¥µèXàQî)¶ å˃ŽN±Fýì‰wÒÇ¿ïÒ‡ŸÜ—6mÝš¾ðÜËé¹o¼žZº‡b³º.—ˆoýXsÎVm°Ï#È_Eÿê©3±œ² Ü>7oÚ€’l€>w†6~ŠòÑ0ã%$`»(à&»~ž’>ÿÙϦ§Þ÷dp”‚K7Ü£Ú_MnÇ*I2ýÌJ§ß%j‹c<ƒ_PrOñÄJrªzVšGÎ× ,™³,%äcS‘±Üê•éÖ|e"Rùx)|; ‹½tî &C“éCO=–:0'Ú5ØÁ®Ÿß“>öìcéË/¿š¾yêŠ.VÁ=ö  0ëJ Ю¥¥‡ḩûxY¨u_JçàLß~íBš:Á‹„m“™ò/ÌŽ ÙþìŒ{Õk³Ä**<#ݸ|>8xfX÷}Ñ0Jâ¾l:ôämmþp¨CM5R Î5jMÉDLÐÁ`ň[ 9ácûXúÅ_üÅtöô”E;c[‹4ÍàêTÒ¤¡»!Ìl*v#6ƒÃ\î*¯·Ž Œáqjð´ÃY¹}Æu<Á˵:%-àç‘ÛRª°EKü‘:lÓr·×Ï„ì8&Tƒáá}nrc͈ß3Œ»·¥ŒL¥7OžIo;–.^½œ®ß`%>ýèîíǦµú°‚]üu{OGÂòK1áÖu×CÙs€¤&PêŒ:YuÔÊ:LûÝË*%ÝÉ5K2=lÜi´teë—ûQŸÕxw ÔÀùî´YÿÆ`“ŒIpJ€¢«â} ¿ý[¿•þ›¿ð²ó 8N9!³iι9Œßá ”cÊiÅ@'^à‹}„(Ø¥”B³îäæ0Uê’sE‹¼˜Œ¢oÈHK'ÔÔçP€¢\—÷rÌJÛ~D£¶Ë@[¥ç›Ønžgº½eÇžàú\Ù³7اáÚ;WúØ–Þthë‘4úÄ>€ó+ªü\Mg.^I—¯]MWG§xH‰Võ¦¾¦é¸ËƒY”›—ñÒs×™³Þ‘ÂÙÝ‘.~T(­ÚŠÒèü&Z}³¾®)p ÔÀy­çv"ßÅŒ"V·lFô#?ú£é_üÊ?OÏ>óLzÿ3ÏFÑr†0g +jP¹ü²š‰gÒP¾ù¦Õ¼ £o§Áó€¬ZãYÀSÛE%Ÿ9s#zV …ãŒijpWëéÍÓÊ—¤Á8íÓÈØTzýíãéðÃGÒM–]ê´@Ÿe+ŒÝûXŸ?37ÍT›øî¶´mïÎôøÞ]i£#l³165›nŽN¦Qί^½ 7:Ê‹aœ…X šXdûkØ•÷Îc~¥|C$¼!a|?5ž¦F¯‡<ÔÝE¥©X)]—Qj Ü j༪Ý&O§Ìq6€°’+Ry3x~èCJ¯}ëÕôË¿ò+iÿþýió¶mèC4ÜvÙe[8êíDm,Nê´·…Ò,ÓR]³9Æu˜‘e¢€"àÔ@ÌËÝ®®û¾|éRúâ¿ÈÃNÌžp,ZÄÊžò`™¬@<æ(xÁ=ëùèü•ë¬ÇO×_y=µýꯥ}ðýé±#ù3oc­ú"œdŽååÌuÚáºu¶JGa†-R«¤¶`÷IùÊ8ݵrÖ}$—È?=wޝN;拞¨‰ôõç¾”Þ|õ›X/t„­©zôÜJb6Bóy#²>©)pG ÔÀyGò¬áæmÆ]s”òJ¯ƒSÄé§~ú§ÒÏÿýŸO÷ç~.ý·?û³iïþýØoŒkP%ûã ‚f'N‹ ¼³7! #­0àô;8V@¤EÉ믿‘ÞyçhúéŸþiòu¸"Í«:A+8mn[uã¾£Àe›Äê9óÂ…‹ø ‡Ä/½ò­tWxGHÏ<ùDûÙ‰­M#wZ —*€2›ÇÒ 7Érã…dÓá¨è#ɳòŒ· RÝÈkmà|t¤-}ƒ]DÃ/'eåò)JÇXÃo™Òƒcj ¬—m‹°ÞLuú[)PÆ_92,3H1På »àg˜Bã-iï¾½é…_Hßxå Ö÷&vÄ’BF²@+÷Î-ò‡ ”i¸ƒ\&R™žÜ•+“äøÚÜã(aþÁ?ü‡iÿþéÓŸþ‘4D=%]æ´V‚¦Xnër‹oíÕÝc­äœrE ShÀ_xþV4õ¦?õc?=“Î_¼˜®ã&ïíã'b ïT|‘þ¶"nè`…•û É©Z&8Ú68Àþº›¦{ù× m\ŸéÑÝ2¸ƒí(Þ˜FFÒ«¯¼„¸s&}ì#Æl #¤š~‚í´óÖC‘u¨)°n ÔÀ¹n’­ÎàðËÁ1˜Ça•ž $å(GéõVl÷8^|ñÅô[¿õÛ1µÞÃJ ±ö—r›¦s­v¢ ‚¨S×t›V%Œ²¾¯|ùËéÿ“ÿ+Êý©Ÿú©tðàÁH§ÉN ¶¡„ôÁH@M“Í@¶ü¼$  GùZ %%vGY=Âõ)d¤{Bƒ®]å‘S{ƒË¢}¹-Æß7PZHs¨Êwc8ë³·4$,ºÙ6äôéSi%×@\)K*ûõöAŽ Ù·o8œž|ôPº†›<I'NžÂœêl8ç®ö‡ìÆQNšøè#q-h“bwK¦á®˜rš®G¤É°c…CÛØÜX¦bšÞl>µL–æÕç5îJ8ïJ¢;'XÍÛ§s*ÛJú ¤á–-[Ò¦M›Ò#<€™e›½¯lÓ<ž›G9âKKœõÐl¶û,çÍmxçY¾éËc¹~Ë÷%1L¾õúëénåzxAø"èÓrÎÐå¦aJŸz7§ý[‡ÓŸx$M°Î|dŒ=–XÅtûGEZÈM·^¨œd€ÝƒL˜Úñ¾„{=¦æ¯ë›é…¯?‡³öS/ô_ù3làC¢ h+vžSl#ráÜÙôÈ‘Ãië–Mä)*¨´ÊÎ…Ôà !êpÈOû=d¬³¼;Ï –”ŽÙˆؼ8ü”{¦/qM¹ç±™ã̦I®*Z€R®qNëßëÐÜGëôc ƒìõó=ßó=!³}î¹ç¢Þ“ÛÌ/͇à¢iføÆœ}Š ¼ñ鞎<\FÙÎúövÜÍßÞÆË£Åx´öt=l89.°Œó5FÏâ4ùð¡‡b½ÿ’ž?lOùDËSC9æ«ú»¦ÀZ)PçZ)µÎtMX9›A³d8 %>.ølšò)ÀT€ÑôÆy”ó+i)ËøÕe–²ä±´ß¶ØA_™íã?ž>ó™ÏÄ”]Q„Àé'ì+í³mg*¾¤¤ŠC ÷yðŸóhÍý¨=G&‘Æe(É@Í`H¡îäÎ9^~é…ô÷?“>ù‰ï ygô/ÿAvµ.ë8jà|À½SËÕÕß |‚\¦ é±Ls x6×]Ê4N%ŠÊ˜fÀl>_]ï½^—ö®.Û>ä:¦ÛžßüÍß ™§àÙÝÝMRÍ¶Ž´»|%VïK-LÇ]ÇÎtZævV—õ¡¦À)Pç u¿ÉòØÍSÙpåXÊnÏÇø$ð\ŽÓ (ù)é›Ë1]É×<­/iË1 z@_Öo¹«ËöÚ68p ýÐýPz饗ÒoüÆoDŸä8sŸœ.+óäã|PSY¤â<› çÇGuùÜ=ˆ\ Ô©–Ð|é¥ÓW¿úÕôÔSOpš6|¡ –åcþoRT”å±5ÖO÷^¶þ6ý—£€[i8xau|¹¿úX§¤/×…kóÚ{~ʽÕe”¼Æ—t¦mÎÛœfuþ{½.í±ìR¯`Yêuº®™•\ç Ì‹ôÞd¿>ýéO‡ýéšóyv産víý"{Åú{m^9·ÌlQ+ ^PÏe‡N?x™œ8q<Ù¥¬?ô'~8RáÌCÛÒ*äŸDúÙÎ[Ãç2%ê³õP ÎõPë»8mªÕM|/ÀruwºV\ xj ÿÁ~0Ì­¾ô¥/…±ÿàŒäáCc’ÄÚtœ0/²8½Mg8î˜e-{§Þña?çgòª$¹Å9Œâ-O.r?Ï¿ø|ú·ÿö7ÒöíÛƒ«ÝÀRÖ"ûUÅZûÝà"À†¼Ò­DK”mGYën9¥O­íé÷¹Ï¥¯a¦ÔÃ:ö°æþ)¼Å î´½šîǺò@@xÀÇŽCžùr:zôXŸ˜`/§§ô#ášOpV `¬&*¿Ci‹ ihÊ83MêïõQ ÎõÑkM©Ë€­sY©%`¥UáåDO9•žþùpZ¢“]ê9ÝV^Ù‹ãg¹LW¹ôÒUHúõlGÃ~äÈ#áåÐÁƒÁê¾g‘ 1AƒÇ%=GÊ¿c škzœëD·¡@ œ·!ÊýF}7çýöáAå/ )Ç©¼Qðô(hva’4‡ã9D7˜siæ¹sgÃe^¨Ìi„žá³²)/GU–© ½á¡ áZçÝì"åëqªÈ7­ÇÐÌqmŽËI믚k¦@ œk&ÕÚÖÀ¹L+9FA³È8= j…+ÌÐørF®C9O3Oë1ŠçžÛ]´âñIG:J)€×²!e£g”I!zÚ7oxz/?Ær“rEëRR#¢>©)pW ÔÀyW­?A«ƒ•!`beÔÄW‚¦\`á8R?ÍÀéžJº¥ QfÍÔŠ·kÛYh(é8—®~4Ïôh&o•¨:ꆮ·š¾%m\ _¨¾®)ðîøÿ~P›’Å-:tIEND®B`‚ntHash-2.2.0/nthash.hpp000066400000000000000000001236061371554176300147620ustar00rootroot00000000000000/* * * nthash.hpp * Author: Hamid Mohamadi * Genome Sciences Centre, * British Columbia Cancer Agency */ #ifndef NT_HASH_H #define NT_HASH_H #include #include #include static const uint8_t RCconvertTab[256] = { 255, 255, 255, 255, 255, 255, 255, 255, // 0..7 255, 255, 255, 255, 255, 255, 255, 255, // 8..15 255, 255, 255, 255, 255, 255, 255, 255, // 16..23 255, 255, 255, 255, 255, 255, 255, 255, // 24..31 255, 255, 255, 255, 255, 255, 255, 255, // 32..39 255, 255, 255, 255, 255, 255, 255, 255, // 40..47 255, 255, 255, 255, 255, 255, 255, 255, // 48..55 255, 255, 255, 255, 255, 255, 255, 255, // 56..63 255, 3, 255, 2, 255, 255, 255, 1, // 64..71 255, 255, 255, 255, 255, 255, 255, 255, // 72..79 255, 255, 255, 255, 0, 3, 255, 255, // 80..87 255, 255, 255, 255, 255, 255, 255, 255, // 88..95 255, 3, 255, 2, 255, 255, 255, 1, // 96..103 255, 255, 255, 255, 255, 255, 255, 255, // 104..111 255, 255, 255, 255, 0, 3, 255, 255, // 112..119 255, 255, 255, 255, 255, 255, 255, 255, // 120..127 255, 255, 255, 255, 255, 255, 255, 255, // 128..135 255, 255, 255, 255, 255, 255, 255, 255, // 136..143 255, 255, 255, 255, 255, 255, 255, 255, // 144..151 255, 255, 255, 255, 255, 255, 255, 255, // 152..159 255, 255, 255, 255, 255, 255, 255, 255, // 160..167 255, 255, 255, 255, 255, 255, 255, 255, // 168..175 255, 255, 255, 255, 255, 255, 255, 255, // 176..183 255, 255, 255, 255, 255, 255, 255, 255, // 184..191 255, 255, 255, 255, 255, 255, 255, 255, // 192..199 255, 255, 255, 255, 255, 255, 255, 255, // 200..207 255, 255, 255, 255, 255, 255, 255, 255, // 208..215 255, 255, 255, 255, 255, 255, 255, 255, // 216..223 255, 255, 255, 255, 255, 255, 255, 255, // 224..231 255, 255, 255, 255, 255, 255, 255, 255, // 232..239 255, 255, 255, 255, 255, 255, 255, 255, // 240..247 255, 255, 255, 255, 255, 255, 255, 255 // 248..255 }; static const uint8_t convertTab[256] = { 255, 255, 255, 255, 255, 255, 255, 255, // 0..7 255, 255, 255, 255, 255, 255, 255, 255, // 8..15 255, 255, 255, 255, 255, 255, 255, 255, // 16..23 255, 255, 255, 255, 255, 255, 255, 255, // 24..31 255, 255, 255, 255, 255, 255, 255, 255, // 32..39 255, 255, 255, 255, 255, 255, 255, 255, // 40..47 255, 255, 255, 255, 255, 255, 255, 255, // 48..55 255, 255, 255, 255, 255, 255, 255, 255, // 56..63 255, 0, 255, 1, 255, 255, 255, 2, // 64..71 255, 255, 255, 255, 255, 255, 255, 255, // 72..79 255, 255, 255, 255, 3, 0, 255, 255, // 80..87 255, 255, 255, 255, 255, 255, 255, 255, // 88..95 255, 0, 255, 1, 255, 255, 255, 2, // 96..103 255, 255, 255, 255, 255, 255, 255, 255, // 104..111 255, 255, 255, 255, 3, 0, 255, 255, // 112..119 255, 255, 255, 255, 255, 255, 255, 255, // 120..127 255, 255, 255, 255, 255, 255, 255, 255, // 128..135 255, 255, 255, 255, 255, 255, 255, 255, // 136..143 255, 255, 255, 255, 255, 255, 255, 255, // 144..151 255, 255, 255, 255, 255, 255, 255, 255, // 152..159 255, 255, 255, 255, 255, 255, 255, 255, // 160..167 255, 255, 255, 255, 255, 255, 255, 255, // 168..175 255, 255, 255, 255, 255, 255, 255, 255, // 176..183 255, 255, 255, 255, 255, 255, 255, 255, // 184..191 255, 255, 255, 255, 255, 255, 255, 255, // 192..199 255, 255, 255, 255, 255, 255, 255, 255, // 200..207 255, 255, 255, 255, 255, 255, 255, 255, // 208..215 255, 255, 255, 255, 255, 255, 255, 255, // 216..223 255, 255, 255, 255, 255, 255, 255, 255, // 224..231 255, 255, 255, 255, 255, 255, 255, 255, // 232..239 255, 255, 255, 255, 255, 255, 255, 255, // 240..247 255, 255, 255, 255, 255, 255, 255, 255 // 248..255 }; static const uint64_t dimerTab[16] = { 5015898201438948509U, 5225361804584821669U, 6423762225589857229U, 5783394398799547583U, 6894017875502584557U, 5959461383092338133U, 4833978511655400893U, 5364573296520205007U, 9002561594443973180U, 8212239310050454788U, 6941810030513055084U, 7579897184553533982U, 7935738758488558809U, 7149836515649299425U, 8257540373175577481U, 8935100007508790523U }; static const uint64_t trimerTab[64] = { 13237172352163388750U, 13451082378889146998U, 12324706752351386142U, 11704099346423635308U, 12503002411303846718U, 11573033083854154758U, 12770611021816489070U, 13284814289517544220U, 10286336837755622383U, 9500434588327378135U, 10554658215321236671U, 11177611689138066381U, 11245073286936829194U, 10454751004568891954U, 9274956656780491354U, 9930495270120774952U, 9498947889754972591U, 10289371588586147479U, 11487222103436658431U, 10812501148518244749U, 11088845979783725023U, 10735249574334615783U, 9609199230360475791U, 10105458452942995453U, 13447889238169808654U, 13238535845420384310U, 11968673763542288478U, 12645600078955589420U, 12136759312206930411U, 11922809957208297171U, 13031072242070652603U, 13668666814620918217U, 14219262150204358668U, 14433136993975185204U, 15703263506252408668U, 15026899868095529006U, 16097136083696541308U, 15167201938128040260U, 14113514427211577644U, 14608043031429815902U, 18169629015343943341U, 17383691583363408277U, 16185576633819064829U, 16859734366019948175U, 17215452794964541512U, 16425095330967072624U, 17460550829194815256U, 18101973914136232042U, 16197524846324948423U, 17136496960994620159U, 18190301010467109527U, 17660752969549176293U, 18084590689685816247U, 17861669045228104847U, 16591430392433501415U, 17233003275094786965U, 15689030113991676774U, 15321980360070757470U, 14196301091602199606U, 14727918144983470916U, 14660430141886012803U, 14297932370981794491U, 15550237822687034067U, 16044915679164358049U }; static const uint64_t tetramerTab[256] = { 6047278271377325800U, 6842100033257738704U, 5716751207778949560U, 5058261232784932554U, 5322212292231585944U, 4955210659836481440U, 6153481158060361672U, 6630136099103187130U, 7683058811908681801U, 7460089081761259377U, 8513615477720831769U, 9169618076073996395U, 8669810821731892908U, 8451393064794886548U, 7271235746105367036U, 7894785163577458318U, 7461575445318369801U, 7680024275870068017U, 8878022265940976985U, 8237757801848291883U, 9060296013225843833U, 8116780716040188737U, 6991106539262573353U, 7521593563379047515U, 6845292839028968616U, 6045914992845185936U, 4775672622745250808U, 5413871935584767114U, 5490367161684853325U, 4695435745326017909U, 5803018666222232861U, 6480400171096490607U, 2381043025085637546U, 3175899973157948562U, 4445879008075678970U, 3807116472585741192U, 4268108881087626714U, 3901072061426881250U, 2847008385469766282U, 3379366782720458232U, 1763336001516006667U, 1540401457157816883U, 342666797974407771U, 983493939256405289U, 771890739233563630U, 553508169276984534U, 1589643033626739902U, 2263336780810576844U, 330722743541775969U, 688712796851212633U, 1742668713148160305U, 1245320973785726531U, 2208596672445898769U, 1422777727841816361U, 152919646732699457U, 826464124477841459U, 4460107693596700864U, 3530055095011467256U, 2403999925630162832U, 2899137386794791138U, 3398970977768160805U, 2464498338584432925U, 3716128830812494197U, 4248337413163712007U, 4264326372183459627U, 3906261395711551507U, 2851952150714671227U, 3383149429014333193U, 2386233046276708699U, 3172117876357805667U, 4441779805226941963U, 3801926588820052345U, 170684860043692426U, 1100671402695403186U, 2226926226858061530U, 1693589575942097320U, 1193606390847620975U, 2128144916583147607U, 876319371625685055U, 382305650241144653U, 1102545060664966090U, 168107437338776818U, 1437989166537956506U, 1915072878734195688U, 1548519783094789562U, 1757891215679916674U, 703889661060612842U, 46092416782165400U, 3908715595921208683U, 4262294307145226835U, 3064498623987880507U, 2585134797421409609U, 2661735585529691022U, 3019760716990469302U, 4055956603131813086U, 3543998858204232620U, 5317339067591416425U, 4959238909506745681U, 6157334207435046201U, 6635009461133220427U, 6051307208490845209U, 6837227221258447649U, 5711490920986878793U, 5054232433096901691U, 8122648135453742280U, 9052599496358476784U, 7782418148093113240U, 7307023562816214250U, 7095314801322056237U, 8029818144085865749U, 9137340041034366333U, 8622472983995947535U, 7806751516869674914U, 7011855109925922970U, 8137690373747335410U, 8757695200062998400U, 8531879593853721042U, 8898947385530005226U, 7700757522090507906U, 7186022138009770480U, 6135219772853324035U, 6358123720871388731U, 5304510851123850835U, 4682089562405882145U, 5182028715320330214U, 5400512630465816798U, 6580751683450298550U, 5923625422568720324U, 13124074928584983660U, 13491146941631638356U, 12293650504952193852U, 11816502978180760654U, 12399079312662682140U, 11604187204414436644U, 12730450818222161228U, 13388307479092468286U, 10327209524901530317U, 9388215691182564853U, 10657868830410829213U, 11137168911054473967U, 11357920004770333736U, 10414374197647485712U, 9306325182584103800U, 9818342344138146826U, 9386341947321596045U, 10329786896059045813U, 11455812913355464669U, 10924692575052363951U, 10984992149858150141U, 10766613702172592581U, 9568826821541020077U, 10208598699842184927U, 13488692655530571308U, 13126106942075820308U, 12072096584926548348U, 12605510244625659406U, 12249677498819492041U, 11882645355480553457U, 13062230760632229785U, 13556163143878539499U, 14178740190036597038U, 14545847390080448022U, 15599559227675164286U, 15067834145139579148U, 16065876409530435422U, 15270949115358734438U, 14000758968863088654U, 14640014089599289212U, 18281953465151117199U, 17342994818563569847U, 16217267316526477535U, 16746698532205467565U, 17255653680509032810U, 16312143059561297490U, 17564497017566543418U, 18061360711745100104U, 16237972021990524133U, 17023861349393640413U, 18293930539975648181U, 17619893477009409223U, 18115916316835994261U, 17757855915011241389U, 16704251839199542725U, 17200966263939144375U, 15576639675766950468U, 15362743113290245500U, 14164544455910714644U, 14841019967217601126U, 14620295210399335585U, 14410818688327658393U, 15446357621659116529U, 16085462927495578755U, 18237799192036655099U, 17294270664133710019U, 16258109964509321387U, 16773410497518403545U, 16657084189963477387U, 16875519862962278067U, 18127020052323321563U, 17507580374969491881U, 14153168177888129370U, 14515696771658964578U, 15624080140268688906U, 15110866744451150200U, 15466708232756051903U, 15833797605570023559U, 14563810316809509103U, 14085706539145691037U, 14517711175708869402U, 14150731501263563810U, 15402451490950456394U, 15899948742203982648U, 15224753927964908906U, 16019597712369578578U, 14983744703118572090U, 14310050713553640776U, 17296865610423782843U, 18235907873078829699U, 17055988043521714923U, 16561000163437350297U, 16340222631939670878U, 17283720110790814822U, 18338064546595415054U, 17805706452459078524U, 10375933128878629561U, 9432369415202180481U, 10612588863825479145U, 11105888166746317467U, 10794790039591648457U, 11013260899437695985U, 9905396050428550041U, 9228014311730625771U, 13154226096333843480U, 13516719503928509216U, 12264699899470662472U, 11768891770841246778U, 11836546934201131773U, 12203601119882644933U, 13328994472388527533U, 12798507759874630367U, 12277767672444305266U, 12068343612890878026U, 13176021535246260258U, 13816435502572994384U, 12705517425460601090U, 13640043170446921274U, 12460006250421962322U, 11929369723008524576U, 10597232027372843475U, 11387585128312430315U, 10351852510211364483U, 9713802769929286129U, 9357917249443839798U, 10143859113470169102U, 11342251114164164710U, 10664720106027613972U }; // offset for the complement base in the random seeds table const uint8_t cpOff = 0x07; // shift for gerenerating multiple hash values const int multiShift = 27; // seed for gerenerating multiple hash values static const uint64_t multiSeed = 0x90b45d39fb6da1fa; // 64-bit random seeds corresponding to bases and their complements static const uint64_t seedA = 0x3c8bfbb395c60474; static const uint64_t seedC = 0x3193c18562a02b4c; static const uint64_t seedG = 0x20323ed082572324; static const uint64_t seedT = 0x295549f54be24456; static const uint64_t seedN = 0x0000000000000000; static const uint64_t seedTab[256] = { seedN, seedT, seedN, seedG, seedA, seedA, seedN, seedC, // 0..7 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 8..15 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 16..23 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 24..31 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 32..39 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 40..47 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 48..55 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 56..63 seedN, seedA, seedN, seedC, seedN, seedN, seedN, seedG, // 64..71 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 72..79 seedN, seedN, seedN, seedN, seedT, seedT, seedN, seedN, // 80..87 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 88..95 seedN, seedA, seedN, seedC, seedN, seedN, seedN, seedG, // 96..103 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 104..111 seedN, seedN, seedN, seedN, seedT, seedT, seedN, seedN, // 112..119 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 120..127 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 128..135 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 136..143 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 144..151 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 152..159 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 160..167 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 168..175 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 176..183 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 184..191 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 192..199 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 200..207 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 208..215 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 216..223 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 224..231 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 232..239 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN, // 240..247 seedN, seedN, seedN, seedN, seedN, seedN, seedN, seedN // 248..255 }; static const uint64_t A33r[33] = { 0x195c60474,0x12b8c08e9,0x571811d3,0xae3023a6,0x15c60474c,0xb8c08e99,0x171811d32,0xe3023a65,0x1c60474ca,0x18c08e995,0x11811d32b,0x3023a657,0x60474cae,0xc08e995c,0x1811d32b8,0x1023a6571,0x474cae3,0x8e995c6,0x11d32b8c,0x23a65718,0x474cae30,0x8e995c60,0x11d32b8c0,0x3a657181,0x74cae302,0xe995c604,0x1d32b8c08,0x1a6571811,0x14cae3023,0x995c6047,0x132b8c08e,0x6571811d,0xcae3023a }; static const uint64_t A31l[31] = { 0x3c8bfbb200000000,0x7917f76400000000,0xf22feec800000000,0xe45fdd9200000000,0xc8bfbb2600000000,0x917f764e00000000,0x22feec9e00000000,0x45fdd93c00000000,0x8bfbb27800000000,0x17f764f200000000,0x2feec9e400000000,0x5fdd93c800000000,0xbfbb279000000000,0x7f764f2200000000,0xfeec9e4400000000,0xfdd93c8a00000000,0xfbb2791600000000,0xf764f22e00000000,0xeec9e45e00000000,0xdd93c8be00000000,0xbb27917e00000000,0x764f22fe00000000,0xec9e45fc00000000,0xd93c8bfa00000000,0xb27917f600000000,0x64f22fee00000000,0xc9e45fdc00000000,0x93c8bfba00000000,0x27917f7600000000,0x4f22feec00000000,0x9e45fdd800000000 }; static const uint64_t C33r[33] = { 0x162a02b4c,0xc5405699,0x18a80ad32,0x115015a65,0x2a02b4cb,0x54056996,0xa80ad32c,0x15015a658,0xa02b4cb1,0x140569962,0x80ad32c5,0x1015a658a,0x2b4cb15,0x569962a,0xad32c54,0x15a658a8,0x2b4cb150,0x569962a0,0xad32c540,0x15a658a80,0xb4cb1501,0x169962a02,0xd32c5405,0x1a658a80a,0x14cb15015,0x9962a02b,0x132c54056,0x658a80ad,0xcb15015a,0x1962a02b4,0x12c540569,0x58a80ad3,0xb15015a6 }; static const uint64_t C31l[31] = { 0x3193c18400000000,0x6327830800000000,0xc64f061000000000,0x8c9e0c2200000000,0x193c184600000000,0x3278308c00000000,0x64f0611800000000,0xc9e0c23000000000,0x93c1846200000000,0x278308c600000000,0x4f06118c00000000,0x9e0c231800000000,0x3c18463200000000,0x78308c6400000000,0xf06118c800000000,0xe0c2319200000000,0xc184632600000000,0x8308c64e00000000,0x6118c9e00000000,0xc23193c00000000,0x1846327800000000,0x308c64f000000000,0x6118c9e000000000,0xc23193c000000000,0x8463278200000000,0x8c64f0600000000,0x118c9e0c00000000,0x23193c1800000000,0x4632783000000000,0x8c64f06000000000,0x18c9e0c200000000 }; static const uint64_t G33r[33] = { 0x82572324,0x104ae4648,0x95c8c91,0x12b91922,0x25723244,0x4ae46488,0x95c8c910,0x12b919220,0x57232441,0xae464882,0x15c8c9104,0xb9192209,0x172324412,0xe4648825,0x1c8c9104a,0x191922095,0x12324412b,0x46488257,0x8c9104ae,0x11922095c,0x324412b9,0x64882572,0xc9104ae4,0x1922095c8,0x124412b91,0x48825723,0x9104ae46,0x122095c8c,0x4412b919,0x88257232,0x1104ae464,0x2095c8c9,0x412b9192 }; static const uint64_t G31l[31] = { 0x20323ed000000000,0x40647da000000000,0x80c8fb4000000000,0x191f68200000000,0x323ed0400000000,0x647da0800000000,0xc8fb41000000000,0x191f682000000000,0x323ed04000000000,0x647da08000000000,0xc8fb410000000000,0x91f6820200000000,0x23ed040600000000,0x47da080c00000000,0x8fb4101800000000,0x1f68203200000000,0x3ed0406400000000,0x7da080c800000000,0xfb41019000000000,0xf682032200000000,0xed04064600000000,0xda080c8e00000000,0xb410191e00000000,0x6820323e00000000,0xd040647c00000000,0xa080c8fa00000000,0x410191f600000000,0x820323ec00000000,0x40647da00000000,0x80c8fb400000000,0x10191f6800000000 }; static const uint64_t T33r[33] = { 0x14be24456,0x97c488ad,0x12f89115a,0x5f1222b5,0xbe24456a,0x17c488ad4,0xf89115a9,0x1f1222b52,0x1e24456a5,0x1c488ad4b,0x189115a97,0x11222b52f,0x24456a5f,0x488ad4be,0x9115a97c,0x1222b52f8,0x4456a5f1,0x88ad4be2,0x1115a97c4,0x22b52f89,0x456a5f12,0x8ad4be24,0x115a97c48,0x2b52f891,0x56a5f122,0xad4be244,0x15a97c488,0xb52f8911,0x16a5f1222,0xd4be2445,0x1a97c488a,0x152f89115,0xa5f1222b }; static const uint64_t T31l[31] = { 0x295549f400000000,0x52aa93e800000000,0xa55527d000000000,0x4aaa4fa200000000,0x95549f4400000000,0x2aa93e8a00000000,0x55527d1400000000,0xaaa4fa2800000000,0x5549f45200000000,0xaa93e8a400000000,0x5527d14a00000000,0xaa4fa29400000000,0x549f452a00000000,0xa93e8a5400000000,0x527d14aa00000000,0xa4fa295400000000,0x49f452aa00000000,0x93e8a55400000000,0x27d14aaa00000000,0x4fa2955400000000,0x9f452aa800000000,0x3e8a555200000000,0x7d14aaa400000000,0xfa29554800000000,0xf452aa9200000000,0xe8a5552600000000,0xd14aaa4e00000000,0xa295549e00000000,0x452aa93e00000000,0x8a55527c00000000,0x14aaa4fa00000000 }; static const uint64_t N33r[33] = { seedN,seedN,seedN,seedN,seedN,seedN,seedN,seedN, seedN,seedN,seedN,seedN,seedN,seedN,seedN,seedN, seedN,seedN,seedN,seedN,seedN,seedN,seedN,seedN, seedN,seedN,seedN,seedN,seedN,seedN,seedN,seedN, seedN }; static const uint64_t N31l[31] = { seedN,seedN,seedN,seedN,seedN,seedN,seedN,seedN, seedN,seedN,seedN,seedN,seedN,seedN,seedN,seedN, seedN,seedN,seedN,seedN,seedN,seedN,seedN,seedN, seedN,seedN,seedN,seedN,seedN,seedN,seedN }; static const uint64_t *msTab33r[256] = { N33r, T33r, N33r, G33r, A33r, A33r, N33r, C33r, // 0..7 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 8..15 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 16..23 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 24..31 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 32..39 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 40..47 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 48..55 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 56..63 N33r, A33r, N33r, C33r, N33r, N33r, N33r, G33r, // 64..71 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 72..79 N33r, N33r, N33r, N33r, T33r, T33r, N33r, N33r, // 80..87 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 88..95 N33r, A33r, N33r, C33r, N33r, N33r, N33r, G33r, // 96..103 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 104..111 N33r, N33r, N33r, N33r, T33r, T33r, N33r, N33r, // 112..119 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 120..127 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 128..135 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 136..143 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 144..151 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 152..159 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 160..167 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 168..175 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 176..183 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 184..191 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 192..199 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 200..207 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 208..215 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 216..223 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 224..231 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 232..239 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r, // 240..247 N33r, N33r, N33r, N33r, N33r, N33r, N33r, N33r // 248..255 }; static const uint64_t *msTab31l[256] = { N31l, T31l, N31l, G31l, A31l, A31l, N31l, C31l, // 0..7 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 8..15 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 16..23 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 24..31 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 32..39 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 40..47 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 48..55 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 56..63 N31l, A31l, N31l, C31l, N31l, N31l, N31l, G31l, // 64..71 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 72..79 N31l, N31l, N31l, N31l, T31l, T31l, N31l, N31l, // 80..87 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 88..95 N31l, A31l, N31l, C31l, N31l, N31l, N31l, G31l, // 96..103 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 104..111 N31l, N31l, N31l, N31l, T31l, T31l, N31l, N31l, // 112..119 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 120..127 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 128..135 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 136..143 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 144..151 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 152..159 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 160..167 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 168..175 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 176..183 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 184..191 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 192..199 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 200..207 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 208..215 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 216..223 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 224..231 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 232..239 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l, // 240..247 N31l, N31l, N31l, N31l, N31l, N31l, N31l, N31l // 248..255 }; // rotate "v" to the left 1 position inline uint64_t rol1(const uint64_t v) { return (v << 1) | (v >> 63); } // rotate "v" to the left x position inline uint64_t rolx(const uint64_t v, const unsigned x) { return (v << x) | (v >> (64 - x)); } // rotate "v" to the right by 1 position inline uint64_t ror1(const uint64_t v) { return (v >> 1) | (v << 63); } // rotate 31-left bits of "v" to the left by "s" positions inline uint64_t rol31(const uint64_t v, unsigned s) { s%=31; return ((v << s) | (v >> (31 - s))) & 0x7FFFFFFF; } // rotate 33-right bits of "v" to the left by "s" positions inline uint64_t rol33(const uint64_t v, unsigned s) { s%=33; return ((v << s) | (v >> (33 - s))) & 0x1FFFFFFFF; } // swap bit 0 with bit 33 in "v" inline uint64_t swapbits033(const uint64_t v) { uint64_t x = (v ^ (v >> 33)) & 1; return v ^ (x | (x << 33)); } // swap bit 32 with bit 63 in "v" inline uint64_t swapbits3263(const uint64_t v) { uint64_t x = ((v >> 32) ^ (v >> 63)) & 1; return v ^ ((x << 32) | (x << 63)); } inline uint64_t swapxbits033(const uint64_t v, const unsigned x) { uint64_t y = (v ^ (v >> 33)) & (std::numeric_limits::max() >> (64 - x)); return v ^ (y | (y << 33)); } // forward-strand hash value of the base kmer, i.e. fhval(kmer_0) inline uint64_t NTF64(const char * kmerSeq, const unsigned k) { uint64_t hVal=0; for (unsigned i=0; i> multiShift; return hVal; } // canonical ntBase with seeding option inline uint64_t NTC64(const char * kmerSeq, const unsigned k, const unsigned seed) { uint64_t hVal = NTC64(kmerSeq,k); if(seed==0) return hVal; hVal *= seed ^ k * multiSeed; hVal ^= hVal >> multiShift; return hVal; } // multihash ntHash, ntBase inline void NTM64(const char * kmerSeq, const unsigned k, const unsigned m, uint64_t *hVal) { uint64_t bVal=0, tVal=0; bVal = NTF64(kmerSeq, k); hVal[0] = bVal; for(unsigned i=1; i> multiShift; hVal[i] = tVal; } } // one extra hash for given base hash inline uint64_t NTE64(const uint64_t hVal, const unsigned k, const unsigned i) { uint64_t tVal = hVal; tVal *= (i ^ k * multiSeed); tVal ^= tVal >> multiShift; return tVal; } // multihash ntHash for sliding k-mers inline void NTM64(const unsigned char charOut, const unsigned char charIn, const unsigned k, const unsigned m, uint64_t *hVal) { uint64_t bVal=0, tVal=0; bVal = NTF64(hVal[0], k, charOut, charIn); hVal[0] = bVal; for(unsigned i=1; i> multiShift; hVal[i] = tVal; } } // canonical multihash ntBase inline void NTMC64(const char * kmerSeq, const unsigned k, const unsigned m, uint64_t *hVal) { uint64_t bVal=0, tVal=0; bVal = NTC64(kmerSeq, k); hVal[0] = bVal; for(unsigned i=1; i> multiShift; hVal[i] = tVal; } } // canonical multihash ntHash inline void NTMC64(const char * kmerSeq, const unsigned k, const unsigned m, uint64_t& fhVal, uint64_t& rhVal, uint64_t *hVal) { uint64_t bVal=0, tVal=0; bVal = NTC64(kmerSeq, k, fhVal, rhVal); hVal[0] = bVal; for(unsigned i=1; i> multiShift; hVal[i] = tVal; } } // canonical multihash ntHash for sliding k-mers inline void NTMC64(const unsigned char charOut, const unsigned char charIn, const unsigned k, const unsigned m, uint64_t& fhVal, uint64_t& rhVal, uint64_t *hVal) { uint64_t bVal=0, tVal=0; bVal = NTC64(charOut, charIn, k, fhVal, rhVal); hVal[0] = bVal; for(unsigned i=1; i> multiShift; hVal[i] = tVal; } } /* * ignoring k-mers containing nonACGT using ntHash function */ // canonical ntBase inline bool NTC64(const char *kmerSeq, const unsigned k, uint64_t& hVal, unsigned& locN) { hVal=0; locN=0; uint64_t fhVal=0,rhVal=0; for(int i=k-1; i>=0; i--) { if(seedTab[(unsigned char)kmerSeq[i]]==seedN) { locN=i; return false; } fhVal = rol1(fhVal); fhVal = swapbits033(fhVal); fhVal ^= seedTab[(unsigned char)kmerSeq[k-1-i]]; rhVal = rol1(rhVal); rhVal = swapbits033(rhVal); rhVal ^= seedTab[(unsigned char)kmerSeq[i]&cpOff]; } hVal = (rhVal=0; i--) { if(seedTab[(unsigned char)kmerSeq[i]]==seedN) { locN=i; return false; } fhVal = rol1(fhVal); fhVal = swapbits033(fhVal); fhVal ^= seedTab[(unsigned char)kmerSeq[k-1-i]]; rhVal = rol1(rhVal); rhVal = swapbits033(rhVal); rhVal ^= seedTab[(unsigned char)kmerSeq[i]&cpOff]; } bVal = (rhVal> multiShift; hVal[i] = tVal; } return true; } // canonical ntHash inline bool NTC64(const char *kmerSeq, const unsigned k, uint64_t& fhVal, uint64_t& rhVal, uint64_t& hVal, unsigned& locN) { hVal=fhVal=rhVal=0; locN=0; for(int i=k-1; i>=0; i--) { if(seedTab[(unsigned char)kmerSeq[i]]==seedN) { locN=i; return false; } fhVal = rol1(fhVal); fhVal = swapbits033(fhVal); fhVal ^= seedTab[(unsigned char)kmerSeq[k-1-i]]; rhVal = rol1(rhVal); rhVal = swapbits033(rhVal); rhVal ^= seedTab[(unsigned char)kmerSeq[i]&cpOff]; } hVal = (rhVal=0; i--) { if(seedTab[(unsigned char)kmerSeq[i]]==seedN) { locN=i; return false; } fhVal = rol1(fhVal); fhVal = swapbits033(fhVal); fhVal ^= seedTab[(unsigned char)kmerSeq[k-1-i]]; rhVal = rol1(rhVal); rhVal = swapbits033(rhVal); rhVal ^= seedTab[(unsigned char)kmerSeq[i]&cpOff]; } bVal = (rhVal> multiShift; hVal[i] = tVal; } return true; } // strand-aware canonical multihash ntHash inline bool NTMC64(const char *kmerSeq, const unsigned k, const unsigned m, uint64_t& fhVal, uint64_t& rhVal, unsigned& locN, uint64_t* hVal, bool& hStn) { fhVal=rhVal=0; uint64_t bVal=0, tVal=0; locN=0; for(int i=k-1; i>=0; i--) { if(seedTab[(unsigned char)kmerSeq[i]]==seedN) { locN=i; return false; } fhVal = rol1(fhVal); fhVal = swapbits033(fhVal); fhVal ^= seedTab[(unsigned char)kmerSeq[k-1-i]]; rhVal = rol1(rhVal); rhVal = swapbits033(rhVal); rhVal ^= seedTab[(unsigned char)kmerSeq[i]&cpOff]; } hStn = rhVal> multiShift; hVal[i] = tVal; } return true; } // starnd-aware canonical multihash ntHash for sliding k-mers inline void NTMC64(const unsigned char charOut, const unsigned char charIn, const unsigned k, const unsigned m, uint64_t& fhVal, uint64_t& rhVal, uint64_t *hVal, bool &hStn) { uint64_t bVal=0, tVal=0; bVal = NTC64(charOut, charIn, k, fhVal, rhVal); hStn = rhVal> multiShift; hVal[i] = tVal; } } // masking canonical ntHash using spaced seed pattern inline uint64_t maskHash(uint64_t &fkVal, uint64_t &rkVal, const char * seedSeq, const char * kmerSeq, const unsigned k) { uint64_t fsVal=fkVal, rsVal=rkVal; for(unsigned i=0; i &seed, const unsigned k, uint64_t &hVal) { hVal=0; uint64_t sVal = 0; for(unsigned i=0; i &seed, const unsigned char charOut, const unsigned char charIn, const unsigned k, uint64_t &hVal) { hVal = NTF64(hVal,k,charOut,charIn); uint64_t sVal = hVal; for(unsigned i=0; i > &seedSeq, const unsigned k, const unsigned m, uint64_t& fhVal, uint64_t& rhVal, unsigned& locN, uint64_t* hVal, bool *hStn) { fhVal=rhVal=0; locN=0; for(int i=k-1; i>=0; i--) { if(seedTab[(unsigned char)kmerSeq[i]]==seedN) { locN=i; return false; } fhVal = rol1(fhVal); fhVal = swapbits033(fhVal); fhVal ^= seedTab[(unsigned char)kmerSeq[k-1-i]]; rhVal = rol1(rhVal); rhVal = swapbits033(rhVal); rhVal ^= seedTab[(unsigned char)kmerSeq[i]&cpOff]; } for(unsigned j=0; j::const_iterator i=seedSeq[j].begin(); i!=seedSeq[j].end(); ++i) { fsVal ^= (msTab31l[(unsigned char)kmerSeq[*i]][(k-1-*i)%31] | msTab33r[(unsigned char)kmerSeq[*i]][(k-1-*i)%33]); rsVal ^= (msTab31l[(unsigned char)kmerSeq[*i]&cpOff][*i%31] | msTab33r[(unsigned char)kmerSeq[*i]&cpOff][*i%33]); } hStn[j] = rsVal > &seedSeq, const unsigned char charOut, const unsigned char charIn, const unsigned k, const unsigned m, uint64_t& fhVal, uint64_t& rhVal, uint64_t *hVal, bool *hStn) { fhVal = NTF64(fhVal,k,charOut,charIn); rhVal = NTR64(rhVal,k,charOut,charIn); for(unsigned j=0; j::const_iterator i=seedSeq[j].begin(); i!=seedSeq[j].end(); ++i) { fsVal ^= (msTab31l[(unsigned char)kmerSeq[*i]][(k-1-*i)%31] | msTab33r[(unsigned char)kmerSeq[*i]][(k-1-*i)%33]); rsVal ^= (msTab31l[(unsigned char)kmerSeq[*i]&cpOff][*i%31] | msTab33r[(unsigned char)kmerSeq[*i]&cpOff][*i%33]);; } hStn[j] = rsVal > &seedSeq, const unsigned k, const unsigned m, const unsigned m2, uint64_t& fhVal, uint64_t& rhVal, unsigned& locN, uint64_t* hVal, bool *hStn) { fhVal=rhVal=0; locN=0; for(int i=k-1; i>=0; i--) { if(seedTab[(unsigned char)kmerSeq[i]]==seedN) { locN=i; return false; } fhVal = rol1(fhVal); fhVal = swapbits033(fhVal); fhVal ^= seedTab[(unsigned char)kmerSeq[k-1-i]]; rhVal = rol1(rhVal); rhVal = swapbits033(rhVal); rhVal ^= seedTab[(unsigned char)kmerSeq[i]&cpOff]; } for(unsigned j=0; j::const_iterator i=seedSeq[j].begin(); i!=seedSeq[j].end(); ++i) { fsVal ^= (msTab31l[(unsigned char)kmerSeq[*i]][(k-1-*i)%31] | msTab33r[(unsigned char)kmerSeq[*i]][(k-1-*i)%33]); rsVal ^= (msTab31l[(unsigned char)kmerSeq[*i]&cpOff][*i%31] | msTab33r[(unsigned char)kmerSeq[*i]&cpOff][*i%33]); } hStn[j * m2] = rsVal> multiShift; hStn[j * m2 + j2] = hStn[j * m2]; hVal[j * m2 + j2] = tVal; } } return true; } // strand-aware multihash spaced seed ntHash for sliding k-mers with multiple hashes per seed inline void NTMSM64(const char *kmerSeq, const std::vector > &seedSeq, const unsigned char charOut, const unsigned char charIn, const unsigned k, const unsigned m, const unsigned m2, uint64_t& fhVal, uint64_t& rhVal, uint64_t *hVal, bool *hStn) { fhVal = NTF64(fhVal,k,charOut,charIn); rhVal = NTR64(rhVal,k,charOut,charIn); for(unsigned j=0; j::const_iterator i=seedSeq[j].begin(); i!=seedSeq[j].end(); ++i) { fsVal ^= (msTab31l[(unsigned char)kmerSeq[*i]][(k-1-*i)%31] | msTab33r[(unsigned char)kmerSeq[*i]][(k-1-*i)%33]); rsVal ^= (msTab31l[(unsigned char)kmerSeq[*i]&cpOff][*i%31] | msTab33r[(unsigned char)kmerSeq[*i]&cpOff][*i%33]); } hStn[j * m2] = rsVal> multiShift; hStn[j * m2 + j2] = hStn[j * m2]; hVal[j * m2 + j2] = tVal; } } } #endif ntHash-2.2.0/nttest.cpp000066400000000000000000000471641371554176300150150ustar00rootroot00000000000000/* * * nttest.hpp * Author: Hamid Mohamadi * Genome Sciences Centre, * British Columbia Cancer Agency */ #include #include #include #include #include #include #include #include #include #include #include #include "seqgen.hpp" #include "BloomFilter.hpp" #include "nthash.hpp" #ifdef _OPENMP #include #endif #define PROGRAM "nttest" static const char VERSION_MESSAGE[] = PROGRAM " Version 1.0.0 \n" "Written by Hamid Mohamadi.\n" "Copyright 2016 Canada's Michael Smith Genome Science Centre\n"; static const char USAGE_MESSAGE[] = "Usage: " PROGRAM " [OPTION]... QUERY\n" "Report bugs to hmohamadi@bcgsc.ca.\n"; namespace opt { unsigned threads=1; unsigned kmerLen=50; unsigned ibits = 8; unsigned nhash=1; unsigned nz; size_t nquery; size_t squery; size_t ngene; size_t sgene; unsigned method; unsigned maxitr; bool fastq = false; bool inpFlag = false; bool uniformity = false; } using namespace std; static const char shortopts[] = "k:b:h:j:q:l:t:g:m:a:iu"; enum { OPT_HELP = 1, OPT_VERSION }; static const struct option longopts[] = { { "threads", required_argument, NULL, 'j' }, { "kmer", required_argument, NULL, 'k' }, { "qnum", required_argument, NULL, 'q' }, { "qlen", required_argument, NULL, 'l' }, { "bit", required_argument, NULL, 'b' }, { "hash", required_argument, NULL, 'h' }, { "tnum", required_argument, NULL, 't' }, { "tlen", required_argument, NULL, 'g' }, { "max", required_argument, NULL, 'm' }, { "alg", required_argument, NULL, 'a' }, { "input", no_argument, NULL, 'i' }, { "uniformity", no_argument, NULL, 'u' }, { "help", no_argument, NULL, OPT_HELP }, { "version", no_argument, NULL, OPT_VERSION }, { NULL, 0, NULL, 0 } }; static const string itm[]= {"ntbase","nthash","city"}; void getFtype(const char *fName) { std::ifstream in(fName); std::string hLine; bool good=static_cast(getline(in,hLine)); in.close(); if(!good) { std::cerr<<"Error in reading file: "<') opt::fastq=false; else if (hLine[0]=='@') opt::fastq=true; else { std::cerr<<"Error in file format: "<(getline(uFile, hline)); good=static_cast(getline(uFile, line)); good=static_cast(getline(uFile, hline)); good=static_cast(getline(uFile, hline)); } else { do { good=static_cast(getline(uFile, hline)); if(hline[0]=='>'&&!line.empty()) break;// !line.empty() for the first rec if(hline[0]!='>')line+=hline; } while(good); if(!good&&!line.empty()) good=true; } return good; } static const unsigned char b2r[256] = { 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //0 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //1 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //2 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //3 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'T', 'N', 'G', 'N', 'N', 'N', 'C', //4 'A' 'C' 'G' 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'A', 'N', 'N', 'N', //5 'T' 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'T', 'N', 'G', 'N', 'N', 'N', 'C', //6 'a' 'c' 'g' 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'A', 'N', 'N', 'N', //7 't' 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //8 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //9 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //10 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //11 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //12 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //13 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //14 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N', //15 'N', 'N', 'N', 'N', 'N', 'N', 'N', 'N' }; void getCanon(std::string &bMer) { int p=0, hLen=(opt::kmerLen-1)/2; while (bMer[p] == b2r[(unsigned char)bMer[opt::kmerLen-1-p]]) { ++p; if(p>=hLen) break; } if (bMer[p] > b2r[(unsigned char)bMer[opt::kmerLen-1-p]]) { for (int lIndex = p, rIndex = opt::kmerLen-1-p; lIndex<=rIndex; ++lIndex,--rIndex) { char tmp = b2r[(unsigned char)bMer[rIndex]]; bMer[rIndex] = b2r[(unsigned char)bMer[lIndex]]; bMer[lIndex] = tmp; } } } void loadSeq(BloomFilter & myFilter, const string & seq) { if (seq.size() < opt::kmerLen) return; for (size_t i = 0; i < seq.size() - opt::kmerLen + 1; i++) { myFilter.insert(seq.c_str()+i); } } void loadSeqr(BloomFilter & myFilter, const string & seq) { if (seq.size() < opt::kmerLen) return; uint64_t fhVal, rhVal; myFilter.insert(seq.c_str(), fhVal, rhVal); for (size_t i = 1; i < seq.size() - opt::kmerLen + 1; i++) { myFilter.insert(fhVal, rhVal, seq[i-1], seq[i+opt::kmerLen-1]); } } void loadSeqm(BloomFilter & myFilter, const string & seq) { if (seq.size() < opt::kmerLen) return; for (size_t i = 0; i < seq.size() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); myFilter.insertMur(kmer.c_str()); } } void loadSeqc(BloomFilter & myFilter, const string & seq) { if (seq.size() < opt::kmerLen) return; for (size_t i = 0; i < seq.size() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); myFilter.insertCit(kmer.c_str()); } } void loadSeqx(BloomFilter & myFilter, const string & seq) { if (seq.size() < opt::kmerLen) return; for (size_t i = 0; i < seq.size() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); myFilter.insertXxh(kmer.c_str()); } } void loadBf(BloomFilter &myFilter, const char* faqFile) { getFtype(faqFile); ifstream uFile(faqFile); bool good = true; #ifdef _OPENMP #pragma omp parallel #endif for(string line; good;) { #ifdef _OPENMP #pragma omp critical(uFile) #endif good = getSeq(uFile, line); if(good) { if(itm[opt::method]=="city") loadSeqc(myFilter, line); else if(itm[opt::method]=="murmur") loadSeqm(myFilter, line); else if(itm[opt::method]=="xxhash") loadSeqx(myFilter, line); else if(itm[opt::method]=="ntbase") loadSeq(myFilter, line); else if(itm[opt::method]=="nthash") loadSeqr(myFilter, line); } } uFile.close(); } void querySeqr(BloomFilter & myFilter, const string & seq, size_t & fHit) { if (seq.size() < opt::kmerLen) return; uint64_t fhVal, rhVal; if(myFilter.contains(seq.c_str(), fhVal, rhVal)) { #ifdef _OPENMP #pragma omp atomic #endif ++fHit; } for (size_t i = 1; i < seq.size() - opt::kmerLen + 1; i++) { if(myFilter.contains(fhVal, rhVal, seq[i-1], seq[i+opt::kmerLen-1])) { #ifdef _OPENMP #pragma omp atomic #endif ++fHit; } } } void querySeq(BloomFilter & myFilter, const string & seq, size_t & fHit) { if (seq.size() < opt::kmerLen) return; for (size_t i = 0; i < seq.size() - opt::kmerLen + 1; i++) { if(myFilter.contains(seq.c_str()+i)) { #ifdef _OPENMP #pragma omp atomic #endif ++fHit; } } } void querySeqm(BloomFilter & myFilter, const string & seq, size_t & fHit) { if (seq.size() < opt::kmerLen) return; for (size_t i = 0; i < seq.size() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); if(myFilter.containsMur(kmer.c_str())) { #ifdef _OPENMP #pragma omp atomic #endif ++fHit; } } } void querySeqc(BloomFilter & myFilter, const string & seq, size_t & fHit) { if (seq.size() < opt::kmerLen) return; for (size_t i = 0; i < seq.size() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); if(myFilter.containsCit(kmer.c_str())) { #ifdef _OPENMP #pragma omp atomic #endif ++fHit; } } } void querySeqx(BloomFilter & myFilter, const string & seq, size_t & fHit) { if (seq.size() < opt::kmerLen) return; for (size_t i = 0; i < seq.size() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); if(myFilter.containsXxh(kmer.c_str())) { #ifdef _OPENMP #pragma omp atomic #endif ++fHit; } } } void queryBf(BloomFilter &myFilter, const char* faqFile) { getFtype(faqFile); ifstream uFile(faqFile); size_t fHit=0,totKmer=0; bool good = true; #ifdef _OPENMP #pragma omp parallel #endif for(string line; good;) { #ifdef _OPENMP #pragma omp critical(uFile) #endif good = getSeq(uFile, line); if(good) { if(itm[opt::method]=="city") querySeqc(myFilter, line, fHit); else if(itm[opt::method]=="murmur") querySeqm(myFilter, line, fHit); else if(itm[opt::method]=="xxhash") querySeqx(myFilter, line, fHit); else if(itm[opt::method]=="ntbase") querySeq(myFilter, line, fHit); else if(itm[opt::method]=="nthash") querySeqr(myFilter, line, fHit); #ifdef _OPENMP #pragma omp atomic #endif totKmer+=opt::squery-opt::kmerLen+1; } } uFile.close(); cerr << "tkmer=" << totKmer << " "; cerr << "fhits=" << fHit << " %" << setprecision(4) << fixed << (double)fHit/(double)totKmer << " "; } void hashSeqb(const string & seq) { for (size_t i = 0; i < seq.length() - opt::kmerLen + 1; i++) { if(NTC64(seq.c_str()+i, opt::kmerLen)) opt::nz++; } } void hashSeqr(const string & seq) { uint64_t fhVal,rhVal,hVal; hVal = NTC64(seq.c_str(), opt::kmerLen, fhVal, rhVal); if(hVal)opt::nz++; for (size_t i = 1; i < seq.length() - opt::kmerLen + 1; i++) { hVal = NTC64(seq[i-1], seq[i-1+opt::kmerLen], opt::kmerLen, fhVal, rhVal); if(hVal)opt::nz++; } } void hashSeqx(const string & seq) { for (size_t i = 0; i < seq.length() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); if(XXH64(kmer.c_str(), opt::kmerLen, 0))++opt::nz; } } void hashSeqc(const string & seq) { for (size_t i = 0; i < seq.length() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); if (CityHash64(kmer.c_str(), opt::kmerLen))++opt::nz; } } void hashSeqm(const string & seq) { for (size_t i = 0; i < seq.length() - opt::kmerLen + 1; i++) { string kmer = seq.substr(i, opt::kmerLen); getCanon(kmer); if(MurmurHash64A(kmer.c_str(), opt::kmerLen, 0))++opt::nz; } } void hashSeqbM(const string & seq) { uint64_t hVal[opt::nhash]; for (size_t i = 0; i < seq.length() - opt::kmerLen + 1; i++) { NTMC64(seq.c_str()+i, opt::kmerLen, opt::nhash, hVal); for(unsigned i=0; i1) { for(unsigned method=0; method<2; method++) { opt::nz=0; ifstream uFile(readName); string line; clock_t sTime = clock(); while(getSeq(uFile,line)) { if(itm[method]=="city") hashSeqcM(line); else if(itm[method]=="murmur") hashSeqmM(line); else if(itm[method]=="nthash") hashSeqrM(line); else if(itm[method]=="ntbase") hashSeqbM(line); else if(itm[method]=="xxhash") hashSeqxM(line); } cerr << (double)(clock() - sTime)/CLOCKS_PER_SEC << "\t"; uFile.close(); } cerr << "\n"; } else { for(unsigned method=0; method<2; method++) { opt::nz=0; ifstream uFile(readName); string line; clock_t sTime = clock(); while(getSeq(uFile, line)) { if(itm[method]=="city") hashSeqc(line); else if(itm[method]=="murmur") hashSeqm(line); else if(itm[method]=="nthash") hashSeqr(line); else if(itm[method]=="ntbase") hashSeqb(line); else if(itm[method]=="xxhash") hashSeqx(line); } cerr << (double)(clock() - sTime)/CLOCKS_PER_SEC << "\t"; uFile.close(); } cerr << "\n"; } } int main(int argc, char** argv) { bool die = false; for (int c; (c = getopt_long(argc, argv, shortopts, longopts, NULL)) != -1;) { std::istringstream arg(optarg != NULL ? optarg : ""); switch (c) { case '?': die = true; break; case 'j': arg >> opt::threads; break; case 'b': arg >> opt::ibits; break; case 'q': arg >> opt::nquery; break; case 'l': arg >> opt::squery; break; case 't': arg >> opt::ngene; break; case 'g': arg >> opt::sgene; break; case 'h': arg >> opt::nhash; break; case 'k': arg >> opt::kmerLen; //init_kmod(opt::kmerLen); break; case 'm': arg >> opt::maxitr; break; case 'a': arg >> opt::method; break; case 'i': opt::inpFlag=true; break; case 'u': opt::uniformity=true; break; case OPT_HELP: std::cerr << USAGE_MESSAGE; exit(EXIT_SUCCESS); case OPT_VERSION: std::cerr << VERSION_MESSAGE; exit(EXIT_SUCCESS); } if (optarg != NULL && !arg.eof()) { std::cerr << PROGRAM ": invalid option: `-" << (char)c << optarg << "'\n"; exit(EXIT_FAILURE); } } if (argc - optind != 1 && argc - optind != 2) { std::cerr << PROGRAM ": missing arguments\n"; die = true; } if (die) { std::cerr << "Try `" << PROGRAM << " --help' for more information.\n"; exit(EXIT_FAILURE); } const char *readName(argv[argc-1]); if (opt::uniformity) { std::cerr<<"bit/i="< #include #include "nthash.hpp" /** * Iterate over hash values for k-mers in a * given DNA sequence. * * This implementation uses ntHash * function to efficiently calculate * hash values for successive k-mers. */ class ssHashIterator { public: /** * Default constructor. Creates an iterator pointing to * the end of the iterator range. */ ssHashIterator(): m_pos(std::numeric_limits::max()) {} /** * Constructor. * @param seq address of DNA sequence to be hashed * @param k k-mer size * @param h number of hashes */ ssHashIterator(const std::string& seq, const std::vector& seed, unsigned k, size_t pos = 0): m_seq(seq), m_seed(seed), m_k(k), m_hVal(0), m_sVal(0), m_pos(pos) { init(); } /** Initialize internal state of iterator */ void init() { if (m_k > m_seq.length()) { m_pos = std::numeric_limits::max(); return; } m_sVal = NTS64(m_seq.data()+m_pos, m_seed, m_k, m_hVal); } /** Advance iterator right to the next valid k-mer */ void next() { ++m_pos; if (m_pos >= m_seq.length()-m_k+1) { m_pos = std::numeric_limits::max(); return; } m_sVal = NTS64(m_seq.data()+m_pos, m_seed, m_seq.at(m_pos-1), m_seq.at(m_pos-1+m_k), m_k, m_hVal); } size_t pos() const { return m_pos; } /** get pointer to hash values for current k-mer */ uint64_t operator*() const { return m_sVal; } /** test equality with another iterator */ bool operator==(const ssHashIterator& it) const { return m_pos == it.m_pos; } /** test inequality with another iterator */ bool operator!=(const ssHashIterator& it) const { return !(*this == it); } /** pre-increment operator */ ssHashIterator& operator++() { next(); return *this; } /** iterator pointing to one past last element */ static const ssHashIterator end() { return ssHashIterator(); } /** destructor */ ~ssHashIterator() { } private: /** DNA sequence */ std::string m_seq; /** spaced seed */ std::vector m_seed; /** k-mer size */ unsigned m_k; /** hash value */ uint64_t m_hVal; /** hash value */ uint64_t m_sVal; /** position of current k-mer */ size_t m_pos; }; #endif ntHash-2.2.0/sstest.cpp000066400000000000000000000011401371554176300150010ustar00rootroot00000000000000#include #include #include #include "ssHashIterator.hpp" using namespace std; int main() { /* test sequence */ std::string seq = "GAGTGTCAAACATTCAGACAACAGCAGGGGTGCTCTGGAATCCTATGTGAGGAACAAACATTCAGGCCACAGTAG"; /* seed is the spaced seed */ std::string seedStr("110001100111000001110100110110100010011101"); std::vector seed; for(auto p : seedStr) seed.push_back(p=='1'); ssHashIterator ssitr(seq, seed, seed.size()); while (ssitr != ssitr.end()) { std::cout << *ssitr << std::endl; ++ssitr; } return 0; }ntHash-2.2.0/stHashIterator.hpp000066400000000000000000000103501371554176300164300ustar00rootroot00000000000000#ifndef STHASH__ITERATOR_H #define STHASH__ITERATOR_H 1 #include #include #include "nthash.hpp" /** * Iterate over hash values for k-mers in a * given DNA sequence. * * This implementation uses ntHash * function to efficiently calculate * hash values for successive k-mers. */ class stHashIterator { public: static std::vector > parseSeed(const std::vector &seedString) { std::vector > seedSet; for (unsigned i=0; i< seedString.size(); i++) { std::vector sSeed; for (unsigned j=0; j < seedString[i].size(); j++) { if(seedString[i][j]!='1') sSeed.push_back(j); } seedSet.push_back(sSeed); } return seedSet; } /** * Default constructor. Creates an iterator pointing to * the end of the iterator range. */ stHashIterator(): m_hVec(NULL), m_hStn(NULL), m_pos(std::numeric_limits::max()) {} /** * Constructor. * @param seq address of DNA sequence to be hashed * @param seed address of spaced seed * @param k k-mer size * @param h number of seeds * @param h2 number of hashes per seed */ stHashIterator(const std::string& seq, const std::vector >& seed, unsigned h, unsigned h2, unsigned k, size_t pos = 0): m_seq(seq), m_seed(seed), m_h(h), m_h2(h2), m_k(k), m_hVec(new uint64_t[h * h2]), m_hStn(new bool[h * h2]), m_pos(pos) { init(); } /** Initialize internal state of iterator */ void init() { if (m_k > m_seq.length()) { m_pos = std::numeric_limits::max(); return; } unsigned locN=0; while (m_pos= m_seq.length()-m_k+1) m_pos = std::numeric_limits::max(); } /** Advance iterator right to the next valid k-mer */ void next() { ++m_pos; if (m_pos >= m_seq.length()-m_k+1) { m_pos = std::numeric_limits::max(); return; } if(seedTab[(unsigned char)(m_seq.at(m_pos+m_k-1))]==seedN) { m_pos+=m_k; init(); } else NTMSM64(m_seq.data()+m_pos, m_seed, m_seq.at(m_pos-1), m_seq.at(m_pos-1+m_k), m_k, m_h, m_h2, m_fhVal, m_rhVal, m_hVec, m_hStn); } size_t pos() const{ return m_pos; } /** get pointer to hash values for current k-mer */ const bool* strandArray() const { return m_hStn; } /** get pointer to hash values for current k-mer */ const uint64_t* operator*() const { return m_hVec; } /** test equality with another iterator */ bool operator==(const stHashIterator& it) const { return m_pos == it.m_pos; } /** test inequality with another iterator */ bool operator!=(const stHashIterator& it) const { return !(*this == it); } /** pre-increment operator */ stHashIterator& operator++() { next(); return *this; } /** iterator pointing to one past last element */ static const stHashIterator end() { return stHashIterator(); } /** destructor */ ~stHashIterator() { if(m_hVec!=NULL) { delete [] m_hVec; delete [] m_hStn; } } private: /** DNA sequence */ std::string m_seq; /** Spaced Seed sequence */ std::vector > m_seed; /** number of seeds */ unsigned m_h; /** number of hashes per seed */ unsigned m_h2; /** k-mer size */ unsigned m_k; /** hash values * For m_h = n and m_h2 = m: * [seed1Hash1, seed1Hash2 ... seed(n)Hash(m-1), seed(n)Hash(m)] */ uint64_t *m_hVec; /** hash strands, forward = 0, reverse-complement = 1 */ bool *m_hStn; /** position of current k-mer */ size_t m_pos; /** forward-strand k-mer hash value */ uint64_t m_fhVal; /** reverse-complement k-mer hash value */ uint64_t m_rhVal; }; #endif ntHash-2.2.0/sttest.cpp000066400000000000000000000031351371554176300150100ustar00rootroot00000000000000#include #include #include #include #include "stHashIterator.hpp" using namespace std; int main(int argc, const char *argv[]) { size_t countOnes=0; std::vector seedString; seedString.push_back("110001100111000001110100110110100010011101"); seedString.push_back("000001111100101110111000001011010100011110"); seedString.push_back("011110001010110100000111011101001111100000"); seedString.push_back("101110010001011011001011100000111001100011"); /* test sequence */ //std::string seq = "GAGTGTCAAACATTCAGACAACAGCAGGGGTGCTCTGGAATCCTATGTGAGGAACAAACATTCAGGCCACAGTAG"; /* h is the number of spaced seeds and k is the length of spaced seeds */ unsigned h, k; h = seedString.size(); k = seedString[0].size(); std::vector > seedSet = parseSeed(seedString); clock_t sTime = clock(); std::ifstream in(argv[argc-1]); bool good = true; for(string seq, hseq; good;) { good = static_cast(getline(in, hseq)); good = static_cast(getline(in, seq)); good = static_cast(getline(in, hseq)); good = static_cast(getline(in, hseq)); if(good){ stHashIterator ssitr(seq, seedSet, h, k); while (ssitr != ssitr.end()) { if((ssitr.strandArray())[0]) ++countOnes; ++ssitr; } } } std::cerr<< countOnes << std::endl; std::cerr << (double)(clock() - sTime)/CLOCKS_PER_SEC << "\n"; return 0; } ntHash-2.2.0/unittest/000077500000000000000000000000001371554176300146335ustar00rootroot00000000000000ntHash-2.2.0/unittest/Makefile.am000066400000000000000000000004651371554176300166740ustar00rootroot00000000000000# program that will only be compiled with 'make check' check_PROGRAMS = UNITTESTS UNITTESTS_SOURCES = UnitTests.cpp UNITTESTS_CPPFLAGS = -I$(top_srcdir) UNITTESTS_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS) -std=c++11 # programs that will be run by 'make check' (after compiling) TESTS = $(check_PROGRAMS) ntHash-2.2.0/unittest/UnitTests.cpp000066400000000000000000000071741371554176300173120ustar00rootroot00000000000000/* * UnitTests.cpp * Unit Tests for various ntHash headers * Created on: January 20, 2020 * Author: Johnathan Wong */ /* automatically create main() function to run tests */ #define CATCH_CONFIG_MAIN /* lightweight unit test framework */ #include "vendor/catch.hpp" #include "ntHashIterator.hpp" #include "stHashIterator.hpp" #include #include #include #include #include #include TEST_CASE("test fixture", "[UnitTests]") { /* * NOTES: * - The SECTION blocks below are separate tests that share the * same setup code * - The common setup code is _re-run_ before each SECTION * - In unit test terminology, this type of setup is known as a * "test fixture" * - See * https://github.com/philsquared/Catch/blob/master/docs/tutorial.md#test-cases-and-sections for * details */ /* START COMMON SETUP CODE */ std::string kmer = "ACGTACACTGGACTGAGTCT"; /* END COMMON SETUP CODE */ SECTION("invariant hash values") { ntHashIterator invariantIt(kmer, 3, 20); /* Hash values*/ const std::vector hashes = {10434435546371013747U, 16073887395445158014U, 8061578976118370557U}; for (int i = 0; i < 3; ++i) { assert((*invariantIt)[i] == hashes[i]); } } SECTION("reverse complement") { ntHashIterator kmerIt(kmer, 3, 20); /* Reverse complement of kmer*/ std::string rcKmer = "AGACTCAGTCCAGTGTACGT"; ntHashIterator rcKmerIt(rcKmer, 3, 20); for (int i = 0; i < 3; ++i) { assert((*kmerIt)[i] == (*rcKmerIt)[i]); } } SECTION("rolling hash values") { ntHashIterator rollingHashIt(kmer, 3, 18); /* 18-mers of kmer*/ std::string kmer1 = "ACGTACACTGGACTGAGT"; std::string kmer2 = "CGTACACTGGACTGAGTC"; std::string kmer3 = "GTACACTGGACTGAGTCT"; ntHashIterator kmer1It(kmer1, 3, 18); ntHashIterator kmer2It(kmer2, 3, 18); ntHashIterator kmer3It(kmer3, 3, 18); std::vector vecKmerIt = {kmer1It, kmer2It, kmer3It}; for (int i = 0; i < 3; ++i) { ntHashIterator kmerPosIt(kmer, 3, 18, i); for (int j = 0; j < 3; ++j) { assert((*rollingHashIt)[j] == (*vecKmerIt[i])[j]); assert((*rollingHashIt)[j] == (*kmerPosIt)[j]); } ++rollingHashIt; } } SECTION("spaced seeds") { std::vector seedString; seedString.push_back("11111100000000111111"); auto numSeeds = seedString.size(); auto k = seedString[0].size(); std::vector> seedSet = stHashIterator::parseSeed(seedString); /* Point Mutations of Kmer*/ std::string kmerM1 = "ACGTACACTTGACTGAGTCT"; std::string kmerM2 = "ACGTACACTGTACTGAGTCT"; std::string kmerM3 = "ACGTACACTGCACTGAGTCT"; stHashIterator ssItr(kmer, seedSet, numSeeds, 1, k); stHashIterator ssM1Itr(kmerM1, seedSet, numSeeds, 1, k); stHashIterator ssM2Itr(kmerM2, seedSet, numSeeds, 1, k); stHashIterator ssM3Itr(kmerM3, seedSet, numSeeds, 1, k); assert((*ssItr)[0] == (*ssM1Itr)[0]); assert((*ssItr)[0] == (*ssM2Itr)[0]); assert((*ssItr)[0] == (*ssM3Itr)[0]); } SECTION("RNA") { ntHashIterator dnaIt(kmer, 3, 20); std::string rnaKmer = "ACGUACACUGGACUGAGUCU"; ntHashIterator rnaIt(rnaKmer, 3, 20); for (int i = 0; i < 3; ++i) { assert((*dnaIt)[i] == (*rnaIt)[i]); } } /* end test fixture */ } ntHash-2.2.0/vendor/000077500000000000000000000000001371554176300142515ustar00rootroot00000000000000ntHash-2.2.0/vendor/Makefile.am000066400000000000000000000000331371554176300163010ustar00rootroot00000000000000noinst_HEADERS = catch.hpp ntHash-2.2.0/vendor/catch.hpp000066400000000000000000013176241371554176300160620ustar00rootroot00000000000000/* * Catch v1.3.0 * Generated: 2015-12-04 10:18:17.055188 * ---------------------------------------------------------- * This file has been merged from multiple headers. Please don't edit it directly * Copyright (c) 2012 Two Blue Cubes Ltd. All rights reserved. * * Distributed under the Boost Software License, Version 1.0. (See accompanying * file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) */ #ifndef TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED #define TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED #define TWOBLUECUBES_CATCH_HPP_INCLUDED #ifdef __clang__ # pragma clang system_header #elif defined __GNUC__ # pragma GCC system_header #endif // #included from: internal/catch_suppress_warnings.h #ifdef __clang__ # ifdef __ICC // icpc defines the __clang__ macro # pragma warning(push) # pragma warning(disable: 161 1682) # else // __ICC # pragma clang diagnostic ignored "-Wglobal-constructors" # pragma clang diagnostic ignored "-Wvariadic-macros" # pragma clang diagnostic ignored "-Wc99-extensions" # pragma clang diagnostic ignored "-Wunused-variable" # pragma clang diagnostic push # pragma clang diagnostic ignored "-Wpadded" # pragma clang diagnostic ignored "-Wc++98-compat" # pragma clang diagnostic ignored "-Wc++98-compat-pedantic" # pragma clang diagnostic ignored "-Wswitch-enum" # pragma clang diagnostic ignored "-Wcovered-switch-default" # endif #elif defined __GNUC__ # pragma GCC diagnostic ignored "-Wvariadic-macros" # pragma GCC diagnostic ignored "-Wunused-variable" # pragma GCC diagnostic push # pragma GCC diagnostic ignored "-Wpadded" #endif #if defined(CATCH_CONFIG_MAIN) || defined(CATCH_CONFIG_RUNNER) # define CATCH_IMPL #endif #ifdef CATCH_IMPL # ifndef CLARA_CONFIG_MAIN # define CLARA_CONFIG_MAIN_NOT_DEFINED # define CLARA_CONFIG_MAIN # endif #endif // #included from: internal/catch_notimplemented_exception.h #define TWOBLUECUBES_CATCH_NOTIMPLEMENTED_EXCEPTION_H_INCLUDED // #included from: catch_common.h #define TWOBLUECUBES_CATCH_COMMON_H_INCLUDED #define INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) name##line #define INTERNAL_CATCH_UNIQUE_NAME_LINE( name, line ) INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) #define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __LINE__ ) #define INTERNAL_CATCH_STRINGIFY2( expr ) #expr #define INTERNAL_CATCH_STRINGIFY( expr ) INTERNAL_CATCH_STRINGIFY2( expr ) #include #include #include // #included from: catch_compiler_capabilities.h #define TWOBLUECUBES_CATCH_COMPILER_CAPABILITIES_HPP_INCLUDED // Detect a number of compiler features - mostly C++11/14 conformance - by compiler // The following features are defined: // // CATCH_CONFIG_CPP11_NULLPTR : is nullptr supported? // CATCH_CONFIG_CPP11_NOEXCEPT : is noexcept supported? // CATCH_CONFIG_CPP11_GENERATED_METHODS : The delete and default keywords for compiler generated methods // CATCH_CONFIG_CPP11_IS_ENUM : std::is_enum is supported? // CATCH_CONFIG_CPP11_TUPLE : std::tuple is supported // CATCH_CONFIG_CPP11_LONG_LONG : is long long supported? // CATCH_CONFIG_CPP11_OVERRIDE : is override supported? // CATCH_CONFIG_CPP11_UNIQUE_PTR : is unique_ptr supported (otherwise use auto_ptr) // CATCH_CONFIG_CPP11_OR_GREATER : Is C++11 supported? // CATCH_CONFIG_VARIADIC_MACROS : are variadic macros supported? // **************** // Note to maintainers: if new toggles are added please document them // in configuration.md, too // **************** // In general each macro has a _NO_ form // (e.g. CATCH_CONFIG_CPP11_NO_NULLPTR) which disables the feature. // Many features, at point of detection, define an _INTERNAL_ macro, so they // can be combined, en-mass, with the _NO_ forms later. // All the C++11 features can be disabled with CATCH_CONFIG_NO_CPP11 #ifdef __clang__ # if __has_feature(cxx_nullptr) # define CATCH_INTERNAL_CONFIG_CPP11_NULLPTR # endif # if __has_feature(cxx_noexcept) # define CATCH_INTERNAL_CONFIG_CPP11_NOEXCEPT # endif #endif // __clang__ //////////////////////////////////////////////////////////////////////////////// // Borland #ifdef __BORLANDC__ #endif // __BORLANDC__ //////////////////////////////////////////////////////////////////////////////// // EDG #ifdef __EDG_VERSION__ #endif // __EDG_VERSION__ //////////////////////////////////////////////////////////////////////////////// // Digital Mars #ifdef __DMC__ #endif // __DMC__ //////////////////////////////////////////////////////////////////////////////// // GCC #ifdef __GNUC__ #if __GNUC__ == 4 && __GNUC_MINOR__ >= 6 && defined(__GXX_EXPERIMENTAL_CXX0X__) # define CATCH_INTERNAL_CONFIG_CPP11_NULLPTR #endif // - otherwise more recent versions define __cplusplus >= 201103L // and will get picked up below #endif // __GNUC__ //////////////////////////////////////////////////////////////////////////////// // Visual C++ #ifdef _MSC_VER #if (_MSC_VER >= 1600) # define CATCH_INTERNAL_CONFIG_CPP11_NULLPTR # define CATCH_INTERNAL_CONFIG_CPP11_UNIQUE_PTR #endif #if (_MSC_VER >= 1900 ) // (VC++ 13 (VS2015)) #define CATCH_INTERNAL_CONFIG_CPP11_NOEXCEPT #define CATCH_INTERNAL_CONFIG_CPP11_GENERATED_METHODS #endif #endif // _MSC_VER //////////////////////////////////////////////////////////////////////////////// // Use variadic macros if the compiler supports them #if ( defined _MSC_VER && _MSC_VER > 1400 && !defined __EDGE__) || \ ( defined __WAVE__ && __WAVE_HAS_VARIADICS ) || \ ( defined __GNUC__ && __GNUC__ >= 3 ) || \ ( !defined __cplusplus && __STDC_VERSION__ >= 199901L || __cplusplus >= 201103L ) #define CATCH_INTERNAL_CONFIG_VARIADIC_MACROS #endif //////////////////////////////////////////////////////////////////////////////// // C++ language feature support // catch all support for C++11 #if defined(__cplusplus) && __cplusplus >= 201103L # define CATCH_CPP11_OR_GREATER # if !defined(CATCH_INTERNAL_CONFIG_CPP11_NULLPTR) # define CATCH_INTERNAL_CONFIG_CPP11_NULLPTR # endif # ifndef CATCH_INTERNAL_CONFIG_CPP11_NOEXCEPT # define CATCH_INTERNAL_CONFIG_CPP11_NOEXCEPT # endif # ifndef CATCH_INTERNAL_CONFIG_CPP11_GENERATED_METHODS # define CATCH_INTERNAL_CONFIG_CPP11_GENERATED_METHODS # endif # ifndef CATCH_INTERNAL_CONFIG_CPP11_IS_ENUM # define CATCH_INTERNAL_CONFIG_CPP11_IS_ENUM # endif # ifndef CATCH_INTERNAL_CONFIG_CPP11_TUPLE # define CATCH_INTERNAL_CONFIG_CPP11_TUPLE # endif # ifndef CATCH_INTERNAL_CONFIG_VARIADIC_MACROS # define CATCH_INTERNAL_CONFIG_VARIADIC_MACROS # endif # if !defined(CATCH_INTERNAL_CONFIG_CPP11_LONG_LONG) # define CATCH_INTERNAL_CONFIG_CPP11_LONG_LONG # endif # if !defined(CATCH_INTERNAL_CONFIG_CPP11_OVERRIDE) # define CATCH_INTERNAL_CONFIG_CPP11_OVERRIDE # endif # if !defined(CATCH_INTERNAL_CONFIG_CPP11_UNIQUE_PTR) # define CATCH_INTERNAL_CONFIG_CPP11_UNIQUE_PTR # endif #endif // __cplusplus >= 201103L // Now set the actual defines based on the above + anything the user has configured #if defined(CATCH_INTERNAL_CONFIG_CPP11_NULLPTR) && !defined(CATCH_CONFIG_CPP11_NO_NULLPTR) && !defined(CATCH_CONFIG_CPP11_NULLPTR) && !defined(CATCH_CONFIG_NO_CPP11) # define CATCH_CONFIG_CPP11_NULLPTR #endif #if defined(CATCH_INTERNAL_CONFIG_CPP11_NOEXCEPT) && !defined(CATCH_CONFIG_CPP11_NO_NOEXCEPT) && !defined(CATCH_CONFIG_CPP11_NOEXCEPT) && !defined(CATCH_CONFIG_NO_CPP11) # define CATCH_CONFIG_CPP11_NOEXCEPT #endif #if defined(CATCH_INTERNAL_CONFIG_CPP11_GENERATED_METHODS) && !defined(CATCH_CONFIG_CPP11_NO_GENERATED_METHODS) && !defined(CATCH_CONFIG_CPP11_GENERATED_METHODS) && !defined(CATCH_CONFIG_NO_CPP11) # define CATCH_CONFIG_CPP11_GENERATED_METHODS #endif #if defined(CATCH_INTERNAL_CONFIG_CPP11_IS_ENUM) && !defined(CATCH_CONFIG_CPP11_NO_IS_ENUM) && !defined(CATCH_CONFIG_CPP11_IS_ENUM) && !defined(CATCH_CONFIG_NO_CPP11) # define CATCH_CONFIG_CPP11_IS_ENUM #endif #if defined(CATCH_INTERNAL_CONFIG_CPP11_TUPLE) && !defined(CATCH_CONFIG_CPP11_NO_TUPLE) && !defined(CATCH_CONFIG_CPP11_TUPLE) && !defined(CATCH_CONFIG_NO_CPP11) # define CATCH_CONFIG_CPP11_TUPLE #endif #if defined(CATCH_INTERNAL_CONFIG_VARIADIC_MACROS) && !defined(CATCH_CONFIG_NO_VARIADIC_MACROS) && !defined(CATCH_CONFIG_VARIADIC_MACROS) # define CATCH_CONFIG_VARIADIC_MACROS #endif #if defined(CATCH_INTERNAL_CONFIG_CPP11_LONG_LONG) && !defined(CATCH_CONFIG_NO_LONG_LONG) && !defined(CATCH_CONFIG_CPP11_LONG_LONG) && !defined(CATCH_CONFIG_NO_CPP11) # define CATCH_CONFIG_CPP11_LONG_LONG #endif #if defined(CATCH_INTERNAL_CONFIG_CPP11_OVERRIDE) && !defined(CATCH_CONFIG_NO_OVERRIDE) && !defined(CATCH_CONFIG_CPP11_OVERRIDE) && !defined(CATCH_CONFIG_NO_CPP11) # define CATCH_CONFIG_CPP11_OVERRIDE #endif #if defined(CATCH_INTERNAL_CONFIG_CPP11_UNIQUE_PTR) && !defined(CATCH_CONFIG_NO_UNIQUE_PTR) && !defined(CATCH_CONFIG_CPP11_UNIQUE_PTR) && !defined(CATCH_CONFIG_NO_CPP11) # define CATCH_CONFIG_CPP11_UNIQUE_PTR #endif // noexcept support: #if defined(CATCH_CONFIG_CPP11_NOEXCEPT) && !defined(CATCH_NOEXCEPT) # define CATCH_NOEXCEPT noexcept # define CATCH_NOEXCEPT_IS(x) noexcept(x) #else # define CATCH_NOEXCEPT throw() # define CATCH_NOEXCEPT_IS(x) #endif // nullptr support #ifdef CATCH_CONFIG_CPP11_NULLPTR # define CATCH_NULL nullptr #else # define CATCH_NULL NULL #endif // override support #ifdef CATCH_CONFIG_CPP11_OVERRIDE # define CATCH_OVERRIDE override #else # define CATCH_OVERRIDE #endif // unique_ptr support #ifdef CATCH_CONFIG_CPP11_UNIQUE_PTR # define CATCH_AUTO_PTR( T ) std::unique_ptr #else # define CATCH_AUTO_PTR( T ) std::auto_ptr #endif namespace Catch { struct IConfig; struct CaseSensitive { enum Choice { Yes, No }; }; class NonCopyable { #ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS NonCopyable( NonCopyable const& ) = delete; NonCopyable( NonCopyable && ) = delete; NonCopyable& operator = ( NonCopyable const& ) = delete; NonCopyable& operator = ( NonCopyable && ) = delete; #else NonCopyable( NonCopyable const& info ); NonCopyable& operator = ( NonCopyable const& ); #endif protected: NonCopyable() {} virtual ~NonCopyable(); }; class SafeBool { public: typedef void (SafeBool::*type)() const; static type makeSafe( bool value ) { return value ? &SafeBool::trueValue : 0; } private: void trueValue() const {} }; template inline void deleteAll( ContainerT& container ) { typename ContainerT::const_iterator it = container.begin(); typename ContainerT::const_iterator itEnd = container.end(); for(; it != itEnd; ++it ) delete *it; } template inline void deleteAllValues( AssociativeContainerT& container ) { typename AssociativeContainerT::const_iterator it = container.begin(); typename AssociativeContainerT::const_iterator itEnd = container.end(); for(; it != itEnd; ++it ) delete it->second; } bool startsWith( std::string const& s, std::string const& prefix ); bool endsWith( std::string const& s, std::string const& suffix ); bool contains( std::string const& s, std::string const& infix ); void toLowerInPlace( std::string& s ); std::string toLower( std::string const& s ); std::string trim( std::string const& str ); bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ); struct pluralise { pluralise( std::size_t count, std::string const& label ); friend std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ); std::size_t m_count; std::string m_label; }; struct SourceLineInfo { SourceLineInfo(); SourceLineInfo( char const* _file, std::size_t _line ); SourceLineInfo( SourceLineInfo const& other ); # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS SourceLineInfo( SourceLineInfo && ) = default; SourceLineInfo& operator = ( SourceLineInfo const& ) = default; SourceLineInfo& operator = ( SourceLineInfo && ) = default; # endif bool empty() const; bool operator == ( SourceLineInfo const& other ) const; bool operator < ( SourceLineInfo const& other ) const; std::string file; std::size_t line; }; std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ); // This is just here to avoid compiler warnings with macro constants and boolean literals inline bool isTrue( bool value ){ return value; } inline bool alwaysTrue() { return true; } inline bool alwaysFalse() { return false; } void throwLogicError( std::string const& message, SourceLineInfo const& locationInfo ); void seedRng( IConfig const& config ); unsigned int rngSeed(); // Use this in variadic streaming macros to allow // >> +StreamEndStop // as well as // >> stuff +StreamEndStop struct StreamEndStop { std::string operator+() { return std::string(); } }; template T const& operator + ( T const& value, StreamEndStop ) { return value; } } #define CATCH_INTERNAL_LINEINFO ::Catch::SourceLineInfo( __FILE__, static_cast( __LINE__ ) ) #define CATCH_INTERNAL_ERROR( msg ) ::Catch::throwLogicError( msg, CATCH_INTERNAL_LINEINFO ); #include namespace Catch { class NotImplementedException : public std::exception { public: NotImplementedException( SourceLineInfo const& lineInfo ); NotImplementedException( NotImplementedException const& ) {} virtual ~NotImplementedException() CATCH_NOEXCEPT {} virtual const char* what() const CATCH_NOEXCEPT; private: std::string m_what; SourceLineInfo m_lineInfo; }; } // end namespace Catch /////////////////////////////////////////////////////////////////////////////// #define CATCH_NOT_IMPLEMENTED throw Catch::NotImplementedException( CATCH_INTERNAL_LINEINFO ) // #included from: internal/catch_context.h #define TWOBLUECUBES_CATCH_CONTEXT_H_INCLUDED // #included from: catch_interfaces_generators.h #define TWOBLUECUBES_CATCH_INTERFACES_GENERATORS_H_INCLUDED #include namespace Catch { struct IGeneratorInfo { virtual ~IGeneratorInfo(); virtual bool moveNext() = 0; virtual std::size_t getCurrentIndex() const = 0; }; struct IGeneratorsForTest { virtual ~IGeneratorsForTest(); virtual IGeneratorInfo& getGeneratorInfo( std::string const& fileInfo, std::size_t size ) = 0; virtual bool moveNext() = 0; }; IGeneratorsForTest* createGeneratorsForTest(); } // end namespace Catch // #included from: catch_ptr.hpp #define TWOBLUECUBES_CATCH_PTR_HPP_INCLUDED #ifdef __clang__ #pragma clang diagnostic push #pragma clang diagnostic ignored "-Wpadded" #endif namespace Catch { // An intrusive reference counting smart pointer. // T must implement addRef() and release() methods // typically implementing the IShared interface template class Ptr { public: Ptr() : m_p( CATCH_NULL ){} Ptr( T* p ) : m_p( p ){ if( m_p ) m_p->addRef(); } Ptr( Ptr const& other ) : m_p( other.m_p ){ if( m_p ) m_p->addRef(); } ~Ptr(){ if( m_p ) m_p->release(); } void reset() { if( m_p ) m_p->release(); m_p = CATCH_NULL; } Ptr& operator = ( T* p ){ Ptr temp( p ); swap( temp ); return *this; } Ptr& operator = ( Ptr const& other ){ Ptr temp( other ); swap( temp ); return *this; } void swap( Ptr& other ) { std::swap( m_p, other.m_p ); } T* get() const{ return m_p; } T& operator*() const { return *m_p; } T* operator->() const { return m_p; } bool operator !() const { return m_p == CATCH_NULL; } operator SafeBool::type() const { return SafeBool::makeSafe( m_p != CATCH_NULL ); } private: T* m_p; }; struct IShared : NonCopyable { virtual ~IShared(); virtual void addRef() const = 0; virtual void release() const = 0; }; template struct SharedImpl : T { SharedImpl() : m_rc( 0 ){} virtual void addRef() const { ++m_rc; } virtual void release() const { if( --m_rc == 0 ) delete this; } mutable unsigned int m_rc; }; } // end namespace Catch #ifdef __clang__ #pragma clang diagnostic pop #endif #include #include #include namespace Catch { class TestCase; class Stream; struct IResultCapture; struct IRunner; struct IGeneratorsForTest; struct IConfig; struct IContext { virtual ~IContext(); virtual IResultCapture* getResultCapture() = 0; virtual IRunner* getRunner() = 0; virtual size_t getGeneratorIndex( std::string const& fileInfo, size_t totalSize ) = 0; virtual bool advanceGeneratorsForCurrentTest() = 0; virtual Ptr getConfig() const = 0; }; struct IMutableContext : IContext { virtual ~IMutableContext(); virtual void setResultCapture( IResultCapture* resultCapture ) = 0; virtual void setRunner( IRunner* runner ) = 0; virtual void setConfig( Ptr const& config ) = 0; }; IContext& getCurrentContext(); IMutableContext& getCurrentMutableContext(); void cleanUpContext(); Stream createStream( std::string const& streamName ); } // #included from: internal/catch_test_registry.hpp #define TWOBLUECUBES_CATCH_TEST_REGISTRY_HPP_INCLUDED // #included from: catch_interfaces_testcase.h #define TWOBLUECUBES_CATCH_INTERFACES_TESTCASE_H_INCLUDED #include namespace Catch { class TestSpec; struct ITestCase : IShared { virtual void invoke () const = 0; protected: virtual ~ITestCase(); }; class TestCase; struct IConfig; struct ITestCaseRegistry { virtual ~ITestCaseRegistry(); virtual std::vector const& getAllTests() const = 0; virtual std::vector const& getAllTestsSorted( IConfig const& config ) const = 0; }; bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); std::vector const& getAllTestCasesSorted( IConfig const& config ); } namespace Catch { template class MethodTestCase : public SharedImpl { public: MethodTestCase( void (C::*method)() ) : m_method( method ) {} virtual void invoke() const { C obj; (obj.*m_method)(); } private: virtual ~MethodTestCase() {} void (C::*m_method)(); }; typedef void(*TestFunction)(); struct NameAndDesc { NameAndDesc( const char* _name = "", const char* _description= "" ) : name( _name ), description( _description ) {} const char* name; const char* description; }; void registerTestCase ( ITestCase* testCase, char const* className, NameAndDesc const& nameAndDesc, SourceLineInfo const& lineInfo ); struct AutoReg { AutoReg ( TestFunction function, SourceLineInfo const& lineInfo, NameAndDesc const& nameAndDesc ); template AutoReg ( void (C::*method)(), char const* className, NameAndDesc const& nameAndDesc, SourceLineInfo const& lineInfo ) { registerTestCase ( new MethodTestCase( method ), className, nameAndDesc, lineInfo ); } ~AutoReg(); private: AutoReg( AutoReg const& ); void operator= ( AutoReg const& ); }; void registerTestCaseFunction ( TestFunction function, SourceLineInfo const& lineInfo, NameAndDesc const& nameAndDesc ); } // end namespace Catch #ifdef CATCH_CONFIG_VARIADIC_MACROS /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_TESTCASE( ... ) \ static void INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )(); \ namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( &INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), CATCH_INTERNAL_LINEINFO, Catch::NameAndDesc( __VA_ARGS__ ) ); }\ static void INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )() /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_METHOD_AS_TEST_CASE( QualifiedMethod, ... ) \ namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( &QualifiedMethod, "&" #QualifiedMethod, Catch::NameAndDesc( __VA_ARGS__ ), CATCH_INTERNAL_LINEINFO ); } /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_TEST_CASE_METHOD( ClassName, ... )\ namespace{ \ struct INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ) : ClassName{ \ void test(); \ }; \ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar ) ( &INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )::test, #ClassName, Catch::NameAndDesc( __VA_ARGS__ ), CATCH_INTERNAL_LINEINFO ); \ } \ void INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )::test() /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_REGISTER_TESTCASE( Function, ... ) \ Catch::AutoReg( Function, CATCH_INTERNAL_LINEINFO, Catch::NameAndDesc( __VA_ARGS__ ) ); #else /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_TESTCASE( Name, Desc ) \ static void INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )(); \ namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( &INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), CATCH_INTERNAL_LINEINFO, Catch::NameAndDesc( Name, Desc ) ); }\ static void INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )() /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_METHOD_AS_TEST_CASE( QualifiedMethod, Name, Desc ) \ namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( &QualifiedMethod, "&" #QualifiedMethod, Catch::NameAndDesc( Name, Desc ), CATCH_INTERNAL_LINEINFO ); } /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_TEST_CASE_METHOD( ClassName, TestName, Desc )\ namespace{ \ struct INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ) : ClassName{ \ void test(); \ }; \ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar ) ( &INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )::test, #ClassName, Catch::NameAndDesc( TestName, Desc ), CATCH_INTERNAL_LINEINFO ); \ } \ void INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )::test() /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_REGISTER_TESTCASE( Function, Name, Desc ) \ Catch::AutoReg( Function, CATCH_INTERNAL_LINEINFO, Catch::NameAndDesc( Name, Desc ) ); #endif // #included from: internal/catch_capture.hpp #define TWOBLUECUBES_CATCH_CAPTURE_HPP_INCLUDED // #included from: catch_result_builder.h #define TWOBLUECUBES_CATCH_RESULT_BUILDER_H_INCLUDED // #included from: catch_result_type.h #define TWOBLUECUBES_CATCH_RESULT_TYPE_H_INCLUDED namespace Catch { // ResultWas::OfType enum struct ResultWas { enum OfType { Unknown = -1, Ok = 0, Info = 1, Warning = 2, FailureBit = 0x10, ExpressionFailed = FailureBit | 1, ExplicitFailure = FailureBit | 2, Exception = 0x100 | FailureBit, ThrewException = Exception | 1, DidntThrowException = Exception | 2, FatalErrorCondition = 0x200 | FailureBit }; }; inline bool isOk( ResultWas::OfType resultType ) { return ( resultType & ResultWas::FailureBit ) == 0; } inline bool isJustInfo( int flags ) { return flags == ResultWas::Info; } // ResultDisposition::Flags enum struct ResultDisposition { enum Flags { Normal = 0x01, ContinueOnFailure = 0x02, // Failures fail test, but execution continues FalseTest = 0x04, // Prefix expression with ! SuppressFail = 0x08 // Failures are reported but do not fail the test }; }; inline ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ) { return static_cast( static_cast( lhs ) | static_cast( rhs ) ); } inline bool shouldContinueOnFailure( int flags ) { return ( flags & ResultDisposition::ContinueOnFailure ) != 0; } inline bool isFalseTest( int flags ) { return ( flags & ResultDisposition::FalseTest ) != 0; } inline bool shouldSuppressFailure( int flags ) { return ( flags & ResultDisposition::SuppressFail ) != 0; } } // end namespace Catch // #included from: catch_assertionresult.h #define TWOBLUECUBES_CATCH_ASSERTIONRESULT_H_INCLUDED #include namespace Catch { struct AssertionInfo { AssertionInfo() {} AssertionInfo( std::string const& _macroName, SourceLineInfo const& _lineInfo, std::string const& _capturedExpression, ResultDisposition::Flags _resultDisposition ); std::string macroName; SourceLineInfo lineInfo; std::string capturedExpression; ResultDisposition::Flags resultDisposition; }; struct AssertionResultData { AssertionResultData() : resultType( ResultWas::Unknown ) {} std::string reconstructedExpression; std::string message; ResultWas::OfType resultType; }; class AssertionResult { public: AssertionResult(); AssertionResult( AssertionInfo const& info, AssertionResultData const& data ); ~AssertionResult(); # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS AssertionResult( AssertionResult const& ) = default; AssertionResult( AssertionResult && ) = default; AssertionResult& operator = ( AssertionResult const& ) = default; AssertionResult& operator = ( AssertionResult && ) = default; # endif bool isOk() const; bool succeeded() const; ResultWas::OfType getResultType() const; bool hasExpression() const; bool hasMessage() const; std::string getExpression() const; std::string getExpressionInMacro() const; bool hasExpandedExpression() const; std::string getExpandedExpression() const; std::string getMessage() const; SourceLineInfo getSourceInfo() const; std::string getTestMacroName() const; protected: AssertionInfo m_info; AssertionResultData m_resultData; }; } // end namespace Catch // #included from: catch_matchers.hpp #define TWOBLUECUBES_CATCH_MATCHERS_HPP_INCLUDED namespace Catch { namespace Matchers { namespace Impl { namespace Generic { template class AllOf; template class AnyOf; template class Not; } template struct Matcher : SharedImpl { typedef ExpressionT ExpressionType; virtual ~Matcher() {} virtual Ptr clone() const = 0; virtual bool match( ExpressionT const& expr ) const = 0; virtual std::string toString() const = 0; Generic::AllOf operator && ( Matcher const& other ) const; Generic::AnyOf operator || ( Matcher const& other ) const; Generic::Not operator ! () const; }; template struct MatcherImpl : Matcher { virtual Ptr > clone() const { return Ptr >( new DerivedT( static_cast( *this ) ) ); } }; namespace Generic { template class Not : public MatcherImpl, ExpressionT> { public: explicit Not( Matcher const& matcher ) : m_matcher(matcher.clone()) {} Not( Not const& other ) : m_matcher( other.m_matcher ) {} virtual bool match( ExpressionT const& expr ) const CATCH_OVERRIDE { return !m_matcher->match( expr ); } virtual std::string toString() const CATCH_OVERRIDE { return "not " + m_matcher->toString(); } private: Ptr< Matcher > m_matcher; }; template class AllOf : public MatcherImpl, ExpressionT> { public: AllOf() {} AllOf( AllOf const& other ) : m_matchers( other.m_matchers ) {} AllOf& add( Matcher const& matcher ) { m_matchers.push_back( matcher.clone() ); return *this; } virtual bool match( ExpressionT const& expr ) const { for( std::size_t i = 0; i < m_matchers.size(); ++i ) if( !m_matchers[i]->match( expr ) ) return false; return true; } virtual std::string toString() const { std::ostringstream oss; oss << "( "; for( std::size_t i = 0; i < m_matchers.size(); ++i ) { if( i != 0 ) oss << " and "; oss << m_matchers[i]->toString(); } oss << " )"; return oss.str(); } AllOf operator && ( Matcher const& other ) const { AllOf allOfExpr( *this ); allOfExpr.add( other ); return allOfExpr; } private: std::vector > > m_matchers; }; template class AnyOf : public MatcherImpl, ExpressionT> { public: AnyOf() {} AnyOf( AnyOf const& other ) : m_matchers( other.m_matchers ) {} AnyOf& add( Matcher const& matcher ) { m_matchers.push_back( matcher.clone() ); return *this; } virtual bool match( ExpressionT const& expr ) const { for( std::size_t i = 0; i < m_matchers.size(); ++i ) if( m_matchers[i]->match( expr ) ) return true; return false; } virtual std::string toString() const { std::ostringstream oss; oss << "( "; for( std::size_t i = 0; i < m_matchers.size(); ++i ) { if( i != 0 ) oss << " or "; oss << m_matchers[i]->toString(); } oss << " )"; return oss.str(); } AnyOf operator || ( Matcher const& other ) const { AnyOf anyOfExpr( *this ); anyOfExpr.add( other ); return anyOfExpr; } private: std::vector > > m_matchers; }; } // namespace Generic template Generic::AllOf Matcher::operator && ( Matcher const& other ) const { Generic::AllOf allOfExpr; allOfExpr.add( *this ); allOfExpr.add( other ); return allOfExpr; } template Generic::AnyOf Matcher::operator || ( Matcher const& other ) const { Generic::AnyOf anyOfExpr; anyOfExpr.add( *this ); anyOfExpr.add( other ); return anyOfExpr; } template Generic::Not Matcher::operator ! () const { return Generic::Not( *this ); } namespace StdString { inline std::string makeString( std::string const& str ) { return str; } inline std::string makeString( const char* str ) { return str ? std::string( str ) : std::string(); } struct CasedString { CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ) : m_caseSensitivity( caseSensitivity ), m_str( adjustString( str ) ) {} std::string adjustString( std::string const& str ) const { return m_caseSensitivity == CaseSensitive::No ? toLower( str ) : str; } std::string toStringSuffix() const { return m_caseSensitivity == CaseSensitive::No ? " (case insensitive)" : ""; } CaseSensitive::Choice m_caseSensitivity; std::string m_str; }; struct Equals : MatcherImpl { Equals( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ) : m_data( str, caseSensitivity ) {} Equals( Equals const& other ) : m_data( other.m_data ){} virtual ~Equals(); virtual bool match( std::string const& expr ) const { return m_data.m_str == m_data.adjustString( expr );; } virtual std::string toString() const { return "equals: \"" + m_data.m_str + "\"" + m_data.toStringSuffix(); } CasedString m_data; }; struct Contains : MatcherImpl { Contains( std::string const& substr, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ) : m_data( substr, caseSensitivity ){} Contains( Contains const& other ) : m_data( other.m_data ){} virtual ~Contains(); virtual bool match( std::string const& expr ) const { return m_data.adjustString( expr ).find( m_data.m_str ) != std::string::npos; } virtual std::string toString() const { return "contains: \"" + m_data.m_str + "\"" + m_data.toStringSuffix(); } CasedString m_data; }; struct StartsWith : MatcherImpl { StartsWith( std::string const& substr, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ) : m_data( substr, caseSensitivity ){} StartsWith( StartsWith const& other ) : m_data( other.m_data ){} virtual ~StartsWith(); virtual bool match( std::string const& expr ) const { return m_data.adjustString( expr ).find( m_data.m_str ) == 0; } virtual std::string toString() const { return "starts with: \"" + m_data.m_str + "\"" + m_data.toStringSuffix(); } CasedString m_data; }; struct EndsWith : MatcherImpl { EndsWith( std::string const& substr, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ) : m_data( substr, caseSensitivity ){} EndsWith( EndsWith const& other ) : m_data( other.m_data ){} virtual ~EndsWith(); virtual bool match( std::string const& expr ) const { return m_data.adjustString( expr ).find( m_data.m_str ) == expr.size() - m_data.m_str.size(); } virtual std::string toString() const { return "ends with: \"" + m_data.m_str + "\"" + m_data.toStringSuffix(); } CasedString m_data; }; } // namespace StdString } // namespace Impl // The following functions create the actual matcher objects. // This allows the types to be inferred template inline Impl::Generic::Not Not( Impl::Matcher const& m ) { return Impl::Generic::Not( m ); } template inline Impl::Generic::AllOf AllOf( Impl::Matcher const& m1, Impl::Matcher const& m2 ) { return Impl::Generic::AllOf().add( m1 ).add( m2 ); } template inline Impl::Generic::AllOf AllOf( Impl::Matcher const& m1, Impl::Matcher const& m2, Impl::Matcher const& m3 ) { return Impl::Generic::AllOf().add( m1 ).add( m2 ).add( m3 ); } template inline Impl::Generic::AnyOf AnyOf( Impl::Matcher const& m1, Impl::Matcher const& m2 ) { return Impl::Generic::AnyOf().add( m1 ).add( m2 ); } template inline Impl::Generic::AnyOf AnyOf( Impl::Matcher const& m1, Impl::Matcher const& m2, Impl::Matcher const& m3 ) { return Impl::Generic::AnyOf().add( m1 ).add( m2 ).add( m3 ); } inline Impl::StdString::Equals Equals( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ) { return Impl::StdString::Equals( str, caseSensitivity ); } inline Impl::StdString::Equals Equals( const char* str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ) { return Impl::StdString::Equals( Impl::StdString::makeString( str ), caseSensitivity ); } inline Impl::StdString::Contains Contains( std::string const& substr, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ) { return Impl::StdString::Contains( substr, caseSensitivity ); } inline Impl::StdString::Contains Contains( const char* substr, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ) { return Impl::StdString::Contains( Impl::StdString::makeString( substr ), caseSensitivity ); } inline Impl::StdString::StartsWith StartsWith( std::string const& substr ) { return Impl::StdString::StartsWith( substr ); } inline Impl::StdString::StartsWith StartsWith( const char* substr ) { return Impl::StdString::StartsWith( Impl::StdString::makeString( substr ) ); } inline Impl::StdString::EndsWith EndsWith( std::string const& substr ) { return Impl::StdString::EndsWith( substr ); } inline Impl::StdString::EndsWith EndsWith( const char* substr ) { return Impl::StdString::EndsWith( Impl::StdString::makeString( substr ) ); } } // namespace Matchers using namespace Matchers; } // namespace Catch namespace Catch { struct TestFailureException{}; template class ExpressionLhs; struct STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison; struct CopyableStream { CopyableStream() {} CopyableStream( CopyableStream const& other ) { oss << other.oss.str(); } CopyableStream& operator=( CopyableStream const& other ) { oss.str(""); oss << other.oss.str(); return *this; } std::ostringstream oss; }; class ResultBuilder { public: ResultBuilder( char const* macroName, SourceLineInfo const& lineInfo, char const* capturedExpression, ResultDisposition::Flags resultDisposition, char const* secondArg = "" ); template ExpressionLhs operator <= ( T const& operand ); ExpressionLhs operator <= ( bool value ); template ResultBuilder& operator << ( T const& value ) { m_stream.oss << value; return *this; } template STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison& operator && ( RhsT const& ); template STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison& operator || ( RhsT const& ); ResultBuilder& setResultType( ResultWas::OfType result ); ResultBuilder& setResultType( bool result ); ResultBuilder& setLhs( std::string const& lhs ); ResultBuilder& setRhs( std::string const& rhs ); ResultBuilder& setOp( std::string const& op ); void endExpression(); std::string reconstructExpression() const; AssertionResult build() const; void useActiveException( ResultDisposition::Flags resultDisposition = ResultDisposition::Normal ); void captureResult( ResultWas::OfType resultType ); void captureExpression(); void captureExpectedException( std::string const& expectedMessage ); void captureExpectedException( Matchers::Impl::Matcher const& matcher ); void handleResult( AssertionResult const& result ); void react(); bool shouldDebugBreak() const; bool allowThrows() const; private: AssertionInfo m_assertionInfo; AssertionResultData m_data; struct ExprComponents { ExprComponents() : testFalse( false ) {} bool testFalse; std::string lhs, rhs, op; } m_exprComponents; CopyableStream m_stream; bool m_shouldDebugBreak; bool m_shouldThrow; }; } // namespace Catch // Include after due to circular dependency: // #included from: catch_expression_lhs.hpp #define TWOBLUECUBES_CATCH_EXPRESSION_LHS_HPP_INCLUDED // #included from: catch_evaluate.hpp #define TWOBLUECUBES_CATCH_EVALUATE_HPP_INCLUDED #ifdef _MSC_VER #pragma warning(push) #pragma warning(disable:4389) // '==' : signed/unsigned mismatch #endif #include namespace Catch { namespace Internal { enum Operator { IsEqualTo, IsNotEqualTo, IsLessThan, IsGreaterThan, IsLessThanOrEqualTo, IsGreaterThanOrEqualTo }; template struct OperatorTraits { static const char* getName(){ return "*error*"; } }; template<> struct OperatorTraits { static const char* getName(){ return "=="; } }; template<> struct OperatorTraits { static const char* getName(){ return "!="; } }; template<> struct OperatorTraits { static const char* getName(){ return "<"; } }; template<> struct OperatorTraits { static const char* getName(){ return ">"; } }; template<> struct OperatorTraits { static const char* getName(){ return "<="; } }; template<> struct OperatorTraits{ static const char* getName(){ return ">="; } }; template inline T& opCast(T const& t) { return const_cast(t); } // nullptr_t support based on pull request #154 from Konstantin Baumann #ifdef CATCH_CONFIG_CPP11_NULLPTR inline std::nullptr_t opCast(std::nullptr_t) { return nullptr; } #endif // CATCH_CONFIG_CPP11_NULLPTR // So the compare overloads can be operator agnostic we convey the operator as a template // enum, which is used to specialise an Evaluator for doing the comparison. template class Evaluator{}; template struct Evaluator { static bool evaluate( T1 const& lhs, T2 const& rhs) { return opCast( lhs ) == opCast( rhs ); } }; template struct Evaluator { static bool evaluate( T1 const& lhs, T2 const& rhs ) { return opCast( lhs ) != opCast( rhs ); } }; template struct Evaluator { static bool evaluate( T1 const& lhs, T2 const& rhs ) { return opCast( lhs ) < opCast( rhs ); } }; template struct Evaluator { static bool evaluate( T1 const& lhs, T2 const& rhs ) { return opCast( lhs ) > opCast( rhs ); } }; template struct Evaluator { static bool evaluate( T1 const& lhs, T2 const& rhs ) { return opCast( lhs ) >= opCast( rhs ); } }; template struct Evaluator { static bool evaluate( T1 const& lhs, T2 const& rhs ) { return opCast( lhs ) <= opCast( rhs ); } }; template bool applyEvaluator( T1 const& lhs, T2 const& rhs ) { return Evaluator::evaluate( lhs, rhs ); } // This level of indirection allows us to specialise for integer types // to avoid signed/ unsigned warnings // "base" overload template bool compare( T1 const& lhs, T2 const& rhs ) { return Evaluator::evaluate( lhs, rhs ); } // unsigned X to int template bool compare( unsigned int lhs, int rhs ) { return applyEvaluator( lhs, static_cast( rhs ) ); } template bool compare( unsigned long lhs, int rhs ) { return applyEvaluator( lhs, static_cast( rhs ) ); } template bool compare( unsigned char lhs, int rhs ) { return applyEvaluator( lhs, static_cast( rhs ) ); } // unsigned X to long template bool compare( unsigned int lhs, long rhs ) { return applyEvaluator( lhs, static_cast( rhs ) ); } template bool compare( unsigned long lhs, long rhs ) { return applyEvaluator( lhs, static_cast( rhs ) ); } template bool compare( unsigned char lhs, long rhs ) { return applyEvaluator( lhs, static_cast( rhs ) ); } // int to unsigned X template bool compare( int lhs, unsigned int rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( int lhs, unsigned long rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( int lhs, unsigned char rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } // long to unsigned X template bool compare( long lhs, unsigned int rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( long lhs, unsigned long rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( long lhs, unsigned char rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } // pointer to long (when comparing against NULL) template bool compare( long lhs, T* rhs ) { return Evaluator::evaluate( reinterpret_cast( lhs ), rhs ); } template bool compare( T* lhs, long rhs ) { return Evaluator::evaluate( lhs, reinterpret_cast( rhs ) ); } // pointer to int (when comparing against NULL) template bool compare( int lhs, T* rhs ) { return Evaluator::evaluate( reinterpret_cast( lhs ), rhs ); } template bool compare( T* lhs, int rhs ) { return Evaluator::evaluate( lhs, reinterpret_cast( rhs ) ); } #ifdef CATCH_CONFIG_CPP11_LONG_LONG // long long to unsigned X template bool compare( long long lhs, unsigned int rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( long long lhs, unsigned long rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( long long lhs, unsigned long long rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( long long lhs, unsigned char rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } // unsigned long long to X template bool compare( unsigned long long lhs, int rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( unsigned long long lhs, long rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( unsigned long long lhs, long long rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } template bool compare( unsigned long long lhs, char rhs ) { return applyEvaluator( static_cast( lhs ), rhs ); } // pointer to long long (when comparing against NULL) template bool compare( long long lhs, T* rhs ) { return Evaluator::evaluate( reinterpret_cast( lhs ), rhs ); } template bool compare( T* lhs, long long rhs ) { return Evaluator::evaluate( lhs, reinterpret_cast( rhs ) ); } #endif // CATCH_CONFIG_CPP11_LONG_LONG #ifdef CATCH_CONFIG_CPP11_NULLPTR // pointer to nullptr_t (when comparing against nullptr) template bool compare( std::nullptr_t, T* rhs ) { return Evaluator::evaluate( nullptr, rhs ); } template bool compare( T* lhs, std::nullptr_t ) { return Evaluator::evaluate( lhs, nullptr ); } #endif // CATCH_CONFIG_CPP11_NULLPTR } // end of namespace Internal } // end of namespace Catch #ifdef _MSC_VER #pragma warning(pop) #endif // #included from: catch_tostring.h #define TWOBLUECUBES_CATCH_TOSTRING_H_INCLUDED #include #include #include #include #include #ifdef __OBJC__ // #included from: catch_objc_arc.hpp #define TWOBLUECUBES_CATCH_OBJC_ARC_HPP_INCLUDED #import #ifdef __has_feature #define CATCH_ARC_ENABLED __has_feature(objc_arc) #else #define CATCH_ARC_ENABLED 0 #endif void arcSafeRelease( NSObject* obj ); id performOptionalSelector( id obj, SEL sel ); #if !CATCH_ARC_ENABLED inline void arcSafeRelease( NSObject* obj ) { [obj release]; } inline id performOptionalSelector( id obj, SEL sel ) { if( [obj respondsToSelector: sel] ) return [obj performSelector: sel]; return nil; } #define CATCH_UNSAFE_UNRETAINED #define CATCH_ARC_STRONG #else inline void arcSafeRelease( NSObject* ){} inline id performOptionalSelector( id obj, SEL sel ) { #ifdef __clang__ #pragma clang diagnostic push #pragma clang diagnostic ignored "-Warc-performSelector-leaks" #endif if( [obj respondsToSelector: sel] ) return [obj performSelector: sel]; #ifdef __clang__ #pragma clang diagnostic pop #endif return nil; } #define CATCH_UNSAFE_UNRETAINED __unsafe_unretained #define CATCH_ARC_STRONG __strong #endif #endif #ifdef CATCH_CONFIG_CPP11_TUPLE #include #endif #ifdef CATCH_CONFIG_CPP11_IS_ENUM #include #endif namespace Catch { // Why we're here. template std::string toString( T const& value ); // Built in overloads std::string toString( std::string const& value ); std::string toString( std::wstring const& value ); std::string toString( const char* const value ); std::string toString( char* const value ); std::string toString( const wchar_t* const value ); std::string toString( wchar_t* const value ); std::string toString( int value ); std::string toString( unsigned long value ); std::string toString( unsigned int value ); std::string toString( const double value ); std::string toString( const float value ); std::string toString( bool value ); std::string toString( char value ); std::string toString( signed char value ); std::string toString( unsigned char value ); #ifdef CATCH_CONFIG_CPP11_LONG_LONG std::string toString( long long value ); std::string toString( unsigned long long value ); #endif #ifdef CATCH_CONFIG_CPP11_NULLPTR std::string toString( std::nullptr_t ); #endif #ifdef __OBJC__ std::string toString( NSString const * const& nsstring ); std::string toString( NSString * CATCH_ARC_STRONG const& nsstring ); std::string toString( NSObject* const& nsObject ); #endif namespace Detail { extern const std::string unprintableString; struct BorgType { template BorgType( T const& ); }; struct TrueType { char sizer[1]; }; struct FalseType { char sizer[2]; }; TrueType& testStreamable( std::ostream& ); FalseType testStreamable( FalseType ); FalseType operator<<( std::ostream const&, BorgType const& ); template struct IsStreamInsertable { static std::ostream &s; static T const&t; enum { value = sizeof( testStreamable(s << t) ) == sizeof( TrueType ) }; }; #if defined(CATCH_CONFIG_CPP11_IS_ENUM) template::value > struct EnumStringMaker { static std::string convert( T const& ) { return unprintableString; } }; template struct EnumStringMaker { static std::string convert( T const& v ) { return ::Catch::toString( static_cast::type>(v) ); } }; #endif template struct StringMakerBase { #if defined(CATCH_CONFIG_CPP11_IS_ENUM) template static std::string convert( T const& v ) { return EnumStringMaker::convert( v ); } #else template static std::string convert( T const& ) { return unprintableString; } #endif }; template<> struct StringMakerBase { template static std::string convert( T const& _value ) { std::ostringstream oss; oss << _value; return oss.str(); } }; std::string rawMemoryToString( const void *object, std::size_t size ); template inline std::string rawMemoryToString( const T& object ) { return rawMemoryToString( &object, sizeof(object) ); } } // end namespace Detail template struct StringMaker : Detail::StringMakerBase::value> {}; template struct StringMaker { template static std::string convert( U* p ) { if( !p ) return "NULL"; else return Detail::rawMemoryToString( p ); } }; template struct StringMaker { static std::string convert( R C::* p ) { if( !p ) return "NULL"; else return Detail::rawMemoryToString( p ); } }; namespace Detail { template std::string rangeToString( InputIterator first, InputIterator last ); } //template //struct StringMaker > { // static std::string convert( std::vector const& v ) { // return Detail::rangeToString( v.begin(), v.end() ); // } //}; template std::string toString( std::vector const& v ) { return Detail::rangeToString( v.begin(), v.end() ); } #ifdef CATCH_CONFIG_CPP11_TUPLE // toString for tuples namespace TupleDetail { template< typename Tuple, std::size_t N = 0, bool = (N < std::tuple_size::value) > struct ElementPrinter { static void print( const Tuple& tuple, std::ostream& os ) { os << ( N ? ", " : " " ) << Catch::toString(std::get(tuple)); ElementPrinter::print(tuple,os); } }; template< typename Tuple, std::size_t N > struct ElementPrinter { static void print( const Tuple&, std::ostream& ) {} }; } template struct StringMaker> { static std::string convert( const std::tuple& tuple ) { std::ostringstream os; os << '{'; TupleDetail::ElementPrinter>::print( tuple, os ); os << " }"; return os.str(); } }; #endif // CATCH_CONFIG_CPP11_TUPLE namespace Detail { template std::string makeString( T const& value ) { return StringMaker::convert( value ); } } // end namespace Detail /// \brief converts any type to a string /// /// The default template forwards on to ostringstream - except when an /// ostringstream overload does not exist - in which case it attempts to detect /// that and writes {?}. /// Overload (not specialise) this template for custom typs that you don't want /// to provide an ostream overload for. template std::string toString( T const& value ) { return StringMaker::convert( value ); } namespace Detail { template std::string rangeToString( InputIterator first, InputIterator last ) { std::ostringstream oss; oss << "{ "; if( first != last ) { oss << Catch::toString( *first ); for( ++first ; first != last ; ++first ) oss << ", " << Catch::toString( *first ); } oss << " }"; return oss.str(); } } } // end namespace Catch namespace Catch { // Wraps the LHS of an expression and captures the operator and RHS (if any) - // wrapping them all in a ResultBuilder object template class ExpressionLhs { ExpressionLhs& operator = ( ExpressionLhs const& ); # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS ExpressionLhs& operator = ( ExpressionLhs && ) = delete; # endif public: ExpressionLhs( ResultBuilder& rb, T lhs ) : m_rb( rb ), m_lhs( lhs ) {} # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS ExpressionLhs( ExpressionLhs const& ) = default; ExpressionLhs( ExpressionLhs && ) = default; # endif template ResultBuilder& operator == ( RhsT const& rhs ) { return captureExpression( rhs ); } template ResultBuilder& operator != ( RhsT const& rhs ) { return captureExpression( rhs ); } template ResultBuilder& operator < ( RhsT const& rhs ) { return captureExpression( rhs ); } template ResultBuilder& operator > ( RhsT const& rhs ) { return captureExpression( rhs ); } template ResultBuilder& operator <= ( RhsT const& rhs ) { return captureExpression( rhs ); } template ResultBuilder& operator >= ( RhsT const& rhs ) { return captureExpression( rhs ); } ResultBuilder& operator == ( bool rhs ) { return captureExpression( rhs ); } ResultBuilder& operator != ( bool rhs ) { return captureExpression( rhs ); } void endExpression() { bool value = m_lhs ? true : false; m_rb .setLhs( Catch::toString( value ) ) .setResultType( value ) .endExpression(); } // Only simple binary expressions are allowed on the LHS. // If more complex compositions are required then place the sub expression in parentheses template STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison& operator + ( RhsT const& ); template STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison& operator - ( RhsT const& ); template STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison& operator / ( RhsT const& ); template STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison& operator * ( RhsT const& ); template STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison& operator && ( RhsT const& ); template STATIC_ASSERT_Expression_Too_Complex_Please_Rewrite_As_Binary_Comparison& operator || ( RhsT const& ); private: template ResultBuilder& captureExpression( RhsT const& rhs ) { return m_rb .setResultType( Internal::compare( m_lhs, rhs ) ) .setLhs( Catch::toString( m_lhs ) ) .setRhs( Catch::toString( rhs ) ) .setOp( Internal::OperatorTraits::getName() ); } private: ResultBuilder& m_rb; T m_lhs; }; } // end namespace Catch namespace Catch { template inline ExpressionLhs ResultBuilder::operator <= ( T const& operand ) { return ExpressionLhs( *this, operand ); } inline ExpressionLhs ResultBuilder::operator <= ( bool value ) { return ExpressionLhs( *this, value ); } } // namespace Catch // #included from: catch_message.h #define TWOBLUECUBES_CATCH_MESSAGE_H_INCLUDED #include namespace Catch { struct MessageInfo { MessageInfo( std::string const& _macroName, SourceLineInfo const& _lineInfo, ResultWas::OfType _type ); std::string macroName; SourceLineInfo lineInfo; ResultWas::OfType type; std::string message; unsigned int sequence; bool operator == ( MessageInfo const& other ) const { return sequence == other.sequence; } bool operator < ( MessageInfo const& other ) const { return sequence < other.sequence; } private: static unsigned int globalCount; }; struct MessageBuilder { MessageBuilder( std::string const& macroName, SourceLineInfo const& lineInfo, ResultWas::OfType type ) : m_info( macroName, lineInfo, type ) {} template MessageBuilder& operator << ( T const& value ) { m_stream << value; return *this; } MessageInfo m_info; std::ostringstream m_stream; }; class ScopedMessage { public: ScopedMessage( MessageBuilder const& builder ); ScopedMessage( ScopedMessage const& other ); ~ScopedMessage(); MessageInfo m_info; }; } // end namespace Catch // #included from: catch_interfaces_capture.h #define TWOBLUECUBES_CATCH_INTERFACES_CAPTURE_H_INCLUDED #include namespace Catch { class TestCase; class AssertionResult; struct AssertionInfo; struct SectionInfo; struct SectionEndInfo; struct MessageInfo; class ScopedMessageBuilder; struct Counts; struct IResultCapture { virtual ~IResultCapture(); virtual void assertionEnded( AssertionResult const& result ) = 0; virtual bool sectionStarted( SectionInfo const& sectionInfo, Counts& assertions ) = 0; virtual void sectionEnded( SectionEndInfo const& endInfo ) = 0; virtual void sectionEndedEarly( SectionEndInfo const& endInfo ) = 0; virtual void pushScopedMessage( MessageInfo const& message ) = 0; virtual void popScopedMessage( MessageInfo const& message ) = 0; virtual std::string getCurrentTestName() const = 0; virtual const AssertionResult* getLastResult() const = 0; virtual void handleFatalErrorCondition( std::string const& message ) = 0; }; IResultCapture& getResultCapture(); } // #included from: catch_debugger.h #define TWOBLUECUBES_CATCH_DEBUGGER_H_INCLUDED // #included from: catch_platform.h #define TWOBLUECUBES_CATCH_PLATFORM_H_INCLUDED #if defined(__MAC_OS_X_VERSION_MIN_REQUIRED) #define CATCH_PLATFORM_MAC #elif defined(__IPHONE_OS_VERSION_MIN_REQUIRED) #define CATCH_PLATFORM_IPHONE #elif defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) #define CATCH_PLATFORM_WINDOWS #endif #include namespace Catch{ bool isDebuggerActive(); void writeToDebugConsole( std::string const& text ); } #ifdef CATCH_PLATFORM_MAC // The following code snippet based on: // http://cocoawithlove.com/2008/03/break-into-debugger.html #ifdef DEBUG #if defined(__ppc64__) || defined(__ppc__) #define CATCH_BREAK_INTO_DEBUGGER() \ if( Catch::isDebuggerActive() ) { \ __asm__("li r0, 20\nsc\nnop\nli r0, 37\nli r4, 2\nsc\nnop\n" \ : : : "memory","r0","r3","r4" ); \ } #else #define CATCH_BREAK_INTO_DEBUGGER() if( Catch::isDebuggerActive() ) {__asm__("int $3\n" : : );} #endif #endif #elif defined(_MSC_VER) #define CATCH_BREAK_INTO_DEBUGGER() if( Catch::isDebuggerActive() ) { __debugbreak(); } #elif defined(__MINGW32__) extern "C" __declspec(dllimport) void __stdcall DebugBreak(); #define CATCH_BREAK_INTO_DEBUGGER() if( Catch::isDebuggerActive() ) { DebugBreak(); } #endif #ifndef CATCH_BREAK_INTO_DEBUGGER #define CATCH_BREAK_INTO_DEBUGGER() Catch::alwaysTrue(); #endif // #included from: catch_interfaces_runner.h #define TWOBLUECUBES_CATCH_INTERFACES_RUNNER_H_INCLUDED namespace Catch { class TestCase; struct IRunner { virtual ~IRunner(); virtual bool aborting() const = 0; }; } /////////////////////////////////////////////////////////////////////////////// // In the event of a failure works out if the debugger needs to be invoked // and/or an exception thrown and takes appropriate action. // This needs to be done as a macro so the debugger will stop in the user // source code rather than in Catch library code #define INTERNAL_CATCH_REACT( resultBuilder ) \ if( resultBuilder.shouldDebugBreak() ) CATCH_BREAK_INTO_DEBUGGER(); \ resultBuilder.react(); /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_TEST( expr, resultDisposition, macroName ) \ do { \ Catch::ResultBuilder __catchResult( macroName, CATCH_INTERNAL_LINEINFO, #expr, resultDisposition ); \ try { \ ( __catchResult <= expr ).endExpression(); \ } \ catch( ... ) { \ __catchResult.useActiveException( Catch::ResultDisposition::Normal ); \ } \ INTERNAL_CATCH_REACT( __catchResult ) \ } while( Catch::isTrue( false && (expr) ) ) // expr here is never evaluated at runtime but it forces the compiler to give it a look /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_IF( expr, resultDisposition, macroName ) \ INTERNAL_CATCH_TEST( expr, resultDisposition, macroName ); \ if( Catch::getResultCapture().getLastResult()->succeeded() ) /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_ELSE( expr, resultDisposition, macroName ) \ INTERNAL_CATCH_TEST( expr, resultDisposition, macroName ); \ if( !Catch::getResultCapture().getLastResult()->succeeded() ) /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_NO_THROW( expr, resultDisposition, macroName ) \ do { \ Catch::ResultBuilder __catchResult( macroName, CATCH_INTERNAL_LINEINFO, #expr, resultDisposition ); \ try { \ expr; \ __catchResult.captureResult( Catch::ResultWas::Ok ); \ } \ catch( ... ) { \ __catchResult.useActiveException( resultDisposition ); \ } \ INTERNAL_CATCH_REACT( __catchResult ) \ } while( Catch::alwaysFalse() ) /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_THROWS( expr, resultDisposition, matcher, macroName ) \ do { \ Catch::ResultBuilder __catchResult( macroName, CATCH_INTERNAL_LINEINFO, #expr, resultDisposition, #matcher ); \ if( __catchResult.allowThrows() ) \ try { \ expr; \ __catchResult.captureResult( Catch::ResultWas::DidntThrowException ); \ } \ catch( ... ) { \ __catchResult.captureExpectedException( matcher ); \ } \ else \ __catchResult.captureResult( Catch::ResultWas::Ok ); \ INTERNAL_CATCH_REACT( __catchResult ) \ } while( Catch::alwaysFalse() ) /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_THROWS_AS( expr, exceptionType, resultDisposition, macroName ) \ do { \ Catch::ResultBuilder __catchResult( macroName, CATCH_INTERNAL_LINEINFO, #expr, resultDisposition ); \ if( __catchResult.allowThrows() ) \ try { \ expr; \ __catchResult.captureResult( Catch::ResultWas::DidntThrowException ); \ } \ catch( exceptionType ) { \ __catchResult.captureResult( Catch::ResultWas::Ok ); \ } \ catch( ... ) { \ __catchResult.useActiveException( resultDisposition ); \ } \ else \ __catchResult.captureResult( Catch::ResultWas::Ok ); \ INTERNAL_CATCH_REACT( __catchResult ) \ } while( Catch::alwaysFalse() ) /////////////////////////////////////////////////////////////////////////////// #ifdef CATCH_CONFIG_VARIADIC_MACROS #define INTERNAL_CATCH_MSG( messageType, resultDisposition, macroName, ... ) \ do { \ Catch::ResultBuilder __catchResult( macroName, CATCH_INTERNAL_LINEINFO, "", resultDisposition ); \ __catchResult << __VA_ARGS__ + ::Catch::StreamEndStop(); \ __catchResult.captureResult( messageType ); \ INTERNAL_CATCH_REACT( __catchResult ) \ } while( Catch::alwaysFalse() ) #else #define INTERNAL_CATCH_MSG( messageType, resultDisposition, macroName, log ) \ do { \ Catch::ResultBuilder __catchResult( macroName, CATCH_INTERNAL_LINEINFO, "", resultDisposition ); \ __catchResult << log + ::Catch::StreamEndStop(); \ __catchResult.captureResult( messageType ); \ INTERNAL_CATCH_REACT( __catchResult ) \ } while( Catch::alwaysFalse() ) #endif /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_INFO( log, macroName ) \ Catch::ScopedMessage INTERNAL_CATCH_UNIQUE_NAME( scopedMessage ) = Catch::MessageBuilder( macroName, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log; /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CHECK_THAT( arg, matcher, resultDisposition, macroName ) \ do { \ Catch::ResultBuilder __catchResult( macroName, CATCH_INTERNAL_LINEINFO, #arg " " #matcher, resultDisposition ); \ try { \ std::string matcherAsString = (matcher).toString(); \ __catchResult \ .setLhs( Catch::toString( arg ) ) \ .setRhs( matcherAsString == Catch::Detail::unprintableString ? #matcher : matcherAsString ) \ .setOp( "matches" ) \ .setResultType( (matcher).match( arg ) ); \ __catchResult.captureExpression(); \ } catch( ... ) { \ __catchResult.useActiveException( resultDisposition | Catch::ResultDisposition::ContinueOnFailure ); \ } \ INTERNAL_CATCH_REACT( __catchResult ) \ } while( Catch::alwaysFalse() ) // #included from: internal/catch_section.h #define TWOBLUECUBES_CATCH_SECTION_H_INCLUDED // #included from: catch_section_info.h #define TWOBLUECUBES_CATCH_SECTION_INFO_H_INCLUDED // #included from: catch_totals.hpp #define TWOBLUECUBES_CATCH_TOTALS_HPP_INCLUDED #include namespace Catch { struct Counts { Counts() : passed( 0 ), failed( 0 ), failedButOk( 0 ) {} Counts operator - ( Counts const& other ) const { Counts diff; diff.passed = passed - other.passed; diff.failed = failed - other.failed; diff.failedButOk = failedButOk - other.failedButOk; return diff; } Counts& operator += ( Counts const& other ) { passed += other.passed; failed += other.failed; failedButOk += other.failedButOk; return *this; } std::size_t total() const { return passed + failed + failedButOk; } bool allPassed() const { return failed == 0 && failedButOk == 0; } bool allOk() const { return failed == 0; } std::size_t passed; std::size_t failed; std::size_t failedButOk; }; struct Totals { Totals operator - ( Totals const& other ) const { Totals diff; diff.assertions = assertions - other.assertions; diff.testCases = testCases - other.testCases; return diff; } Totals delta( Totals const& prevTotals ) const { Totals diff = *this - prevTotals; if( diff.assertions.failed > 0 ) ++diff.testCases.failed; else if( diff.assertions.failedButOk > 0 ) ++diff.testCases.failedButOk; else ++diff.testCases.passed; return diff; } Totals& operator += ( Totals const& other ) { assertions += other.assertions; testCases += other.testCases; return *this; } Counts assertions; Counts testCases; }; } namespace Catch { struct SectionInfo { SectionInfo ( SourceLineInfo const& _lineInfo, std::string const& _name, std::string const& _description = std::string() ); std::string name; std::string description; SourceLineInfo lineInfo; }; struct SectionEndInfo { SectionEndInfo( SectionInfo const& _sectionInfo, Counts const& _prevAssertions, double _durationInSeconds ) : sectionInfo( _sectionInfo ), prevAssertions( _prevAssertions ), durationInSeconds( _durationInSeconds ) {} SectionInfo sectionInfo; Counts prevAssertions; double durationInSeconds; }; } // end namespace Catch // #included from: catch_timer.h #define TWOBLUECUBES_CATCH_TIMER_H_INCLUDED #ifdef CATCH_PLATFORM_WINDOWS typedef unsigned long long uint64_t; #else #include #endif namespace Catch { class Timer { public: Timer() : m_ticks( 0 ) {} void start(); unsigned int getElapsedMicroseconds() const; unsigned int getElapsedMilliseconds() const; double getElapsedSeconds() const; private: uint64_t m_ticks; }; } // namespace Catch #include namespace Catch { class Section : NonCopyable { public: Section( SectionInfo const& info ); ~Section(); // This indicates whether the section should be executed or not operator bool() const; private: SectionInfo m_info; std::string m_name; Counts m_assertions; bool m_sectionIncluded; Timer m_timer; }; } // end namespace Catch #ifdef CATCH_CONFIG_VARIADIC_MACROS #define INTERNAL_CATCH_SECTION( ... ) \ if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, __VA_ARGS__ ) ) #else #define INTERNAL_CATCH_SECTION( name, desc ) \ if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, name, desc ) ) #endif // #included from: internal/catch_generators.hpp #define TWOBLUECUBES_CATCH_GENERATORS_HPP_INCLUDED #include #include #include #include namespace Catch { template struct IGenerator { virtual ~IGenerator() {} virtual T getValue( std::size_t index ) const = 0; virtual std::size_t size () const = 0; }; template class BetweenGenerator : public IGenerator { public: BetweenGenerator( T from, T to ) : m_from( from ), m_to( to ){} virtual T getValue( std::size_t index ) const { return m_from+static_cast( index ); } virtual std::size_t size() const { return static_cast( 1+m_to-m_from ); } private: T m_from; T m_to; }; template class ValuesGenerator : public IGenerator { public: ValuesGenerator(){} void add( T value ) { m_values.push_back( value ); } virtual T getValue( std::size_t index ) const { return m_values[index]; } virtual std::size_t size() const { return m_values.size(); } private: std::vector m_values; }; template class CompositeGenerator { public: CompositeGenerator() : m_totalSize( 0 ) {} // *** Move semantics, similar to auto_ptr *** CompositeGenerator( CompositeGenerator& other ) : m_fileInfo( other.m_fileInfo ), m_totalSize( 0 ) { move( other ); } CompositeGenerator& setFileInfo( const char* fileInfo ) { m_fileInfo = fileInfo; return *this; } ~CompositeGenerator() { deleteAll( m_composed ); } operator T () const { size_t overallIndex = getCurrentContext().getGeneratorIndex( m_fileInfo, m_totalSize ); typename std::vector*>::const_iterator it = m_composed.begin(); typename std::vector*>::const_iterator itEnd = m_composed.end(); for( size_t index = 0; it != itEnd; ++it ) { const IGenerator* generator = *it; if( overallIndex >= index && overallIndex < index + generator->size() ) { return generator->getValue( overallIndex-index ); } index += generator->size(); } CATCH_INTERNAL_ERROR( "Indexed past end of generated range" ); return T(); // Suppress spurious "not all control paths return a value" warning in Visual Studio - if you know how to fix this please do so } void add( const IGenerator* generator ) { m_totalSize += generator->size(); m_composed.push_back( generator ); } CompositeGenerator& then( CompositeGenerator& other ) { move( other ); return *this; } CompositeGenerator& then( T value ) { ValuesGenerator* valuesGen = new ValuesGenerator(); valuesGen->add( value ); add( valuesGen ); return *this; } private: void move( CompositeGenerator& other ) { std::copy( other.m_composed.begin(), other.m_composed.end(), std::back_inserter( m_composed ) ); m_totalSize += other.m_totalSize; other.m_composed.clear(); } std::vector*> m_composed; std::string m_fileInfo; size_t m_totalSize; }; namespace Generators { template CompositeGenerator between( T from, T to ) { CompositeGenerator generators; generators.add( new BetweenGenerator( from, to ) ); return generators; } template CompositeGenerator values( T val1, T val2 ) { CompositeGenerator generators; ValuesGenerator* valuesGen = new ValuesGenerator(); valuesGen->add( val1 ); valuesGen->add( val2 ); generators.add( valuesGen ); return generators; } template CompositeGenerator values( T val1, T val2, T val3 ){ CompositeGenerator generators; ValuesGenerator* valuesGen = new ValuesGenerator(); valuesGen->add( val1 ); valuesGen->add( val2 ); valuesGen->add( val3 ); generators.add( valuesGen ); return generators; } template CompositeGenerator values( T val1, T val2, T val3, T val4 ) { CompositeGenerator generators; ValuesGenerator* valuesGen = new ValuesGenerator(); valuesGen->add( val1 ); valuesGen->add( val2 ); valuesGen->add( val3 ); valuesGen->add( val4 ); generators.add( valuesGen ); return generators; } } // end namespace Generators using namespace Generators; } // end namespace Catch #define INTERNAL_CATCH_LINESTR2( line ) #line #define INTERNAL_CATCH_LINESTR( line ) INTERNAL_CATCH_LINESTR2( line ) #define INTERNAL_CATCH_GENERATE( expr ) expr.setFileInfo( __FILE__ "(" INTERNAL_CATCH_LINESTR( __LINE__ ) ")" ) // #included from: internal/catch_interfaces_exception.h #define TWOBLUECUBES_CATCH_INTERFACES_EXCEPTION_H_INCLUDED #include #include // #included from: catch_interfaces_registry_hub.h #define TWOBLUECUBES_CATCH_INTERFACES_REGISTRY_HUB_H_INCLUDED #include namespace Catch { class TestCase; struct ITestCaseRegistry; struct IExceptionTranslatorRegistry; struct IExceptionTranslator; struct IReporterRegistry; struct IReporterFactory; struct IRegistryHub { virtual ~IRegistryHub(); virtual IReporterRegistry const& getReporterRegistry() const = 0; virtual ITestCaseRegistry const& getTestCaseRegistry() const = 0; virtual IExceptionTranslatorRegistry& getExceptionTranslatorRegistry() = 0; }; struct IMutableRegistryHub { virtual ~IMutableRegistryHub(); virtual void registerReporter( std::string const& name, Ptr const& factory ) = 0; virtual void registerListener( Ptr const& factory ) = 0; virtual void registerTest( TestCase const& testInfo ) = 0; virtual void registerTranslator( const IExceptionTranslator* translator ) = 0; }; IRegistryHub& getRegistryHub(); IMutableRegistryHub& getMutableRegistryHub(); void cleanUp(); std::string translateActiveException(); } namespace Catch { typedef std::string(*exceptionTranslateFunction)(); struct IExceptionTranslator; typedef std::vector ExceptionTranslators; struct IExceptionTranslator { virtual ~IExceptionTranslator(); virtual std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const = 0; }; struct IExceptionTranslatorRegistry { virtual ~IExceptionTranslatorRegistry(); virtual std::string translateActiveException() const = 0; }; class ExceptionTranslatorRegistrar { template class ExceptionTranslator : public IExceptionTranslator { public: ExceptionTranslator( std::string(*translateFunction)( T& ) ) : m_translateFunction( translateFunction ) {} virtual std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const CATCH_OVERRIDE { try { if( it == itEnd ) throw; else return (*it)->translate( it+1, itEnd ); } catch( T& ex ) { return m_translateFunction( ex ); } } protected: std::string(*m_translateFunction)( T& ); }; public: template ExceptionTranslatorRegistrar( std::string(*translateFunction)( T& ) ) { getMutableRegistryHub().registerTranslator ( new ExceptionTranslator( translateFunction ) ); } }; } /////////////////////////////////////////////////////////////////////////////// #define INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) \ static std::string INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator )( signature ); \ namespace{ Catch::ExceptionTranslatorRegistrar INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionRegistrar )( &INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ) ); }\ static std::string INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator )( signature ) // #included from: internal/catch_approx.hpp #define TWOBLUECUBES_CATCH_APPROX_HPP_INCLUDED #include #include namespace Catch { namespace Detail { class Approx { public: explicit Approx ( double value ) : m_epsilon( std::numeric_limits::epsilon()*100 ), m_scale( 1.0 ), m_value( value ) {} Approx( Approx const& other ) : m_epsilon( other.m_epsilon ), m_scale( other.m_scale ), m_value( other.m_value ) {} static Approx custom() { return Approx( 0 ); } Approx operator()( double value ) { Approx approx( value ); approx.epsilon( m_epsilon ); approx.scale( m_scale ); return approx; } friend bool operator == ( double lhs, Approx const& rhs ) { // Thanks to Richard Harris for his help refining this formula return fabs( lhs - rhs.m_value ) < rhs.m_epsilon * (rhs.m_scale + (std::max)( fabs(lhs), fabs(rhs.m_value) ) ); } friend bool operator == ( Approx const& lhs, double rhs ) { return operator==( rhs, lhs ); } friend bool operator != ( double lhs, Approx const& rhs ) { return !operator==( lhs, rhs ); } friend bool operator != ( Approx const& lhs, double rhs ) { return !operator==( rhs, lhs ); } Approx& epsilon( double newEpsilon ) { m_epsilon = newEpsilon; return *this; } Approx& scale( double newScale ) { m_scale = newScale; return *this; } std::string toString() const { std::ostringstream oss; oss << "Approx( " << Catch::toString( m_value ) << " )"; return oss.str(); } private: double m_epsilon; double m_scale; double m_value; }; } template<> inline std::string toString( Detail::Approx const& value ) { return value.toString(); } } // end namespace Catch // #included from: internal/catch_interfaces_tag_alias_registry.h #define TWOBLUECUBES_CATCH_INTERFACES_TAG_ALIAS_REGISTRY_H_INCLUDED // #included from: catch_tag_alias.h #define TWOBLUECUBES_CATCH_TAG_ALIAS_H_INCLUDED #include namespace Catch { struct TagAlias { TagAlias( std::string _tag, SourceLineInfo _lineInfo ) : tag( _tag ), lineInfo( _lineInfo ) {} std::string tag; SourceLineInfo lineInfo; }; struct RegistrarForTagAliases { RegistrarForTagAliases( char const* alias, char const* tag, SourceLineInfo const& lineInfo ); }; } // end namespace Catch #define CATCH_REGISTER_TAG_ALIAS( alias, spec ) namespace{ Catch::RegistrarForTagAliases INTERNAL_CATCH_UNIQUE_NAME( AutoRegisterTagAlias )( alias, spec, CATCH_INTERNAL_LINEINFO ); } // #included from: catch_option.hpp #define TWOBLUECUBES_CATCH_OPTION_HPP_INCLUDED namespace Catch { // An optional type template class Option { public: Option() : nullableValue( CATCH_NULL ) {} Option( T const& _value ) : nullableValue( new( storage ) T( _value ) ) {} Option( Option const& _other ) : nullableValue( _other ? new( storage ) T( *_other ) : CATCH_NULL ) {} ~Option() { reset(); } Option& operator= ( Option const& _other ) { if( &_other != this ) { reset(); if( _other ) nullableValue = new( storage ) T( *_other ); } return *this; } Option& operator = ( T const& _value ) { reset(); nullableValue = new( storage ) T( _value ); return *this; } void reset() { if( nullableValue ) nullableValue->~T(); nullableValue = CATCH_NULL; } T& operator*() { return *nullableValue; } T const& operator*() const { return *nullableValue; } T* operator->() { return nullableValue; } const T* operator->() const { return nullableValue; } T valueOr( T const& defaultValue ) const { return nullableValue ? *nullableValue : defaultValue; } bool some() const { return nullableValue != CATCH_NULL; } bool none() const { return nullableValue == CATCH_NULL; } bool operator !() const { return nullableValue == CATCH_NULL; } operator SafeBool::type() const { return SafeBool::makeSafe( some() ); } private: T* nullableValue; char storage[sizeof(T)]; }; } // end namespace Catch namespace Catch { struct ITagAliasRegistry { virtual ~ITagAliasRegistry(); virtual Option find( std::string const& alias ) const = 0; virtual std::string expandAliases( std::string const& unexpandedTestSpec ) const = 0; static ITagAliasRegistry const& get(); }; } // end namespace Catch // These files are included here so the single_include script doesn't put them // in the conditionally compiled sections // #included from: internal/catch_test_case_info.h #define TWOBLUECUBES_CATCH_TEST_CASE_INFO_H_INCLUDED #include #include #ifdef __clang__ #pragma clang diagnostic push #pragma clang diagnostic ignored "-Wpadded" #endif namespace Catch { struct ITestCase; struct TestCaseInfo { enum SpecialProperties{ None = 0, IsHidden = 1 << 1, ShouldFail = 1 << 2, MayFail = 1 << 3, Throws = 1 << 4 }; TestCaseInfo( std::string const& _name, std::string const& _className, std::string const& _description, std::set const& _tags, SourceLineInfo const& _lineInfo ); TestCaseInfo( TestCaseInfo const& other ); friend void setTags( TestCaseInfo& testCaseInfo, std::set const& tags ); bool isHidden() const; bool throws() const; bool okToFail() const; bool expectedToFail() const; std::string name; std::string className; std::string description; std::set tags; std::set lcaseTags; std::string tagsAsString; SourceLineInfo lineInfo; SpecialProperties properties; }; class TestCase : public TestCaseInfo { public: TestCase( ITestCase* testCase, TestCaseInfo const& info ); TestCase( TestCase const& other ); TestCase withName( std::string const& _newName ) const; void invoke() const; TestCaseInfo const& getTestCaseInfo() const; void swap( TestCase& other ); bool operator == ( TestCase const& other ) const; bool operator < ( TestCase const& other ) const; TestCase& operator = ( TestCase const& other ); private: Ptr test; }; TestCase makeTestCase( ITestCase* testCase, std::string const& className, std::string const& name, std::string const& description, SourceLineInfo const& lineInfo ); } #ifdef __clang__ #pragma clang diagnostic pop #endif #ifdef __OBJC__ // #included from: internal/catch_objc.hpp #define TWOBLUECUBES_CATCH_OBJC_HPP_INCLUDED #import #include // NB. Any general catch headers included here must be included // in catch.hpp first to make sure they are included by the single // header for non obj-usage /////////////////////////////////////////////////////////////////////////////// // This protocol is really only here for (self) documenting purposes, since // all its methods are optional. @protocol OcFixture @optional -(void) setUp; -(void) tearDown; @end namespace Catch { class OcMethod : public SharedImpl { public: OcMethod( Class cls, SEL sel ) : m_cls( cls ), m_sel( sel ) {} virtual void invoke() const { id obj = [[m_cls alloc] init]; performOptionalSelector( obj, @selector(setUp) ); performOptionalSelector( obj, m_sel ); performOptionalSelector( obj, @selector(tearDown) ); arcSafeRelease( obj ); } private: virtual ~OcMethod() {} Class m_cls; SEL m_sel; }; namespace Detail{ inline std::string getAnnotation( Class cls, std::string const& annotationName, std::string const& testCaseName ) { NSString* selStr = [[NSString alloc] initWithFormat:@"Catch_%s_%s", annotationName.c_str(), testCaseName.c_str()]; SEL sel = NSSelectorFromString( selStr ); arcSafeRelease( selStr ); id value = performOptionalSelector( cls, sel ); if( value ) return [(NSString*)value UTF8String]; return ""; } } inline size_t registerTestMethods() { size_t noTestMethods = 0; int noClasses = objc_getClassList( CATCH_NULL, 0 ); Class* classes = (CATCH_UNSAFE_UNRETAINED Class *)malloc( sizeof(Class) * noClasses); objc_getClassList( classes, noClasses ); for( int c = 0; c < noClasses; c++ ) { Class cls = classes[c]; { u_int count; Method* methods = class_copyMethodList( cls, &count ); for( u_int m = 0; m < count ; m++ ) { SEL selector = method_getName(methods[m]); std::string methodName = sel_getName(selector); if( startsWith( methodName, "Catch_TestCase_" ) ) { std::string testCaseName = methodName.substr( 15 ); std::string name = Detail::getAnnotation( cls, "Name", testCaseName ); std::string desc = Detail::getAnnotation( cls, "Description", testCaseName ); const char* className = class_getName( cls ); getMutableRegistryHub().registerTest( makeTestCase( new OcMethod( cls, selector ), className, name.c_str(), desc.c_str(), SourceLineInfo() ) ); noTestMethods++; } } free(methods); } } return noTestMethods; } namespace Matchers { namespace Impl { namespace NSStringMatchers { template struct StringHolder : MatcherImpl{ StringHolder( NSString* substr ) : m_substr( [substr copy] ){} StringHolder( StringHolder const& other ) : m_substr( [other.m_substr copy] ){} StringHolder() { arcSafeRelease( m_substr ); } NSString* m_substr; }; struct Equals : StringHolder { Equals( NSString* substr ) : StringHolder( substr ){} virtual bool match( ExpressionType const& str ) const { return (str != nil || m_substr == nil ) && [str isEqualToString:m_substr]; } virtual std::string toString() const { return "equals string: " + Catch::toString( m_substr ); } }; struct Contains : StringHolder { Contains( NSString* substr ) : StringHolder( substr ){} virtual bool match( ExpressionType const& str ) const { return (str != nil || m_substr == nil ) && [str rangeOfString:m_substr].location != NSNotFound; } virtual std::string toString() const { return "contains string: " + Catch::toString( m_substr ); } }; struct StartsWith : StringHolder { StartsWith( NSString* substr ) : StringHolder( substr ){} virtual bool match( ExpressionType const& str ) const { return (str != nil || m_substr == nil ) && [str rangeOfString:m_substr].location == 0; } virtual std::string toString() const { return "starts with: " + Catch::toString( m_substr ); } }; struct EndsWith : StringHolder { EndsWith( NSString* substr ) : StringHolder( substr ){} virtual bool match( ExpressionType const& str ) const { return (str != nil || m_substr == nil ) && [str rangeOfString:m_substr].location == [str length] - [m_substr length]; } virtual std::string toString() const { return "ends with: " + Catch::toString( m_substr ); } }; } // namespace NSStringMatchers } // namespace Impl inline Impl::NSStringMatchers::Equals Equals( NSString* substr ){ return Impl::NSStringMatchers::Equals( substr ); } inline Impl::NSStringMatchers::Contains Contains( NSString* substr ){ return Impl::NSStringMatchers::Contains( substr ); } inline Impl::NSStringMatchers::StartsWith StartsWith( NSString* substr ){ return Impl::NSStringMatchers::StartsWith( substr ); } inline Impl::NSStringMatchers::EndsWith EndsWith( NSString* substr ){ return Impl::NSStringMatchers::EndsWith( substr ); } } // namespace Matchers using namespace Matchers; } // namespace Catch /////////////////////////////////////////////////////////////////////////////// #define OC_TEST_CASE( name, desc )\ +(NSString*) INTERNAL_CATCH_UNIQUE_NAME( Catch_Name_test ) \ {\ return @ name; \ }\ +(NSString*) INTERNAL_CATCH_UNIQUE_NAME( Catch_Description_test ) \ { \ return @ desc; \ } \ -(void) INTERNAL_CATCH_UNIQUE_NAME( Catch_TestCase_test ) #endif #ifdef CATCH_IMPL // #included from: internal/catch_impl.hpp #define TWOBLUECUBES_CATCH_IMPL_HPP_INCLUDED // Collect all the implementation files together here // These are the equivalent of what would usually be cpp files #ifdef __clang__ #pragma clang diagnostic push #pragma clang diagnostic ignored "-Wweak-vtables" #endif // #included from: ../catch_session.hpp #define TWOBLUECUBES_CATCH_RUNNER_HPP_INCLUDED // #included from: internal/catch_commandline.hpp #define TWOBLUECUBES_CATCH_COMMANDLINE_HPP_INCLUDED // #included from: catch_config.hpp #define TWOBLUECUBES_CATCH_CONFIG_HPP_INCLUDED // #included from: catch_test_spec_parser.hpp #define TWOBLUECUBES_CATCH_TEST_SPEC_PARSER_HPP_INCLUDED #ifdef __clang__ #pragma clang diagnostic push #pragma clang diagnostic ignored "-Wpadded" #endif // #included from: catch_test_spec.hpp #define TWOBLUECUBES_CATCH_TEST_SPEC_HPP_INCLUDED #ifdef __clang__ #pragma clang diagnostic push #pragma clang diagnostic ignored "-Wpadded" #endif // #included from: catch_wildcard_pattern.hpp #define TWOBLUECUBES_CATCH_WILDCARD_PATTERN_HPP_INCLUDED namespace Catch { class WildcardPattern { enum WildcardPosition { NoWildcard = 0, WildcardAtStart = 1, WildcardAtEnd = 2, WildcardAtBothEnds = WildcardAtStart | WildcardAtEnd }; public: WildcardPattern( std::string const& pattern, CaseSensitive::Choice caseSensitivity ) : m_caseSensitivity( caseSensitivity ), m_wildcard( NoWildcard ), m_pattern( adjustCase( pattern ) ) { if( startsWith( m_pattern, "*" ) ) { m_pattern = m_pattern.substr( 1 ); m_wildcard = WildcardAtStart; } if( endsWith( m_pattern, "*" ) ) { m_pattern = m_pattern.substr( 0, m_pattern.size()-1 ); m_wildcard = static_cast( m_wildcard | WildcardAtEnd ); } } virtual ~WildcardPattern(); virtual bool matches( std::string const& str ) const { switch( m_wildcard ) { case NoWildcard: return m_pattern == adjustCase( str ); case WildcardAtStart: return endsWith( adjustCase( str ), m_pattern ); case WildcardAtEnd: return startsWith( adjustCase( str ), m_pattern ); case WildcardAtBothEnds: return contains( adjustCase( str ), m_pattern ); } #ifdef __clang__ #pragma clang diagnostic push #pragma clang diagnostic ignored "-Wunreachable-code" #endif throw std::logic_error( "Unknown enum" ); #ifdef __clang__ #pragma clang diagnostic pop #endif } private: std::string adjustCase( std::string const& str ) const { return m_caseSensitivity == CaseSensitive::No ? toLower( str ) : str; } CaseSensitive::Choice m_caseSensitivity; WildcardPosition m_wildcard; std::string m_pattern; }; } #include #include namespace Catch { class TestSpec { struct Pattern : SharedImpl<> { virtual ~Pattern(); virtual bool matches( TestCaseInfo const& testCase ) const = 0; }; class NamePattern : public Pattern { public: NamePattern( std::string const& name ) : m_wildcardPattern( toLower( name ), CaseSensitive::No ) {} virtual ~NamePattern(); virtual bool matches( TestCaseInfo const& testCase ) const { return m_wildcardPattern.matches( toLower( testCase.name ) ); } private: WildcardPattern m_wildcardPattern; }; class TagPattern : public Pattern { public: TagPattern( std::string const& tag ) : m_tag( toLower( tag ) ) {} virtual ~TagPattern(); virtual bool matches( TestCaseInfo const& testCase ) const { return testCase.lcaseTags.find( m_tag ) != testCase.lcaseTags.end(); } private: std::string m_tag; }; class ExcludedPattern : public Pattern { public: ExcludedPattern( Ptr const& underlyingPattern ) : m_underlyingPattern( underlyingPattern ) {} virtual ~ExcludedPattern(); virtual bool matches( TestCaseInfo const& testCase ) const { return !m_underlyingPattern->matches( testCase ); } private: Ptr m_underlyingPattern; }; struct Filter { std::vector > m_patterns; bool matches( TestCaseInfo const& testCase ) const { // All patterns in a filter must match for the filter to be a match for( std::vector >::const_iterator it = m_patterns.begin(), itEnd = m_patterns.end(); it != itEnd; ++it ) if( !(*it)->matches( testCase ) ) return false; return true; } }; public: bool hasFilters() const { return !m_filters.empty(); } bool matches( TestCaseInfo const& testCase ) const { // A TestSpec matches if any filter matches for( std::vector::const_iterator it = m_filters.begin(), itEnd = m_filters.end(); it != itEnd; ++it ) if( it->matches( testCase ) ) return true; return false; } private: std::vector m_filters; friend class TestSpecParser; }; } #ifdef __clang__ #pragma clang diagnostic pop #endif namespace Catch { class TestSpecParser { enum Mode{ None, Name, QuotedName, Tag }; Mode m_mode; bool m_exclusion; std::size_t m_start, m_pos; std::string m_arg; TestSpec::Filter m_currentFilter; TestSpec m_testSpec; ITagAliasRegistry const* m_tagAliases; public: TestSpecParser( ITagAliasRegistry const& tagAliases ) : m_tagAliases( &tagAliases ) {} TestSpecParser& parse( std::string const& arg ) { m_mode = None; m_exclusion = false; m_start = std::string::npos; m_arg = m_tagAliases->expandAliases( arg ); for( m_pos = 0; m_pos < m_arg.size(); ++m_pos ) visitChar( m_arg[m_pos] ); if( m_mode == Name ) addPattern(); return *this; } TestSpec testSpec() { addFilter(); return m_testSpec; } private: void visitChar( char c ) { if( m_mode == None ) { switch( c ) { case ' ': return; case '~': m_exclusion = true; return; case '[': return startNewMode( Tag, ++m_pos ); case '"': return startNewMode( QuotedName, ++m_pos ); default: startNewMode( Name, m_pos ); break; } } if( m_mode == Name ) { if( c == ',' ) { addPattern(); addFilter(); } else if( c == '[' ) { if( subString() == "exclude:" ) m_exclusion = true; else addPattern(); startNewMode( Tag, ++m_pos ); } } else if( m_mode == QuotedName && c == '"' ) addPattern(); else if( m_mode == Tag && c == ']' ) addPattern(); } void startNewMode( Mode mode, std::size_t start ) { m_mode = mode; m_start = start; } std::string subString() const { return m_arg.substr( m_start, m_pos - m_start ); } template void addPattern() { std::string token = subString(); if( startsWith( token, "exclude:" ) ) { m_exclusion = true; token = token.substr( 8 ); } if( !token.empty() ) { Ptr pattern = new T( token ); if( m_exclusion ) pattern = new TestSpec::ExcludedPattern( pattern ); m_currentFilter.m_patterns.push_back( pattern ); } m_exclusion = false; m_mode = None; } void addFilter() { if( !m_currentFilter.m_patterns.empty() ) { m_testSpec.m_filters.push_back( m_currentFilter ); m_currentFilter = TestSpec::Filter(); } } }; inline TestSpec parseTestSpec( std::string const& arg ) { return TestSpecParser( ITagAliasRegistry::get() ).parse( arg ).testSpec(); } } // namespace Catch #ifdef __clang__ #pragma clang diagnostic pop #endif // #included from: catch_interfaces_config.h #define TWOBLUECUBES_CATCH_INTERFACES_CONFIG_H_INCLUDED #include #include #include namespace Catch { struct Verbosity { enum Level { NoOutput = 0, Quiet, Normal }; }; struct WarnAbout { enum What { Nothing = 0x00, NoAssertions = 0x01 }; }; struct ShowDurations { enum OrNot { DefaultForReporter, Always, Never }; }; struct RunTests { enum InWhatOrder { InDeclarationOrder, InLexicographicalOrder, InRandomOrder }; }; class TestSpec; struct IConfig : IShared { virtual ~IConfig(); virtual bool allowThrows() const = 0; virtual std::ostream& stream() const = 0; virtual std::string name() const = 0; virtual bool includeSuccessfulResults() const = 0; virtual bool shouldDebugBreak() const = 0; virtual bool warnAboutMissingAssertions() const = 0; virtual int abortAfter() const = 0; virtual bool showInvisibles() const = 0; virtual ShowDurations::OrNot showDurations() const = 0; virtual TestSpec const& testSpec() const = 0; virtual RunTests::InWhatOrder runOrder() const = 0; virtual unsigned int rngSeed() const = 0; virtual bool forceColour() const = 0; }; } // #included from: catch_stream.h #define TWOBLUECUBES_CATCH_STREAM_H_INCLUDED // #included from: catch_streambuf.h #define TWOBLUECUBES_CATCH_STREAMBUF_H_INCLUDED #include namespace Catch { class StreamBufBase : public std::streambuf { public: virtual ~StreamBufBase() CATCH_NOEXCEPT; }; } #include #include #include namespace Catch { std::ostream& cout(); std::ostream& cerr(); struct IStream { virtual ~IStream() CATCH_NOEXCEPT; virtual std::ostream& stream() const = 0; }; class FileStream : public IStream { mutable std::ofstream m_ofs; public: FileStream( std::string const& filename ); virtual ~FileStream() CATCH_NOEXCEPT; public: // IStream virtual std::ostream& stream() const CATCH_OVERRIDE; }; class CoutStream : public IStream { mutable std::ostream m_os; public: CoutStream(); virtual ~CoutStream() CATCH_NOEXCEPT; public: // IStream virtual std::ostream& stream() const CATCH_OVERRIDE; }; class DebugOutStream : public IStream { std::auto_ptr m_streamBuf; mutable std::ostream m_os; public: DebugOutStream(); virtual ~DebugOutStream() CATCH_NOEXCEPT; public: // IStream virtual std::ostream& stream() const CATCH_OVERRIDE; }; } #include #include #include #include #include #ifndef CATCH_CONFIG_CONSOLE_WIDTH #define CATCH_CONFIG_CONSOLE_WIDTH 80 #endif namespace Catch { struct ConfigData { ConfigData() : listTests( false ), listTags( false ), listReporters( false ), listTestNamesOnly( false ), showSuccessfulTests( false ), shouldDebugBreak( false ), noThrow( false ), showHelp( false ), showInvisibles( false ), forceColour( false ), filenamesAsTags( false ), abortAfter( -1 ), rngSeed( 0 ), verbosity( Verbosity::Normal ), warnings( WarnAbout::Nothing ), showDurations( ShowDurations::DefaultForReporter ), runOrder( RunTests::InDeclarationOrder ) {} bool listTests; bool listTags; bool listReporters; bool listTestNamesOnly; bool showSuccessfulTests; bool shouldDebugBreak; bool noThrow; bool showHelp; bool showInvisibles; bool forceColour; bool filenamesAsTags; int abortAfter; unsigned int rngSeed; Verbosity::Level verbosity; WarnAbout::What warnings; ShowDurations::OrNot showDurations; RunTests::InWhatOrder runOrder; std::string outputFilename; std::string name; std::string processName; std::vector reporterNames; std::vector testsOrTags; }; class Config : public SharedImpl { private: Config( Config const& other ); Config& operator = ( Config const& other ); virtual void dummy(); public: Config() {} Config( ConfigData const& data ) : m_data( data ), m_stream( openStream() ) { if( !data.testsOrTags.empty() ) { TestSpecParser parser( ITagAliasRegistry::get() ); for( std::size_t i = 0; i < data.testsOrTags.size(); ++i ) parser.parse( data.testsOrTags[i] ); m_testSpec = parser.testSpec(); } } virtual ~Config() { } std::string const& getFilename() const { return m_data.outputFilename ; } bool listTests() const { return m_data.listTests; } bool listTestNamesOnly() const { return m_data.listTestNamesOnly; } bool listTags() const { return m_data.listTags; } bool listReporters() const { return m_data.listReporters; } std::string getProcessName() const { return m_data.processName; } bool shouldDebugBreak() const { return m_data.shouldDebugBreak; } std::vector getReporterNames() const { return m_data.reporterNames; } int abortAfter() const { return m_data.abortAfter; } TestSpec const& testSpec() const { return m_testSpec; } bool showHelp() const { return m_data.showHelp; } bool showInvisibles() const { return m_data.showInvisibles; } // IConfig interface virtual bool allowThrows() const { return !m_data.noThrow; } virtual std::ostream& stream() const { return m_stream->stream(); } virtual std::string name() const { return m_data.name.empty() ? m_data.processName : m_data.name; } virtual bool includeSuccessfulResults() const { return m_data.showSuccessfulTests; } virtual bool warnAboutMissingAssertions() const { return m_data.warnings & WarnAbout::NoAssertions; } virtual ShowDurations::OrNot showDurations() const { return m_data.showDurations; } virtual RunTests::InWhatOrder runOrder() const { return m_data.runOrder; } virtual unsigned int rngSeed() const { return m_data.rngSeed; } virtual bool forceColour() const { return m_data.forceColour; } private: IStream const* openStream() { if( m_data.outputFilename.empty() ) return new CoutStream(); else if( m_data.outputFilename[0] == '%' ) { if( m_data.outputFilename == "%debug" ) return new DebugOutStream(); else throw std::domain_error( "Unrecognised stream: " + m_data.outputFilename ); } else return new FileStream( m_data.outputFilename ); } ConfigData m_data; std::auto_ptr m_stream; TestSpec m_testSpec; }; } // end namespace Catch // #included from: catch_clara.h #define TWOBLUECUBES_CATCH_CLARA_H_INCLUDED // Use Catch's value for console width (store Clara's off to the side, if present) #ifdef CLARA_CONFIG_CONSOLE_WIDTH #define CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH CLARA_CONFIG_CONSOLE_WIDTH #undef CLARA_CONFIG_CONSOLE_WIDTH #endif #define CLARA_CONFIG_CONSOLE_WIDTH CATCH_CONFIG_CONSOLE_WIDTH // Declare Clara inside the Catch namespace #define STITCH_CLARA_OPEN_NAMESPACE namespace Catch { // #included from: ../external/clara.h // Only use header guard if we are not using an outer namespace #if !defined(TWOBLUECUBES_CLARA_H_INCLUDED) || defined(STITCH_CLARA_OPEN_NAMESPACE) #ifndef STITCH_CLARA_OPEN_NAMESPACE #define TWOBLUECUBES_CLARA_H_INCLUDED #define STITCH_CLARA_OPEN_NAMESPACE #define STITCH_CLARA_CLOSE_NAMESPACE #else #define STITCH_CLARA_CLOSE_NAMESPACE } #endif #define STITCH_TBC_TEXT_FORMAT_OPEN_NAMESPACE STITCH_CLARA_OPEN_NAMESPACE // ----------- #included from tbc_text_format.h ----------- // Only use header guard if we are not using an outer namespace #if !defined(TBC_TEXT_FORMAT_H_INCLUDED) || defined(STITCH_TBC_TEXT_FORMAT_OUTER_NAMESPACE) #ifndef STITCH_TBC_TEXT_FORMAT_OUTER_NAMESPACE #define TBC_TEXT_FORMAT_H_INCLUDED #endif #include #include #include // Use optional outer namespace #ifdef STITCH_TBC_TEXT_FORMAT_OUTER_NAMESPACE namespace STITCH_TBC_TEXT_FORMAT_OUTER_NAMESPACE { #endif namespace Tbc { #ifdef TBC_TEXT_FORMAT_CONSOLE_WIDTH const unsigned int consoleWidth = TBC_TEXT_FORMAT_CONSOLE_WIDTH; #else const unsigned int consoleWidth = 80; #endif struct TextAttributes { TextAttributes() : initialIndent( std::string::npos ), indent( 0 ), width( consoleWidth-1 ), tabChar( '\t' ) {} TextAttributes& setInitialIndent( std::size_t _value ) { initialIndent = _value; return *this; } TextAttributes& setIndent( std::size_t _value ) { indent = _value; return *this; } TextAttributes& setWidth( std::size_t _value ) { width = _value; return *this; } TextAttributes& setTabChar( char _value ) { tabChar = _value; return *this; } std::size_t initialIndent; // indent of first line, or npos std::size_t indent; // indent of subsequent lines, or all if initialIndent is npos std::size_t width; // maximum width of text, including indent. Longer text will wrap char tabChar; // If this char is seen the indent is changed to current pos }; class Text { public: Text( std::string const& _str, TextAttributes const& _attr = TextAttributes() ) : attr( _attr ) { std::string wrappableChars = " [({.,/|\\-"; std::size_t indent = _attr.initialIndent != std::string::npos ? _attr.initialIndent : _attr.indent; std::string remainder = _str; while( !remainder.empty() ) { if( lines.size() >= 1000 ) { lines.push_back( "... message truncated due to excessive size" ); return; } std::size_t tabPos = std::string::npos; std::size_t width = (std::min)( remainder.size(), _attr.width - indent ); std::size_t pos = remainder.find_first_of( '\n' ); if( pos <= width ) { width = pos; } pos = remainder.find_last_of( _attr.tabChar, width ); if( pos != std::string::npos ) { tabPos = pos; if( remainder[width] == '\n' ) width--; remainder = remainder.substr( 0, tabPos ) + remainder.substr( tabPos+1 ); } if( width == remainder.size() ) { spliceLine( indent, remainder, width ); } else if( remainder[width] == '\n' ) { spliceLine( indent, remainder, width ); if( width <= 1 || remainder.size() != 1 ) remainder = remainder.substr( 1 ); indent = _attr.indent; } else { pos = remainder.find_last_of( wrappableChars, width ); if( pos != std::string::npos && pos > 0 ) { spliceLine( indent, remainder, pos ); if( remainder[0] == ' ' ) remainder = remainder.substr( 1 ); } else { spliceLine( indent, remainder, width-1 ); lines.back() += "-"; } if( lines.size() == 1 ) indent = _attr.indent; if( tabPos != std::string::npos ) indent += tabPos; } } } void spliceLine( std::size_t _indent, std::string& _remainder, std::size_t _pos ) { lines.push_back( std::string( _indent, ' ' ) + _remainder.substr( 0, _pos ) ); _remainder = _remainder.substr( _pos ); } typedef std::vector::const_iterator const_iterator; const_iterator begin() const { return lines.begin(); } const_iterator end() const { return lines.end(); } std::string const& last() const { return lines.back(); } std::size_t size() const { return lines.size(); } std::string const& operator[]( std::size_t _index ) const { return lines[_index]; } std::string toString() const { std::ostringstream oss; oss << *this; return oss.str(); } inline friend std::ostream& operator << ( std::ostream& _stream, Text const& _text ) { for( Text::const_iterator it = _text.begin(), itEnd = _text.end(); it != itEnd; ++it ) { if( it != _text.begin() ) _stream << "\n"; _stream << *it; } return _stream; } private: std::string str; TextAttributes attr; std::vector lines; }; } // end namespace Tbc #ifdef STITCH_TBC_TEXT_FORMAT_OUTER_NAMESPACE } // end outer namespace #endif #endif // TBC_TEXT_FORMAT_H_INCLUDED // ----------- end of #include from tbc_text_format.h ----------- // ........... back in /Users/philnash/Dev/OSS/Clara/srcs/clara.h #undef STITCH_TBC_TEXT_FORMAT_OPEN_NAMESPACE #include #include #include #include // Use optional outer namespace #ifdef STITCH_CLARA_OPEN_NAMESPACE STITCH_CLARA_OPEN_NAMESPACE #endif namespace Clara { struct UnpositionalTag {}; extern UnpositionalTag _; #ifdef CLARA_CONFIG_MAIN UnpositionalTag _; #endif namespace Detail { #ifdef CLARA_CONSOLE_WIDTH const unsigned int consoleWidth = CLARA_CONFIG_CONSOLE_WIDTH; #else const unsigned int consoleWidth = 80; #endif using namespace Tbc; inline bool startsWith( std::string const& str, std::string const& prefix ) { return str.size() >= prefix.size() && str.substr( 0, prefix.size() ) == prefix; } template struct RemoveConstRef{ typedef T type; }; template struct RemoveConstRef{ typedef T type; }; template struct RemoveConstRef{ typedef T type; }; template struct RemoveConstRef{ typedef T type; }; template struct IsBool { static const bool value = false; }; template<> struct IsBool { static const bool value = true; }; template void convertInto( std::string const& _source, T& _dest ) { std::stringstream ss; ss << _source; ss >> _dest; if( ss.fail() ) throw std::runtime_error( "Unable to convert " + _source + " to destination type" ); } inline void convertInto( std::string const& _source, std::string& _dest ) { _dest = _source; } inline void convertInto( std::string const& _source, bool& _dest ) { std::string sourceLC = _source; std::transform( sourceLC.begin(), sourceLC.end(), sourceLC.begin(), ::tolower ); if( sourceLC == "y" || sourceLC == "1" || sourceLC == "true" || sourceLC == "yes" || sourceLC == "on" ) _dest = true; else if( sourceLC == "n" || sourceLC == "0" || sourceLC == "false" || sourceLC == "no" || sourceLC == "off" ) _dest = false; else throw std::runtime_error( "Expected a boolean value but did not recognise:\n '" + _source + "'" ); } inline void convertInto( bool _source, bool& _dest ) { _dest = _source; } template inline void convertInto( bool, T& ) { throw std::runtime_error( "Invalid conversion" ); } template struct IArgFunction { virtual ~IArgFunction() {} # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS IArgFunction() = default; IArgFunction( IArgFunction const& ) = default; # endif virtual void set( ConfigT& config, std::string const& value ) const = 0; virtual void setFlag( ConfigT& config ) const = 0; virtual bool takesArg() const = 0; virtual IArgFunction* clone() const = 0; }; template class BoundArgFunction { public: BoundArgFunction() : functionObj( CATCH_NULL ) {} BoundArgFunction( IArgFunction* _functionObj ) : functionObj( _functionObj ) {} BoundArgFunction( BoundArgFunction const& other ) : functionObj( other.functionObj ? other.functionObj->clone() : CATCH_NULL ) {} BoundArgFunction& operator = ( BoundArgFunction const& other ) { IArgFunction* newFunctionObj = other.functionObj ? other.functionObj->clone() : CATCH_NULL; delete functionObj; functionObj = newFunctionObj; return *this; } ~BoundArgFunction() { delete functionObj; } void set( ConfigT& config, std::string const& value ) const { functionObj->set( config, value ); } void setFlag( ConfigT& config ) const { functionObj->setFlag( config ); } bool takesArg() const { return functionObj->takesArg(); } bool isSet() const { return functionObj != CATCH_NULL; } private: IArgFunction* functionObj; }; template struct NullBinder : IArgFunction{ virtual void set( C&, std::string const& ) const {} virtual void setFlag( C& ) const {} virtual bool takesArg() const { return true; } virtual IArgFunction* clone() const { return new NullBinder( *this ); } }; template struct BoundDataMember : IArgFunction{ BoundDataMember( M C::* _member ) : member( _member ) {} virtual void set( C& p, std::string const& stringValue ) const { convertInto( stringValue, p.*member ); } virtual void setFlag( C& p ) const { convertInto( true, p.*member ); } virtual bool takesArg() const { return !IsBool::value; } virtual IArgFunction* clone() const { return new BoundDataMember( *this ); } M C::* member; }; template struct BoundUnaryMethod : IArgFunction{ BoundUnaryMethod( void (C::*_member)( M ) ) : member( _member ) {} virtual void set( C& p, std::string const& stringValue ) const { typename RemoveConstRef::type value; convertInto( stringValue, value ); (p.*member)( value ); } virtual void setFlag( C& p ) const { typename RemoveConstRef::type value; convertInto( true, value ); (p.*member)( value ); } virtual bool takesArg() const { return !IsBool::value; } virtual IArgFunction* clone() const { return new BoundUnaryMethod( *this ); } void (C::*member)( M ); }; template struct BoundNullaryMethod : IArgFunction{ BoundNullaryMethod( void (C::*_member)() ) : member( _member ) {} virtual void set( C& p, std::string const& stringValue ) const { bool value; convertInto( stringValue, value ); if( value ) (p.*member)(); } virtual void setFlag( C& p ) const { (p.*member)(); } virtual bool takesArg() const { return false; } virtual IArgFunction* clone() const { return new BoundNullaryMethod( *this ); } void (C::*member)(); }; template struct BoundUnaryFunction : IArgFunction{ BoundUnaryFunction( void (*_function)( C& ) ) : function( _function ) {} virtual void set( C& obj, std::string const& stringValue ) const { bool value; convertInto( stringValue, value ); if( value ) function( obj ); } virtual void setFlag( C& p ) const { function( p ); } virtual bool takesArg() const { return false; } virtual IArgFunction* clone() const { return new BoundUnaryFunction( *this ); } void (*function)( C& ); }; template struct BoundBinaryFunction : IArgFunction{ BoundBinaryFunction( void (*_function)( C&, T ) ) : function( _function ) {} virtual void set( C& obj, std::string const& stringValue ) const { typename RemoveConstRef::type value; convertInto( stringValue, value ); function( obj, value ); } virtual void setFlag( C& obj ) const { typename RemoveConstRef::type value; convertInto( true, value ); function( obj, value ); } virtual bool takesArg() const { return !IsBool::value; } virtual IArgFunction* clone() const { return new BoundBinaryFunction( *this ); } void (*function)( C&, T ); }; } // namespace Detail struct Parser { Parser() : separators( " \t=:" ) {} struct Token { enum Type { Positional, ShortOpt, LongOpt }; Token( Type _type, std::string const& _data ) : type( _type ), data( _data ) {} Type type; std::string data; }; void parseIntoTokens( int argc, char const * const * argv, std::vector& tokens ) const { const std::string doubleDash = "--"; for( int i = 1; i < argc && argv[i] != doubleDash; ++i ) parseIntoTokens( argv[i] , tokens); } void parseIntoTokens( std::string arg, std::vector& tokens ) const { while( !arg.empty() ) { Parser::Token token( Parser::Token::Positional, arg ); arg = ""; if( token.data[0] == '-' ) { if( token.data.size() > 1 && token.data[1] == '-' ) { token = Parser::Token( Parser::Token::LongOpt, token.data.substr( 2 ) ); } else { token = Parser::Token( Parser::Token::ShortOpt, token.data.substr( 1 ) ); if( token.data.size() > 1 && separators.find( token.data[1] ) == std::string::npos ) { arg = "-" + token.data.substr( 1 ); token.data = token.data.substr( 0, 1 ); } } } if( token.type != Parser::Token::Positional ) { std::size_t pos = token.data.find_first_of( separators ); if( pos != std::string::npos ) { arg = token.data.substr( pos+1 ); token.data = token.data.substr( 0, pos ); } } tokens.push_back( token ); } } std::string separators; }; template struct CommonArgProperties { CommonArgProperties() {} CommonArgProperties( Detail::BoundArgFunction const& _boundField ) : boundField( _boundField ) {} Detail::BoundArgFunction boundField; std::string description; std::string detail; std::string placeholder; // Only value if boundField takes an arg bool takesArg() const { return !placeholder.empty(); } void validate() const { if( !boundField.isSet() ) throw std::logic_error( "option not bound" ); } }; struct OptionArgProperties { std::vector shortNames; std::string longName; bool hasShortName( std::string const& shortName ) const { return std::find( shortNames.begin(), shortNames.end(), shortName ) != shortNames.end(); } bool hasLongName( std::string const& _longName ) const { return _longName == longName; } }; struct PositionalArgProperties { PositionalArgProperties() : position( -1 ) {} int position; // -1 means non-positional (floating) bool isFixedPositional() const { return position != -1; } }; template class CommandLine { struct Arg : CommonArgProperties, OptionArgProperties, PositionalArgProperties { Arg() {} Arg( Detail::BoundArgFunction const& _boundField ) : CommonArgProperties( _boundField ) {} using CommonArgProperties::placeholder; // !TBD std::string dbgName() const { if( !longName.empty() ) return "--" + longName; if( !shortNames.empty() ) return "-" + shortNames[0]; return "positional args"; } std::string commands() const { std::ostringstream oss; bool first = true; std::vector::const_iterator it = shortNames.begin(), itEnd = shortNames.end(); for(; it != itEnd; ++it ) { if( first ) first = false; else oss << ", "; oss << "-" << *it; } if( !longName.empty() ) { if( !first ) oss << ", "; oss << "--" << longName; } if( !placeholder.empty() ) oss << " <" << placeholder << ">"; return oss.str(); } }; typedef CATCH_AUTO_PTR( Arg ) ArgAutoPtr; friend void addOptName( Arg& arg, std::string const& optName ) { if( optName.empty() ) return; if( Detail::startsWith( optName, "--" ) ) { if( !arg.longName.empty() ) throw std::logic_error( "Only one long opt may be specified. '" + arg.longName + "' already specified, now attempting to add '" + optName + "'" ); arg.longName = optName.substr( 2 ); } else if( Detail::startsWith( optName, "-" ) ) arg.shortNames.push_back( optName.substr( 1 ) ); else throw std::logic_error( "option must begin with - or --. Option was: '" + optName + "'" ); } friend void setPositionalArg( Arg& arg, int position ) { arg.position = position; } class ArgBuilder { public: ArgBuilder( Arg* arg ) : m_arg( arg ) {} // Bind a non-boolean data member (requires placeholder string) template void bind( M C::* field, std::string const& placeholder ) { m_arg->boundField = new Detail::BoundDataMember( field ); m_arg->placeholder = placeholder; } // Bind a boolean data member (no placeholder required) template void bind( bool C::* field ) { m_arg->boundField = new Detail::BoundDataMember( field ); } // Bind a method taking a single, non-boolean argument (requires a placeholder string) template void bind( void (C::* unaryMethod)( M ), std::string const& placeholder ) { m_arg->boundField = new Detail::BoundUnaryMethod( unaryMethod ); m_arg->placeholder = placeholder; } // Bind a method taking a single, boolean argument (no placeholder string required) template void bind( void (C::* unaryMethod)( bool ) ) { m_arg->boundField = new Detail::BoundUnaryMethod( unaryMethod ); } // Bind a method that takes no arguments (will be called if opt is present) template void bind( void (C::* nullaryMethod)() ) { m_arg->boundField = new Detail::BoundNullaryMethod( nullaryMethod ); } // Bind a free function taking a single argument - the object to operate on (no placeholder string required) template void bind( void (* unaryFunction)( C& ) ) { m_arg->boundField = new Detail::BoundUnaryFunction( unaryFunction ); } // Bind a free function taking a single argument - the object to operate on (requires a placeholder string) template void bind( void (* binaryFunction)( C&, T ), std::string const& placeholder ) { m_arg->boundField = new Detail::BoundBinaryFunction( binaryFunction ); m_arg->placeholder = placeholder; } ArgBuilder& describe( std::string const& description ) { m_arg->description = description; return *this; } ArgBuilder& detail( std::string const& _detail ) { m_arg->detail = _detail; return *this; } protected: Arg* m_arg; }; class OptBuilder : public ArgBuilder { public: OptBuilder( Arg* arg ) : ArgBuilder( arg ) {} OptBuilder( OptBuilder& other ) : ArgBuilder( other ) {} OptBuilder& operator[]( std::string const& optName ) { addOptName( *ArgBuilder::m_arg, optName ); return *this; } }; public: CommandLine() : m_boundProcessName( new Detail::NullBinder() ), m_highestSpecifiedArgPosition( 0 ), m_throwOnUnrecognisedTokens( false ) {} CommandLine( CommandLine const& other ) : m_boundProcessName( other.m_boundProcessName ), m_options ( other.m_options ), m_positionalArgs( other.m_positionalArgs ), m_highestSpecifiedArgPosition( other.m_highestSpecifiedArgPosition ), m_throwOnUnrecognisedTokens( other.m_throwOnUnrecognisedTokens ) { if( other.m_floatingArg.get() ) m_floatingArg.reset( new Arg( *other.m_floatingArg ) ); } CommandLine& setThrowOnUnrecognisedTokens( bool shouldThrow = true ) { m_throwOnUnrecognisedTokens = shouldThrow; return *this; } OptBuilder operator[]( std::string const& optName ) { m_options.push_back( Arg() ); addOptName( m_options.back(), optName ); OptBuilder builder( &m_options.back() ); return builder; } ArgBuilder operator[]( int position ) { m_positionalArgs.insert( std::make_pair( position, Arg() ) ); if( position > m_highestSpecifiedArgPosition ) m_highestSpecifiedArgPosition = position; setPositionalArg( m_positionalArgs[position], position ); ArgBuilder builder( &m_positionalArgs[position] ); return builder; } // Invoke this with the _ instance ArgBuilder operator[]( UnpositionalTag ) { if( m_floatingArg.get() ) throw std::logic_error( "Only one unpositional argument can be added" ); m_floatingArg.reset( new Arg() ); ArgBuilder builder( m_floatingArg.get() ); return builder; } template void bindProcessName( M C::* field ) { m_boundProcessName = new Detail::BoundDataMember( field ); } template void bindProcessName( void (C::*_unaryMethod)( M ) ) { m_boundProcessName = new Detail::BoundUnaryMethod( _unaryMethod ); } void optUsage( std::ostream& os, std::size_t indent = 0, std::size_t width = Detail::consoleWidth ) const { typename std::vector::const_iterator itBegin = m_options.begin(), itEnd = m_options.end(), it; std::size_t maxWidth = 0; for( it = itBegin; it != itEnd; ++it ) maxWidth = (std::max)( maxWidth, it->commands().size() ); for( it = itBegin; it != itEnd; ++it ) { Detail::Text usageText( it->commands(), Detail::TextAttributes() .setWidth( maxWidth+indent ) .setIndent( indent ) ); Detail::Text desc( it->description, Detail::TextAttributes() .setWidth( width - maxWidth - 3 ) ); for( std::size_t i = 0; i < (std::max)( usageText.size(), desc.size() ); ++i ) { std::string usageCol = i < usageText.size() ? usageText[i] : ""; os << usageCol; if( i < desc.size() && !desc[i].empty() ) os << std::string( indent + 2 + maxWidth - usageCol.size(), ' ' ) << desc[i]; os << "\n"; } } } std::string optUsage() const { std::ostringstream oss; optUsage( oss ); return oss.str(); } void argSynopsis( std::ostream& os ) const { for( int i = 1; i <= m_highestSpecifiedArgPosition; ++i ) { if( i > 1 ) os << " "; typename std::map::const_iterator it = m_positionalArgs.find( i ); if( it != m_positionalArgs.end() ) os << "<" << it->second.placeholder << ">"; else if( m_floatingArg.get() ) os << "<" << m_floatingArg->placeholder << ">"; else throw std::logic_error( "non consecutive positional arguments with no floating args" ); } // !TBD No indication of mandatory args if( m_floatingArg.get() ) { if( m_highestSpecifiedArgPosition > 1 ) os << " "; os << "[<" << m_floatingArg->placeholder << "> ...]"; } } std::string argSynopsis() const { std::ostringstream oss; argSynopsis( oss ); return oss.str(); } void usage( std::ostream& os, std::string const& procName ) const { validate(); os << "usage:\n " << procName << " "; argSynopsis( os ); if( !m_options.empty() ) { os << " [options]\n\nwhere options are: \n"; optUsage( os, 2 ); } os << "\n"; } std::string usage( std::string const& procName ) const { std::ostringstream oss; usage( oss, procName ); return oss.str(); } ConfigT parse( int argc, char const * const * argv ) const { ConfigT config; parseInto( argc, argv, config ); return config; } std::vector parseInto( int argc, char const * const * argv, ConfigT& config ) const { std::string processName = argv[0]; std::size_t lastSlash = processName.find_last_of( "/\\" ); if( lastSlash != std::string::npos ) processName = processName.substr( lastSlash+1 ); m_boundProcessName.set( config, processName ); std::vector tokens; Parser parser; parser.parseIntoTokens( argc, argv, tokens ); return populate( tokens, config ); } std::vector populate( std::vector const& tokens, ConfigT& config ) const { validate(); std::vector unusedTokens = populateOptions( tokens, config ); unusedTokens = populateFixedArgs( unusedTokens, config ); unusedTokens = populateFloatingArgs( unusedTokens, config ); return unusedTokens; } std::vector populateOptions( std::vector const& tokens, ConfigT& config ) const { std::vector unusedTokens; std::vector errors; for( std::size_t i = 0; i < tokens.size(); ++i ) { Parser::Token const& token = tokens[i]; typename std::vector::const_iterator it = m_options.begin(), itEnd = m_options.end(); for(; it != itEnd; ++it ) { Arg const& arg = *it; try { if( ( token.type == Parser::Token::ShortOpt && arg.hasShortName( token.data ) ) || ( token.type == Parser::Token::LongOpt && arg.hasLongName( token.data ) ) ) { if( arg.takesArg() ) { if( i == tokens.size()-1 || tokens[i+1].type != Parser::Token::Positional ) errors.push_back( "Expected argument to option: " + token.data ); else arg.boundField.set( config, tokens[++i].data ); } else { arg.boundField.setFlag( config ); } break; } } catch( std::exception& ex ) { errors.push_back( std::string( ex.what() ) + "\n- while parsing: (" + arg.commands() + ")" ); } } if( it == itEnd ) { if( token.type == Parser::Token::Positional || !m_throwOnUnrecognisedTokens ) unusedTokens.push_back( token ); else if( errors.empty() && m_throwOnUnrecognisedTokens ) errors.push_back( "unrecognised option: " + token.data ); } } if( !errors.empty() ) { std::ostringstream oss; for( std::vector::const_iterator it = errors.begin(), itEnd = errors.end(); it != itEnd; ++it ) { if( it != errors.begin() ) oss << "\n"; oss << *it; } throw std::runtime_error( oss.str() ); } return unusedTokens; } std::vector populateFixedArgs( std::vector const& tokens, ConfigT& config ) const { std::vector unusedTokens; int position = 1; for( std::size_t i = 0; i < tokens.size(); ++i ) { Parser::Token const& token = tokens[i]; typename std::map::const_iterator it = m_positionalArgs.find( position ); if( it != m_positionalArgs.end() ) it->second.boundField.set( config, token.data ); else unusedTokens.push_back( token ); if( token.type == Parser::Token::Positional ) position++; } return unusedTokens; } std::vector populateFloatingArgs( std::vector const& tokens, ConfigT& config ) const { if( !m_floatingArg.get() ) return tokens; std::vector unusedTokens; for( std::size_t i = 0; i < tokens.size(); ++i ) { Parser::Token const& token = tokens[i]; if( token.type == Parser::Token::Positional ) m_floatingArg->boundField.set( config, token.data ); else unusedTokens.push_back( token ); } return unusedTokens; } void validate() const { if( m_options.empty() && m_positionalArgs.empty() && !m_floatingArg.get() ) throw std::logic_error( "No options or arguments specified" ); for( typename std::vector::const_iterator it = m_options.begin(), itEnd = m_options.end(); it != itEnd; ++it ) it->validate(); } private: Detail::BoundArgFunction m_boundProcessName; std::vector m_options; std::map m_positionalArgs; ArgAutoPtr m_floatingArg; int m_highestSpecifiedArgPosition; bool m_throwOnUnrecognisedTokens; }; } // end namespace Clara STITCH_CLARA_CLOSE_NAMESPACE #undef STITCH_CLARA_OPEN_NAMESPACE #undef STITCH_CLARA_CLOSE_NAMESPACE #endif // TWOBLUECUBES_CLARA_H_INCLUDED #undef STITCH_CLARA_OPEN_NAMESPACE // Restore Clara's value for console width, if present #ifdef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH #define CLARA_CONFIG_CONSOLE_WIDTH CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH #undef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH #endif #include namespace Catch { inline void abortAfterFirst( ConfigData& config ) { config.abortAfter = 1; } inline void abortAfterX( ConfigData& config, int x ) { if( x < 1 ) throw std::runtime_error( "Value after -x or --abortAfter must be greater than zero" ); config.abortAfter = x; } inline void addTestOrTags( ConfigData& config, std::string const& _testSpec ) { config.testsOrTags.push_back( _testSpec ); } inline void addReporterName( ConfigData& config, std::string const& _reporterName ) { config.reporterNames.push_back( _reporterName ); } inline void addWarning( ConfigData& config, std::string const& _warning ) { if( _warning == "NoAssertions" ) config.warnings = static_cast( config.warnings | WarnAbout::NoAssertions ); else throw std::runtime_error( "Unrecognised warning: '" + _warning + "'" ); } inline void setOrder( ConfigData& config, std::string const& order ) { if( startsWith( "declared", order ) ) config.runOrder = RunTests::InDeclarationOrder; else if( startsWith( "lexical", order ) ) config.runOrder = RunTests::InLexicographicalOrder; else if( startsWith( "random", order ) ) config.runOrder = RunTests::InRandomOrder; else throw std::runtime_error( "Unrecognised ordering: '" + order + "'" ); } inline void setRngSeed( ConfigData& config, std::string const& seed ) { if( seed == "time" ) { config.rngSeed = static_cast( std::time(0) ); } else { std::stringstream ss; ss << seed; ss >> config.rngSeed; if( ss.fail() ) throw std::runtime_error( "Argment to --rng-seed should be the word 'time' or a number" ); } } inline void setVerbosity( ConfigData& config, int level ) { // !TBD: accept strings? config.verbosity = static_cast( level ); } inline void setShowDurations( ConfigData& config, bool _showDurations ) { config.showDurations = _showDurations ? ShowDurations::Always : ShowDurations::Never; } inline void loadTestNamesFromFile( ConfigData& config, std::string const& _filename ) { std::ifstream f( _filename.c_str() ); if( !f.is_open() ) throw std::domain_error( "Unable to load input file: " + _filename ); std::string line; while( std::getline( f, line ) ) { line = trim(line); if( !line.empty() && !startsWith( line, "#" ) ) addTestOrTags( config, "\"" + line + "\"," ); } } inline Clara::CommandLine makeCommandLineParser() { using namespace Clara; CommandLine cli; cli.bindProcessName( &ConfigData::processName ); cli["-?"]["-h"]["--help"] .describe( "display usage information" ) .bind( &ConfigData::showHelp ); cli["-l"]["--list-tests"] .describe( "list all/matching test cases" ) .bind( &ConfigData::listTests ); cli["-t"]["--list-tags"] .describe( "list all/matching tags" ) .bind( &ConfigData::listTags ); cli["-s"]["--success"] .describe( "include successful tests in output" ) .bind( &ConfigData::showSuccessfulTests ); cli["-b"]["--break"] .describe( "break into debugger on failure" ) .bind( &ConfigData::shouldDebugBreak ); cli["-e"]["--nothrow"] .describe( "skip exception tests" ) .bind( &ConfigData::noThrow ); cli["-i"]["--invisibles"] .describe( "show invisibles (tabs, newlines)" ) .bind( &ConfigData::showInvisibles ); cli["-o"]["--out"] .describe( "output filename" ) .bind( &ConfigData::outputFilename, "filename" ); cli["-r"]["--reporter"] // .placeholder( "name[:filename]" ) .describe( "reporter to use (defaults to console)" ) .bind( &addReporterName, "name" ); cli["-n"]["--name"] .describe( "suite name" ) .bind( &ConfigData::name, "name" ); cli["-a"]["--abort"] .describe( "abort at first failure" ) .bind( &abortAfterFirst ); cli["-x"]["--abortx"] .describe( "abort after x failures" ) .bind( &abortAfterX, "no. failures" ); cli["-w"]["--warn"] .describe( "enable warnings" ) .bind( &addWarning, "warning name" ); // - needs updating if reinstated // cli.into( &setVerbosity ) // .describe( "level of verbosity (0=no output)" ) // .shortOpt( "v") // .longOpt( "verbosity" ) // .placeholder( "level" ); cli[_] .describe( "which test or tests to use" ) .bind( &addTestOrTags, "test name, pattern or tags" ); cli["-d"]["--durations"] .describe( "show test durations" ) .bind( &setShowDurations, "yes/no" ); cli["-f"]["--input-file"] .describe( "load test names to run from a file" ) .bind( &loadTestNamesFromFile, "filename" ); cli["-#"]["--filenames-as-tags"] .describe( "adds a tag for the filename" ) .bind( &ConfigData::filenamesAsTags ); // Less common commands which don't have a short form cli["--list-test-names-only"] .describe( "list all/matching test cases names only" ) .bind( &ConfigData::listTestNamesOnly ); cli["--list-reporters"] .describe( "list all reporters" ) .bind( &ConfigData::listReporters ); cli["--order"] .describe( "test case order (defaults to decl)" ) .bind( &setOrder, "decl|lex|rand" ); cli["--rng-seed"] .describe( "set a specific seed for random numbers" ) .bind( &setRngSeed, "'time'|number" ); cli["--force-colour"] .describe( "force colourised output" ) .bind( &ConfigData::forceColour ); return cli; } } // end namespace Catch // #included from: internal/catch_list.hpp #define TWOBLUECUBES_CATCH_LIST_HPP_INCLUDED // #included from: catch_text.h #define TWOBLUECUBES_CATCH_TEXT_H_INCLUDED #define TBC_TEXT_FORMAT_CONSOLE_WIDTH CATCH_CONFIG_CONSOLE_WIDTH #define CLICHE_TBC_TEXT_FORMAT_OUTER_NAMESPACE Catch // #included from: ../external/tbc_text_format.h // Only use header guard if we are not using an outer namespace #ifndef CLICHE_TBC_TEXT_FORMAT_OUTER_NAMESPACE # ifdef TWOBLUECUBES_TEXT_FORMAT_H_INCLUDED # ifndef TWOBLUECUBES_TEXT_FORMAT_H_ALREADY_INCLUDED # define TWOBLUECUBES_TEXT_FORMAT_H_ALREADY_INCLUDED # endif # else # define TWOBLUECUBES_TEXT_FORMAT_H_INCLUDED # endif #endif #ifndef TWOBLUECUBES_TEXT_FORMAT_H_ALREADY_INCLUDED #include #include #include // Use optional outer namespace #ifdef CLICHE_TBC_TEXT_FORMAT_OUTER_NAMESPACE namespace CLICHE_TBC_TEXT_FORMAT_OUTER_NAMESPACE { #endif namespace Tbc { #ifdef TBC_TEXT_FORMAT_CONSOLE_WIDTH const unsigned int consoleWidth = TBC_TEXT_FORMAT_CONSOLE_WIDTH; #else const unsigned int consoleWidth = 80; #endif struct TextAttributes { TextAttributes() : initialIndent( std::string::npos ), indent( 0 ), width( consoleWidth-1 ), tabChar( '\t' ) {} TextAttributes& setInitialIndent( std::size_t _value ) { initialIndent = _value; return *this; } TextAttributes& setIndent( std::size_t _value ) { indent = _value; return *this; } TextAttributes& setWidth( std::size_t _value ) { width = _value; return *this; } TextAttributes& setTabChar( char _value ) { tabChar = _value; return *this; } std::size_t initialIndent; // indent of first line, or npos std::size_t indent; // indent of subsequent lines, or all if initialIndent is npos std::size_t width; // maximum width of text, including indent. Longer text will wrap char tabChar; // If this char is seen the indent is changed to current pos }; class Text { public: Text( std::string const& _str, TextAttributes const& _attr = TextAttributes() ) : attr( _attr ) { std::string wrappableChars = " [({.,/|\\-"; std::size_t indent = _attr.initialIndent != std::string::npos ? _attr.initialIndent : _attr.indent; std::string remainder = _str; while( !remainder.empty() ) { if( lines.size() >= 1000 ) { lines.push_back( "... message truncated due to excessive size" ); return; } std::size_t tabPos = std::string::npos; std::size_t width = (std::min)( remainder.size(), _attr.width - indent ); std::size_t pos = remainder.find_first_of( '\n' ); if( pos <= width ) { width = pos; } pos = remainder.find_last_of( _attr.tabChar, width ); if( pos != std::string::npos ) { tabPos = pos; if( remainder[width] == '\n' ) width--; remainder = remainder.substr( 0, tabPos ) + remainder.substr( tabPos+1 ); } if( width == remainder.size() ) { spliceLine( indent, remainder, width ); } else if( remainder[width] == '\n' ) { spliceLine( indent, remainder, width ); if( width <= 1 || remainder.size() != 1 ) remainder = remainder.substr( 1 ); indent = _attr.indent; } else { pos = remainder.find_last_of( wrappableChars, width ); if( pos != std::string::npos && pos > 0 ) { spliceLine( indent, remainder, pos ); if( remainder[0] == ' ' ) remainder = remainder.substr( 1 ); } else { spliceLine( indent, remainder, width-1 ); lines.back() += "-"; } if( lines.size() == 1 ) indent = _attr.indent; if( tabPos != std::string::npos ) indent += tabPos; } } } void spliceLine( std::size_t _indent, std::string& _remainder, std::size_t _pos ) { lines.push_back( std::string( _indent, ' ' ) + _remainder.substr( 0, _pos ) ); _remainder = _remainder.substr( _pos ); } typedef std::vector::const_iterator const_iterator; const_iterator begin() const { return lines.begin(); } const_iterator end() const { return lines.end(); } std::string const& last() const { return lines.back(); } std::size_t size() const { return lines.size(); } std::string const& operator[]( std::size_t _index ) const { return lines[_index]; } std::string toString() const { std::ostringstream oss; oss << *this; return oss.str(); } inline friend std::ostream& operator << ( std::ostream& _stream, Text const& _text ) { for( Text::const_iterator it = _text.begin(), itEnd = _text.end(); it != itEnd; ++it ) { if( it != _text.begin() ) _stream << "\n"; _stream << *it; } return _stream; } private: std::string str; TextAttributes attr; std::vector lines; }; } // end namespace Tbc #ifdef CLICHE_TBC_TEXT_FORMAT_OUTER_NAMESPACE } // end outer namespace #endif #endif // TWOBLUECUBES_TEXT_FORMAT_H_ALREADY_INCLUDED #undef CLICHE_TBC_TEXT_FORMAT_OUTER_NAMESPACE namespace Catch { using Tbc::Text; using Tbc::TextAttributes; } // #included from: catch_console_colour.hpp #define TWOBLUECUBES_CATCH_CONSOLE_COLOUR_HPP_INCLUDED namespace Catch { struct Colour { enum Code { None = 0, White, Red, Green, Blue, Cyan, Yellow, Grey, Bright = 0x10, BrightRed = Bright | Red, BrightGreen = Bright | Green, LightGrey = Bright | Grey, BrightWhite = Bright | White, // By intention FileName = LightGrey, Warning = Yellow, ResultError = BrightRed, ResultSuccess = BrightGreen, ResultExpectedFailure = Warning, Error = BrightRed, Success = Green, OriginalExpression = Cyan, ReconstructedExpression = Yellow, SecondaryText = LightGrey, Headers = White }; // Use constructed object for RAII guard Colour( Code _colourCode ); Colour( Colour const& other ); ~Colour(); // Use static method for one-shot changes static void use( Code _colourCode ); private: bool m_moved; }; inline std::ostream& operator << ( std::ostream& os, Colour const& ) { return os; } } // end namespace Catch // #included from: catch_interfaces_reporter.h #define TWOBLUECUBES_CATCH_INTERFACES_REPORTER_H_INCLUDED #include #include #include #include namespace Catch { struct ReporterConfig { explicit ReporterConfig( Ptr const& _fullConfig ) : m_stream( &_fullConfig->stream() ), m_fullConfig( _fullConfig ) {} ReporterConfig( Ptr const& _fullConfig, std::ostream& _stream ) : m_stream( &_stream ), m_fullConfig( _fullConfig ) {} std::ostream& stream() const { return *m_stream; } Ptr fullConfig() const { return m_fullConfig; } private: std::ostream* m_stream; Ptr m_fullConfig; }; struct ReporterPreferences { ReporterPreferences() : shouldRedirectStdOut( false ) {} bool shouldRedirectStdOut; }; template struct LazyStat : Option { LazyStat() : used( false ) {} LazyStat& operator=( T const& _value ) { Option::operator=( _value ); used = false; return *this; } void reset() { Option::reset(); used = false; } bool used; }; struct TestRunInfo { TestRunInfo( std::string const& _name ) : name( _name ) {} std::string name; }; struct GroupInfo { GroupInfo( std::string const& _name, std::size_t _groupIndex, std::size_t _groupsCount ) : name( _name ), groupIndex( _groupIndex ), groupsCounts( _groupsCount ) {} std::string name; std::size_t groupIndex; std::size_t groupsCounts; }; struct AssertionStats { AssertionStats( AssertionResult const& _assertionResult, std::vector const& _infoMessages, Totals const& _totals ) : assertionResult( _assertionResult ), infoMessages( _infoMessages ), totals( _totals ) { if( assertionResult.hasMessage() ) { // Copy message into messages list. // !TBD This should have been done earlier, somewhere MessageBuilder builder( assertionResult.getTestMacroName(), assertionResult.getSourceInfo(), assertionResult.getResultType() ); builder << assertionResult.getMessage(); builder.m_info.message = builder.m_stream.str(); infoMessages.push_back( builder.m_info ); } } virtual ~AssertionStats(); # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS AssertionStats( AssertionStats const& ) = default; AssertionStats( AssertionStats && ) = default; AssertionStats& operator = ( AssertionStats const& ) = default; AssertionStats& operator = ( AssertionStats && ) = default; # endif AssertionResult assertionResult; std::vector infoMessages; Totals totals; }; struct SectionStats { SectionStats( SectionInfo const& _sectionInfo, Counts const& _assertions, double _durationInSeconds, bool _missingAssertions ) : sectionInfo( _sectionInfo ), assertions( _assertions ), durationInSeconds( _durationInSeconds ), missingAssertions( _missingAssertions ) {} virtual ~SectionStats(); # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS SectionStats( SectionStats const& ) = default; SectionStats( SectionStats && ) = default; SectionStats& operator = ( SectionStats const& ) = default; SectionStats& operator = ( SectionStats && ) = default; # endif SectionInfo sectionInfo; Counts assertions; double durationInSeconds; bool missingAssertions; }; struct TestCaseStats { TestCaseStats( TestCaseInfo const& _testInfo, Totals const& _totals, std::string const& _stdOut, std::string const& _stdErr, bool _aborting ) : testInfo( _testInfo ), totals( _totals ), stdOut( _stdOut ), stdErr( _stdErr ), aborting( _aborting ) {} virtual ~TestCaseStats(); # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS TestCaseStats( TestCaseStats const& ) = default; TestCaseStats( TestCaseStats && ) = default; TestCaseStats& operator = ( TestCaseStats const& ) = default; TestCaseStats& operator = ( TestCaseStats && ) = default; # endif TestCaseInfo testInfo; Totals totals; std::string stdOut; std::string stdErr; bool aborting; }; struct TestGroupStats { TestGroupStats( GroupInfo const& _groupInfo, Totals const& _totals, bool _aborting ) : groupInfo( _groupInfo ), totals( _totals ), aborting( _aborting ) {} TestGroupStats( GroupInfo const& _groupInfo ) : groupInfo( _groupInfo ), aborting( false ) {} virtual ~TestGroupStats(); # ifdef CATCH_CONFIG_CPP11_GENERATED_METHODS TestGroupStats( TestGroupStats const& ) = default; TestGroupStats( TestGroupStats && ) = default; TestGroupStats& operator = ( TestGroupStats const& ) = default; TestGroupStats& operator = ( TestGroupStats && ) = default; # endif GroupInfo groupInfo; Totals totals; bool aborting; }; struct TestRunStats { TestRunStats( TestRunInfo const& _runInfo, Totals const& _totals, bool _aborting ) : runInfo( _runInfo ), totals( _totals ), aborting( _aborting ) {} virtual ~TestRunStats(); # ifndef CATCH_CONFIG_CPP11_GENERATED_METHODS TestRunStats( TestRunStats const& _other ) : runInfo( _other.runInfo ), totals( _other.totals ), aborting( _other.aborting ) {} # else TestRunStats( TestRunStats const& ) = default; TestRunStats( TestRunStats && ) = default; TestRunStats& operator = ( TestRunStats const& ) = default; TestRunStats& operator = ( TestRunStats && ) = default; # endif TestRunInfo runInfo; Totals totals; bool aborting; }; struct IStreamingReporter : IShared { virtual ~IStreamingReporter(); // Implementing class must also provide the following static method: // static std::string getDescription(); virtual ReporterPreferences getPreferences() const = 0; virtual void noMatchingTestCases( std::string const& spec ) = 0; virtual void testRunStarting( TestRunInfo const& testRunInfo ) = 0; virtual void testGroupStarting( GroupInfo const& groupInfo ) = 0; virtual void testCaseStarting( TestCaseInfo const& testInfo ) = 0; virtual void sectionStarting( SectionInfo const& sectionInfo ) = 0; virtual void assertionStarting( AssertionInfo const& assertionInfo ) = 0; // The return value indicates if the messages buffer should be cleared: virtual bool assertionEnded( AssertionStats const& assertionStats ) = 0; virtual void sectionEnded( SectionStats const& sectionStats ) = 0; virtual void testCaseEnded( TestCaseStats const& testCaseStats ) = 0; virtual void testGroupEnded( TestGroupStats const& testGroupStats ) = 0; virtual void testRunEnded( TestRunStats const& testRunStats ) = 0; virtual void skipTest( TestCaseInfo const& testInfo ) = 0; }; struct IReporterFactory : IShared { virtual ~IReporterFactory(); virtual IStreamingReporter* create( ReporterConfig const& config ) const = 0; virtual std::string getDescription() const = 0; }; struct IReporterRegistry { typedef std::map > FactoryMap; typedef std::vector > Listeners; virtual ~IReporterRegistry(); virtual IStreamingReporter* create( std::string const& name, Ptr const& config ) const = 0; virtual FactoryMap const& getFactories() const = 0; virtual Listeners const& getListeners() const = 0; }; Ptr addReporter( Ptr const& existingReporter, Ptr const& additionalReporter ); } #include #include namespace Catch { inline std::size_t listTests( Config const& config ) { TestSpec testSpec = config.testSpec(); if( config.testSpec().hasFilters() ) Catch::cout() << "Matching test cases:\n"; else { Catch::cout() << "All available test cases:\n"; testSpec = TestSpecParser( ITagAliasRegistry::get() ).parse( "*" ).testSpec(); } std::size_t matchedTests = 0; TextAttributes nameAttr, tagsAttr; nameAttr.setInitialIndent( 2 ).setIndent( 4 ); tagsAttr.setIndent( 6 ); std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); for( std::vector::const_iterator it = matchedTestCases.begin(), itEnd = matchedTestCases.end(); it != itEnd; ++it ) { matchedTests++; TestCaseInfo const& testCaseInfo = it->getTestCaseInfo(); Colour::Code colour = testCaseInfo.isHidden() ? Colour::SecondaryText : Colour::None; Colour colourGuard( colour ); Catch::cout() << Text( testCaseInfo.name, nameAttr ) << std::endl; if( !testCaseInfo.tags.empty() ) Catch::cout() << Text( testCaseInfo.tagsAsString, tagsAttr ) << std::endl; } if( !config.testSpec().hasFilters() ) Catch::cout() << pluralise( matchedTests, "test case" ) << "\n" << std::endl; else Catch::cout() << pluralise( matchedTests, "matching test case" ) << "\n" << std::endl; return matchedTests; } inline std::size_t listTestsNamesOnly( Config const& config ) { TestSpec testSpec = config.testSpec(); if( !config.testSpec().hasFilters() ) testSpec = TestSpecParser( ITagAliasRegistry::get() ).parse( "*" ).testSpec(); std::size_t matchedTests = 0; std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); for( std::vector::const_iterator it = matchedTestCases.begin(), itEnd = matchedTestCases.end(); it != itEnd; ++it ) { matchedTests++; TestCaseInfo const& testCaseInfo = it->getTestCaseInfo(); Catch::cout() << testCaseInfo.name << std::endl; } return matchedTests; } struct TagInfo { TagInfo() : count ( 0 ) {} void add( std::string const& spelling ) { ++count; spellings.insert( spelling ); } std::string all() const { std::string out; for( std::set::const_iterator it = spellings.begin(), itEnd = spellings.end(); it != itEnd; ++it ) out += "[" + *it + "]"; return out; } std::set spellings; std::size_t count; }; inline std::size_t listTags( Config const& config ) { TestSpec testSpec = config.testSpec(); if( config.testSpec().hasFilters() ) Catch::cout() << "Tags for matching test cases:\n"; else { Catch::cout() << "All available tags:\n"; testSpec = TestSpecParser( ITagAliasRegistry::get() ).parse( "*" ).testSpec(); } std::map tagCounts; std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); for( std::vector::const_iterator it = matchedTestCases.begin(), itEnd = matchedTestCases.end(); it != itEnd; ++it ) { for( std::set::const_iterator tagIt = it->getTestCaseInfo().tags.begin(), tagItEnd = it->getTestCaseInfo().tags.end(); tagIt != tagItEnd; ++tagIt ) { std::string tagName = *tagIt; std::string lcaseTagName = toLower( tagName ); std::map::iterator countIt = tagCounts.find( lcaseTagName ); if( countIt == tagCounts.end() ) countIt = tagCounts.insert( std::make_pair( lcaseTagName, TagInfo() ) ).first; countIt->second.add( tagName ); } } for( std::map::const_iterator countIt = tagCounts.begin(), countItEnd = tagCounts.end(); countIt != countItEnd; ++countIt ) { std::ostringstream oss; oss << " " << std::setw(2) << countIt->second.count << " "; Text wrapper( countIt->second.all(), TextAttributes() .setInitialIndent( 0 ) .setIndent( oss.str().size() ) .setWidth( CATCH_CONFIG_CONSOLE_WIDTH-10 ) ); Catch::cout() << oss.str() << wrapper << "\n"; } Catch::cout() << pluralise( tagCounts.size(), "tag" ) << "\n" << std::endl; return tagCounts.size(); } inline std::size_t listReporters( Config const& /*config*/ ) { Catch::cout() << "Available reporters:\n"; IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); IReporterRegistry::FactoryMap::const_iterator itBegin = factories.begin(), itEnd = factories.end(), it; std::size_t maxNameLen = 0; for(it = itBegin; it != itEnd; ++it ) maxNameLen = (std::max)( maxNameLen, it->first.size() ); for(it = itBegin; it != itEnd; ++it ) { Text wrapper( it->second->getDescription(), TextAttributes() .setInitialIndent( 0 ) .setIndent( 7+maxNameLen ) .setWidth( CATCH_CONFIG_CONSOLE_WIDTH - maxNameLen-8 ) ); Catch::cout() << " " << it->first << ":" << std::string( maxNameLen - it->first.size() + 2, ' ' ) << wrapper << "\n"; } Catch::cout() << std::endl; return factories.size(); } inline Option list( Config const& config ) { Option listedCount; if( config.listTests() ) listedCount = listedCount.valueOr(0) + listTests( config ); if( config.listTestNamesOnly() ) listedCount = listedCount.valueOr(0) + listTestsNamesOnly( config ); if( config.listTags() ) listedCount = listedCount.valueOr(0) + listTags( config ); if( config.listReporters() ) listedCount = listedCount.valueOr(0) + listReporters( config ); return listedCount; } } // end namespace Catch // #included from: internal/catch_run_context.hpp #define TWOBLUECUBES_CATCH_RUNNER_IMPL_HPP_INCLUDED // #included from: catch_test_case_tracker.hpp #define TWOBLUECUBES_CATCH_TEST_CASE_TRACKER_HPP_INCLUDED #include #include #include #include namespace Catch { namespace TestCaseTracking { struct ITracker : SharedImpl<> { virtual ~ITracker(); // static queries virtual std::string name() const = 0; // dynamic queries virtual bool isComplete() const = 0; // Successfully completed or failed virtual bool isSuccessfullyCompleted() const = 0; virtual bool isOpen() const = 0; // Started but not complete virtual bool hasChildren() const = 0; virtual ITracker& parent() = 0; // actions virtual void close() = 0; // Successfully complete virtual void fail() = 0; virtual void markAsNeedingAnotherRun() = 0; virtual void addChild( Ptr const& child ) = 0; virtual ITracker* findChild( std::string const& name ) = 0; virtual void openChild() = 0; }; class TrackerContext { enum RunState { NotStarted, Executing, CompletedCycle }; Ptr m_rootTracker; ITracker* m_currentTracker; RunState m_runState; public: static TrackerContext& instance() { static TrackerContext s_instance; return s_instance; } TrackerContext() : m_currentTracker( CATCH_NULL ), m_runState( NotStarted ) {} ITracker& startRun(); void endRun() { m_rootTracker.reset(); m_currentTracker = CATCH_NULL; m_runState = NotStarted; } void startCycle() { m_currentTracker = m_rootTracker.get(); m_runState = Executing; } void completeCycle() { m_runState = CompletedCycle; } bool completedCycle() const { return m_runState == CompletedCycle; } ITracker& currentTracker() { return *m_currentTracker; } void setCurrentTracker( ITracker* tracker ) { m_currentTracker = tracker; } }; class TrackerBase : public ITracker { protected: enum CycleState { NotStarted, Executing, ExecutingChildren, NeedsAnotherRun, CompletedSuccessfully, Failed }; class TrackerHasName { std::string m_name; public: TrackerHasName( std::string const& name ) : m_name( name ) {} bool operator ()( Ptr const& tracker ) { return tracker->name() == m_name; } }; typedef std::vector > Children; std::string m_name; TrackerContext& m_ctx; ITracker* m_parent; Children m_children; CycleState m_runState; public: TrackerBase( std::string const& name, TrackerContext& ctx, ITracker* parent ) : m_name( name ), m_ctx( ctx ), m_parent( parent ), m_runState( NotStarted ) {} virtual ~TrackerBase(); virtual std::string name() const CATCH_OVERRIDE { return m_name; } virtual bool isComplete() const CATCH_OVERRIDE { return m_runState == CompletedSuccessfully || m_runState == Failed; } virtual bool isSuccessfullyCompleted() const CATCH_OVERRIDE { return m_runState == CompletedSuccessfully; } virtual bool isOpen() const CATCH_OVERRIDE { return m_runState != NotStarted && !isComplete(); } virtual bool hasChildren() const CATCH_OVERRIDE { return !m_children.empty(); } virtual void addChild( Ptr const& child ) CATCH_OVERRIDE { m_children.push_back( child ); } virtual ITracker* findChild( std::string const& name ) CATCH_OVERRIDE { Children::const_iterator it = std::find_if( m_children.begin(), m_children.end(), TrackerHasName( name ) ); return( it != m_children.end() ) ? it->get() : CATCH_NULL; } virtual ITracker& parent() CATCH_OVERRIDE { assert( m_parent ); // Should always be non-null except for root return *m_parent; } virtual void openChild() CATCH_OVERRIDE { if( m_runState != ExecutingChildren ) { m_runState = ExecutingChildren; if( m_parent ) m_parent->openChild(); } } void open() { m_runState = Executing; moveToThis(); if( m_parent ) m_parent->openChild(); } virtual void close() CATCH_OVERRIDE { // Close any still open children (e.g. generators) while( &m_ctx.currentTracker() != this ) m_ctx.currentTracker().close(); switch( m_runState ) { case NotStarted: case CompletedSuccessfully: case Failed: throw std::logic_error( "Illogical state" ); case NeedsAnotherRun: break;; case Executing: m_runState = CompletedSuccessfully; break; case ExecutingChildren: if( m_children.empty() || m_children.back()->isComplete() ) m_runState = CompletedSuccessfully; break; default: throw std::logic_error( "Unexpected state" ); } moveToParent(); m_ctx.completeCycle(); } virtual void fail() CATCH_OVERRIDE { m_runState = Failed; if( m_parent ) m_parent->markAsNeedingAnotherRun(); moveToParent(); m_ctx.completeCycle(); } virtual void markAsNeedingAnotherRun() CATCH_OVERRIDE { m_runState = NeedsAnotherRun; } private: void moveToParent() { assert( m_parent ); m_ctx.setCurrentTracker( m_parent ); } void moveToThis() { m_ctx.setCurrentTracker( this ); } }; class SectionTracker : public TrackerBase { public: SectionTracker( std::string const& name, TrackerContext& ctx, ITracker* parent ) : TrackerBase( name, ctx, parent ) {} virtual ~SectionTracker(); static SectionTracker& acquire( TrackerContext& ctx, std::string const& name ) { SectionTracker* section = CATCH_NULL; ITracker& currentTracker = ctx.currentTracker(); if( ITracker* childTracker = currentTracker.findChild( name ) ) { section = dynamic_cast( childTracker ); assert( section ); } else { section = new SectionTracker( name, ctx, ¤tTracker ); currentTracker.addChild( section ); } if( !ctx.completedCycle() && !section->isComplete() ) { section->open(); } return *section; } }; class IndexTracker : public TrackerBase { int m_size; int m_index; public: IndexTracker( std::string const& name, TrackerContext& ctx, ITracker* parent, int size ) : TrackerBase( name, ctx, parent ), m_size( size ), m_index( -1 ) {} virtual ~IndexTracker(); static IndexTracker& acquire( TrackerContext& ctx, std::string const& name, int size ) { IndexTracker* tracker = CATCH_NULL; ITracker& currentTracker = ctx.currentTracker(); if( ITracker* childTracker = currentTracker.findChild( name ) ) { tracker = dynamic_cast( childTracker ); assert( tracker ); } else { tracker = new IndexTracker( name, ctx, ¤tTracker, size ); currentTracker.addChild( tracker ); } if( !ctx.completedCycle() && !tracker->isComplete() ) { if( tracker->m_runState != ExecutingChildren && tracker->m_runState != NeedsAnotherRun ) tracker->moveNext(); tracker->open(); } return *tracker; } int index() const { return m_index; } void moveNext() { m_index++; m_children.clear(); } virtual void close() CATCH_OVERRIDE { TrackerBase::close(); if( m_runState == CompletedSuccessfully && m_index < m_size-1 ) m_runState = Executing; } }; inline ITracker& TrackerContext::startRun() { m_rootTracker = new SectionTracker( "{root}", *this, CATCH_NULL ); m_currentTracker = CATCH_NULL; m_runState = Executing; return *m_rootTracker; } } // namespace TestCaseTracking using TestCaseTracking::ITracker; using TestCaseTracking::TrackerContext; using TestCaseTracking::SectionTracker; using TestCaseTracking::IndexTracker; } // namespace Catch // #included from: catch_fatal_condition.hpp #define TWOBLUECUBES_CATCH_FATAL_CONDITION_H_INCLUDED namespace Catch { // Report the error condition then exit the process inline void fatal( std::string const& message, int exitCode ) { IContext& context = Catch::getCurrentContext(); IResultCapture* resultCapture = context.getResultCapture(); resultCapture->handleFatalErrorCondition( message ); if( Catch::alwaysTrue() ) // avoids "no return" warnings exit( exitCode ); } } // namespace Catch #if defined ( CATCH_PLATFORM_WINDOWS ) ///////////////////////////////////////// namespace Catch { struct FatalConditionHandler { void reset() {} }; } // namespace Catch #else // Not Windows - assumed to be POSIX compatible ////////////////////////// #include namespace Catch { struct SignalDefs { int id; const char* name; }; extern SignalDefs signalDefs[]; SignalDefs signalDefs[] = { { SIGINT, "SIGINT - Terminal interrupt signal" }, { SIGILL, "SIGILL - Illegal instruction signal" }, { SIGFPE, "SIGFPE - Floating point error signal" }, { SIGSEGV, "SIGSEGV - Segmentation violation signal" }, { SIGTERM, "SIGTERM - Termination request signal" }, { SIGABRT, "SIGABRT - Abort (abnormal termination) signal" } }; struct FatalConditionHandler { static void handleSignal( int sig ) { for( std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i ) if( sig == signalDefs[i].id ) fatal( signalDefs[i].name, -sig ); fatal( "", -sig ); } FatalConditionHandler() : m_isSet( true ) { for( std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i ) signal( signalDefs[i].id, handleSignal ); } ~FatalConditionHandler() { reset(); } void reset() { if( m_isSet ) { for( std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i ) signal( signalDefs[i].id, SIG_DFL ); m_isSet = false; } } bool m_isSet; }; } // namespace Catch #endif // not Windows #include #include namespace Catch { class StreamRedirect { public: StreamRedirect( std::ostream& stream, std::string& targetString ) : m_stream( stream ), m_prevBuf( stream.rdbuf() ), m_targetString( targetString ) { stream.rdbuf( m_oss.rdbuf() ); } ~StreamRedirect() { m_targetString += m_oss.str(); m_stream.rdbuf( m_prevBuf ); } private: std::ostream& m_stream; std::streambuf* m_prevBuf; std::ostringstream m_oss; std::string& m_targetString; }; /////////////////////////////////////////////////////////////////////////// class RunContext : public IResultCapture, public IRunner { RunContext( RunContext const& ); void operator =( RunContext const& ); public: explicit RunContext( Ptr const& _config, Ptr const& reporter ) : m_runInfo( _config->name() ), m_context( getCurrentMutableContext() ), m_activeTestCase( CATCH_NULL ), m_config( _config ), m_reporter( reporter ) { m_context.setRunner( this ); m_context.setConfig( m_config ); m_context.setResultCapture( this ); m_reporter->testRunStarting( m_runInfo ); } virtual ~RunContext() { m_reporter->testRunEnded( TestRunStats( m_runInfo, m_totals, aborting() ) ); } void testGroupStarting( std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount ) { m_reporter->testGroupStarting( GroupInfo( testSpec, groupIndex, groupsCount ) ); } void testGroupEnded( std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount ) { m_reporter->testGroupEnded( TestGroupStats( GroupInfo( testSpec, groupIndex, groupsCount ), totals, aborting() ) ); } Totals runTest( TestCase const& testCase ) { Totals prevTotals = m_totals; std::string redirectedCout; std::string redirectedCerr; TestCaseInfo testInfo = testCase.getTestCaseInfo(); m_reporter->testCaseStarting( testInfo ); m_activeTestCase = &testCase; do { m_trackerContext.startRun(); do { m_trackerContext.startCycle(); m_testCaseTracker = &SectionTracker::acquire( m_trackerContext, testInfo.name ); runCurrentTest( redirectedCout, redirectedCerr ); } while( !m_testCaseTracker->isSuccessfullyCompleted() && !aborting() ); } // !TBD: deprecated - this will be replaced by indexed trackers while( getCurrentContext().advanceGeneratorsForCurrentTest() && !aborting() ); Totals deltaTotals = m_totals.delta( prevTotals ); m_totals.testCases += deltaTotals.testCases; m_reporter->testCaseEnded( TestCaseStats( testInfo, deltaTotals, redirectedCout, redirectedCerr, aborting() ) ); m_activeTestCase = CATCH_NULL; m_testCaseTracker = CATCH_NULL; return deltaTotals; } Ptr config() const { return m_config; } private: // IResultCapture virtual void assertionEnded( AssertionResult const& result ) { if( result.getResultType() == ResultWas::Ok ) { m_totals.assertions.passed++; } else if( !result.isOk() ) { m_totals.assertions.failed++; } if( m_reporter->assertionEnded( AssertionStats( result, m_messages, m_totals ) ) ) m_messages.clear(); // Reset working state m_lastAssertionInfo = AssertionInfo( "", m_lastAssertionInfo.lineInfo, "{Unknown expression after the reported line}" , m_lastAssertionInfo.resultDisposition ); m_lastResult = result; } virtual bool sectionStarted ( SectionInfo const& sectionInfo, Counts& assertions ) { std::ostringstream oss; oss << sectionInfo.name << "@" << sectionInfo.lineInfo; ITracker& sectionTracker = SectionTracker::acquire( m_trackerContext, oss.str() ); if( !sectionTracker.isOpen() ) return false; m_activeSections.push_back( §ionTracker ); m_lastAssertionInfo.lineInfo = sectionInfo.lineInfo; m_reporter->sectionStarting( sectionInfo ); assertions = m_totals.assertions; return true; } bool testForMissingAssertions( Counts& assertions ) { if( assertions.total() != 0 ) return false; if( !m_config->warnAboutMissingAssertions() ) return false; if( m_trackerContext.currentTracker().hasChildren() ) return false; m_totals.assertions.failed++; assertions.failed++; return true; } virtual void sectionEnded( SectionEndInfo const& endInfo ) { Counts assertions = m_totals.assertions - endInfo.prevAssertions; bool missingAssertions = testForMissingAssertions( assertions ); if( !m_activeSections.empty() ) { m_activeSections.back()->close(); m_activeSections.pop_back(); } m_reporter->sectionEnded( SectionStats( endInfo.sectionInfo, assertions, endInfo.durationInSeconds, missingAssertions ) ); m_messages.clear(); } virtual void sectionEndedEarly( SectionEndInfo const& endInfo ) { if( m_unfinishedSections.empty() ) m_activeSections.back()->fail(); else m_activeSections.back()->close(); m_activeSections.pop_back(); m_unfinishedSections.push_back( endInfo ); } virtual void pushScopedMessage( MessageInfo const& message ) { m_messages.push_back( message ); } virtual void popScopedMessage( MessageInfo const& message ) { m_messages.erase( std::remove( m_messages.begin(), m_messages.end(), message ), m_messages.end() ); } virtual std::string getCurrentTestName() const { return m_activeTestCase ? m_activeTestCase->getTestCaseInfo().name : ""; } virtual const AssertionResult* getLastResult() const { return &m_lastResult; } virtual void handleFatalErrorCondition( std::string const& message ) { ResultBuilder resultBuilder = makeUnexpectedResultBuilder(); resultBuilder.setResultType( ResultWas::FatalErrorCondition ); resultBuilder << message; resultBuilder.captureExpression(); handleUnfinishedSections(); // Recreate section for test case (as we will lose the one that was in scope) TestCaseInfo const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); SectionInfo testCaseSection( testCaseInfo.lineInfo, testCaseInfo.name, testCaseInfo.description ); Counts assertions; assertions.failed = 1; SectionStats testCaseSectionStats( testCaseSection, assertions, 0, false ); m_reporter->sectionEnded( testCaseSectionStats ); TestCaseInfo testInfo = m_activeTestCase->getTestCaseInfo(); Totals deltaTotals; deltaTotals.testCases.failed = 1; m_reporter->testCaseEnded( TestCaseStats( testInfo, deltaTotals, "", "", false ) ); m_totals.testCases.failed++; testGroupEnded( "", m_totals, 1, 1 ); m_reporter->testRunEnded( TestRunStats( m_runInfo, m_totals, false ) ); } public: // !TBD We need to do this another way! bool aborting() const { return m_totals.assertions.failed == static_cast( m_config->abortAfter() ); } private: void runCurrentTest( std::string& redirectedCout, std::string& redirectedCerr ) { TestCaseInfo const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); SectionInfo testCaseSection( testCaseInfo.lineInfo, testCaseInfo.name, testCaseInfo.description ); m_reporter->sectionStarting( testCaseSection ); Counts prevAssertions = m_totals.assertions; double duration = 0; try { m_lastAssertionInfo = AssertionInfo( "TEST_CASE", testCaseInfo.lineInfo, "", ResultDisposition::Normal ); seedRng( *m_config ); Timer timer; timer.start(); if( m_reporter->getPreferences().shouldRedirectStdOut ) { StreamRedirect coutRedir( Catch::cout(), redirectedCout ); StreamRedirect cerrRedir( Catch::cerr(), redirectedCerr ); invokeActiveTestCase(); } else { invokeActiveTestCase(); } duration = timer.getElapsedSeconds(); } catch( TestFailureException& ) { // This just means the test was aborted due to failure } catch(...) { makeUnexpectedResultBuilder().useActiveException(); } m_testCaseTracker->close(); handleUnfinishedSections(); m_messages.clear(); Counts assertions = m_totals.assertions - prevAssertions; bool missingAssertions = testForMissingAssertions( assertions ); if( testCaseInfo.okToFail() ) { std::swap( assertions.failedButOk, assertions.failed ); m_totals.assertions.failed -= assertions.failedButOk; m_totals.assertions.failedButOk += assertions.failedButOk; } SectionStats testCaseSectionStats( testCaseSection, assertions, duration, missingAssertions ); m_reporter->sectionEnded( testCaseSectionStats ); } void invokeActiveTestCase() { FatalConditionHandler fatalConditionHandler; // Handle signals m_activeTestCase->invoke(); fatalConditionHandler.reset(); } private: ResultBuilder makeUnexpectedResultBuilder() const { return ResultBuilder( m_lastAssertionInfo.macroName.c_str(), m_lastAssertionInfo.lineInfo, m_lastAssertionInfo.capturedExpression.c_str(), m_lastAssertionInfo.resultDisposition ); } void handleUnfinishedSections() { // If sections ended prematurely due to an exception we stored their // infos here so we can tear them down outside the unwind process. for( std::vector::const_reverse_iterator it = m_unfinishedSections.rbegin(), itEnd = m_unfinishedSections.rend(); it != itEnd; ++it ) sectionEnded( *it ); m_unfinishedSections.clear(); } TestRunInfo m_runInfo; IMutableContext& m_context; TestCase const* m_activeTestCase; ITracker* m_testCaseTracker; ITracker* m_currentSectionTracker; AssertionResult m_lastResult; Ptr m_config; Totals m_totals; Ptr m_reporter; std::vector m_messages; AssertionInfo m_lastAssertionInfo; std::vector m_unfinishedSections; std::vector m_activeSections; TrackerContext m_trackerContext; }; IResultCapture& getResultCapture() { if( IResultCapture* capture = getCurrentContext().getResultCapture() ) return *capture; else throw std::logic_error( "No result capture instance" ); } } // end namespace Catch // #included from: internal/catch_version.h #define TWOBLUECUBES_CATCH_VERSION_H_INCLUDED namespace Catch { // Versioning information struct Version { Version( unsigned int _majorVersion, unsigned int _minorVersion, unsigned int _patchNumber, std::string const& _branchName, unsigned int _buildNumber ); unsigned int const majorVersion; unsigned int const minorVersion; unsigned int const patchNumber; // buildNumber is only used if branchName is not null std::string const branchName; unsigned int const buildNumber; friend std::ostream& operator << ( std::ostream& os, Version const& version ); private: void operator=( Version const& ); }; extern Version libraryVersion; } #include #include #include namespace Catch { Ptr createReporter( std::string const& reporterName, Ptr const& config ) { Ptr reporter = getRegistryHub().getReporterRegistry().create( reporterName, config.get() ); if( !reporter ) { std::ostringstream oss; oss << "No reporter registered with name: '" << reporterName << "'"; throw std::domain_error( oss.str() ); } return reporter; } Ptr makeReporter( Ptr const& config ) { std::vector reporters = config->getReporterNames(); if( reporters.empty() ) reporters.push_back( "console" ); Ptr reporter; for( std::vector::const_iterator it = reporters.begin(), itEnd = reporters.end(); it != itEnd; ++it ) reporter = addReporter( reporter, createReporter( *it, config ) ); return reporter; } Ptr addListeners( Ptr const& config, Ptr reporters ) { IReporterRegistry::Listeners listeners = getRegistryHub().getReporterRegistry().getListeners(); for( IReporterRegistry::Listeners::const_iterator it = listeners.begin(), itEnd = listeners.end(); it != itEnd; ++it ) reporters = addReporter(reporters, (*it)->create( ReporterConfig( config ) ) ); return reporters; } Totals runTests( Ptr const& config ) { Ptr iconfig = config.get(); Ptr reporter = makeReporter( config ); reporter = addListeners( iconfig, reporter ); RunContext context( iconfig, reporter ); Totals totals; context.testGroupStarting( config->name(), 1, 1 ); TestSpec testSpec = config->testSpec(); if( !testSpec.hasFilters() ) testSpec = TestSpecParser( ITagAliasRegistry::get() ).parse( "~[.]" ).testSpec(); // All not hidden tests std::vector const& allTestCases = getAllTestCasesSorted( *iconfig ); for( std::vector::const_iterator it = allTestCases.begin(), itEnd = allTestCases.end(); it != itEnd; ++it ) { if( !context.aborting() && matchTest( *it, testSpec, *iconfig ) ) totals += context.runTest( *it ); else reporter->skipTest( *it ); } context.testGroupEnded( iconfig->name(), totals, 1, 1 ); return totals; } void applyFilenamesAsTags( IConfig const& config ) { std::vector const& tests = getAllTestCasesSorted( config ); for(std::size_t i = 0; i < tests.size(); ++i ) { TestCase& test = const_cast( tests[i] ); std::set tags = test.tags; std::string filename = test.lineInfo.file; std::string::size_type lastSlash = filename.find_last_of( "\\/" ); if( lastSlash != std::string::npos ) filename = filename.substr( lastSlash+1 ); std::string::size_type lastDot = filename.find_last_of( "." ); if( lastDot != std::string::npos ) filename = filename.substr( 0, lastDot ); tags.insert( "#" + filename ); setTags( test, tags ); } } class Session : NonCopyable { static bool alreadyInstantiated; public: struct OnUnusedOptions { enum DoWhat { Ignore, Fail }; }; Session() : m_cli( makeCommandLineParser() ) { if( alreadyInstantiated ) { std::string msg = "Only one instance of Catch::Session can ever be used"; Catch::cerr() << msg << std::endl; throw std::logic_error( msg ); } alreadyInstantiated = true; } ~Session() { Catch::cleanUp(); } void showHelp( std::string const& processName ) { Catch::cout() << "\nCatch v" << libraryVersion << "\n"; m_cli.usage( Catch::cout(), processName ); Catch::cout() << "For more detail usage please see the project docs\n" << std::endl; } int applyCommandLine( int argc, char const* const argv[], OnUnusedOptions::DoWhat unusedOptionBehaviour = OnUnusedOptions::Fail ) { try { m_cli.setThrowOnUnrecognisedTokens( unusedOptionBehaviour == OnUnusedOptions::Fail ); m_unusedTokens = m_cli.parseInto( argc, argv, m_configData ); if( m_configData.showHelp ) showHelp( m_configData.processName ); m_config.reset(); } catch( std::exception& ex ) { { Colour colourGuard( Colour::Red ); Catch::cerr() << "\nError(s) in input:\n" << Text( ex.what(), TextAttributes().setIndent(2) ) << "\n\n"; } m_cli.usage( Catch::cout(), m_configData.processName ); return (std::numeric_limits::max)(); } return 0; } void useConfigData( ConfigData const& _configData ) { m_configData = _configData; m_config.reset(); } int run( int argc, char const* const argv[] ) { int returnCode = applyCommandLine( argc, argv ); if( returnCode == 0 ) returnCode = run(); return returnCode; } int run() { if( m_configData.showHelp ) return 0; try { config(); // Force config to be constructed seedRng( *m_config ); if( m_configData.filenamesAsTags ) applyFilenamesAsTags( *m_config ); // Handle list request if( Option listed = list( config() ) ) return static_cast( *listed ); return static_cast( runTests( m_config ).assertions.failed ); } catch( std::exception& ex ) { Catch::cerr() << ex.what() << std::endl; return (std::numeric_limits::max)(); } } Clara::CommandLine const& cli() const { return m_cli; } std::vector const& unusedTokens() const { return m_unusedTokens; } ConfigData& configData() { return m_configData; } Config& config() { if( !m_config ) m_config = new Config( m_configData ); return *m_config; } private: Clara::CommandLine m_cli; std::vector m_unusedTokens; ConfigData m_configData; Ptr m_config; }; bool Session::alreadyInstantiated = false; } // end namespace Catch // #included from: catch_registry_hub.hpp #define TWOBLUECUBES_CATCH_REGISTRY_HUB_HPP_INCLUDED // #included from: catch_test_case_registry_impl.hpp #define TWOBLUECUBES_CATCH_TEST_CASE_REGISTRY_IMPL_HPP_INCLUDED #include #include #include #include #include namespace Catch { struct LexSort { bool operator() (TestCase i,TestCase j) const { return (i sortTests( IConfig const& config, std::vector const& unsortedTestCases ) { std::vector sorted = unsortedTestCases; switch( config.runOrder() ) { case RunTests::InLexicographicalOrder: std::sort( sorted.begin(), sorted.end(), LexSort() ); break; case RunTests::InRandomOrder: { seedRng( config ); RandomNumberGenerator rng; std::random_shuffle( sorted.begin(), sorted.end(), rng ); } break; case RunTests::InDeclarationOrder: // already in declaration order break; } return sorted; } bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ) { return testSpec.matches( testCase ) && ( config.allowThrows() || !testCase.throws() ); } void enforceNoDuplicateTestCases( std::vector const& functions ) { std::set seenFunctions; for( std::vector::const_iterator it = functions.begin(), itEnd = functions.end(); it != itEnd; ++it ) { std::pair::const_iterator, bool> prev = seenFunctions.insert( *it ); if( !prev.second ){ Catch::cerr() << Colour( Colour::Red ) << "error: TEST_CASE( \"" << it->name << "\" ) already defined.\n" << "\tFirst seen at " << prev.first->getTestCaseInfo().lineInfo << "\n" << "\tRedefined at " << it->getTestCaseInfo().lineInfo << std::endl; exit(1); } } } std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ) { std::vector filtered; filtered.reserve( testCases.size() ); for( std::vector::const_iterator it = testCases.begin(), itEnd = testCases.end(); it != itEnd; ++it ) if( matchTest( *it, testSpec, config ) ) filtered.push_back( *it ); return filtered; } std::vector const& getAllTestCasesSorted( IConfig const& config ) { return getRegistryHub().getTestCaseRegistry().getAllTestsSorted( config ); } class TestRegistry : public ITestCaseRegistry { public: TestRegistry() : m_unnamedCount( 0 ) {} virtual ~TestRegistry(); virtual void registerTest( TestCase const& testCase ) { std::string name = testCase.getTestCaseInfo().name; if( name == "" ) { std::ostringstream oss; oss << "Anonymous test case " << ++m_unnamedCount; return registerTest( testCase.withName( oss.str() ) ); } m_functions.push_back( testCase ); } virtual std::vector const& getAllTests() const { return m_functions; } virtual std::vector const& getAllTestsSorted( IConfig const& config ) const { if( m_sortedFunctions.empty() ) enforceNoDuplicateTestCases( m_functions ); if( m_currentSortOrder != config.runOrder() || m_sortedFunctions.empty() ) { m_sortedFunctions = sortTests( config, m_functions ); m_currentSortOrder = config.runOrder(); } return m_sortedFunctions; } private: std::vector m_functions; mutable RunTests::InWhatOrder m_currentSortOrder; mutable std::vector m_sortedFunctions; size_t m_unnamedCount; std::ios_base::Init m_ostreamInit; // Forces cout/ cerr to be initialised }; /////////////////////////////////////////////////////////////////////////// class FreeFunctionTestCase : public SharedImpl { public: FreeFunctionTestCase( TestFunction fun ) : m_fun( fun ) {} virtual void invoke() const { m_fun(); } private: virtual ~FreeFunctionTestCase(); TestFunction m_fun; }; inline std::string extractClassName( std::string const& classOrQualifiedMethodName ) { std::string className = classOrQualifiedMethodName; if( startsWith( className, "&" ) ) { std::size_t lastColons = className.rfind( "::" ); std::size_t penultimateColons = className.rfind( "::", lastColons-1 ); if( penultimateColons == std::string::npos ) penultimateColons = 1; className = className.substr( penultimateColons, lastColons-penultimateColons ); } return className; } void registerTestCase ( ITestCase* testCase, char const* classOrQualifiedMethodName, NameAndDesc const& nameAndDesc, SourceLineInfo const& lineInfo ) { getMutableRegistryHub().registerTest ( makeTestCase ( testCase, extractClassName( classOrQualifiedMethodName ), nameAndDesc.name, nameAndDesc.description, lineInfo ) ); } void registerTestCaseFunction ( TestFunction function, SourceLineInfo const& lineInfo, NameAndDesc const& nameAndDesc ) { registerTestCase( new FreeFunctionTestCase( function ), "", nameAndDesc, lineInfo ); } /////////////////////////////////////////////////////////////////////////// AutoReg::AutoReg ( TestFunction function, SourceLineInfo const& lineInfo, NameAndDesc const& nameAndDesc ) { registerTestCaseFunction( function, lineInfo, nameAndDesc ); } AutoReg::~AutoReg() {} } // end namespace Catch // #included from: catch_reporter_registry.hpp #define TWOBLUECUBES_CATCH_REPORTER_REGISTRY_HPP_INCLUDED #include namespace Catch { class ReporterRegistry : public IReporterRegistry { public: virtual ~ReporterRegistry() CATCH_OVERRIDE {} virtual IStreamingReporter* create( std::string const& name, Ptr const& config ) const CATCH_OVERRIDE { FactoryMap::const_iterator it = m_factories.find( name ); if( it == m_factories.end() ) return CATCH_NULL; return it->second->create( ReporterConfig( config ) ); } void registerReporter( std::string const& name, Ptr const& factory ) { m_factories.insert( std::make_pair( name, factory ) ); } void registerListener( Ptr const& factory ) { m_listeners.push_back( factory ); } virtual FactoryMap const& getFactories() const CATCH_OVERRIDE { return m_factories; } virtual Listeners const& getListeners() const CATCH_OVERRIDE { return m_listeners; } private: FactoryMap m_factories; Listeners m_listeners; }; } // #included from: catch_exception_translator_registry.hpp #define TWOBLUECUBES_CATCH_EXCEPTION_TRANSLATOR_REGISTRY_HPP_INCLUDED #ifdef __OBJC__ #import "Foundation/Foundation.h" #endif namespace Catch { class ExceptionTranslatorRegistry : public IExceptionTranslatorRegistry { public: ~ExceptionTranslatorRegistry() { deleteAll( m_translators ); } virtual void registerTranslator( const IExceptionTranslator* translator ) { m_translators.push_back( translator ); } virtual std::string translateActiveException() const { try { #ifdef __OBJC__ // In Objective-C try objective-c exceptions first @try { return tryTranslators(); } @catch (NSException *exception) { return Catch::toString( [exception description] ); } #else return tryTranslators(); #endif } catch( TestFailureException& ) { throw; } catch( std::exception& ex ) { return ex.what(); } catch( std::string& msg ) { return msg; } catch( const char* msg ) { return msg; } catch(...) { return "Unknown exception"; } } std::string tryTranslators() const { if( m_translators.empty() ) throw; else return m_translators[0]->translate( m_translators.begin()+1, m_translators.end() ); } private: std::vector m_translators; }; } namespace Catch { namespace { class RegistryHub : public IRegistryHub, public IMutableRegistryHub { RegistryHub( RegistryHub const& ); void operator=( RegistryHub const& ); public: // IRegistryHub RegistryHub() { } virtual IReporterRegistry const& getReporterRegistry() const CATCH_OVERRIDE { return m_reporterRegistry; } virtual ITestCaseRegistry const& getTestCaseRegistry() const CATCH_OVERRIDE { return m_testCaseRegistry; } virtual IExceptionTranslatorRegistry& getExceptionTranslatorRegistry() CATCH_OVERRIDE { return m_exceptionTranslatorRegistry; } public: // IMutableRegistryHub virtual void registerReporter( std::string const& name, Ptr const& factory ) CATCH_OVERRIDE { m_reporterRegistry.registerReporter( name, factory ); } virtual void registerListener( Ptr const& factory ) CATCH_OVERRIDE { m_reporterRegistry.registerListener( factory ); } virtual void registerTest( TestCase const& testInfo ) CATCH_OVERRIDE { m_testCaseRegistry.registerTest( testInfo ); } virtual void registerTranslator( const IExceptionTranslator* translator ) CATCH_OVERRIDE { m_exceptionTranslatorRegistry.registerTranslator( translator ); } private: TestRegistry m_testCaseRegistry; ReporterRegistry m_reporterRegistry; ExceptionTranslatorRegistry m_exceptionTranslatorRegistry; }; // Single, global, instance inline RegistryHub*& getTheRegistryHub() { static RegistryHub* theRegistryHub = CATCH_NULL; if( !theRegistryHub ) theRegistryHub = new RegistryHub(); return theRegistryHub; } } IRegistryHub& getRegistryHub() { return *getTheRegistryHub(); } IMutableRegistryHub& getMutableRegistryHub() { return *getTheRegistryHub(); } void cleanUp() { delete getTheRegistryHub(); getTheRegistryHub() = CATCH_NULL; cleanUpContext(); } std::string translateActiveException() { return getRegistryHub().getExceptionTranslatorRegistry().translateActiveException(); } } // end namespace Catch // #included from: catch_notimplemented_exception.hpp #define TWOBLUECUBES_CATCH_NOTIMPLEMENTED_EXCEPTION_HPP_INCLUDED #include namespace Catch { NotImplementedException::NotImplementedException( SourceLineInfo const& lineInfo ) : m_lineInfo( lineInfo ) { std::ostringstream oss; oss << lineInfo << ": function "; oss << "not implemented"; m_what = oss.str(); } const char* NotImplementedException::what() const CATCH_NOEXCEPT { return m_what.c_str(); } } // end namespace Catch // #included from: catch_context_impl.hpp #define TWOBLUECUBES_CATCH_CONTEXT_IMPL_HPP_INCLUDED // #included from: catch_stream.hpp #define TWOBLUECUBES_CATCH_STREAM_HPP_INCLUDED #include #include #include namespace Catch { template class StreamBufImpl : public StreamBufBase { char data[bufferSize]; WriterF m_writer; public: StreamBufImpl() { setp( data, data + sizeof(data) ); } ~StreamBufImpl() CATCH_NOEXCEPT { sync(); } private: int overflow( int c ) { sync(); if( c != EOF ) { if( pbase() == epptr() ) m_writer( std::string( 1, static_cast( c ) ) ); else sputc( static_cast( c ) ); } return 0; } int sync() { if( pbase() != pptr() ) { m_writer( std::string( pbase(), static_cast( pptr() - pbase() ) ) ); setp( pbase(), epptr() ); } return 0; } }; /////////////////////////////////////////////////////////////////////////// FileStream::FileStream( std::string const& filename ) { m_ofs.open( filename.c_str() ); if( m_ofs.fail() ) { std::ostringstream oss; oss << "Unable to open file: '" << filename << "'"; throw std::domain_error( oss.str() ); } } std::ostream& FileStream::stream() const { return m_ofs; } struct OutputDebugWriter { void operator()( std::string const&str ) { writeToDebugConsole( str ); } }; DebugOutStream::DebugOutStream() : m_streamBuf( new StreamBufImpl() ), m_os( m_streamBuf.get() ) {} std::ostream& DebugOutStream::stream() const { return m_os; } // Store the streambuf from cout up-front because // cout may get redirected when running tests CoutStream::CoutStream() : m_os( Catch::cout().rdbuf() ) {} std::ostream& CoutStream::stream() const { return m_os; } #ifndef CATCH_CONFIG_NOSTDOUT // If you #define this you must implement these functions std::ostream& cout() { return std::cout; } std::ostream& cerr() { return std::cerr; } #endif } namespace Catch { class Context : public IMutableContext { Context() : m_config( CATCH_NULL ), m_runner( CATCH_NULL ), m_resultCapture( CATCH_NULL ) {} Context( Context const& ); void operator=( Context const& ); public: // IContext virtual IResultCapture* getResultCapture() { return m_resultCapture; } virtual IRunner* getRunner() { return m_runner; } virtual size_t getGeneratorIndex( std::string const& fileInfo, size_t totalSize ) { return getGeneratorsForCurrentTest() .getGeneratorInfo( fileInfo, totalSize ) .getCurrentIndex(); } virtual bool advanceGeneratorsForCurrentTest() { IGeneratorsForTest* generators = findGeneratorsForCurrentTest(); return generators && generators->moveNext(); } virtual Ptr getConfig() const { return m_config; } public: // IMutableContext virtual void setResultCapture( IResultCapture* resultCapture ) { m_resultCapture = resultCapture; } virtual void setRunner( IRunner* runner ) { m_runner = runner; } virtual void setConfig( Ptr const& config ) { m_config = config; } friend IMutableContext& getCurrentMutableContext(); private: IGeneratorsForTest* findGeneratorsForCurrentTest() { std::string testName = getResultCapture()->getCurrentTestName(); std::map::const_iterator it = m_generatorsByTestName.find( testName ); return it != m_generatorsByTestName.end() ? it->second : CATCH_NULL; } IGeneratorsForTest& getGeneratorsForCurrentTest() { IGeneratorsForTest* generators = findGeneratorsForCurrentTest(); if( !generators ) { std::string testName = getResultCapture()->getCurrentTestName(); generators = createGeneratorsForTest(); m_generatorsByTestName.insert( std::make_pair( testName, generators ) ); } return *generators; } private: Ptr m_config; IRunner* m_runner; IResultCapture* m_resultCapture; std::map m_generatorsByTestName; }; namespace { Context* currentContext = CATCH_NULL; } IMutableContext& getCurrentMutableContext() { if( !currentContext ) currentContext = new Context(); return *currentContext; } IContext& getCurrentContext() { return getCurrentMutableContext(); } void cleanUpContext() { delete currentContext; currentContext = CATCH_NULL; } } // #included from: catch_console_colour_impl.hpp #define TWOBLUECUBES_CATCH_CONSOLE_COLOUR_IMPL_HPP_INCLUDED namespace Catch { namespace { struct IColourImpl { virtual ~IColourImpl() {} virtual void use( Colour::Code _colourCode ) = 0; }; struct NoColourImpl : IColourImpl { void use( Colour::Code ) {} static IColourImpl* instance() { static NoColourImpl s_instance; return &s_instance; } }; } // anon namespace } // namespace Catch #if !defined( CATCH_CONFIG_COLOUR_NONE ) && !defined( CATCH_CONFIG_COLOUR_WINDOWS ) && !defined( CATCH_CONFIG_COLOUR_ANSI ) # ifdef CATCH_PLATFORM_WINDOWS # define CATCH_CONFIG_COLOUR_WINDOWS # else # define CATCH_CONFIG_COLOUR_ANSI # endif #endif #if defined ( CATCH_CONFIG_COLOUR_WINDOWS ) ///////////////////////////////////////// #ifndef NOMINMAX #define NOMINMAX #endif #ifdef __AFXDLL #include #else #include #endif namespace Catch { namespace { class Win32ColourImpl : public IColourImpl { public: Win32ColourImpl() : stdoutHandle( GetStdHandle(STD_OUTPUT_HANDLE) ) { CONSOLE_SCREEN_BUFFER_INFO csbiInfo; GetConsoleScreenBufferInfo( stdoutHandle, &csbiInfo ); originalForegroundAttributes = csbiInfo.wAttributes & ~( BACKGROUND_GREEN | BACKGROUND_RED | BACKGROUND_BLUE | BACKGROUND_INTENSITY ); originalBackgroundAttributes = csbiInfo.wAttributes & ~( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE | FOREGROUND_INTENSITY ); } virtual void use( Colour::Code _colourCode ) { switch( _colourCode ) { case Colour::None: return setTextAttribute( originalForegroundAttributes ); case Colour::White: return setTextAttribute( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); case Colour::Red: return setTextAttribute( FOREGROUND_RED ); case Colour::Green: return setTextAttribute( FOREGROUND_GREEN ); case Colour::Blue: return setTextAttribute( FOREGROUND_BLUE ); case Colour::Cyan: return setTextAttribute( FOREGROUND_BLUE | FOREGROUND_GREEN ); case Colour::Yellow: return setTextAttribute( FOREGROUND_RED | FOREGROUND_GREEN ); case Colour::Grey: return setTextAttribute( 0 ); case Colour::LightGrey: return setTextAttribute( FOREGROUND_INTENSITY ); case Colour::BrightRed: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED ); case Colour::BrightGreen: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN ); case Colour::BrightWhite: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); case Colour::Bright: throw std::logic_error( "not a colour" ); } } private: void setTextAttribute( WORD _textAttribute ) { SetConsoleTextAttribute( stdoutHandle, _textAttribute | originalBackgroundAttributes ); } HANDLE stdoutHandle; WORD originalForegroundAttributes; WORD originalBackgroundAttributes; }; IColourImpl* platformColourInstance() { static Win32ColourImpl s_instance; return &s_instance; } } // end anon namespace } // end namespace Catch #elif defined( CATCH_CONFIG_COLOUR_ANSI ) ////////////////////////////////////// #include namespace Catch { namespace { // use POSIX/ ANSI console terminal codes // Thanks to Adam Strzelecki for original contribution // (http://github.com/nanoant) // https://github.com/philsquared/Catch/pull/131 class PosixColourImpl : public IColourImpl { public: virtual void use( Colour::Code _colourCode ) { switch( _colourCode ) { case Colour::None: case Colour::White: return setColour( "[0m" ); case Colour::Red: return setColour( "[0;31m" ); case Colour::Green: return setColour( "[0;32m" ); case Colour::Blue: return setColour( "[0:34m" ); case Colour::Cyan: return setColour( "[0;36m" ); case Colour::Yellow: return setColour( "[0;33m" ); case Colour::Grey: return setColour( "[1;30m" ); case Colour::LightGrey: return setColour( "[0;37m" ); case Colour::BrightRed: return setColour( "[1;31m" ); case Colour::BrightGreen: return setColour( "[1;32m" ); case Colour::BrightWhite: return setColour( "[1;37m" ); case Colour::Bright: throw std::logic_error( "not a colour" ); } } static IColourImpl* instance() { static PosixColourImpl s_instance; return &s_instance; } private: void setColour( const char* _escapeCode ) { Catch::cout() << '\033' << _escapeCode; } }; IColourImpl* platformColourInstance() { Ptr config = getCurrentContext().getConfig(); return (config && config->forceColour()) || isatty(STDOUT_FILENO) ? PosixColourImpl::instance() : NoColourImpl::instance(); } } // end anon namespace } // end namespace Catch #else // not Windows or ANSI /////////////////////////////////////////////// namespace Catch { static IColourImpl* platformColourInstance() { return NoColourImpl::instance(); } } // end namespace Catch #endif // Windows/ ANSI/ None namespace Catch { Colour::Colour( Code _colourCode ) : m_moved( false ) { use( _colourCode ); } Colour::Colour( Colour const& _other ) : m_moved( false ) { const_cast( _other ).m_moved = true; } Colour::~Colour(){ if( !m_moved ) use( None ); } void Colour::use( Code _colourCode ) { static IColourImpl* impl = isDebuggerActive() ? NoColourImpl::instance() : platformColourInstance(); impl->use( _colourCode ); } } // end namespace Catch // #included from: catch_generators_impl.hpp #define TWOBLUECUBES_CATCH_GENERATORS_IMPL_HPP_INCLUDED #include #include #include namespace Catch { struct GeneratorInfo : IGeneratorInfo { GeneratorInfo( std::size_t size ) : m_size( size ), m_currentIndex( 0 ) {} bool moveNext() { if( ++m_currentIndex == m_size ) { m_currentIndex = 0; return false; } return true; } std::size_t getCurrentIndex() const { return m_currentIndex; } std::size_t m_size; std::size_t m_currentIndex; }; /////////////////////////////////////////////////////////////////////////// class GeneratorsForTest : public IGeneratorsForTest { public: ~GeneratorsForTest() { deleteAll( m_generatorsInOrder ); } IGeneratorInfo& getGeneratorInfo( std::string const& fileInfo, std::size_t size ) { std::map::const_iterator it = m_generatorsByName.find( fileInfo ); if( it == m_generatorsByName.end() ) { IGeneratorInfo* info = new GeneratorInfo( size ); m_generatorsByName.insert( std::make_pair( fileInfo, info ) ); m_generatorsInOrder.push_back( info ); return *info; } return *it->second; } bool moveNext() { std::vector::const_iterator it = m_generatorsInOrder.begin(); std::vector::const_iterator itEnd = m_generatorsInOrder.end(); for(; it != itEnd; ++it ) { if( (*it)->moveNext() ) return true; } return false; } private: std::map m_generatorsByName; std::vector m_generatorsInOrder; }; IGeneratorsForTest* createGeneratorsForTest() { return new GeneratorsForTest(); } } // end namespace Catch // #included from: catch_assertionresult.hpp #define TWOBLUECUBES_CATCH_ASSERTIONRESULT_HPP_INCLUDED namespace Catch { AssertionInfo::AssertionInfo( std::string const& _macroName, SourceLineInfo const& _lineInfo, std::string const& _capturedExpression, ResultDisposition::Flags _resultDisposition ) : macroName( _macroName ), lineInfo( _lineInfo ), capturedExpression( _capturedExpression ), resultDisposition( _resultDisposition ) {} AssertionResult::AssertionResult() {} AssertionResult::AssertionResult( AssertionInfo const& info, AssertionResultData const& data ) : m_info( info ), m_resultData( data ) {} AssertionResult::~AssertionResult() {} // Result was a success bool AssertionResult::succeeded() const { return Catch::isOk( m_resultData.resultType ); } // Result was a success, or failure is suppressed bool AssertionResult::isOk() const { return Catch::isOk( m_resultData.resultType ) || shouldSuppressFailure( m_info.resultDisposition ); } ResultWas::OfType AssertionResult::getResultType() const { return m_resultData.resultType; } bool AssertionResult::hasExpression() const { return !m_info.capturedExpression.empty(); } bool AssertionResult::hasMessage() const { return !m_resultData.message.empty(); } std::string AssertionResult::getExpression() const { if( isFalseTest( m_info.resultDisposition ) ) return "!" + m_info.capturedExpression; else return m_info.capturedExpression; } std::string AssertionResult::getExpressionInMacro() const { if( m_info.macroName.empty() ) return m_info.capturedExpression; else return m_info.macroName + "( " + m_info.capturedExpression + " )"; } bool AssertionResult::hasExpandedExpression() const { return hasExpression() && getExpandedExpression() != getExpression(); } std::string AssertionResult::getExpandedExpression() const { return m_resultData.reconstructedExpression; } std::string AssertionResult::getMessage() const { return m_resultData.message; } SourceLineInfo AssertionResult::getSourceInfo() const { return m_info.lineInfo; } std::string AssertionResult::getTestMacroName() const { return m_info.macroName; } } // end namespace Catch // #included from: catch_test_case_info.hpp #define TWOBLUECUBES_CATCH_TEST_CASE_INFO_HPP_INCLUDED namespace Catch { inline TestCaseInfo::SpecialProperties parseSpecialTag( std::string const& tag ) { if( startsWith( tag, "." ) || tag == "hide" || tag == "!hide" ) return TestCaseInfo::IsHidden; else if( tag == "!throws" ) return TestCaseInfo::Throws; else if( tag == "!shouldfail" ) return TestCaseInfo::ShouldFail; else if( tag == "!mayfail" ) return TestCaseInfo::MayFail; else return TestCaseInfo::None; } inline bool isReservedTag( std::string const& tag ) { return parseSpecialTag( tag ) == TestCaseInfo::None && tag.size() > 0 && !isalnum( tag[0] ); } inline void enforceNotReservedTag( std::string const& tag, SourceLineInfo const& _lineInfo ) { if( isReservedTag( tag ) ) { { Colour colourGuard( Colour::Red ); Catch::cerr() << "Tag name [" << tag << "] not allowed.\n" << "Tag names starting with non alpha-numeric characters are reserved\n"; } { Colour colourGuard( Colour::FileName ); Catch::cerr() << _lineInfo << std::endl; } exit(1); } } TestCase makeTestCase( ITestCase* _testCase, std::string const& _className, std::string const& _name, std::string const& _descOrTags, SourceLineInfo const& _lineInfo ) { bool isHidden( startsWith( _name, "./" ) ); // Legacy support // Parse out tags std::set tags; std::string desc, tag; bool inTag = false; for( std::size_t i = 0; i < _descOrTags.size(); ++i ) { char c = _descOrTags[i]; if( !inTag ) { if( c == '[' ) inTag = true; else desc += c; } else { if( c == ']' ) { TestCaseInfo::SpecialProperties prop = parseSpecialTag( tag ); if( prop == TestCaseInfo::IsHidden ) isHidden = true; else if( prop == TestCaseInfo::None ) enforceNotReservedTag( tag, _lineInfo ); tags.insert( tag ); tag.clear(); inTag = false; } else tag += c; } } if( isHidden ) { tags.insert( "hide" ); tags.insert( "." ); } TestCaseInfo info( _name, _className, desc, tags, _lineInfo ); return TestCase( _testCase, info ); } void setTags( TestCaseInfo& testCaseInfo, std::set const& tags ) { testCaseInfo.tags = tags; testCaseInfo.lcaseTags.clear(); std::ostringstream oss; for( std::set::const_iterator it = tags.begin(), itEnd = tags.end(); it != itEnd; ++it ) { oss << "[" << *it << "]"; std::string lcaseTag = toLower( *it ); testCaseInfo.properties = static_cast( testCaseInfo.properties | parseSpecialTag( lcaseTag ) ); testCaseInfo.lcaseTags.insert( lcaseTag ); } testCaseInfo.tagsAsString = oss.str(); } TestCaseInfo::TestCaseInfo( std::string const& _name, std::string const& _className, std::string const& _description, std::set const& _tags, SourceLineInfo const& _lineInfo ) : name( _name ), className( _className ), description( _description ), lineInfo( _lineInfo ), properties( None ) { setTags( *this, _tags ); } TestCaseInfo::TestCaseInfo( TestCaseInfo const& other ) : name( other.name ), className( other.className ), description( other.description ), tags( other.tags ), lcaseTags( other.lcaseTags ), tagsAsString( other.tagsAsString ), lineInfo( other.lineInfo ), properties( other.properties ) {} bool TestCaseInfo::isHidden() const { return ( properties & IsHidden ) != 0; } bool TestCaseInfo::throws() const { return ( properties & Throws ) != 0; } bool TestCaseInfo::okToFail() const { return ( properties & (ShouldFail | MayFail ) ) != 0; } bool TestCaseInfo::expectedToFail() const { return ( properties & (ShouldFail ) ) != 0; } TestCase::TestCase( ITestCase* testCase, TestCaseInfo const& info ) : TestCaseInfo( info ), test( testCase ) {} TestCase::TestCase( TestCase const& other ) : TestCaseInfo( other ), test( other.test ) {} TestCase TestCase::withName( std::string const& _newName ) const { TestCase other( *this ); other.name = _newName; return other; } void TestCase::swap( TestCase& other ) { test.swap( other.test ); name.swap( other.name ); className.swap( other.className ); description.swap( other.description ); tags.swap( other.tags ); lcaseTags.swap( other.lcaseTags ); tagsAsString.swap( other.tagsAsString ); std::swap( TestCaseInfo::properties, static_cast( other ).properties ); std::swap( lineInfo, other.lineInfo ); } void TestCase::invoke() const { test->invoke(); } bool TestCase::operator == ( TestCase const& other ) const { return test.get() == other.test.get() && name == other.name && className == other.className; } bool TestCase::operator < ( TestCase const& other ) const { return name < other.name; } TestCase& TestCase::operator = ( TestCase const& other ) { TestCase temp( other ); swap( temp ); return *this; } TestCaseInfo const& TestCase::getTestCaseInfo() const { return *this; } } // end namespace Catch // #included from: catch_version.hpp #define TWOBLUECUBES_CATCH_VERSION_HPP_INCLUDED namespace Catch { Version::Version ( unsigned int _majorVersion, unsigned int _minorVersion, unsigned int _patchNumber, std::string const& _branchName, unsigned int _buildNumber ) : majorVersion( _majorVersion ), minorVersion( _minorVersion ), patchNumber( _patchNumber ), branchName( _branchName ), buildNumber( _buildNumber ) {} std::ostream& operator << ( std::ostream& os, Version const& version ) { os << version.majorVersion << "." << version.minorVersion << "." << version.patchNumber; if( !version.branchName.empty() ) { os << "-" << version.branchName << "." << version.buildNumber; } return os; } Version libraryVersion( 1, 3, 0, "", 0 ); } // #included from: catch_message.hpp #define TWOBLUECUBES_CATCH_MESSAGE_HPP_INCLUDED namespace Catch { MessageInfo::MessageInfo( std::string const& _macroName, SourceLineInfo const& _lineInfo, ResultWas::OfType _type ) : macroName( _macroName ), lineInfo( _lineInfo ), type( _type ), sequence( ++globalCount ) {} // This may need protecting if threading support is added unsigned int MessageInfo::globalCount = 0; //////////////////////////////////////////////////////////////////////////// ScopedMessage::ScopedMessage( MessageBuilder const& builder ) : m_info( builder.m_info ) { m_info.message = builder.m_stream.str(); getResultCapture().pushScopedMessage( m_info ); } ScopedMessage::ScopedMessage( ScopedMessage const& other ) : m_info( other.m_info ) {} ScopedMessage::~ScopedMessage() { getResultCapture().popScopedMessage( m_info ); } } // end namespace Catch // #included from: catch_legacy_reporter_adapter.hpp #define TWOBLUECUBES_CATCH_LEGACY_REPORTER_ADAPTER_HPP_INCLUDED // #included from: catch_legacy_reporter_adapter.h #define TWOBLUECUBES_CATCH_LEGACY_REPORTER_ADAPTER_H_INCLUDED namespace Catch { // Deprecated struct IReporter : IShared { virtual ~IReporter(); virtual bool shouldRedirectStdout() const = 0; virtual void StartTesting() = 0; virtual void EndTesting( Totals const& totals ) = 0; virtual void StartGroup( std::string const& groupName ) = 0; virtual void EndGroup( std::string const& groupName, Totals const& totals ) = 0; virtual void StartTestCase( TestCaseInfo const& testInfo ) = 0; virtual void EndTestCase( TestCaseInfo const& testInfo, Totals const& totals, std::string const& stdOut, std::string const& stdErr ) = 0; virtual void StartSection( std::string const& sectionName, std::string const& description ) = 0; virtual void EndSection( std::string const& sectionName, Counts const& assertions ) = 0; virtual void NoAssertionsInSection( std::string const& sectionName ) = 0; virtual void NoAssertionsInTestCase( std::string const& testName ) = 0; virtual void Aborted() = 0; virtual void Result( AssertionResult const& result ) = 0; }; class LegacyReporterAdapter : public SharedImpl { public: LegacyReporterAdapter( Ptr const& legacyReporter ); virtual ~LegacyReporterAdapter(); virtual ReporterPreferences getPreferences() const; virtual void noMatchingTestCases( std::string const& ); virtual void testRunStarting( TestRunInfo const& ); virtual void testGroupStarting( GroupInfo const& groupInfo ); virtual void testCaseStarting( TestCaseInfo const& testInfo ); virtual void sectionStarting( SectionInfo const& sectionInfo ); virtual void assertionStarting( AssertionInfo const& ); virtual bool assertionEnded( AssertionStats const& assertionStats ); virtual void sectionEnded( SectionStats const& sectionStats ); virtual void testCaseEnded( TestCaseStats const& testCaseStats ); virtual void testGroupEnded( TestGroupStats const& testGroupStats ); virtual void testRunEnded( TestRunStats const& testRunStats ); virtual void skipTest( TestCaseInfo const& ); private: Ptr m_legacyReporter; }; } namespace Catch { LegacyReporterAdapter::LegacyReporterAdapter( Ptr const& legacyReporter ) : m_legacyReporter( legacyReporter ) {} LegacyReporterAdapter::~LegacyReporterAdapter() {} ReporterPreferences LegacyReporterAdapter::getPreferences() const { ReporterPreferences prefs; prefs.shouldRedirectStdOut = m_legacyReporter->shouldRedirectStdout(); return prefs; } void LegacyReporterAdapter::noMatchingTestCases( std::string const& ) {} void LegacyReporterAdapter::testRunStarting( TestRunInfo const& ) { m_legacyReporter->StartTesting(); } void LegacyReporterAdapter::testGroupStarting( GroupInfo const& groupInfo ) { m_legacyReporter->StartGroup( groupInfo.name ); } void LegacyReporterAdapter::testCaseStarting( TestCaseInfo const& testInfo ) { m_legacyReporter->StartTestCase( testInfo ); } void LegacyReporterAdapter::sectionStarting( SectionInfo const& sectionInfo ) { m_legacyReporter->StartSection( sectionInfo.name, sectionInfo.description ); } void LegacyReporterAdapter::assertionStarting( AssertionInfo const& ) { // Not on legacy interface } bool LegacyReporterAdapter::assertionEnded( AssertionStats const& assertionStats ) { if( assertionStats.assertionResult.getResultType() != ResultWas::Ok ) { for( std::vector::const_iterator it = assertionStats.infoMessages.begin(), itEnd = assertionStats.infoMessages.end(); it != itEnd; ++it ) { if( it->type == ResultWas::Info ) { ResultBuilder rb( it->macroName.c_str(), it->lineInfo, "", ResultDisposition::Normal ); rb << it->message; rb.setResultType( ResultWas::Info ); AssertionResult result = rb.build(); m_legacyReporter->Result( result ); } } } m_legacyReporter->Result( assertionStats.assertionResult ); return true; } void LegacyReporterAdapter::sectionEnded( SectionStats const& sectionStats ) { if( sectionStats.missingAssertions ) m_legacyReporter->NoAssertionsInSection( sectionStats.sectionInfo.name ); m_legacyReporter->EndSection( sectionStats.sectionInfo.name, sectionStats.assertions ); } void LegacyReporterAdapter::testCaseEnded( TestCaseStats const& testCaseStats ) { m_legacyReporter->EndTestCase ( testCaseStats.testInfo, testCaseStats.totals, testCaseStats.stdOut, testCaseStats.stdErr ); } void LegacyReporterAdapter::testGroupEnded( TestGroupStats const& testGroupStats ) { if( testGroupStats.aborting ) m_legacyReporter->Aborted(); m_legacyReporter->EndGroup( testGroupStats.groupInfo.name, testGroupStats.totals ); } void LegacyReporterAdapter::testRunEnded( TestRunStats const& testRunStats ) { m_legacyReporter->EndTesting( testRunStats.totals ); } void LegacyReporterAdapter::skipTest( TestCaseInfo const& ) { } } // #included from: catch_timer.hpp #ifdef __clang__ #pragma clang diagnostic push #pragma clang diagnostic ignored "-Wc++11-long-long" #endif #ifdef CATCH_PLATFORM_WINDOWS #include #else #include #endif namespace Catch { namespace { #ifdef CATCH_PLATFORM_WINDOWS uint64_t getCurrentTicks() { static uint64_t hz=0, hzo=0; if (!hz) { QueryPerformanceFrequency( reinterpret_cast( &hz ) ); QueryPerformanceCounter( reinterpret_cast( &hzo ) ); } uint64_t t; QueryPerformanceCounter( reinterpret_cast( &t ) ); return ((t-hzo)*1000000)/hz; } #else uint64_t getCurrentTicks() { timeval t; gettimeofday(&t,CATCH_NULL); return static_cast( t.tv_sec ) * 1000000ull + static_cast( t.tv_usec ); } #endif } void Timer::start() { m_ticks = getCurrentTicks(); } unsigned int Timer::getElapsedMicroseconds() const { return static_cast(getCurrentTicks() - m_ticks); } unsigned int Timer::getElapsedMilliseconds() const { return static_cast(getElapsedMicroseconds()/1000); } double Timer::getElapsedSeconds() const { return getElapsedMicroseconds()/1000000.0; } } // namespace Catch #ifdef __clang__ #pragma clang diagnostic pop #endif // #included from: catch_common.hpp #define TWOBLUECUBES_CATCH_COMMON_HPP_INCLUDED namespace Catch { bool startsWith( std::string const& s, std::string const& prefix ) { return s.size() >= prefix.size() && s.substr( 0, prefix.size() ) == prefix; } bool endsWith( std::string const& s, std::string const& suffix ) { return s.size() >= suffix.size() && s.substr( s.size()-suffix.size(), suffix.size() ) == suffix; } bool contains( std::string const& s, std::string const& infix ) { return s.find( infix ) != std::string::npos; } void toLowerInPlace( std::string& s ) { std::transform( s.begin(), s.end(), s.begin(), ::tolower ); } std::string toLower( std::string const& s ) { std::string lc = s; toLowerInPlace( lc ); return lc; } std::string trim( std::string const& str ) { static char const* whitespaceChars = "\n\r\t "; std::string::size_type start = str.find_first_not_of( whitespaceChars ); std::string::size_type end = str.find_last_not_of( whitespaceChars ); return start != std::string::npos ? str.substr( start, 1+end-start ) : ""; } bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ) { bool replaced = false; std::size_t i = str.find( replaceThis ); while( i != std::string::npos ) { replaced = true; str = str.substr( 0, i ) + withThis + str.substr( i+replaceThis.size() ); if( i < str.size()-withThis.size() ) i = str.find( replaceThis, i+withThis.size() ); else i = std::string::npos; } return replaced; } pluralise::pluralise( std::size_t count, std::string const& label ) : m_count( count ), m_label( label ) {} std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ) { os << pluraliser.m_count << " " << pluraliser.m_label; if( pluraliser.m_count != 1 ) os << "s"; return os; } SourceLineInfo::SourceLineInfo() : line( 0 ){} SourceLineInfo::SourceLineInfo( char const* _file, std::size_t _line ) : file( _file ), line( _line ) {} SourceLineInfo::SourceLineInfo( SourceLineInfo const& other ) : file( other.file ), line( other.line ) {} bool SourceLineInfo::empty() const { return file.empty(); } bool SourceLineInfo::operator == ( SourceLineInfo const& other ) const { return line == other.line && file == other.file; } bool SourceLineInfo::operator < ( SourceLineInfo const& other ) const { return line < other.line || ( line == other.line && file < other.file ); } void seedRng( IConfig const& config ) { if( config.rngSeed() != 0 ) std::srand( config.rngSeed() ); } unsigned int rngSeed() { return getCurrentContext().getConfig()->rngSeed(); } std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ) { #ifndef __GNUG__ os << info.file << "(" << info.line << ")"; #else os << info.file << ":" << info.line; #endif return os; } void throwLogicError( std::string const& message, SourceLineInfo const& locationInfo ) { std::ostringstream oss; oss << locationInfo << ": Internal Catch error: '" << message << "'"; if( alwaysTrue() ) throw std::logic_error( oss.str() ); } } // #included from: catch_section.hpp #define TWOBLUECUBES_CATCH_SECTION_HPP_INCLUDED namespace Catch { SectionInfo::SectionInfo ( SourceLineInfo const& _lineInfo, std::string const& _name, std::string const& _description ) : name( _name ), description( _description ), lineInfo( _lineInfo ) {} Section::Section( SectionInfo const& info ) : m_info( info ), m_sectionIncluded( getResultCapture().sectionStarted( m_info, m_assertions ) ) { m_timer.start(); } Section::~Section() { if( m_sectionIncluded ) { SectionEndInfo endInfo( m_info, m_assertions, m_timer.getElapsedSeconds() ); if( std::uncaught_exception() ) getResultCapture().sectionEndedEarly( endInfo ); else getResultCapture().sectionEnded( endInfo ); } } // This indicates whether the section should be executed or not Section::operator bool() const { return m_sectionIncluded; } } // end namespace Catch // #included from: catch_debugger.hpp #define TWOBLUECUBES_CATCH_DEBUGGER_HPP_INCLUDED #include #ifdef CATCH_PLATFORM_MAC #include #include #include #include #include namespace Catch{ // The following function is taken directly from the following technical note: // http://developer.apple.com/library/mac/#qa/qa2004/qa1361.html // Returns true if the current process is being debugged (either // running under the debugger or has a debugger attached post facto). bool isDebuggerActive(){ int mib[4]; struct kinfo_proc info; size_t size; // Initialize the flags so that, if sysctl fails for some bizarre // reason, we get a predictable result. info.kp_proc.p_flag = 0; // Initialize mib, which tells sysctl the info we want, in this case // we're looking for information about a specific process ID. mib[0] = CTL_KERN; mib[1] = KERN_PROC; mib[2] = KERN_PROC_PID; mib[3] = getpid(); // Call sysctl. size = sizeof(info); if( sysctl(mib, sizeof(mib) / sizeof(*mib), &info, &size, CATCH_NULL, 0) != 0 ) { Catch::cerr() << "\n** Call to sysctl failed - unable to determine if debugger is active **\n" << std::endl; return false; } // We're being debugged if the P_TRACED flag is set. return ( (info.kp_proc.p_flag & P_TRACED) != 0 ); } } // namespace Catch #elif defined(_MSC_VER) extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); namespace Catch { bool isDebuggerActive() { return IsDebuggerPresent() != 0; } } #elif defined(__MINGW32__) extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); namespace Catch { bool isDebuggerActive() { return IsDebuggerPresent() != 0; } } #else namespace Catch { inline bool isDebuggerActive() { return false; } } #endif // Platform #ifdef CATCH_PLATFORM_WINDOWS extern "C" __declspec(dllimport) void __stdcall OutputDebugStringA( const char* ); namespace Catch { void writeToDebugConsole( std::string const& text ) { ::OutputDebugStringA( text.c_str() ); } } #else namespace Catch { void writeToDebugConsole( std::string const& text ) { // !TBD: Need a version for Mac/ XCode and other IDEs Catch::cout() << text; } } #endif // Platform // #included from: catch_tostring.hpp #define TWOBLUECUBES_CATCH_TOSTRING_HPP_INCLUDED namespace Catch { namespace Detail { const std::string unprintableString = "{?}"; namespace { const int hexThreshold = 255; struct Endianness { enum Arch { Big, Little }; static Arch which() { union _{ int asInt; char asChar[sizeof (int)]; } u; u.asInt = 1; return ( u.asChar[sizeof(int)-1] == 1 ) ? Big : Little; } }; } std::string rawMemoryToString( const void *object, std::size_t size ) { // Reverse order for little endian architectures int i = 0, end = static_cast( size ), inc = 1; if( Endianness::which() == Endianness::Little ) { i = end-1; end = inc = -1; } unsigned char const *bytes = static_cast(object); std::ostringstream os; os << "0x" << std::setfill('0') << std::hex; for( ; i != end; i += inc ) os << std::setw(2) << static_cast(bytes[i]); return os.str(); } } std::string toString( std::string const& value ) { std::string s = value; if( getCurrentContext().getConfig()->showInvisibles() ) { for(size_t i = 0; i < s.size(); ++i ) { std::string subs; switch( s[i] ) { case '\n': subs = "\\n"; break; case '\t': subs = "\\t"; break; default: break; } if( !subs.empty() ) { s = s.substr( 0, i ) + subs + s.substr( i+1 ); ++i; } } } return "\"" + s + "\""; } std::string toString( std::wstring const& value ) { std::string s; s.reserve( value.size() ); for(size_t i = 0; i < value.size(); ++i ) s += value[i] <= 0xff ? static_cast( value[i] ) : '?'; return Catch::toString( s ); } std::string toString( const char* const value ) { return value ? Catch::toString( std::string( value ) ) : std::string( "{null string}" ); } std::string toString( char* const value ) { return Catch::toString( static_cast( value ) ); } std::string toString( const wchar_t* const value ) { return value ? Catch::toString( std::wstring(value) ) : std::string( "{null string}" ); } std::string toString( wchar_t* const value ) { return Catch::toString( static_cast( value ) ); } std::string toString( int value ) { std::ostringstream oss; oss << value; if( value > Detail::hexThreshold ) oss << " (0x" << std::hex << value << ")"; return oss.str(); } std::string toString( unsigned long value ) { std::ostringstream oss; oss << value; if( value > Detail::hexThreshold ) oss << " (0x" << std::hex << value << ")"; return oss.str(); } std::string toString( unsigned int value ) { return Catch::toString( static_cast( value ) ); } template std::string fpToString( T value, int precision ) { std::ostringstream oss; oss << std::setprecision( precision ) << std::fixed << value; std::string d = oss.str(); std::size_t i = d.find_last_not_of( '0' ); if( i != std::string::npos && i != d.size()-1 ) { if( d[i] == '.' ) i++; d = d.substr( 0, i+1 ); } return d; } std::string toString( const double value ) { return fpToString( value, 10 ); } std::string toString( const float value ) { return fpToString( value, 5 ) + "f"; } std::string toString( bool value ) { return value ? "true" : "false"; } std::string toString( char value ) { return value < ' ' ? toString( static_cast( value ) ) : Detail::makeString( value ); } std::string toString( signed char value ) { return toString( static_cast( value ) ); } std::string toString( unsigned char value ) { return toString( static_cast( value ) ); } #ifdef CATCH_CONFIG_CPP11_LONG_LONG std::string toString( long long value ) { std::ostringstream oss; oss << value; if( value > Detail::hexThreshold ) oss << " (0x" << std::hex << value << ")"; return oss.str(); } std::string toString( unsigned long long value ) { std::ostringstream oss; oss << value; if( value > Detail::hexThreshold ) oss << " (0x" << std::hex << value << ")"; return oss.str(); } #endif #ifdef CATCH_CONFIG_CPP11_NULLPTR std::string toString( std::nullptr_t ) { return "nullptr"; } #endif #ifdef __OBJC__ std::string toString( NSString const * const& nsstring ) { if( !nsstring ) return "nil"; return "@" + toString([nsstring UTF8String]); } std::string toString( NSString * CATCH_ARC_STRONG const& nsstring ) { if( !nsstring ) return "nil"; return "@" + toString([nsstring UTF8String]); } std::string toString( NSObject* const& nsObject ) { return toString( [nsObject description] ); } #endif } // end namespace Catch // #included from: catch_result_builder.hpp #define TWOBLUECUBES_CATCH_RESULT_BUILDER_HPP_INCLUDED namespace Catch { std::string capturedExpressionWithSecondArgument( std::string const& capturedExpression, std::string const& secondArg ) { return secondArg.empty() || secondArg == "\"\"" ? capturedExpression : capturedExpression + ", " + secondArg; } ResultBuilder::ResultBuilder( char const* macroName, SourceLineInfo const& lineInfo, char const* capturedExpression, ResultDisposition::Flags resultDisposition, char const* secondArg ) : m_assertionInfo( macroName, lineInfo, capturedExpressionWithSecondArgument( capturedExpression, secondArg ), resultDisposition ), m_shouldDebugBreak( false ), m_shouldThrow( false ) {} ResultBuilder& ResultBuilder::setResultType( ResultWas::OfType result ) { m_data.resultType = result; return *this; } ResultBuilder& ResultBuilder::setResultType( bool result ) { m_data.resultType = result ? ResultWas::Ok : ResultWas::ExpressionFailed; return *this; } ResultBuilder& ResultBuilder::setLhs( std::string const& lhs ) { m_exprComponents.lhs = lhs; return *this; } ResultBuilder& ResultBuilder::setRhs( std::string const& rhs ) { m_exprComponents.rhs = rhs; return *this; } ResultBuilder& ResultBuilder::setOp( std::string const& op ) { m_exprComponents.op = op; return *this; } void ResultBuilder::endExpression() { m_exprComponents.testFalse = isFalseTest( m_assertionInfo.resultDisposition ); captureExpression(); } void ResultBuilder::useActiveException( ResultDisposition::Flags resultDisposition ) { m_assertionInfo.resultDisposition = resultDisposition; m_stream.oss << Catch::translateActiveException(); captureResult( ResultWas::ThrewException ); } void ResultBuilder::captureResult( ResultWas::OfType resultType ) { setResultType( resultType ); captureExpression(); } void ResultBuilder::captureExpectedException( std::string const& expectedMessage ) { if( expectedMessage.empty() ) captureExpectedException( Matchers::Impl::Generic::AllOf() ); else captureExpectedException( Matchers::Equals( expectedMessage ) ); } void ResultBuilder::captureExpectedException( Matchers::Impl::Matcher const& matcher ) { assert( m_exprComponents.testFalse == false ); AssertionResultData data = m_data; data.resultType = ResultWas::Ok; data.reconstructedExpression = m_assertionInfo.capturedExpression; std::string actualMessage = Catch::translateActiveException(); if( !matcher.match( actualMessage ) ) { data.resultType = ResultWas::ExpressionFailed; data.reconstructedExpression = actualMessage; } AssertionResult result( m_assertionInfo, data ); handleResult( result ); } void ResultBuilder::captureExpression() { AssertionResult result = build(); handleResult( result ); } void ResultBuilder::handleResult( AssertionResult const& result ) { getResultCapture().assertionEnded( result ); if( !result.isOk() ) { if( getCurrentContext().getConfig()->shouldDebugBreak() ) m_shouldDebugBreak = true; if( getCurrentContext().getRunner()->aborting() || (m_assertionInfo.resultDisposition & ResultDisposition::Normal) ) m_shouldThrow = true; } } void ResultBuilder::react() { if( m_shouldThrow ) throw Catch::TestFailureException(); } bool ResultBuilder::shouldDebugBreak() const { return m_shouldDebugBreak; } bool ResultBuilder::allowThrows() const { return getCurrentContext().getConfig()->allowThrows(); } AssertionResult ResultBuilder::build() const { assert( m_data.resultType != ResultWas::Unknown ); AssertionResultData data = m_data; // Flip bool results if testFalse is set if( m_exprComponents.testFalse ) { if( data.resultType == ResultWas::Ok ) data.resultType = ResultWas::ExpressionFailed; else if( data.resultType == ResultWas::ExpressionFailed ) data.resultType = ResultWas::Ok; } data.message = m_stream.oss.str(); data.reconstructedExpression = reconstructExpression(); if( m_exprComponents.testFalse ) { if( m_exprComponents.op == "" ) data.reconstructedExpression = "!" + data.reconstructedExpression; else data.reconstructedExpression = "!(" + data.reconstructedExpression + ")"; } return AssertionResult( m_assertionInfo, data ); } std::string ResultBuilder::reconstructExpression() const { if( m_exprComponents.op == "" ) return m_exprComponents.lhs.empty() ? m_assertionInfo.capturedExpression : m_exprComponents.op + m_exprComponents.lhs; else if( m_exprComponents.op == "matches" ) return m_exprComponents.lhs + " " + m_exprComponents.rhs; else if( m_exprComponents.op != "!" ) { if( m_exprComponents.lhs.size() + m_exprComponents.rhs.size() < 40 && m_exprComponents.lhs.find("\n") == std::string::npos && m_exprComponents.rhs.find("\n") == std::string::npos ) return m_exprComponents.lhs + " " + m_exprComponents.op + " " + m_exprComponents.rhs; else return m_exprComponents.lhs + "\n" + m_exprComponents.op + "\n" + m_exprComponents.rhs; } else return "{can't expand - use " + m_assertionInfo.macroName + "_FALSE( " + m_assertionInfo.capturedExpression.substr(1) + " ) instead of " + m_assertionInfo.macroName + "( " + m_assertionInfo.capturedExpression + " ) for better diagnostics}"; } } // end namespace Catch // #included from: catch_tag_alias_registry.hpp #define TWOBLUECUBES_CATCH_TAG_ALIAS_REGISTRY_HPP_INCLUDED // #included from: catch_tag_alias_registry.h #define TWOBLUECUBES_CATCH_TAG_ALIAS_REGISTRY_H_INCLUDED #include namespace Catch { class TagAliasRegistry : public ITagAliasRegistry { public: virtual ~TagAliasRegistry(); virtual Option find( std::string const& alias ) const; virtual std::string expandAliases( std::string const& unexpandedTestSpec ) const; void add( char const* alias, char const* tag, SourceLineInfo const& lineInfo ); static TagAliasRegistry& get(); private: std::map m_registry; }; } // end namespace Catch #include #include namespace Catch { TagAliasRegistry::~TagAliasRegistry() {} Option TagAliasRegistry::find( std::string const& alias ) const { std::map::const_iterator it = m_registry.find( alias ); if( it != m_registry.end() ) return it->second; else return Option(); } std::string TagAliasRegistry::expandAliases( std::string const& unexpandedTestSpec ) const { std::string expandedTestSpec = unexpandedTestSpec; for( std::map::const_iterator it = m_registry.begin(), itEnd = m_registry.end(); it != itEnd; ++it ) { std::size_t pos = expandedTestSpec.find( it->first ); if( pos != std::string::npos ) { expandedTestSpec = expandedTestSpec.substr( 0, pos ) + it->second.tag + expandedTestSpec.substr( pos + it->first.size() ); } } return expandedTestSpec; } void TagAliasRegistry::add( char const* alias, char const* tag, SourceLineInfo const& lineInfo ) { if( !startsWith( alias, "[@" ) || !endsWith( alias, "]" ) ) { std::ostringstream oss; oss << "error: tag alias, \"" << alias << "\" is not of the form [@alias name].\n" << lineInfo; throw std::domain_error( oss.str().c_str() ); } if( !m_registry.insert( std::make_pair( alias, TagAlias( tag, lineInfo ) ) ).second ) { std::ostringstream oss; oss << "error: tag alias, \"" << alias << "\" already registered.\n" << "\tFirst seen at " << find(alias)->lineInfo << "\n" << "\tRedefined at " << lineInfo; throw std::domain_error( oss.str().c_str() ); } } TagAliasRegistry& TagAliasRegistry::get() { static TagAliasRegistry instance; return instance; } ITagAliasRegistry::~ITagAliasRegistry() {} ITagAliasRegistry const& ITagAliasRegistry::get() { return TagAliasRegistry::get(); } RegistrarForTagAliases::RegistrarForTagAliases( char const* alias, char const* tag, SourceLineInfo const& lineInfo ) { try { TagAliasRegistry::get().add( alias, tag, lineInfo ); } catch( std::exception& ex ) { Colour colourGuard( Colour::Red ); Catch::cerr() << ex.what() << std::endl; exit(1); } } } // end namespace Catch // #included from: ../reporters/catch_reporter_multi.hpp #define TWOBLUECUBES_CATCH_REPORTER_MULTI_HPP_INCLUDED namespace Catch { class MultipleReporters : public SharedImpl { typedef std::vector > Reporters; Reporters m_reporters; public: void add( Ptr const& reporter ) { m_reporters.push_back( reporter ); } public: // IStreamingReporter virtual ReporterPreferences getPreferences() const CATCH_OVERRIDE { return m_reporters[0]->getPreferences(); } virtual void noMatchingTestCases( std::string const& spec ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->noMatchingTestCases( spec ); } virtual void testRunStarting( TestRunInfo const& testRunInfo ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->testRunStarting( testRunInfo ); } virtual void testGroupStarting( GroupInfo const& groupInfo ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->testGroupStarting( groupInfo ); } virtual void testCaseStarting( TestCaseInfo const& testInfo ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->testCaseStarting( testInfo ); } virtual void sectionStarting( SectionInfo const& sectionInfo ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->sectionStarting( sectionInfo ); } virtual void assertionStarting( AssertionInfo const& assertionInfo ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->assertionStarting( assertionInfo ); } // The return value indicates if the messages buffer should be cleared: virtual bool assertionEnded( AssertionStats const& assertionStats ) CATCH_OVERRIDE { bool clearBuffer = false; for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) clearBuffer |= (*it)->assertionEnded( assertionStats ); return clearBuffer; } virtual void sectionEnded( SectionStats const& sectionStats ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->sectionEnded( sectionStats ); } virtual void testCaseEnded( TestCaseStats const& testCaseStats ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->testCaseEnded( testCaseStats ); } virtual void testGroupEnded( TestGroupStats const& testGroupStats ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->testGroupEnded( testGroupStats ); } virtual void testRunEnded( TestRunStats const& testRunStats ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->testRunEnded( testRunStats ); } virtual void skipTest( TestCaseInfo const& testInfo ) CATCH_OVERRIDE { for( Reporters::const_iterator it = m_reporters.begin(), itEnd = m_reporters.end(); it != itEnd; ++it ) (*it)->skipTest( testInfo ); } }; Ptr addReporter( Ptr const& existingReporter, Ptr const& additionalReporter ) { Ptr resultingReporter; if( existingReporter ) { MultipleReporters* multi = dynamic_cast( existingReporter.get() ); if( !multi ) { multi = new MultipleReporters; resultingReporter = Ptr( multi ); if( existingReporter ) multi->add( existingReporter ); } else resultingReporter = existingReporter; multi->add( additionalReporter ); } else resultingReporter = additionalReporter; return resultingReporter; } } // end namespace Catch // #included from: ../reporters/catch_reporter_xml.hpp #define TWOBLUECUBES_CATCH_REPORTER_XML_HPP_INCLUDED // #included from: catch_reporter_bases.hpp #define TWOBLUECUBES_CATCH_REPORTER_BASES_HPP_INCLUDED #include namespace Catch { struct StreamingReporterBase : SharedImpl { StreamingReporterBase( ReporterConfig const& _config ) : m_config( _config.fullConfig() ), stream( _config.stream() ) { m_reporterPrefs.shouldRedirectStdOut = false; } virtual ReporterPreferences getPreferences() const CATCH_OVERRIDE { return m_reporterPrefs; } virtual ~StreamingReporterBase() CATCH_OVERRIDE; virtual void noMatchingTestCases( std::string const& ) CATCH_OVERRIDE {} virtual void testRunStarting( TestRunInfo const& _testRunInfo ) CATCH_OVERRIDE { currentTestRunInfo = _testRunInfo; } virtual void testGroupStarting( GroupInfo const& _groupInfo ) CATCH_OVERRIDE { currentGroupInfo = _groupInfo; } virtual void testCaseStarting( TestCaseInfo const& _testInfo ) CATCH_OVERRIDE { currentTestCaseInfo = _testInfo; } virtual void sectionStarting( SectionInfo const& _sectionInfo ) CATCH_OVERRIDE { m_sectionStack.push_back( _sectionInfo ); } virtual void sectionEnded( SectionStats const& /* _sectionStats */ ) CATCH_OVERRIDE { m_sectionStack.pop_back(); } virtual void testCaseEnded( TestCaseStats const& /* _testCaseStats */ ) CATCH_OVERRIDE { currentTestCaseInfo.reset(); } virtual void testGroupEnded( TestGroupStats const& /* _testGroupStats */ ) CATCH_OVERRIDE { currentGroupInfo.reset(); } virtual void testRunEnded( TestRunStats const& /* _testRunStats */ ) CATCH_OVERRIDE { currentTestCaseInfo.reset(); currentGroupInfo.reset(); currentTestRunInfo.reset(); } virtual void skipTest( TestCaseInfo const& ) CATCH_OVERRIDE { // Don't do anything with this by default. // It can optionally be overridden in the derived class. } Ptr m_config; std::ostream& stream; LazyStat currentTestRunInfo; LazyStat currentGroupInfo; LazyStat currentTestCaseInfo; std::vector m_sectionStack; ReporterPreferences m_reporterPrefs; }; struct CumulativeReporterBase : SharedImpl { template struct Node : SharedImpl<> { explicit Node( T const& _value ) : value( _value ) {} virtual ~Node() {} typedef std::vector > ChildNodes; T value; ChildNodes children; }; struct SectionNode : SharedImpl<> { explicit SectionNode( SectionStats const& _stats ) : stats( _stats ) {} virtual ~SectionNode(); bool operator == ( SectionNode const& other ) const { return stats.sectionInfo.lineInfo == other.stats.sectionInfo.lineInfo; } bool operator == ( Ptr const& other ) const { return operator==( *other ); } SectionStats stats; typedef std::vector > ChildSections; typedef std::vector Assertions; ChildSections childSections; Assertions assertions; std::string stdOut; std::string stdErr; }; struct BySectionInfo { BySectionInfo( SectionInfo const& other ) : m_other( other ) {} BySectionInfo( BySectionInfo const& other ) : m_other( other.m_other ) {} bool operator() ( Ptr const& node ) const { return node->stats.sectionInfo.lineInfo == m_other.lineInfo; } private: void operator=( BySectionInfo const& ); SectionInfo const& m_other; }; typedef Node TestCaseNode; typedef Node TestGroupNode; typedef Node TestRunNode; CumulativeReporterBase( ReporterConfig const& _config ) : m_config( _config.fullConfig() ), stream( _config.stream() ) { m_reporterPrefs.shouldRedirectStdOut = false; } ~CumulativeReporterBase(); virtual ReporterPreferences getPreferences() const CATCH_OVERRIDE { return m_reporterPrefs; } virtual void testRunStarting( TestRunInfo const& ) CATCH_OVERRIDE {} virtual void testGroupStarting( GroupInfo const& ) CATCH_OVERRIDE {} virtual void testCaseStarting( TestCaseInfo const& ) CATCH_OVERRIDE {} virtual void sectionStarting( SectionInfo const& sectionInfo ) CATCH_OVERRIDE { SectionStats incompleteStats( sectionInfo, Counts(), 0, false ); Ptr node; if( m_sectionStack.empty() ) { if( !m_rootSection ) m_rootSection = new SectionNode( incompleteStats ); node = m_rootSection; } else { SectionNode& parentNode = *m_sectionStack.back(); SectionNode::ChildSections::const_iterator it = std::find_if( parentNode.childSections.begin(), parentNode.childSections.end(), BySectionInfo( sectionInfo ) ); if( it == parentNode.childSections.end() ) { node = new SectionNode( incompleteStats ); parentNode.childSections.push_back( node ); } else node = *it; } m_sectionStack.push_back( node ); m_deepestSection = node; } virtual void assertionStarting( AssertionInfo const& ) CATCH_OVERRIDE {} virtual bool assertionEnded( AssertionStats const& assertionStats ) { assert( !m_sectionStack.empty() ); SectionNode& sectionNode = *m_sectionStack.back(); sectionNode.assertions.push_back( assertionStats ); return true; } virtual void sectionEnded( SectionStats const& sectionStats ) CATCH_OVERRIDE { assert( !m_sectionStack.empty() ); SectionNode& node = *m_sectionStack.back(); node.stats = sectionStats; m_sectionStack.pop_back(); } virtual void testCaseEnded( TestCaseStats const& testCaseStats ) CATCH_OVERRIDE { Ptr node = new TestCaseNode( testCaseStats ); assert( m_sectionStack.size() == 0 ); node->children.push_back( m_rootSection ); m_testCases.push_back( node ); m_rootSection.reset(); assert( m_deepestSection ); m_deepestSection->stdOut = testCaseStats.stdOut; m_deepestSection->stdErr = testCaseStats.stdErr; } virtual void testGroupEnded( TestGroupStats const& testGroupStats ) CATCH_OVERRIDE { Ptr node = new TestGroupNode( testGroupStats ); node->children.swap( m_testCases ); m_testGroups.push_back( node ); } virtual void testRunEnded( TestRunStats const& testRunStats ) CATCH_OVERRIDE { Ptr node = new TestRunNode( testRunStats ); node->children.swap( m_testGroups ); m_testRuns.push_back( node ); testRunEndedCumulative(); } virtual void testRunEndedCumulative() = 0; virtual void skipTest( TestCaseInfo const& ) CATCH_OVERRIDE {} Ptr m_config; std::ostream& stream; std::vector m_assertions; std::vector > > m_sections; std::vector > m_testCases; std::vector > m_testGroups; std::vector > m_testRuns; Ptr m_rootSection; Ptr m_deepestSection; std::vector > m_sectionStack; ReporterPreferences m_reporterPrefs; }; template char const* getLineOfChars() { static char line[CATCH_CONFIG_CONSOLE_WIDTH] = {0}; if( !*line ) { memset( line, C, CATCH_CONFIG_CONSOLE_WIDTH-1 ); line[CATCH_CONFIG_CONSOLE_WIDTH-1] = 0; } return line; } struct TestEventListenerBase : StreamingReporterBase { TestEventListenerBase( ReporterConfig const& _config ) : StreamingReporterBase( _config ) {} virtual void assertionStarting( AssertionInfo const& ) CATCH_OVERRIDE {} virtual bool assertionEnded( AssertionStats const& ) CATCH_OVERRIDE { return false; } }; } // end namespace Catch // #included from: ../internal/catch_reporter_registrars.hpp #define TWOBLUECUBES_CATCH_REPORTER_REGISTRARS_HPP_INCLUDED namespace Catch { template class LegacyReporterRegistrar { class ReporterFactory : public IReporterFactory { virtual IStreamingReporter* create( ReporterConfig const& config ) const { return new LegacyReporterAdapter( new T( config ) ); } virtual std::string getDescription() const { return T::getDescription(); } }; public: LegacyReporterRegistrar( std::string const& name ) { getMutableRegistryHub().registerReporter( name, new ReporterFactory() ); } }; template class ReporterRegistrar { class ReporterFactory : public SharedImpl { // *** Please Note ***: // - If you end up here looking at a compiler error because it's trying to register // your custom reporter class be aware that the native reporter interface has changed // to IStreamingReporter. The "legacy" interface, IReporter, is still supported via // an adapter. Just use REGISTER_LEGACY_REPORTER to take advantage of the adapter. // However please consider updating to the new interface as the old one is now // deprecated and will probably be removed quite soon! // Please contact me via github if you have any questions at all about this. // In fact, ideally, please contact me anyway to let me know you've hit this - as I have // no idea who is actually using custom reporters at all (possibly no-one!). // The new interface is designed to minimise exposure to interface changes in the future. virtual IStreamingReporter* create( ReporterConfig const& config ) const { return new T( config ); } virtual std::string getDescription() const { return T::getDescription(); } }; public: ReporterRegistrar( std::string const& name ) { getMutableRegistryHub().registerReporter( name, new ReporterFactory() ); } }; template class ListenerRegistrar { class ListenerFactory : public SharedImpl { virtual IStreamingReporter* create( ReporterConfig const& config ) const { return new T( config ); } virtual std::string getDescription() const { return ""; } }; public: ListenerRegistrar() { getMutableRegistryHub().registerListener( new ListenerFactory() ); } }; } #define INTERNAL_CATCH_REGISTER_LEGACY_REPORTER( name, reporterType ) \ namespace{ Catch::LegacyReporterRegistrar catch_internal_RegistrarFor##reporterType( name ); } #define INTERNAL_CATCH_REGISTER_REPORTER( name, reporterType ) \ namespace{ Catch::ReporterRegistrar catch_internal_RegistrarFor##reporterType( name ); } #define INTERNAL_CATCH_REGISTER_LISTENER( listenerType ) \ namespace{ Catch::ListenerRegistrar catch_internal_RegistrarFor##listenerType; } // #included from: ../internal/catch_xmlwriter.hpp #define TWOBLUECUBES_CATCH_XMLWRITER_HPP_INCLUDED #include #include #include #include namespace Catch { class XmlEncode { public: enum ForWhat { ForTextNodes, ForAttributes }; XmlEncode( std::string const& str, ForWhat forWhat = ForTextNodes ) : m_str( str ), m_forWhat( forWhat ) {} void encodeTo( std::ostream& os ) const { // Apostrophe escaping not necessary if we always use " to write attributes // (see: http://www.w3.org/TR/xml/#syntax) for( std::size_t i = 0; i < m_str.size(); ++ i ) { char c = m_str[i]; switch( c ) { case '<': os << "<"; break; case '&': os << "&"; break; case '>': // See: http://www.w3.org/TR/xml/#syntax if( i > 2 && m_str[i-1] == ']' && m_str[i-2] == ']' ) os << ">"; else os << c; break; case '\"': if( m_forWhat == ForAttributes ) os << """; else os << c; break; default: // Escape control chars - based on contribution by @espenalb in PR #465 if ( ( c < '\x09' ) || ( c > '\x0D' && c < '\x20') || c=='\x7F' ) os << "&#x" << std::uppercase << std::hex << static_cast( c ); else os << c; } } } friend std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ) { xmlEncode.encodeTo( os ); return os; } private: std::string m_str; ForWhat m_forWhat; }; class XmlWriter { public: class ScopedElement { public: ScopedElement( XmlWriter* writer ) : m_writer( writer ) {} ScopedElement( ScopedElement const& other ) : m_writer( other.m_writer ){ other.m_writer = CATCH_NULL; } ~ScopedElement() { if( m_writer ) m_writer->endElement(); } ScopedElement& writeText( std::string const& text, bool indent = true ) { m_writer->writeText( text, indent ); return *this; } template ScopedElement& writeAttribute( std::string const& name, T const& attribute ) { m_writer->writeAttribute( name, attribute ); return *this; } private: mutable XmlWriter* m_writer; }; XmlWriter() : m_tagIsOpen( false ), m_needsNewline( false ), m_os( &Catch::cout() ) {} XmlWriter( std::ostream& os ) : m_tagIsOpen( false ), m_needsNewline( false ), m_os( &os ) {} ~XmlWriter() { while( !m_tags.empty() ) endElement(); } XmlWriter& startElement( std::string const& name ) { ensureTagClosed(); newlineIfNecessary(); stream() << m_indent << "<" << name; m_tags.push_back( name ); m_indent += " "; m_tagIsOpen = true; return *this; } ScopedElement scopedElement( std::string const& name ) { ScopedElement scoped( this ); startElement( name ); return scoped; } XmlWriter& endElement() { newlineIfNecessary(); m_indent = m_indent.substr( 0, m_indent.size()-2 ); if( m_tagIsOpen ) { stream() << "/>\n"; m_tagIsOpen = false; } else { stream() << m_indent << "\n"; } m_tags.pop_back(); return *this; } XmlWriter& writeAttribute( std::string const& name, std::string const& attribute ) { if( !name.empty() && !attribute.empty() ) stream() << " " << name << "=\"" << XmlEncode( attribute, XmlEncode::ForAttributes ) << "\""; return *this; } XmlWriter& writeAttribute( std::string const& name, bool attribute ) { stream() << " " << name << "=\"" << ( attribute ? "true" : "false" ) << "\""; return *this; } template XmlWriter& writeAttribute( std::string const& name, T const& attribute ) { std::ostringstream oss; oss << attribute; return writeAttribute( name, oss.str() ); } XmlWriter& writeText( std::string const& text, bool indent = true ) { if( !text.empty() ){ bool tagWasOpen = m_tagIsOpen; ensureTagClosed(); if( tagWasOpen && indent ) stream() << m_indent; stream() << XmlEncode( text ); m_needsNewline = true; } return *this; } XmlWriter& writeComment( std::string const& text ) { ensureTagClosed(); stream() << m_indent << ""; m_needsNewline = true; return *this; } XmlWriter& writeBlankLine() { ensureTagClosed(); stream() << "\n"; return *this; } void setStream( std::ostream& os ) { m_os = &os; } private: XmlWriter( XmlWriter const& ); void operator=( XmlWriter const& ); std::ostream& stream() { return *m_os; } void ensureTagClosed() { if( m_tagIsOpen ) { stream() << ">\n"; m_tagIsOpen = false; } } void newlineIfNecessary() { if( m_needsNewline ) { stream() << "\n"; m_needsNewline = false; } } bool m_tagIsOpen; bool m_needsNewline; std::vector m_tags; std::string m_indent; std::ostream* m_os; }; } // #included from: catch_reenable_warnings.h #define TWOBLUECUBES_CATCH_REENABLE_WARNINGS_H_INCLUDED #ifdef __clang__ # ifdef __ICC // icpc defines the __clang__ macro # pragma warning(pop) # else # pragma clang diagnostic pop # endif #elif defined __GNUC__ # pragma GCC diagnostic pop #endif namespace Catch { class XmlReporter : public StreamingReporterBase { public: XmlReporter( ReporterConfig const& _config ) : StreamingReporterBase( _config ), m_sectionDepth( 0 ) { m_reporterPrefs.shouldRedirectStdOut = true; } virtual ~XmlReporter() CATCH_OVERRIDE; static std::string getDescription() { return "Reports test results as an XML document"; } public: // StreamingReporterBase virtual void noMatchingTestCases( std::string const& s ) CATCH_OVERRIDE { StreamingReporterBase::noMatchingTestCases( s ); } virtual void testRunStarting( TestRunInfo const& testInfo ) CATCH_OVERRIDE { StreamingReporterBase::testRunStarting( testInfo ); m_xml.setStream( stream ); m_xml.startElement( "Catch" ); if( !m_config->name().empty() ) m_xml.writeAttribute( "name", m_config->name() ); } virtual void testGroupStarting( GroupInfo const& groupInfo ) CATCH_OVERRIDE { StreamingReporterBase::testGroupStarting( groupInfo ); m_xml.startElement( "Group" ) .writeAttribute( "name", groupInfo.name ); } virtual void testCaseStarting( TestCaseInfo const& testInfo ) CATCH_OVERRIDE { StreamingReporterBase::testCaseStarting(testInfo); m_xml.startElement( "TestCase" ).writeAttribute( "name", trim( testInfo.name ) ); if ( m_config->showDurations() == ShowDurations::Always ) m_testCaseTimer.start(); } virtual void sectionStarting( SectionInfo const& sectionInfo ) CATCH_OVERRIDE { StreamingReporterBase::sectionStarting( sectionInfo ); if( m_sectionDepth++ > 0 ) { m_xml.startElement( "Section" ) .writeAttribute( "name", trim( sectionInfo.name ) ) .writeAttribute( "description", sectionInfo.description ); } } virtual void assertionStarting( AssertionInfo const& ) CATCH_OVERRIDE { } virtual bool assertionEnded( AssertionStats const& assertionStats ) CATCH_OVERRIDE { const AssertionResult& assertionResult = assertionStats.assertionResult; // Print any info messages in tags. if( assertionStats.assertionResult.getResultType() != ResultWas::Ok ) { for( std::vector::const_iterator it = assertionStats.infoMessages.begin(), itEnd = assertionStats.infoMessages.end(); it != itEnd; ++it ) { if( it->type == ResultWas::Info ) { m_xml.scopedElement( "Info" ) .writeText( it->message ); } else if ( it->type == ResultWas::Warning ) { m_xml.scopedElement( "Warning" ) .writeText( it->message ); } } } // Drop out if result was successful but we're not printing them. if( !m_config->includeSuccessfulResults() && isOk(assertionResult.getResultType()) ) return true; // Print the expression if there is one. if( assertionResult.hasExpression() ) { m_xml.startElement( "Expression" ) .writeAttribute( "success", assertionResult.succeeded() ) .writeAttribute( "type", assertionResult.getTestMacroName() ) .writeAttribute( "filename", assertionResult.getSourceInfo().file ) .writeAttribute( "line", assertionResult.getSourceInfo().line ); m_xml.scopedElement( "Original" ) .writeText( assertionResult.getExpression() ); m_xml.scopedElement( "Expanded" ) .writeText( assertionResult.getExpandedExpression() ); } // And... Print a result applicable to each result type. switch( assertionResult.getResultType() ) { case ResultWas::ThrewException: m_xml.scopedElement( "Exception" ) .writeAttribute( "filename", assertionResult.getSourceInfo().file ) .writeAttribute( "line", assertionResult.getSourceInfo().line ) .writeText( assertionResult.getMessage() ); break; case ResultWas::FatalErrorCondition: m_xml.scopedElement( "Fatal Error Condition" ) .writeAttribute( "filename", assertionResult.getSourceInfo().file ) .writeAttribute( "line", assertionResult.getSourceInfo().line ) .writeText( assertionResult.getMessage() ); break; case ResultWas::Info: m_xml.scopedElement( "Info" ) .writeText( assertionResult.getMessage() ); break; case ResultWas::Warning: // Warning will already have been written break; case ResultWas::ExplicitFailure: m_xml.scopedElement( "Failure" ) .writeText( assertionResult.getMessage() ); break; default: break; } if( assertionResult.hasExpression() ) m_xml.endElement(); return true; } virtual void sectionEnded( SectionStats const& sectionStats ) CATCH_OVERRIDE { StreamingReporterBase::sectionEnded( sectionStats ); if( --m_sectionDepth > 0 ) { XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResults" ); e.writeAttribute( "successes", sectionStats.assertions.passed ); e.writeAttribute( "failures", sectionStats.assertions.failed ); e.writeAttribute( "expectedFailures", sectionStats.assertions.failedButOk ); if ( m_config->showDurations() == ShowDurations::Always ) e.writeAttribute( "durationInSeconds", sectionStats.durationInSeconds ); m_xml.endElement(); } } virtual void testCaseEnded( TestCaseStats const& testCaseStats ) CATCH_OVERRIDE { StreamingReporterBase::testCaseEnded( testCaseStats ); XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResult" ); e.writeAttribute( "success", testCaseStats.totals.assertions.allOk() ); if ( m_config->showDurations() == ShowDurations::Always ) e.writeAttribute( "durationInSeconds", m_testCaseTimer.getElapsedSeconds() ); m_xml.endElement(); } virtual void testGroupEnded( TestGroupStats const& testGroupStats ) CATCH_OVERRIDE { StreamingReporterBase::testGroupEnded( testGroupStats ); // TODO: Check testGroupStats.aborting and act accordingly. m_xml.scopedElement( "OverallResults" ) .writeAttribute( "successes", testGroupStats.totals.assertions.passed ) .writeAttribute( "failures", testGroupStats.totals.assertions.failed ) .writeAttribute( "expectedFailures", testGroupStats.totals.assertions.failedButOk ); m_xml.endElement(); } virtual void testRunEnded( TestRunStats const& testRunStats ) CATCH_OVERRIDE { StreamingReporterBase::testRunEnded( testRunStats ); m_xml.scopedElement( "OverallResults" ) .writeAttribute( "successes", testRunStats.totals.assertions.passed ) .writeAttribute( "failures", testRunStats.totals.assertions.failed ) .writeAttribute( "expectedFailures", testRunStats.totals.assertions.failedButOk ); m_xml.endElement(); } private: Timer m_testCaseTimer; XmlWriter m_xml; int m_sectionDepth; }; INTERNAL_CATCH_REGISTER_REPORTER( "xml", XmlReporter ) } // end namespace Catch // #included from: ../reporters/catch_reporter_junit.hpp #define TWOBLUECUBES_CATCH_REPORTER_JUNIT_HPP_INCLUDED #include namespace Catch { class JunitReporter : public CumulativeReporterBase { public: JunitReporter( ReporterConfig const& _config ) : CumulativeReporterBase( _config ), xml( _config.stream() ) { m_reporterPrefs.shouldRedirectStdOut = true; } virtual ~JunitReporter() CATCH_OVERRIDE; static std::string getDescription() { return "Reports test results in an XML format that looks like Ant's junitreport target"; } virtual void noMatchingTestCases( std::string const& /*spec*/ ) CATCH_OVERRIDE {} virtual void testRunStarting( TestRunInfo const& runInfo ) CATCH_OVERRIDE { CumulativeReporterBase::testRunStarting( runInfo ); xml.startElement( "testsuites" ); } virtual void testGroupStarting( GroupInfo const& groupInfo ) CATCH_OVERRIDE { suiteTimer.start(); stdOutForSuite.str(""); stdErrForSuite.str(""); unexpectedExceptions = 0; CumulativeReporterBase::testGroupStarting( groupInfo ); } virtual bool assertionEnded( AssertionStats const& assertionStats ) CATCH_OVERRIDE { if( assertionStats.assertionResult.getResultType() == ResultWas::ThrewException ) unexpectedExceptions++; return CumulativeReporterBase::assertionEnded( assertionStats ); } virtual void testCaseEnded( TestCaseStats const& testCaseStats ) CATCH_OVERRIDE { stdOutForSuite << testCaseStats.stdOut; stdErrForSuite << testCaseStats.stdErr; CumulativeReporterBase::testCaseEnded( testCaseStats ); } virtual void testGroupEnded( TestGroupStats const& testGroupStats ) CATCH_OVERRIDE { double suiteTime = suiteTimer.getElapsedSeconds(); CumulativeReporterBase::testGroupEnded( testGroupStats ); writeGroup( *m_testGroups.back(), suiteTime ); } virtual void testRunEndedCumulative() CATCH_OVERRIDE { xml.endElement(); } void writeGroup( TestGroupNode const& groupNode, double suiteTime ) { XmlWriter::ScopedElement e = xml.scopedElement( "testsuite" ); TestGroupStats const& stats = groupNode.value; xml.writeAttribute( "name", stats.groupInfo.name ); xml.writeAttribute( "errors", unexpectedExceptions ); xml.writeAttribute( "failures", stats.totals.assertions.failed-unexpectedExceptions ); xml.writeAttribute( "tests", stats.totals.assertions.total() ); xml.writeAttribute( "hostname", "tbd" ); // !TBD if( m_config->showDurations() == ShowDurations::Never ) xml.writeAttribute( "time", "" ); else xml.writeAttribute( "time", suiteTime ); xml.writeAttribute( "timestamp", "tbd" ); // !TBD // Write test cases for( TestGroupNode::ChildNodes::const_iterator it = groupNode.children.begin(), itEnd = groupNode.children.end(); it != itEnd; ++it ) writeTestCase( **it ); xml.scopedElement( "system-out" ).writeText( trim( stdOutForSuite.str() ), false ); xml.scopedElement( "system-err" ).writeText( trim( stdErrForSuite.str() ), false ); } void writeTestCase( TestCaseNode const& testCaseNode ) { TestCaseStats const& stats = testCaseNode.value; // All test cases have exactly one section - which represents the // test case itself. That section may have 0-n nested sections assert( testCaseNode.children.size() == 1 ); SectionNode const& rootSection = *testCaseNode.children.front(); std::string className = stats.testInfo.className; if( className.empty() ) { if( rootSection.childSections.empty() ) className = "global"; } writeSection( className, "", rootSection ); } void writeSection( std::string const& className, std::string const& rootName, SectionNode const& sectionNode ) { std::string name = trim( sectionNode.stats.sectionInfo.name ); if( !rootName.empty() ) name = rootName + "/" + name; if( !sectionNode.assertions.empty() || !sectionNode.stdOut.empty() || !sectionNode.stdErr.empty() ) { XmlWriter::ScopedElement e = xml.scopedElement( "testcase" ); if( className.empty() ) { xml.writeAttribute( "classname", name ); xml.writeAttribute( "name", "root" ); } else { xml.writeAttribute( "classname", className ); xml.writeAttribute( "name", name ); } xml.writeAttribute( "time", Catch::toString( sectionNode.stats.durationInSeconds ) ); writeAssertions( sectionNode ); if( !sectionNode.stdOut.empty() ) xml.scopedElement( "system-out" ).writeText( trim( sectionNode.stdOut ), false ); if( !sectionNode.stdErr.empty() ) xml.scopedElement( "system-err" ).writeText( trim( sectionNode.stdErr ), false ); } for( SectionNode::ChildSections::const_iterator it = sectionNode.childSections.begin(), itEnd = sectionNode.childSections.end(); it != itEnd; ++it ) if( className.empty() ) writeSection( name, "", **it ); else writeSection( className, name, **it ); } void writeAssertions( SectionNode const& sectionNode ) { for( SectionNode::Assertions::const_iterator it = sectionNode.assertions.begin(), itEnd = sectionNode.assertions.end(); it != itEnd; ++it ) writeAssertion( *it ); } void writeAssertion( AssertionStats const& stats ) { AssertionResult const& result = stats.assertionResult; if( !result.isOk() ) { std::string elementName; switch( result.getResultType() ) { case ResultWas::ThrewException: case ResultWas::FatalErrorCondition: elementName = "error"; break; case ResultWas::ExplicitFailure: elementName = "failure"; break; case ResultWas::ExpressionFailed: elementName = "failure"; break; case ResultWas::DidntThrowException: elementName = "failure"; break; // We should never see these here: case ResultWas::Info: case ResultWas::Warning: case ResultWas::Ok: case ResultWas::Unknown: case ResultWas::FailureBit: case ResultWas::Exception: elementName = "internalError"; break; } XmlWriter::ScopedElement e = xml.scopedElement( elementName ); xml.writeAttribute( "message", result.getExpandedExpression() ); xml.writeAttribute( "type", result.getTestMacroName() ); std::ostringstream oss; if( !result.getMessage().empty() ) oss << result.getMessage() << "\n"; for( std::vector::const_iterator it = stats.infoMessages.begin(), itEnd = stats.infoMessages.end(); it != itEnd; ++it ) if( it->type == ResultWas::Info ) oss << it->message << "\n"; oss << "at " << result.getSourceInfo(); xml.writeText( oss.str(), false ); } } XmlWriter xml; Timer suiteTimer; std::ostringstream stdOutForSuite; std::ostringstream stdErrForSuite; unsigned int unexpectedExceptions; }; INTERNAL_CATCH_REGISTER_REPORTER( "junit", JunitReporter ) } // end namespace Catch // #included from: ../reporters/catch_reporter_console.hpp #define TWOBLUECUBES_CATCH_REPORTER_CONSOLE_HPP_INCLUDED namespace Catch { struct ConsoleReporter : StreamingReporterBase { ConsoleReporter( ReporterConfig const& _config ) : StreamingReporterBase( _config ), m_headerPrinted( false ) {} virtual ~ConsoleReporter() CATCH_OVERRIDE; static std::string getDescription() { return "Reports test results as plain lines of text"; } virtual void noMatchingTestCases( std::string const& spec ) CATCH_OVERRIDE { stream << "No test cases matched '" << spec << "'" << std::endl; } virtual void assertionStarting( AssertionInfo const& ) CATCH_OVERRIDE { } virtual bool assertionEnded( AssertionStats const& _assertionStats ) CATCH_OVERRIDE { AssertionResult const& result = _assertionStats.assertionResult; bool printInfoMessages = true; // Drop out if result was successful and we're not printing those if( !m_config->includeSuccessfulResults() && result.isOk() ) { if( result.getResultType() != ResultWas::Warning ) return false; printInfoMessages = false; } lazyPrint(); AssertionPrinter printer( stream, _assertionStats, printInfoMessages ); printer.print(); stream << std::endl; return true; } virtual void sectionStarting( SectionInfo const& _sectionInfo ) CATCH_OVERRIDE { m_headerPrinted = false; StreamingReporterBase::sectionStarting( _sectionInfo ); } virtual void sectionEnded( SectionStats const& _sectionStats ) CATCH_OVERRIDE { if( _sectionStats.missingAssertions ) { lazyPrint(); Colour colour( Colour::ResultError ); if( m_sectionStack.size() > 1 ) stream << "\nNo assertions in section"; else stream << "\nNo assertions in test case"; stream << " '" << _sectionStats.sectionInfo.name << "'\n" << std::endl; } if( m_headerPrinted ) { if( m_config->showDurations() == ShowDurations::Always ) stream << "Completed in " << _sectionStats.durationInSeconds << "s" << std::endl; m_headerPrinted = false; } else { if( m_config->showDurations() == ShowDurations::Always ) stream << _sectionStats.sectionInfo.name << " completed in " << _sectionStats.durationInSeconds << "s" << std::endl; } StreamingReporterBase::sectionEnded( _sectionStats ); } virtual void testCaseEnded( TestCaseStats const& _testCaseStats ) CATCH_OVERRIDE { StreamingReporterBase::testCaseEnded( _testCaseStats ); m_headerPrinted = false; } virtual void testGroupEnded( TestGroupStats const& _testGroupStats ) CATCH_OVERRIDE { if( currentGroupInfo.used ) { printSummaryDivider(); stream << "Summary for group '" << _testGroupStats.groupInfo.name << "':\n"; printTotals( _testGroupStats.totals ); stream << "\n" << std::endl; } StreamingReporterBase::testGroupEnded( _testGroupStats ); } virtual void testRunEnded( TestRunStats const& _testRunStats ) CATCH_OVERRIDE { printTotalsDivider( _testRunStats.totals ); printTotals( _testRunStats.totals ); stream << std::endl; StreamingReporterBase::testRunEnded( _testRunStats ); } private: class AssertionPrinter { void operator= ( AssertionPrinter const& ); public: AssertionPrinter( std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages ) : stream( _stream ), stats( _stats ), result( _stats.assertionResult ), colour( Colour::None ), message( result.getMessage() ), messages( _stats.infoMessages ), printInfoMessages( _printInfoMessages ) { switch( result.getResultType() ) { case ResultWas::Ok: colour = Colour::Success; passOrFail = "PASSED"; //if( result.hasMessage() ) if( _stats.infoMessages.size() == 1 ) messageLabel = "with message"; if( _stats.infoMessages.size() > 1 ) messageLabel = "with messages"; break; case ResultWas::ExpressionFailed: if( result.isOk() ) { colour = Colour::Success; passOrFail = "FAILED - but was ok"; } else { colour = Colour::Error; passOrFail = "FAILED"; } if( _stats.infoMessages.size() == 1 ) messageLabel = "with message"; if( _stats.infoMessages.size() > 1 ) messageLabel = "with messages"; break; case ResultWas::ThrewException: colour = Colour::Error; passOrFail = "FAILED"; messageLabel = "due to unexpected exception with message"; break; case ResultWas::FatalErrorCondition: colour = Colour::Error; passOrFail = "FAILED"; messageLabel = "due to a fatal error condition"; break; case ResultWas::DidntThrowException: colour = Colour::Error; passOrFail = "FAILED"; messageLabel = "because no exception was thrown where one was expected"; break; case ResultWas::Info: messageLabel = "info"; break; case ResultWas::Warning: messageLabel = "warning"; break; case ResultWas::ExplicitFailure: passOrFail = "FAILED"; colour = Colour::Error; if( _stats.infoMessages.size() == 1 ) messageLabel = "explicitly with message"; if( _stats.infoMessages.size() > 1 ) messageLabel = "explicitly with messages"; break; // These cases are here to prevent compiler warnings case ResultWas::Unknown: case ResultWas::FailureBit: case ResultWas::Exception: passOrFail = "** internal error **"; colour = Colour::Error; break; } } void print() const { printSourceInfo(); if( stats.totals.assertions.total() > 0 ) { if( result.isOk() ) stream << "\n"; printResultType(); printOriginalExpression(); printReconstructedExpression(); } else { stream << "\n"; } printMessage(); } private: void printResultType() const { if( !passOrFail.empty() ) { Colour colourGuard( colour ); stream << passOrFail << ":\n"; } } void printOriginalExpression() const { if( result.hasExpression() ) { Colour colourGuard( Colour::OriginalExpression ); stream << " "; stream << result.getExpressionInMacro(); stream << "\n"; } } void printReconstructedExpression() const { if( result.hasExpandedExpression() ) { stream << "with expansion:\n"; Colour colourGuard( Colour::ReconstructedExpression ); stream << Text( result.getExpandedExpression(), TextAttributes().setIndent(2) ) << "\n"; } } void printMessage() const { if( !messageLabel.empty() ) stream << messageLabel << ":" << "\n"; for( std::vector::const_iterator it = messages.begin(), itEnd = messages.end(); it != itEnd; ++it ) { // If this assertion is a warning ignore any INFO messages if( printInfoMessages || it->type != ResultWas::Info ) stream << Text( it->message, TextAttributes().setIndent(2) ) << "\n"; } } void printSourceInfo() const { Colour colourGuard( Colour::FileName ); stream << result.getSourceInfo() << ": "; } std::ostream& stream; AssertionStats const& stats; AssertionResult const& result; Colour::Code colour; std::string passOrFail; std::string messageLabel; std::string message; std::vector messages; bool printInfoMessages; }; void lazyPrint() { if( !currentTestRunInfo.used ) lazyPrintRunInfo(); if( !currentGroupInfo.used ) lazyPrintGroupInfo(); if( !m_headerPrinted ) { printTestCaseAndSectionHeader(); m_headerPrinted = true; } } void lazyPrintRunInfo() { stream << "\n" << getLineOfChars<'~'>() << "\n"; Colour colour( Colour::SecondaryText ); stream << currentTestRunInfo->name << " is a Catch v" << libraryVersion << " host application.\n" << "Run with -? for options\n\n"; if( m_config->rngSeed() != 0 ) stream << "Randomness seeded to: " << m_config->rngSeed() << "\n\n"; currentTestRunInfo.used = true; } void lazyPrintGroupInfo() { if( !currentGroupInfo->name.empty() && currentGroupInfo->groupsCounts > 1 ) { printClosedHeader( "Group: " + currentGroupInfo->name ); currentGroupInfo.used = true; } } void printTestCaseAndSectionHeader() { assert( !m_sectionStack.empty() ); printOpenHeader( currentTestCaseInfo->name ); if( m_sectionStack.size() > 1 ) { Colour colourGuard( Colour::Headers ); std::vector::const_iterator it = m_sectionStack.begin()+1, // Skip first section (test case) itEnd = m_sectionStack.end(); for( ; it != itEnd; ++it ) printHeaderString( it->name, 2 ); } SourceLineInfo lineInfo = m_sectionStack.front().lineInfo; if( !lineInfo.empty() ){ stream << getLineOfChars<'-'>() << "\n"; Colour colourGuard( Colour::FileName ); stream << lineInfo << "\n"; } stream << getLineOfChars<'.'>() << "\n" << std::endl; } void printClosedHeader( std::string const& _name ) { printOpenHeader( _name ); stream << getLineOfChars<'.'>() << "\n"; } void printOpenHeader( std::string const& _name ) { stream << getLineOfChars<'-'>() << "\n"; { Colour colourGuard( Colour::Headers ); printHeaderString( _name ); } } // if string has a : in first line will set indent to follow it on // subsequent lines void printHeaderString( std::string const& _string, std::size_t indent = 0 ) { std::size_t i = _string.find( ": " ); if( i != std::string::npos ) i+=2; else i = 0; stream << Text( _string, TextAttributes() .setIndent( indent+i) .setInitialIndent( indent ) ) << "\n"; } struct SummaryColumn { SummaryColumn( std::string const& _label, Colour::Code _colour ) : label( _label ), colour( _colour ) {} SummaryColumn addRow( std::size_t count ) { std::ostringstream oss; oss << count; std::string row = oss.str(); for( std::vector::iterator it = rows.begin(); it != rows.end(); ++it ) { while( it->size() < row.size() ) *it = " " + *it; while( it->size() > row.size() ) row = " " + row; } rows.push_back( row ); return *this; } std::string label; Colour::Code colour; std::vector rows; }; void printTotals( Totals const& totals ) { if( totals.testCases.total() == 0 ) { stream << Colour( Colour::Warning ) << "No tests ran\n"; } else if( totals.assertions.total() > 0 && totals.assertions.allPassed() ) { stream << Colour( Colour::ResultSuccess ) << "All tests passed"; stream << " (" << pluralise( totals.assertions.passed, "assertion" ) << " in " << pluralise( totals.testCases.passed, "test case" ) << ")" << "\n"; } else { std::vector columns; columns.push_back( SummaryColumn( "", Colour::None ) .addRow( totals.testCases.total() ) .addRow( totals.assertions.total() ) ); columns.push_back( SummaryColumn( "passed", Colour::Success ) .addRow( totals.testCases.passed ) .addRow( totals.assertions.passed ) ); columns.push_back( SummaryColumn( "failed", Colour::ResultError ) .addRow( totals.testCases.failed ) .addRow( totals.assertions.failed ) ); columns.push_back( SummaryColumn( "failed as expected", Colour::ResultExpectedFailure ) .addRow( totals.testCases.failedButOk ) .addRow( totals.assertions.failedButOk ) ); printSummaryRow( "test cases", columns, 0 ); printSummaryRow( "assertions", columns, 1 ); } } void printSummaryRow( std::string const& label, std::vector const& cols, std::size_t row ) { for( std::vector::const_iterator it = cols.begin(); it != cols.end(); ++it ) { std::string value = it->rows[row]; if( it->label.empty() ) { stream << label << ": "; if( value != "0" ) stream << value; else stream << Colour( Colour::Warning ) << "- none -"; } else if( value != "0" ) { stream << Colour( Colour::LightGrey ) << " | "; stream << Colour( it->colour ) << value << " " << it->label; } } stream << "\n"; } static std::size_t makeRatio( std::size_t number, std::size_t total ) { std::size_t ratio = total > 0 ? CATCH_CONFIG_CONSOLE_WIDTH * number/ total : 0; return ( ratio == 0 && number > 0 ) ? 1 : ratio; } static std::size_t& findMax( std::size_t& i, std::size_t& j, std::size_t& k ) { if( i > j && i > k ) return i; else if( j > k ) return j; else return k; } void printTotalsDivider( Totals const& totals ) { if( totals.testCases.total() > 0 ) { std::size_t failedRatio = makeRatio( totals.testCases.failed, totals.testCases.total() ); std::size_t failedButOkRatio = makeRatio( totals.testCases.failedButOk, totals.testCases.total() ); std::size_t passedRatio = makeRatio( totals.testCases.passed, totals.testCases.total() ); while( failedRatio + failedButOkRatio + passedRatio < CATCH_CONFIG_CONSOLE_WIDTH-1 ) findMax( failedRatio, failedButOkRatio, passedRatio )++; while( failedRatio + failedButOkRatio + passedRatio > CATCH_CONFIG_CONSOLE_WIDTH-1 ) findMax( failedRatio, failedButOkRatio, passedRatio )--; stream << Colour( Colour::Error ) << std::string( failedRatio, '=' ); stream << Colour( Colour::ResultExpectedFailure ) << std::string( failedButOkRatio, '=' ); if( totals.testCases.allPassed() ) stream << Colour( Colour::ResultSuccess ) << std::string( passedRatio, '=' ); else stream << Colour( Colour::Success ) << std::string( passedRatio, '=' ); } else { stream << Colour( Colour::Warning ) << std::string( CATCH_CONFIG_CONSOLE_WIDTH-1, '=' ); } stream << "\n"; } void printSummaryDivider() { stream << getLineOfChars<'-'>() << "\n"; } private: bool m_headerPrinted; }; INTERNAL_CATCH_REGISTER_REPORTER( "console", ConsoleReporter ) } // end namespace Catch // #included from: ../reporters/catch_reporter_compact.hpp #define TWOBLUECUBES_CATCH_REPORTER_COMPACT_HPP_INCLUDED namespace Catch { struct CompactReporter : StreamingReporterBase { CompactReporter( ReporterConfig const& _config ) : StreamingReporterBase( _config ) {} virtual ~CompactReporter(); static std::string getDescription() { return "Reports test results on a single line, suitable for IDEs"; } virtual ReporterPreferences getPreferences() const { ReporterPreferences prefs; prefs.shouldRedirectStdOut = false; return prefs; } virtual void noMatchingTestCases( std::string const& spec ) { stream << "No test cases matched '" << spec << "'" << std::endl; } virtual void assertionStarting( AssertionInfo const& ) { } virtual bool assertionEnded( AssertionStats const& _assertionStats ) { AssertionResult const& result = _assertionStats.assertionResult; bool printInfoMessages = true; // Drop out if result was successful and we're not printing those if( !m_config->includeSuccessfulResults() && result.isOk() ) { if( result.getResultType() != ResultWas::Warning ) return false; printInfoMessages = false; } AssertionPrinter printer( stream, _assertionStats, printInfoMessages ); printer.print(); stream << std::endl; return true; } virtual void testRunEnded( TestRunStats const& _testRunStats ) { printTotals( _testRunStats.totals ); stream << "\n" << std::endl; StreamingReporterBase::testRunEnded( _testRunStats ); } private: class AssertionPrinter { void operator= ( AssertionPrinter const& ); public: AssertionPrinter( std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages ) : stream( _stream ) , stats( _stats ) , result( _stats.assertionResult ) , messages( _stats.infoMessages ) , itMessage( _stats.infoMessages.begin() ) , printInfoMessages( _printInfoMessages ) {} void print() { printSourceInfo(); itMessage = messages.begin(); switch( result.getResultType() ) { case ResultWas::Ok: printResultType( Colour::ResultSuccess, passedString() ); printOriginalExpression(); printReconstructedExpression(); if ( ! result.hasExpression() ) printRemainingMessages( Colour::None ); else printRemainingMessages(); break; case ResultWas::ExpressionFailed: if( result.isOk() ) printResultType( Colour::ResultSuccess, failedString() + std::string( " - but was ok" ) ); else printResultType( Colour::Error, failedString() ); printOriginalExpression(); printReconstructedExpression(); printRemainingMessages(); break; case ResultWas::ThrewException: printResultType( Colour::Error, failedString() ); printIssue( "unexpected exception with message:" ); printMessage(); printExpressionWas(); printRemainingMessages(); break; case ResultWas::FatalErrorCondition: printResultType( Colour::Error, failedString() ); printIssue( "fatal error condition with message:" ); printMessage(); printExpressionWas(); printRemainingMessages(); break; case ResultWas::DidntThrowException: printResultType( Colour::Error, failedString() ); printIssue( "expected exception, got none" ); printExpressionWas(); printRemainingMessages(); break; case ResultWas::Info: printResultType( Colour::None, "info" ); printMessage(); printRemainingMessages(); break; case ResultWas::Warning: printResultType( Colour::None, "warning" ); printMessage(); printRemainingMessages(); break; case ResultWas::ExplicitFailure: printResultType( Colour::Error, failedString() ); printIssue( "explicitly" ); printRemainingMessages( Colour::None ); break; // These cases are here to prevent compiler warnings case ResultWas::Unknown: case ResultWas::FailureBit: case ResultWas::Exception: printResultType( Colour::Error, "** internal error **" ); break; } } private: // Colour::LightGrey static Colour::Code dimColour() { return Colour::FileName; } #ifdef CATCH_PLATFORM_MAC static const char* failedString() { return "FAILED"; } static const char* passedString() { return "PASSED"; } #else static const char* failedString() { return "failed"; } static const char* passedString() { return "passed"; } #endif void printSourceInfo() const { Colour colourGuard( Colour::FileName ); stream << result.getSourceInfo() << ":"; } void printResultType( Colour::Code colour, std::string passOrFail ) const { if( !passOrFail.empty() ) { { Colour colourGuard( colour ); stream << " " << passOrFail; } stream << ":"; } } void printIssue( std::string issue ) const { stream << " " << issue; } void printExpressionWas() { if( result.hasExpression() ) { stream << ";"; { Colour colour( dimColour() ); stream << " expression was:"; } printOriginalExpression(); } } void printOriginalExpression() const { if( result.hasExpression() ) { stream << " " << result.getExpression(); } } void printReconstructedExpression() const { if( result.hasExpandedExpression() ) { { Colour colour( dimColour() ); stream << " for: "; } stream << result.getExpandedExpression(); } } void printMessage() { if ( itMessage != messages.end() ) { stream << " '" << itMessage->message << "'"; ++itMessage; } } void printRemainingMessages( Colour::Code colour = dimColour() ) { if ( itMessage == messages.end() ) return; // using messages.end() directly yields compilation error: std::vector::const_iterator itEnd = messages.end(); const std::size_t N = static_cast( std::distance( itMessage, itEnd ) ); { Colour colourGuard( colour ); stream << " with " << pluralise( N, "message" ) << ":"; } for(; itMessage != itEnd; ) { // If this assertion is a warning ignore any INFO messages if( printInfoMessages || itMessage->type != ResultWas::Info ) { stream << " '" << itMessage->message << "'"; if ( ++itMessage != itEnd ) { Colour colourGuard( dimColour() ); stream << " and"; } } } } private: std::ostream& stream; AssertionStats const& stats; AssertionResult const& result; std::vector messages; std::vector::const_iterator itMessage; bool printInfoMessages; }; // Colour, message variants: // - white: No tests ran. // - red: Failed [both/all] N test cases, failed [both/all] M assertions. // - white: Passed [both/all] N test cases (no assertions). // - red: Failed N tests cases, failed M assertions. // - green: Passed [both/all] N tests cases with M assertions. std::string bothOrAll( std::size_t count ) const { return count == 1 ? "" : count == 2 ? "both " : "all " ; } void printTotals( const Totals& totals ) const { if( totals.testCases.total() == 0 ) { stream << "No tests ran."; } else if( totals.testCases.failed == totals.testCases.total() ) { Colour colour( Colour::ResultError ); const std::string qualify_assertions_failed = totals.assertions.failed == totals.assertions.total() ? bothOrAll( totals.assertions.failed ) : ""; stream << "Failed " << bothOrAll( totals.testCases.failed ) << pluralise( totals.testCases.failed, "test case" ) << ", " "failed " << qualify_assertions_failed << pluralise( totals.assertions.failed, "assertion" ) << "."; } else if( totals.assertions.total() == 0 ) { stream << "Passed " << bothOrAll( totals.testCases.total() ) << pluralise( totals.testCases.total(), "test case" ) << " (no assertions)."; } else if( totals.assertions.failed ) { Colour colour( Colour::ResultError ); stream << "Failed " << pluralise( totals.testCases.failed, "test case" ) << ", " "failed " << pluralise( totals.assertions.failed, "assertion" ) << "."; } else { Colour colour( Colour::ResultSuccess ); stream << "Passed " << bothOrAll( totals.testCases.passed ) << pluralise( totals.testCases.passed, "test case" ) << " with " << pluralise( totals.assertions.passed, "assertion" ) << "."; } } }; INTERNAL_CATCH_REGISTER_REPORTER( "compact", CompactReporter ) } // end namespace Catch namespace Catch { // These are all here to avoid warnings about not having any out of line // virtual methods NonCopyable::~NonCopyable() {} IShared::~IShared() {} IStream::~IStream() CATCH_NOEXCEPT {} FileStream::~FileStream() CATCH_NOEXCEPT {} CoutStream::~CoutStream() CATCH_NOEXCEPT {} DebugOutStream::~DebugOutStream() CATCH_NOEXCEPT {} StreamBufBase::~StreamBufBase() CATCH_NOEXCEPT {} IContext::~IContext() {} IResultCapture::~IResultCapture() {} ITestCase::~ITestCase() {} ITestCaseRegistry::~ITestCaseRegistry() {} IRegistryHub::~IRegistryHub() {} IMutableRegistryHub::~IMutableRegistryHub() {} IExceptionTranslator::~IExceptionTranslator() {} IExceptionTranslatorRegistry::~IExceptionTranslatorRegistry() {} IReporter::~IReporter() {} IReporterFactory::~IReporterFactory() {} IReporterRegistry::~IReporterRegistry() {} IStreamingReporter::~IStreamingReporter() {} AssertionStats::~AssertionStats() {} SectionStats::~SectionStats() {} TestCaseStats::~TestCaseStats() {} TestGroupStats::~TestGroupStats() {} TestRunStats::~TestRunStats() {} CumulativeReporterBase::SectionNode::~SectionNode() {} CumulativeReporterBase::~CumulativeReporterBase() {} StreamingReporterBase::~StreamingReporterBase() {} ConsoleReporter::~ConsoleReporter() {} CompactReporter::~CompactReporter() {} IRunner::~IRunner() {} IMutableContext::~IMutableContext() {} IConfig::~IConfig() {} XmlReporter::~XmlReporter() {} JunitReporter::~JunitReporter() {} TestRegistry::~TestRegistry() {} FreeFunctionTestCase::~FreeFunctionTestCase() {} IGeneratorInfo::~IGeneratorInfo() {} IGeneratorsForTest::~IGeneratorsForTest() {} WildcardPattern::~WildcardPattern() {} TestSpec::Pattern::~Pattern() {} TestSpec::NamePattern::~NamePattern() {} TestSpec::TagPattern::~TagPattern() {} TestSpec::ExcludedPattern::~ExcludedPattern() {} Matchers::Impl::StdString::Equals::~Equals() {} Matchers::Impl::StdString::Contains::~Contains() {} Matchers::Impl::StdString::StartsWith::~StartsWith() {} Matchers::Impl::StdString::EndsWith::~EndsWith() {} void Config::dummy() {} namespace TestCaseTracking { ITracker::~ITracker() {} TrackerBase::~TrackerBase() {} SectionTracker::~SectionTracker() {} IndexTracker::~IndexTracker() {} } } #ifdef __clang__ #pragma clang diagnostic pop #endif #endif #ifdef CATCH_CONFIG_MAIN // #included from: internal/catch_default_main.hpp #define TWOBLUECUBES_CATCH_DEFAULT_MAIN_HPP_INCLUDED #ifndef __OBJC__ // Standard C/C++ main entry point int main (int argc, char * const argv[]) { return Catch::Session().run( argc, argv ); } #else // __OBJC__ // Objective-C entry point int main (int argc, char * const argv[]) { #if !CATCH_ARC_ENABLED NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; #endif Catch::registerTestMethods(); int result = Catch::Session().run( argc, (char* const*)argv ); #if !CATCH_ARC_ENABLED [pool drain]; #endif return result; } #endif // __OBJC__ #endif #ifdef CLARA_CONFIG_MAIN_NOT_DEFINED # undef CLARA_CONFIG_MAIN #endif ////// // If this config identifier is defined then all CATCH macros are prefixed with CATCH_ #ifdef CATCH_CONFIG_PREFIX_ALL #define CATCH_REQUIRE( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::Normal, "CATCH_REQUIRE" ) #define CATCH_REQUIRE_FALSE( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, "CATCH_REQUIRE_FALSE" ) #define CATCH_REQUIRE_THROWS( expr ) INTERNAL_CATCH_THROWS( expr, Catch::ResultDisposition::Normal, "", "CATCH_REQUIRE_THROWS" ) #define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( expr, exceptionType, Catch::ResultDisposition::Normal, "CATCH_REQUIRE_THROWS_AS" ) #define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS( expr, Catch::ResultDisposition::Normal, matcher, "CATCH_REQUIRE_THROWS_WITH" ) #define CATCH_REQUIRE_NOTHROW( expr ) INTERNAL_CATCH_NO_THROW( expr, Catch::ResultDisposition::Normal, "CATCH_REQUIRE_NOTHROW" ) #define CATCH_CHECK( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::ContinueOnFailure, "CATCH_CHECK" ) #define CATCH_CHECK_FALSE( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, "CATCH_CHECK_FALSE" ) #define CATCH_CHECKED_IF( expr ) INTERNAL_CATCH_IF( expr, Catch::ResultDisposition::ContinueOnFailure, "CATCH_CHECKED_IF" ) #define CATCH_CHECKED_ELSE( expr ) INTERNAL_CATCH_ELSE( expr, Catch::ResultDisposition::ContinueOnFailure, "CATCH_CHECKED_ELSE" ) #define CATCH_CHECK_NOFAIL( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, "CATCH_CHECK_NOFAIL" ) #define CATCH_CHECK_THROWS( expr ) INTERNAL_CATCH_THROWS( expr, Catch::ResultDisposition::ContinueOnFailure, "CATCH_CHECK_THROWS" ) #define CATCH_CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( expr, exceptionType, Catch::ResultDisposition::ContinueOnFailure, "CATCH_CHECK_THROWS_AS" ) #define CATCH_CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS( expr, Catch::ResultDisposition::ContinueOnFailure, matcher, "CATCH_CHECK_THROWS_WITH" ) #define CATCH_CHECK_NOTHROW( expr ) INTERNAL_CATCH_NO_THROW( expr, Catch::ResultDisposition::ContinueOnFailure, "CATCH_CHECK_NOTHROW" ) #define CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( arg, matcher, Catch::ResultDisposition::ContinueOnFailure, "CATCH_CHECK_THAT" ) #define CATCH_REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( arg, matcher, Catch::ResultDisposition::Normal, "CATCH_REQUIRE_THAT" ) #define CATCH_INFO( msg ) INTERNAL_CATCH_INFO( msg, "CATCH_INFO" ) #define CATCH_WARN( msg ) INTERNAL_CATCH_MSG( Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, "CATCH_WARN", msg ) #define CATCH_SCOPED_INFO( msg ) INTERNAL_CATCH_INFO( msg, "CATCH_INFO" ) #define CATCH_CAPTURE( msg ) INTERNAL_CATCH_INFO( #msg " := " << msg, "CATCH_CAPTURE" ) #define CATCH_SCOPED_CAPTURE( msg ) INTERNAL_CATCH_INFO( #msg " := " << msg, "CATCH_CAPTURE" ) #ifdef CATCH_CONFIG_VARIADIC_MACROS #define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) #define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) #define CATCH_METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) #define CATCH_REGISTER_TEST_CASE( ... ) INTERNAL_CATCH_REGISTER_TESTCASE( __VA_ARGS__ ) #define CATCH_SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) #define CATCH_FAIL( ... ) INTERNAL_CATCH_MSG( Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, "CATCH_FAIL", __VA_ARGS__ ) #define CATCH_SUCCEED( ... ) INTERNAL_CATCH_MSG( Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, "CATCH_SUCCEED", __VA_ARGS__ ) #else #define CATCH_TEST_CASE( name, description ) INTERNAL_CATCH_TESTCASE( name, description ) #define CATCH_TEST_CASE_METHOD( className, name, description ) INTERNAL_CATCH_TEST_CASE_METHOD( className, name, description ) #define CATCH_METHOD_AS_TEST_CASE( method, name, description ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, name, description ) #define CATCH_REGISTER_TEST_CASE( function, name, description ) INTERNAL_CATCH_REGISTER_TESTCASE( function, name, description ) #define CATCH_SECTION( name, description ) INTERNAL_CATCH_SECTION( name, description ) #define CATCH_FAIL( msg ) INTERNAL_CATCH_MSG( Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, "CATCH_FAIL", msg ) #define CATCH_SUCCEED( msg ) INTERNAL_CATCH_MSG( Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, "CATCH_SUCCEED", msg ) #endif #define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE( "", "" ) #define CATCH_REGISTER_REPORTER( name, reporterType ) INTERNAL_CATCH_REGISTER_REPORTER( name, reporterType ) #define CATCH_REGISTER_LEGACY_REPORTER( name, reporterType ) INTERNAL_CATCH_REGISTER_LEGACY_REPORTER( name, reporterType ) #define CATCH_GENERATE( expr) INTERNAL_CATCH_GENERATE( expr ) // "BDD-style" convenience wrappers #ifdef CATCH_CONFIG_VARIADIC_MACROS #define CATCH_SCENARIO( ... ) CATCH_TEST_CASE( "Scenario: " __VA_ARGS__ ) #define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) #else #define CATCH_SCENARIO( name, tags ) CATCH_TEST_CASE( "Scenario: " name, tags ) #define CATCH_SCENARIO_METHOD( className, name, tags ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " name, tags ) #endif #define CATCH_GIVEN( desc ) CATCH_SECTION( std::string( "Given: ") + desc, "" ) #define CATCH_WHEN( desc ) CATCH_SECTION( std::string( " When: ") + desc, "" ) #define CATCH_AND_WHEN( desc ) CATCH_SECTION( std::string( " And: ") + desc, "" ) #define CATCH_THEN( desc ) CATCH_SECTION( std::string( " Then: ") + desc, "" ) #define CATCH_AND_THEN( desc ) CATCH_SECTION( std::string( " And: ") + desc, "" ) // If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required #else #define REQUIRE( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::Normal, "REQUIRE" ) #define REQUIRE_FALSE( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, "REQUIRE_FALSE" ) #define REQUIRE_THROWS( expr ) INTERNAL_CATCH_THROWS( expr, Catch::ResultDisposition::Normal, "", "REQUIRE_THROWS" ) #define REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( expr, exceptionType, Catch::ResultDisposition::Normal, "REQUIRE_THROWS_AS" ) #define REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS( expr, Catch::ResultDisposition::Normal, matcher, "REQUIRE_THROWS_WITH" ) #define REQUIRE_NOTHROW( expr ) INTERNAL_CATCH_NO_THROW( expr, Catch::ResultDisposition::Normal, "REQUIRE_NOTHROW" ) #define CHECK( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::ContinueOnFailure, "CHECK" ) #define CHECK_FALSE( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, "CHECK_FALSE" ) #define CHECKED_IF( expr ) INTERNAL_CATCH_IF( expr, Catch::ResultDisposition::ContinueOnFailure, "CHECKED_IF" ) #define CHECKED_ELSE( expr ) INTERNAL_CATCH_ELSE( expr, Catch::ResultDisposition::ContinueOnFailure, "CHECKED_ELSE" ) #define CHECK_NOFAIL( expr ) INTERNAL_CATCH_TEST( expr, Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, "CHECK_NOFAIL" ) #define CHECK_THROWS( expr ) INTERNAL_CATCH_THROWS( expr, Catch::ResultDisposition::ContinueOnFailure, "", "CHECK_THROWS" ) #define CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( expr, exceptionType, Catch::ResultDisposition::ContinueOnFailure, "CHECK_THROWS_AS" ) #define CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS( expr, Catch::ResultDisposition::ContinueOnFailure, matcher, "CHECK_THROWS_WITH" ) #define CHECK_NOTHROW( expr ) INTERNAL_CATCH_NO_THROW( expr, Catch::ResultDisposition::ContinueOnFailure, "CHECK_NOTHROW" ) #define CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( arg, matcher, Catch::ResultDisposition::ContinueOnFailure, "CHECK_THAT" ) #define REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( arg, matcher, Catch::ResultDisposition::Normal, "REQUIRE_THAT" ) #define INFO( msg ) INTERNAL_CATCH_INFO( msg, "INFO" ) #define WARN( msg ) INTERNAL_CATCH_MSG( Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, "WARN", msg ) #define SCOPED_INFO( msg ) INTERNAL_CATCH_INFO( msg, "INFO" ) #define CAPTURE( msg ) INTERNAL_CATCH_INFO( #msg " := " << msg, "CAPTURE" ) #define SCOPED_CAPTURE( msg ) INTERNAL_CATCH_INFO( #msg " := " << msg, "CAPTURE" ) #ifdef CATCH_CONFIG_VARIADIC_MACROS #define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) #define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) #define METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) #define REGISTER_TEST_CASE( ... ) INTERNAL_CATCH_REGISTER_TESTCASE( __VA_ARGS__ ) #define SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) #define FAIL( ... ) INTERNAL_CATCH_MSG( Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, "FAIL", __VA_ARGS__ ) #define SUCCEED( ... ) INTERNAL_CATCH_MSG( Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, "SUCCEED", __VA_ARGS__ ) #else #define TEST_CASE( name, description ) INTERNAL_CATCH_TESTCASE( name, description ) #define TEST_CASE_METHOD( className, name, description ) INTERNAL_CATCH_TEST_CASE_METHOD( className, name, description ) #define METHOD_AS_TEST_CASE( method, name, description ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, name, description ) #define REGISTER_TEST_CASE( ... ) INTERNAL_CATCH_REGISTER_TESTCASE( __VA_ARGS__ ) #define SECTION( name, description ) INTERNAL_CATCH_SECTION( name, description ) #define FAIL( msg ) INTERNAL_CATCH_MSG( Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, "FAIL", msg ) #define SUCCEED( msg ) INTERNAL_CATCH_MSG( Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, "SUCCEED", msg ) #endif #define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE( "", "" ) #define REGISTER_REPORTER( name, reporterType ) INTERNAL_CATCH_REGISTER_REPORTER( name, reporterType ) #define REGISTER_LEGACY_REPORTER( name, reporterType ) INTERNAL_CATCH_REGISTER_LEGACY_REPORTER( name, reporterType ) #define GENERATE( expr) INTERNAL_CATCH_GENERATE( expr ) #endif #define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) // "BDD-style" convenience wrappers #ifdef CATCH_CONFIG_VARIADIC_MACROS #define SCENARIO( ... ) TEST_CASE( "Scenario: " __VA_ARGS__ ) #define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) #else #define SCENARIO( name, tags ) TEST_CASE( "Scenario: " name, tags ) #define SCENARIO_METHOD( className, name, tags ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " name, tags ) #endif #define GIVEN( desc ) SECTION( std::string(" Given: ") + desc, "" ) #define WHEN( desc ) SECTION( std::string(" When: ") + desc, "" ) #define AND_WHEN( desc ) SECTION( std::string("And when: ") + desc, "" ) #define THEN( desc ) SECTION( std::string(" Then: ") + desc, "" ) #define AND_THEN( desc ) SECTION( std::string(" And: ") + desc, "" ) using Catch::Detail::Approx; #endif // TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED