pax_global_header 0000666 0000000 0000000 00000000064 13146565224 0014522 g ustar 00root root 0000000 0000000 52 comment=663369862b9c6d02da77d6a5dd22dba8e467422e
pymummer-0.10.3/ 0000775 0000000 0000000 00000000000 13146565224 0013456 5 ustar 00root root 0000000 0000000 pymummer-0.10.3/.gitignore 0000664 0000000 0000000 00000001243 13146565224 0015446 0 ustar 00root root 0000000 0000000 # Byte-compiled / optimized / DLL files
__pycache__/
*.py[cod]
# C extensions
*.so
# Distribution / packaging
.Python
env/
build/
develop-eggs/
dist/
downloads/
eggs/
lib/
lib64/
parts/
sdist/
var/
*.egg-info/
.installed.cfg
*.egg
# PyInstaller
# Usually these files are written by a python script from a template
# before PyInstaller builds the exe, so as to inject date/other infos into it.
*.manifest
*.spec
# Installer logs
pip-log.txt
pip-delete-this-directory.txt
# Unit test / coverage reports
htmlcov/
.tox/
.coverage
.cache
nosetests.xml
coverage.xml
# Translations
*.mo
*.pot
# Django stuff:
*.log
# Sphinx documentation
docs/_build/
# PyBuilder
target/
pymummer-0.10.3/.travis.yml 0000664 0000000 0000000 00000000371 13146565224 0015570 0 ustar 00root root 0000000 0000000 language: python
addons:
apt:
packages:
- g++
- python-dev
cache:
directories:
- "build"
- "$HOME/.cache/pip"
python:
- "3.3"
- "3.4"
sudo: false
install:
- "source ./install_dependencies.sh"
script: "python setup.py test"
pymummer-0.10.3/AUTHORS 0000664 0000000 0000000 00000000117 13146565224 0014525 0 ustar 00root root 0000000 0000000 Martin Hunt (path-help@sanger.ac.uk)
Nishadi De Silva (path-help@sanger.ac.uk)
pymummer-0.10.3/LICENSE 0000664 0000000 0000000 00000104615 13146565224 0014472 0 ustar 00root root 0000000 0000000 Copyright (c) 2015 - 2017 by Genome Research Ltd.
This is free software, licensed under:
GNU GENERAL PUBLIC LICENSE
Version 3, 29 June 2007
Copyright (C) 2007 Free Software Foundation, Inc.
Everyone is permitted to copy and distribute verbatim copies
of this license document, but changing it is not allowed.
Preamble
The GNU General Public License is a free, copyleft license for
software and other kinds of works.
The licenses for most software and other practical works are designed
to take away your freedom to share and change the works. By contrast,
the GNU General Public License is intended to guarantee your freedom to
share and change all versions of a program--to make sure it remains free
software for all its users. We, the Free Software Foundation, use the
GNU General Public License for most of our software; it applies also to
any other work released this way by its authors. You can apply it to
your programs, too.
When we speak of free software, we are referring to freedom, not
price. Our General Public Licenses are designed to make sure that you
have the freedom to distribute copies of free software (and charge for
them if you wish), that you receive source code or can get it if you
want it, that you can change the software or use pieces of it in new
free programs, and that you know you can do these things.
To protect your rights, we need to prevent others from denying you
these rights or asking you to surrender the rights. Therefore, you have
certain responsibilities if you distribute copies of the software, or if
you modify it: responsibilities to respect the freedom of others.
For example, if you distribute copies of such a program, whether
gratis or for a fee, you must pass on to the recipients the same
freedoms that you received. You must make sure that they, too, receive
or can get the source code. And you must show them these terms so they
know their rights.
Developers that use the GNU GPL protect your rights with two steps:
(1) assert copyright on the software, and (2) offer you this License
giving you legal permission to copy, distribute and/or modify it.
For the developers' and authors' protection, the GPL clearly explains
that there is no warranty for this free software. For both users' and
authors' sake, the GPL requires that modified versions be marked as
changed, so that their problems will not be attributed erroneously to
authors of previous versions.
Some devices are designed to deny users access to install or run
modified versions of the software inside them, although the manufacturer
can do so. This is fundamentally incompatible with the aim of
protecting users' freedom to change the software. The systematic
pattern of such abuse occurs in the area of products for individuals to
use, which is precisely where it is most unacceptable. Therefore, we
have designed this version of the GPL to prohibit the practice for those
products. If such problems arise substantially in other domains, we
stand ready to extend this provision to those domains in future versions
of the GPL, as needed to protect the freedom of users.
Finally, every program is threatened constantly by software patents.
States should not allow patents to restrict development and use of
software on general-purpose computers, but in those that do, we wish to
avoid the special danger that patents applied to a free program could
make it effectively proprietary. To prevent this, the GPL assures that
patents cannot be used to render the program non-free.
The precise terms and conditions for copying, distribution and
modification follow.
TERMS AND CONDITIONS
0. Definitions.
"This License" refers to version 3 of the GNU General Public License.
"Copyright" also means copyright-like laws that apply to other kinds of
works, such as semiconductor masks.
"The Program" refers to any copyrightable work licensed under this
License. Each licensee is addressed as "you". "Licensees" and
"recipients" may be individuals or organizations.
To "modify" a work means to copy from or adapt all or part of the work
in a fashion requiring copyright permission, other than the making of an
exact copy. The resulting work is called a "modified version" of the
earlier work or a work "based on" the earlier work.
A "covered work" means either the unmodified Program or a work based
on the Program.
To "propagate" a work means to do anything with it that, without
permission, would make you directly or secondarily liable for
infringement under applicable copyright law, except executing it on a
computer or modifying a private copy. Propagation includes copying,
distribution (with or without modification), making available to the
public, and in some countries other activities as well.
To "convey" a work means any kind of propagation that enables other
parties to make or receive copies. Mere interaction with a user through
a computer network, with no transfer of a copy, is not conveying.
An interactive user interface displays "Appropriate Legal Notices"
to the extent that it includes a convenient and prominently visible
feature that (1) displays an appropriate copyright notice, and (2)
tells the user that there is no warranty for the work (except to the
extent that warranties are provided), that licensees may convey the
work under this License, and how to view a copy of this License. If
the interface presents a list of user commands or options, such as a
menu, a prominent item in the list meets this criterion.
1. Source Code.
The "source code" for a work means the preferred form of the work
for making modifications to it. "Object code" means any non-source
form of a work.
A "Standard Interface" means an interface that either is an official
standard defined by a recognized standards body, or, in the case of
interfaces specified for a particular programming language, one that
is widely used among developers working in that language.
The "System Libraries" of an executable work include anything, other
than the work as a whole, that (a) is included in the normal form of
packaging a Major Component, but which is not part of that Major
Component, and (b) serves only to enable use of the work with that
Major Component, or to implement a Standard Interface for which an
implementation is available to the public in source code form. A
"Major Component", in this context, means a major essential component
(kernel, window system, and so on) of the specific operating system
(if any) on which the executable work runs, or a compiler used to
produce the work, or an object code interpreter used to run it.
The "Corresponding Source" for a work in object code form means all
the source code needed to generate, install, and (for an executable
work) run the object code and to modify the work, including scripts to
control those activities. However, it does not include the work's
System Libraries, or general-purpose tools or generally available free
programs which are used unmodified in performing those activities but
which are not part of the work. For example, Corresponding Source
includes interface definition files associated with source files for
the work, and the source code for shared libraries and dynamically
linked subprograms that the work is specifically designed to require,
such as by intimate data communication or control flow between those
subprograms and other parts of the work.
The Corresponding Source need not include anything that users
can regenerate automatically from other parts of the Corresponding
Source.
The Corresponding Source for a work in source code form is that
same work.
2. Basic Permissions.
All rights granted under this License are granted for the term of
copyright on the Program, and are irrevocable provided the stated
conditions are met. This License explicitly affirms your unlimited
permission to run the unmodified Program. The output from running a
covered work is covered by this License only if the output, given its
content, constitutes a covered work. This License acknowledges your
rights of fair use or other equivalent, as provided by copyright law.
You may make, run and propagate covered works that you do not
convey, without conditions so long as your license otherwise remains
in force. You may convey covered works to others for the sole purpose
of having them make modifications exclusively for you, or provide you
with facilities for running those works, provided that you comply with
the terms of this License in conveying all material for which you do
not control copyright. Those thus making or running the covered works
for you must do so exclusively on your behalf, under your direction
and control, on terms that prohibit them from making any copies of
your copyrighted material outside their relationship with you.
Conveying under any other circumstances is permitted solely under
the conditions stated below. Sublicensing is not allowed; section 10
makes it unnecessary.
3. Protecting Users' Legal Rights From Anti-Circumvention Law.
No covered work shall be deemed part of an effective technological
measure under any applicable law fulfilling obligations under article
11 of the WIPO copyright treaty adopted on 20 December 1996, or
similar laws prohibiting or restricting circumvention of such
measures.
When you convey a covered work, you waive any legal power to forbid
circumvention of technological measures to the extent such circumvention
is effected by exercising rights under this License with respect to
the covered work, and you disclaim any intention to limit operation or
modification of the work as a means of enforcing, against the work's
users, your or third parties' legal rights to forbid circumvention of
technological measures.
4. Conveying Verbatim Copies.
You may convey verbatim copies of the Program's source code as you
receive it, in any medium, provided that you conspicuously and
appropriately publish on each copy an appropriate copyright notice;
keep intact all notices stating that this License and any
non-permissive terms added in accord with section 7 apply to the code;
keep intact all notices of the absence of any warranty; and give all
recipients a copy of this License along with the Program.
You may charge any price or no price for each copy that you convey,
and you may offer support or warranty protection for a fee.
5. Conveying Modified Source Versions.
You may convey a work based on the Program, or the modifications to
produce it from the Program, in the form of source code under the
terms of section 4, provided that you also meet all of these conditions:
a) The work must carry prominent notices stating that you modified
it, and giving a relevant date.
b) The work must carry prominent notices stating that it is
released under this License and any conditions added under section
7. This requirement modifies the requirement in section 4 to
"keep intact all notices".
c) You must license the entire work, as a whole, under this
License to anyone who comes into possession of a copy. This
License will therefore apply, along with any applicable section 7
additional terms, to the whole of the work, and all its parts,
regardless of how they are packaged. This License gives no
permission to license the work in any other way, but it does not
invalidate such permission if you have separately received it.
d) If the work has interactive user interfaces, each must display
Appropriate Legal Notices; however, if the Program has interactive
interfaces that do not display Appropriate Legal Notices, your
work need not make them do so.
A compilation of a covered work with other separate and independent
works, which are not by their nature extensions of the covered work,
and which are not combined with it such as to form a larger program,
in or on a volume of a storage or distribution medium, is called an
"aggregate" if the compilation and its resulting copyright are not
used to limit the access or legal rights of the compilation's users
beyond what the individual works permit. Inclusion of a covered work
in an aggregate does not cause this License to apply to the other
parts of the aggregate.
6. Conveying Non-Source Forms.
You may convey a covered work in object code form under the terms
of sections 4 and 5, provided that you also convey the
machine-readable Corresponding Source under the terms of this License,
in one of these ways:
a) Convey the object code in, or embodied in, a physical product
(including a physical distribution medium), accompanied by the
Corresponding Source fixed on a durable physical medium
customarily used for software interchange.
b) Convey the object code in, or embodied in, a physical product
(including a physical distribution medium), accompanied by a
written offer, valid for at least three years and valid for as
long as you offer spare parts or customer support for that product
model, to give anyone who possesses the object code either (1) a
copy of the Corresponding Source for all the software in the
product that is covered by this License, on a durable physical
medium customarily used for software interchange, for a price no
more than your reasonable cost of physically performing this
conveying of source, or (2) access to copy the
Corresponding Source from a network server at no charge.
c) Convey individual copies of the object code with a copy of the
written offer to provide the Corresponding Source. This
alternative is allowed only occasionally and noncommercially, and
only if you received the object code with such an offer, in accord
with subsection 6b.
d) Convey the object code by offering access from a designated
place (gratis or for a charge), and offer equivalent access to the
Corresponding Source in the same way through the same place at no
further charge. You need not require recipients to copy the
Corresponding Source along with the object code. If the place to
copy the object code is a network server, the Corresponding Source
may be on a different server (operated by you or a third party)
that supports equivalent copying facilities, provided you maintain
clear directions next to the object code saying where to find the
Corresponding Source. Regardless of what server hosts the
Corresponding Source, you remain obligated to ensure that it is
available for as long as needed to satisfy these requirements.
e) Convey the object code using peer-to-peer transmission, provided
you inform other peers where the object code and Corresponding
Source of the work are being offered to the general public at no
charge under subsection 6d.
A separable portion of the object code, whose source code is excluded
from the Corresponding Source as a System Library, need not be
included in conveying the object code work.
A "User Product" is either (1) a "consumer product", which means any
tangible personal property which is normally used for personal, family,
or household purposes, or (2) anything designed or sold for incorporation
into a dwelling. In determining whether a product is a consumer product,
doubtful cases shall be resolved in favor of coverage. For a particular
product received by a particular user, "normally used" refers to a
typical or common use of that class of product, regardless of the status
of the particular user or of the way in which the particular user
actually uses, or expects or is expected to use, the product. A product
is a consumer product regardless of whether the product has substantial
commercial, industrial or non-consumer uses, unless such uses represent
the only significant mode of use of the product.
"Installation Information" for a User Product means any methods,
procedures, authorization keys, or other information required to install
and execute modified versions of a covered work in that User Product from
a modified version of its Corresponding Source. The information must
suffice to ensure that the continued functioning of the modified object
code is in no case prevented or interfered with solely because
modification has been made.
If you convey an object code work under this section in, or with, or
specifically for use in, a User Product, and the conveying occurs as
part of a transaction in which the right of possession and use of the
User Product is transferred to the recipient in perpetuity or for a
fixed term (regardless of how the transaction is characterized), the
Corresponding Source conveyed under this section must be accompanied
by the Installation Information. But this requirement does not apply
if neither you nor any third party retains the ability to install
modified object code on the User Product (for example, the work has
been installed in ROM).
The requirement to provide Installation Information does not include a
requirement to continue to provide support service, warranty, or updates
for a work that has been modified or installed by the recipient, or for
the User Product in which it has been modified or installed. Access to a
network may be denied when the modification itself materially and
adversely affects the operation of the network or violates the rules and
protocols for communication across the network.
Corresponding Source conveyed, and Installation Information provided,
in accord with this section must be in a format that is publicly
documented (and with an implementation available to the public in
source code form), and must require no special password or key for
unpacking, reading or copying.
7. Additional Terms.
"Additional permissions" are terms that supplement the terms of this
License by making exceptions from one or more of its conditions.
Additional permissions that are applicable to the entire Program shall
be treated as though they were included in this License, to the extent
that they are valid under applicable law. If additional permissions
apply only to part of the Program, that part may be used separately
under those permissions, but the entire Program remains governed by
this License without regard to the additional permissions.
When you convey a copy of a covered work, you may at your option
remove any additional permissions from that copy, or from any part of
it. (Additional permissions may be written to require their own
removal in certain cases when you modify the work.) You may place
additional permissions on material, added by you to a covered work,
for which you have or can give appropriate copyright permission.
Notwithstanding any other provision of this License, for material you
add to a covered work, you may (if authorized by the copyright holders of
that material) supplement the terms of this License with terms:
a) Disclaiming warranty or limiting liability differently from the
terms of sections 15 and 16 of this License; or
b) Requiring preservation of specified reasonable legal notices or
author attributions in that material or in the Appropriate Legal
Notices displayed by works containing it; or
c) Prohibiting misrepresentation of the origin of that material, or
requiring that modified versions of such material be marked in
reasonable ways as different from the original version; or
d) Limiting the use for publicity purposes of names of licensors or
authors of the material; or
e) Declining to grant rights under trademark law for use of some
trade names, trademarks, or service marks; or
f) Requiring indemnification of licensors and authors of that
material by anyone who conveys the material (or modified versions of
it) with contractual assumptions of liability to the recipient, for
any liability that these contractual assumptions directly impose on
those licensors and authors.
All other non-permissive additional terms are considered "further
restrictions" within the meaning of section 10. If the Program as you
received it, or any part of it, contains a notice stating that it is
governed by this License along with a term that is a further
restriction, you may remove that term. If a license document contains
a further restriction but permits relicensing or conveying under this
License, you may add to a covered work material governed by the terms
of that license document, provided that the further restriction does
not survive such relicensing or conveying.
If you add terms to a covered work in accord with this section, you
must place, in the relevant source files, a statement of the
additional terms that apply to those files, or a notice indicating
where to find the applicable terms.
Additional terms, permissive or non-permissive, may be stated in the
form of a separately written license, or stated as exceptions;
the above requirements apply either way.
8. Termination.
You may not propagate or modify a covered work except as expressly
provided under this License. Any attempt otherwise to propagate or
modify it is void, and will automatically terminate your rights under
this License (including any patent licenses granted under the third
paragraph of section 11).
However, if you cease all violation of this License, then your
license from a particular copyright holder is reinstated (a)
provisionally, unless and until the copyright holder explicitly and
finally terminates your license, and (b) permanently, if the copyright
holder fails to notify you of the violation by some reasonable means
prior to 60 days after the cessation.
Moreover, your license from a particular copyright holder is
reinstated permanently if the copyright holder notifies you of the
violation by some reasonable means, this is the first time you have
received notice of violation of this License (for any work) from that
copyright holder, and you cure the violation prior to 30 days after
your receipt of the notice.
Termination of your rights under this section does not terminate the
licenses of parties who have received copies or rights from you under
this License. If your rights have been terminated and not permanently
reinstated, you do not qualify to receive new licenses for the same
material under section 10.
9. Acceptance Not Required for Having Copies.
You are not required to accept this License in order to receive or
run a copy of the Program. Ancillary propagation of a covered work
occurring solely as a consequence of using peer-to-peer transmission
to receive a copy likewise does not require acceptance. However,
nothing other than this License grants you permission to propagate or
modify any covered work. These actions infringe copyright if you do
not accept this License. Therefore, by modifying or propagating a
covered work, you indicate your acceptance of this License to do so.
10. Automatic Licensing of Downstream Recipients.
Each time you convey a covered work, the recipient automatically
receives a license from the original licensors, to run, modify and
propagate that work, subject to this License. You are not responsible
for enforcing compliance by third parties with this License.
An "entity transaction" is a transaction transferring control of an
organization, or substantially all assets of one, or subdividing an
organization, or merging organizations. If propagation of a covered
work results from an entity transaction, each party to that
transaction who receives a copy of the work also receives whatever
licenses to the work the party's predecessor in interest had or could
give under the previous paragraph, plus a right to possession of the
Corresponding Source of the work from the predecessor in interest, if
the predecessor has it or can get it with reasonable efforts.
You may not impose any further restrictions on the exercise of the
rights granted or affirmed under this License. For example, you may
not impose a license fee, royalty, or other charge for exercise of
rights granted under this License, and you may not initiate litigation
(including a cross-claim or counterclaim in a lawsuit) alleging that
any patent claim is infringed by making, using, selling, offering for
sale, or importing the Program or any portion of it.
11. Patents.
A "contributor" is a copyright holder who authorizes use under this
License of the Program or a work on which the Program is based. The
work thus licensed is called the contributor's "contributor version".
A contributor's "essential patent claims" are all patent claims
owned or controlled by the contributor, whether already acquired or
hereafter acquired, that would be infringed by some manner, permitted
by this License, of making, using, or selling its contributor version,
but do not include claims that would be infringed only as a
consequence of further modification of the contributor version. For
purposes of this definition, "control" includes the right to grant
patent sublicenses in a manner consistent with the requirements of
this License.
Each contributor grants you a non-exclusive, worldwide, royalty-free
patent license under the contributor's essential patent claims, to
make, use, sell, offer for sale, import and otherwise run, modify and
propagate the contents of its contributor version.
In the following three paragraphs, a "patent license" is any express
agreement or commitment, however denominated, not to enforce a patent
(such as an express permission to practice a patent or covenant not to
sue for patent infringement). To "grant" such a patent license to a
party means to make such an agreement or commitment not to enforce a
patent against the party.
If you convey a covered work, knowingly relying on a patent license,
and the Corresponding Source of the work is not available for anyone
to copy, free of charge and under the terms of this License, through a
publicly available network server or other readily accessible means,
then you must either (1) cause the Corresponding Source to be so
available, or (2) arrange to deprive yourself of the benefit of the
patent license for this particular work, or (3) arrange, in a manner
consistent with the requirements of this License, to extend the patent
license to downstream recipients. "Knowingly relying" means you have
actual knowledge that, but for the patent license, your conveying the
covered work in a country, or your recipient's use of the covered work
in a country, would infringe one or more identifiable patents in that
country that you have reason to believe are valid.
If, pursuant to or in connection with a single transaction or
arrangement, you convey, or propagate by procuring conveyance of, a
covered work, and grant a patent license to some of the parties
receiving the covered work authorizing them to use, propagate, modify
or convey a specific copy of the covered work, then the patent license
you grant is automatically extended to all recipients of the covered
work and works based on it.
A patent license is "discriminatory" if it does not include within
the scope of its coverage, prohibits the exercise of, or is
conditioned on the non-exercise of one or more of the rights that are
specifically granted under this License. You may not convey a covered
work if you are a party to an arrangement with a third party that is
in the business of distributing software, under which you make payment
to the third party based on the extent of your activity of conveying
the work, and under which the third party grants, to any of the
parties who would receive the covered work from you, a discriminatory
patent license (a) in connection with copies of the covered work
conveyed by you (or copies made from those copies), or (b) primarily
for and in connection with specific products or compilations that
contain the covered work, unless you entered into that arrangement,
or that patent license was granted, prior to 28 March 2007.
Nothing in this License shall be construed as excluding or limiting
any implied license or other defenses to infringement that may
otherwise be available to you under applicable patent law.
12. No Surrender of Others' Freedom.
If conditions are imposed on you (whether by court order, agreement or
otherwise) that contradict the conditions of this License, they do not
excuse you from the conditions of this License. If you cannot convey a
covered work so as to satisfy simultaneously your obligations under this
License and any other pertinent obligations, then as a consequence you may
not convey it at all. For example, if you agree to terms that obligate you
to collect a royalty for further conveying from those to whom you convey
the Program, the only way you could satisfy both those terms and this
License would be to refrain entirely from conveying the Program.
13. Use with the GNU Affero General Public License.
Notwithstanding any other provision of this License, you have
permission to link or combine any covered work with a work licensed
under version 3 of the GNU Affero General Public License into a single
combined work, and to convey the resulting work. The terms of this
License will continue to apply to the part which is the covered work,
but the special requirements of the GNU Affero General Public License,
section 13, concerning interaction through a network will apply to the
combination as such.
14. Revised Versions of this License.
The Free Software Foundation may publish revised and/or new versions of
the GNU General Public License from time to time. Such new versions will
be similar in spirit to the present version, but may differ in detail to
address new problems or concerns.
Each version is given a distinguishing version number. If the
Program specifies that a certain numbered version of the GNU General
Public License "or any later version" applies to it, you have the
option of following the terms and conditions either of that numbered
version or of any later version published by the Free Software
Foundation. If the Program does not specify a version number of the
GNU General Public License, you may choose any version ever published
by the Free Software Foundation.
If the Program specifies that a proxy can decide which future
versions of the GNU General Public License can be used, that proxy's
public statement of acceptance of a version permanently authorizes you
to choose that version for the Program.
Later license versions may give you additional or different
permissions. However, no additional obligations are imposed on any
author or copyright holder as a result of your choosing to follow a
later version.
15. Disclaimer of Warranty.
THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
16. Limitation of Liability.
IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
SUCH DAMAGES.
17. Interpretation of Sections 15 and 16.
If the disclaimer of warranty and limitation of liability provided
above cannot be given local legal effect according to their terms,
reviewing courts shall apply local law that most closely approximates
an absolute waiver of all civil liability in connection with the
Program, unless a warranty or assumption of liability accompanies a
copy of the Program in return for a fee.
END OF TERMS AND CONDITIONS
How to Apply These Terms to Your New Programs
If you develop a new program, and you want it to be of the greatest
possible use to the public, the best way to achieve this is to make it
free software which everyone can redistribute and change under these terms.
To do so, attach the following notices to the program. It is safest
to attach them to the start of each source file to most effectively
state the exclusion of warranty; and each file should have at least
the "copyright" line and a pointer to where the full notice is found.
{one line to give the program's name and a brief idea of what it does.}
Copyright (C) {year} {name of author}
This program is free software: you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation, either version 3 of the License, or
(at your option) any later version.
This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
You should have received a copy of the GNU General Public License
along with this program. If not, see .
Also add information on how to contact you by electronic and paper mail.
If the program does terminal interaction, make it output a short
notice like this when it starts in an interactive mode:
{project} Copyright (C) {year} {fullname}
This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
This is free software, and you are welcome to redistribute it
under certain conditions; type `show c' for details.
The hypothetical commands `show w' and `show c' should show the appropriate
parts of the General Public License. Of course, your program's commands
might be different; for a GUI interface, you would use an "about box".
You should also get your employer (if you work as a programmer) or school,
if any, to sign a "copyright disclaimer" for the program, if necessary.
For more information on this, and how to apply and follow the GNU GPL, see
.
The GNU General Public License does not permit incorporating your program
into proprietary programs. If your program is a subroutine library, you
may consider it more useful to permit linking proprietary applications with
the library. If this is what you want to do, use the GNU Lesser General
Public License instead of this License. But first, please read
.
pymummer-0.10.3/README.md 0000664 0000000 0000000 00000004072 13146565224 0014740 0 ustar 00root root 0000000 0000000 pymummer
========
Python3 wrapper for running MUMmer and parsing the output.
[](https://travis-ci.org/sanger-pathogens/pymummer)
Installation
------------
###Homebrew/LinuxBrew###
```
brew tap homebrew/python
brew install pymummer
```
##Pip
###Pre-requisites###
The MUMmer package must be installed.
Instructions to install MUMmer can be found [here](http://mummer.sourceforge.net/manual/#installation)
###Installation###
Install with
pip3 install pymummer
Usage (for developers)
----------------------
Example showing how pymummer can be used to run nucmer on a fasta file and parse the output file to produce a set of alignment objects:
from pymummer import coords_file, alignment, nucmer
...
runner = nucmer.Runner(reference_file, query_file, results_file)
runner.run()
file_reader = coords_file.reader(results_file)
alignments = [coord for coord in file_reader if not coord.is_self_hit()] #Remove self hits
...
###pymummer nucmer class###
Wraps the `nucmer`, `delta-filter`, `show-coords` and `show-snps` commands.
Arguments:
__ref__ reference file
__query__ query file
__outfile__ output file
__min\_id__ min\_id for delta-filter command (default None)
__min\_length__ min\_length for delta-filter command (default None)
__breaklen__ breaklen for nucmer command (nucmer's default is 200)
__coords\_header__ print header in show-coords output (default True)
__maxmatch__ maxmatch for nucmer (default False)
__show\_snps__ run show-snps (default False)
__snps\_header__ print header in show-snps output (default True)
###pymummer promer class###
[TODO]
###pymummer coords_file class###
Parses the nucmer output and populate an alignment object for each hit in the output
###pymummer alignment class###
Check attributes of a hit, swap the reference and query, check if it's a self hit and so on
Contact
-------
Authors: Martin Hunt, Nishadi De Silva
Affiliation: Wellcome Trust Sanger Institute, Hinxton, UK
Email: path-help@sanger.ac.uk
pymummer-0.10.3/install_dependencies.sh 0000664 0000000 0000000 00000002345 13146565224 0020172 0 ustar 00root root 0000000 0000000 #!/bin/bash
set -x
set -e
start_dir=$(pwd)
MUMMER_VERSION="3.23"
MUMMER_DOWNLOAD_URL="http://sourceforge.net/projects/mummer/files/mummer/${MUMMER_VERSION}/MUMmer${MUMMER_VERSION}.tar.gz/download"
# Make an install location
if [ ! -d 'build' ]; then
mkdir build
fi
cd build
build_dir=$(pwd)
# DOWNLOAD ALL THE THINGS
download () {
url=$1
download_location=$2
if [ -e $download_location ]; then
echo "Skipping download of $url, $download_location already exists"
else
echo "Downloading $url to $download_location"
wget $url -O $download_location
fi
}
download $MUMMER_DOWNLOAD_URL "mummer-${MUMMER_VERSION}.tgz"
# Build all the things
cd $build_dir
## Mummer
mummer_dir=$(pwd)/MUMmer${MUMMER_VERSION}
if [ ! -d $mummer_dir ]; then
tar xzf mummer-${MUMMER_VERSION}.tgz
fi
cd $mummer_dir
if [ -e "${mummer_dir}/mummer" ]; then
echo "Already built Mummer; skipping build"
else
make check
make
cd ./src/tigr
make
fi
cd $build_dir
# Setup environment variables
update_path () {
new_dir=$1
export PATH=${PATH:-$new_dir}
if [[ ! "$PATH" =~ (^|:)"${new_dir}"(:|$) ]]; then
export PATH=${new_dir}:${PATH}
fi
}
update_path ${mummer_dir}
update_path ${mummer_dir}/src/tigr
cd $start_dir
set +x
set +e
pymummer-0.10.3/pymummer/ 0000775 0000000 0000000 00000000000 13146565224 0015331 5 ustar 00root root 0000000 0000000 pymummer-0.10.3/pymummer/__init__.py 0000664 0000000 0000000 00000000435 13146565224 0017444 0 ustar 00root root 0000000 0000000 from pkg_resources import get_distribution
try:
__version__ = get_distribution('pymummer').version
except:
__version__ = 'local'
__all__ = [
'alignment',
'coords_file',
'nucmer',
'snp',
'snp_file',
'syscall',
'variant',
]
from pymummer import *
pymummer-0.10.3/pymummer/alignment.py 0000664 0000000 0000000 00000022712 13146565224 0017665 0 ustar 00root root 0000000 0000000 import pyfastaq
from pymummer import variant
class Error (Exception): pass
class Alignment:
def __init__(self, line):
'''Constructs Alignment object from a line of show-coords -dTlro'''
# nucmer:
# [S1] [E1] [S2] [E2] [LEN 1] [LEN 2] [% IDY] [LEN R] [LEN Q] [FRM] [TAGS]
#1162 25768 24536 4 24607 24533 99.32 640851 24536 1 -1 ref qry [CONTAINS]
# promer:
#[S1] [E1] [S2] [E2] [LEN 1] [LEN 2] [% IDY] [% SIM] [% STP] [LEN R] [LEN Q] [FRM] [TAGS]
# 1 1398 4891054 4892445 1398 1392 89.55 93.18 0.21 1398 5349013 1 1 ref qry [CONTAINED]
fields = line.rstrip().split('\t')
try:
self.ref_start = int(fields[0]) - 1
self.ref_end = int(fields[1]) - 1
self.qry_start = int(fields[2]) - 1
self.qry_end = int(fields[3]) - 1
self.hit_length_ref = int(fields[4])
self.hit_length_qry = int(fields[5])
self.percent_identity = float(fields[6])
if len(fields) >= 15: # promer has more fields
self.ref_length = int(fields[9])
self.qry_length = int(fields[10])
self.frame = int(fields[11])
self.ref_name = fields[13]
self.qry_name = fields[14]
else:
self.ref_length = int(fields[7])
self.qry_length = int(fields[8])
self.frame = int(fields[9])
self.ref_name = fields[11]
self.qry_name = fields[12]
except:
raise Error('Error reading this nucmer line:\n' + line)
def __eq__(self, other):
return type(other) is type(self) and self.__dict__ == other.__dict__
def __hash__(self):
return hash((self.ref_start, self.ref_end, self.qry_start, self.qry_end, self.hit_length_ref, self.hit_length_qry, self.percent_identity, self.ref_length, self.qry_length, self.frame, self.ref_name, self.qry_name))
def _swap(self):
'''Swaps the alignment so that the reference becomes the query and vice-versa. Swaps their names, coordinates etc. The frame is not changed'''
self.ref_start, self.qry_start = self.qry_start, self.ref_start
self.ref_end, self.qry_end = self.qry_end, self.ref_end
self.hit_length_ref, self.hit_length_qry = self.hit_length_qry, self.hit_length_ref
self.ref_length, self.qry_length = self.qry_length, self.ref_length
self.ref_name, self.qry_name = self.qry_name, self.ref_name
def qry_coords(self):
'''Returns a pyfastaq.intervals.Interval object of the start and end coordinates in the query sequence'''
return pyfastaq.intervals.Interval(min(self.qry_start, self.qry_end), max(self.qry_start, self.qry_end))
def ref_coords(self):
'''Returns a pyfastaq.intervals.Interval object of the start and end coordinates in the reference sequence'''
return pyfastaq.intervals.Interval(min(self.ref_start, self.ref_end), max(self.ref_start, self.ref_end))
def on_same_strand(self):
'''Returns true iff the direction of the alignment is the same in the reference and the query'''
return (self.ref_start < self.ref_end) == (self.qry_start < self.qry_end)
def is_self_hit(self):
'''Returns true iff the alignment is of a sequence to itself: names and all coordinates are the same and 100 percent identity'''
return self.ref_name == self.qry_name \
and self.ref_start == self.qry_start \
and self.ref_end == self.qry_end \
and self.percent_identity == 100
def reverse_query(self):
'''Changes the coordinates as if the query sequence has been reverse complemented'''
self.qry_start = self.qry_length - self.qry_start - 1
self.qry_end = self.qry_length - self.qry_end - 1
def reverse_reference(self):
'''Changes the coordinates as if the reference sequence has been reverse complemented'''
self.ref_start = self.ref_length - self.ref_start - 1
self.ref_end = self.ref_length - self.ref_end - 1
def __str__(self):
'''Returns a tab delimited string containing the values of this alignment object'''
return '\t'.join(str(x) for x in
[self.ref_start + 1,
self.ref_end + 1,
self.qry_start + 1,
self.qry_end + 1,
self.hit_length_ref,
self.hit_length_qry,
'{0:.2f}'.format(self.percent_identity),
self.ref_length,
self.qry_length,
self.frame,
self.ref_name,
self.qry_name])
def to_msp_crunch(self):
'''Returns the alignment as a line in MSPcrunch format. The columns are space-separated and are:
1. score
2. percent identity
3. match start in the query sequence
4. match end in the query sequence
5. query sequence name
6. subject sequence start
7. subject sequence end
8. subject sequence name'''
# we don't know the alignment score. Estimate it. This approximates 1 for a match.
aln_score = int(self.percent_identity * 0.005 * (self.hit_length_ref + self.hit_length_qry))
return ' '.join(str(x) for x in [
aln_score,
'{0:.2f}'.format(self.percent_identity),
self.qry_start + 1,
self.qry_end + 1,
self.qry_name,
self.ref_start + 1,
self.ref_end + 1,
self.ref_name
])
def intersects_variant(self, var):
var_ref_coords = sorted([var.ref_start, var.ref_end])
var_ref_coords = pyfastaq.intervals.Interval(var_ref_coords[0], var_ref_coords[1])
var_qry_coords = sorted([var.qry_start, var.qry_end])
var_qry_coords = pyfastaq.intervals.Interval(var_qry_coords[0], var_qry_coords[1])
return var_ref_coords.intersects(self.ref_coords()) and var_qry_coords.intersects(self.qry_coords())
def qry_coords_from_ref_coord(self, ref_coord, variant_list):
'''Given a reference position and a list of variants ([variant.Variant]),
works out the position in the query sequence, accounting for indels.
Returns a tuple: (position, True|False), where second element is whether
or not the ref_coord lies in an indel. If it is, then
returns the corresponding start position
of the indel in the query'''
if self.ref_coords().distance_to_point(ref_coord) > 0:
raise Error('Cannot get query coord in qry_coords_from_ref_coord because given ref_coord ' + str(ref_coord) + ' does not lie in nucmer alignment:\n' + str(self))
indel_variant_indexes = []
for i in range(len(variant_list)):
if variant_list[i].var_type not in {variant.INS, variant.DEL}:
continue
if not self.intersects_variant(variant_list[i]):
continue
if variant_list[i].ref_start <= ref_coord <= variant_list[i].ref_end:
return variant_list[i].qry_start, True
elif variant_list[i].ref_start < ref_coord:
indel_variant_indexes.append(i)
distance = ref_coord - min(self.ref_start, self.ref_end)
for i in indel_variant_indexes:
if variant_list[i].var_type == variant.INS:
distance += len(variant_list[i].qry_base)
else:
assert variant_list[i].var_type == variant.DEL
distance -= len(variant_list[i].ref_base)
if self.on_same_strand():
return min(self.qry_start, self.qry_end) + distance, False
else:
return max(self.qry_start, self.qry_end) - distance, False
def ref_coords_from_qry_coord(self, qry_coord, variant_list):
'''Given a qryerence position and a list of variants ([variant.Variant]),
works out the position in the ref sequence, accounting for indels.
Returns a tuple: (position, True|False), where second element is whether
or not the qry_coord lies in an indel. If it is, then
returns the corresponding start position
of the indel in the ref'''
if self.qry_coords().distance_to_point(qry_coord) > 0:
raise Error('Cannot get ref coord in ref_coords_from_qry_coord because given qry_coord ' + str(qry_coord) + ' does not lie in nucmer alignment:\n' + str(self))
indel_variant_indexes = []
for i in range(len(variant_list)):
if variant_list[i].var_type not in {variant.INS, variant.DEL}:
continue
if not self.intersects_variant(variant_list[i]):
continue
if variant_list[i].qry_start <= qry_coord <= variant_list[i].qry_end:
return variant_list[i].ref_start, True
elif variant_list[i].qry_start < qry_coord:
indel_variant_indexes.append(i)
distance = qry_coord - min(self.qry_start, self.qry_end)
for i in indel_variant_indexes:
if variant_list[i].var_type == variant.DEL:
distance += len(variant_list[i].ref_base)
else:
assert variant_list[i].var_type == variant.INS
distance -= len(variant_list[i].qry_base)
if self.on_same_strand():
return min(self.ref_start, self.ref_end) + distance, False
else:
return max(self.ref_start, self.ref_end) - distance, False
pymummer-0.10.3/pymummer/coords_file.py 0000664 0000000 0000000 00000003375 13146565224 0020203 0 ustar 00root root 0000000 0000000 import pyfastaq
from pymummer import alignment
class Error (Exception): pass
def reader(fname):
'''Helper function to open the results file (coords file) and create alignment objects with the values in it'''
f = pyfastaq.utils.open_file_read(fname)
for line in f:
if line.startswith('[') or (not '\t' in line):
continue
yield alignment.Alignment(line)
pyfastaq.utils.close(f)
def convert_to_msp_crunch(infile, outfile, ref_fai=None, qry_fai=None):
'''Converts a coords file to a file in MSPcrunch format (for use with ACT, most likely).
ACT ignores sequence names in the crunch file, and just looks at the numbers.
To make a compatible file, the coords all must be shifted appropriately, which
can be done by providing both the ref_fai and qry_fai options.
Both or neither of these must be used, otherwise an error will be thrown.'''
fai_files = {ref_fai, qry_fai}
if None in fai_files and len(fai_files) != 1:
print(fai_files)
raise Error('Error in convert_to_msp_crunch. Must use both of ref_fai and qry_fai, or neither of them')
if ref_fai is not None:
assert qry_fai is not None
ref_offsets = pyfastaq.tasks.length_offsets_from_fai(ref_fai)
qry_offsets = pyfastaq.tasks.length_offsets_from_fai(qry_fai)
file_reader = reader(infile)
f_out = pyfastaq.utils.open_file_write(outfile)
for aln in file_reader:
if ref_fai is not None:
aln.ref_start += ref_offsets[aln.ref_name]
aln.ref_end += ref_offsets[aln.ref_name]
aln.qry_start += qry_offsets[aln.qry_name]
aln.qry_end += qry_offsets[aln.qry_name]
print(aln.to_msp_crunch(), file=f_out)
pyfastaq.utils.close(f_out)
pymummer-0.10.3/pymummer/nucmer.py 0000664 0000000 0000000 00000010177 13146565224 0017202 0 ustar 00root root 0000000 0000000 import os
import tempfile
import shutil
import pyfastaq
from pymummer import syscall
class Error (Exception): pass
class Runner:
'''Handy reference for all the arguments needed for nucmer, delta-filter, show-coords, show-snps'''
def __init__(
self,
ref,
query,
outfile,
min_id=None,
min_length=None,
breaklen=None,
coords_header=True,
diagdiff=None,
diagfactor=None,
maxgap=None,
maxmatch=False,
mincluster=None,
simplify=True,
show_snps=False,
snps_header=True,
verbose=False,
promer=False,
show_snps_C=True,
):
self.qry = query
self.ref = ref
self.outfile = outfile
self.min_id = min_id
self.min_length = min_length
self.breaklen = breaklen
self.diagdiff = diagdiff
self.diagfactor = diagfactor
self.coords_header = coords_header
self.maxgap = maxgap
self.maxmatch = maxmatch
self.mincluster = mincluster
self.simplify = simplify
self.show_snps = show_snps
self.snps_header = snps_header
self.verbose = verbose
self.use_promer = promer
self.show_snps_C = show_snps_C
def _nucmer_command(self, ref, qry, outprefix):
'''Construct the nucmer command'''
if self.use_promer:
command = 'promer'
else:
command = 'nucmer'
command += ' -p ' + outprefix
if self.breaklen is not None:
command += ' -b ' + str(self.breaklen)
if self.diagdiff is not None and not self.use_promer:
command += ' -D ' + str(self.diagdiff)
if self.diagfactor:
command += ' -d ' + str(self.diagfactor)
if self.maxgap:
command += ' -g ' + str(self.maxgap)
if self.maxmatch:
command += ' --maxmatch'
if self.mincluster is not None:
command += ' -c ' + str(self.mincluster)
if not self.simplify and not self.use_promer:
command += ' --nosimplify'
return command + ' ' + ref + ' ' + qry
def _delta_filter_command(self, infile, outfile):
'''Construct delta-filter command'''
command = 'delta-filter'
if self.min_id is not None:
command += ' -i ' + str(self.min_id)
if self.min_length is not None:
command += ' -l ' + str(self.min_length)
return command + ' ' + infile + ' > ' + outfile
def _show_coords_command(self, infile, outfile):
'''Construct show-coords command'''
command = 'show-coords -dTlro'
if not self.coords_header:
command += ' -H'
return command + ' ' + infile + ' > ' + outfile
def _show_snps_command(self, infile, outfile):
command = 'show-snps -T' + ('C' if self.show_snps_C else '') + 'lr'
if not self.snps_header:
command += ' -H'
return command + ' ' + infile + ' > ' + outfile
def _write_script(self, script_name, ref, qry, outfile):
'''Write commands into a bash script'''
f = pyfastaq.utils.open_file_write(script_name)
print(self._nucmer_command(ref, qry, 'p'), file=f)
print(self._delta_filter_command('p.delta', 'p.delta.filter'), file=f)
print(self._show_coords_command('p.delta.filter', outfile), file=f)
if self.show_snps:
print(self._show_snps_command('p.delta.filter', outfile + '.snps'), file=f)
pyfastaq.utils.close(f)
def run(self):
'''
Change to a temp directory
Run bash script containing commands
Place results in specified output file
Clean up temp directory
'''
qry = os.path.abspath(self.qry)
ref = os.path.abspath(self.ref)
outfile = os.path.abspath(self.outfile)
tmpdir = tempfile.mkdtemp(prefix='tmp.run_nucmer.', dir=os.getcwd())
original_dir = os.getcwd()
os.chdir(tmpdir)
script = 'run_nucmer.sh'
self._write_script(script, ref, qry, outfile)
syscall.run('bash ' + script, verbose=self.verbose)
os.chdir(original_dir)
shutil.rmtree(tmpdir)
pymummer-0.10.3/pymummer/snp.py 0000664 0000000 0000000 00000002647 13146565224 0016514 0 ustar 00root root 0000000 0000000 class Error (Exception): pass
class Snp:
def __init__(self, line):
# Without the -C option to show-snps, looks like this:
#[P1] [SUB] [SUB] [P2] [BUFF] [DIST] [LEN R] [LEN Q] [FRM] [TAGS]
#187 A C 269 187 187 654 853 1 1 ref_name qry_name
# With the -C option to show-snps, looks like this:
#[P1] [SUB] [SUB] [P2] [BUFF] [DIST] [R] [Q] [LEN R] [LEN Q] [FRM] [TAGS]
#187 A C 269 187 187 0 0 654 853 1 1 ref_name qry_name
try:
l = line.rstrip().split('\t')
self.ref_pos = int(l[0]) - 1
self.ref_base = l[1]
self.qry_base = l[2]
self.qry_pos = int(l[3]) - 1
self.ref_length = int(l[-6])
self.qry_length = int(l[-5])
self.ref_name = l[-2]
self.qry_name = l[-1]
except:
raise Error('Error constructing pymummer.snp.Snp from mummer show-snps output at this line:\n' + line)
def __eq__(self, other):
return type(other) is type(self) and self.__dict__ == other.__dict__
def __str__(self):
return '\t'.join([str(x) for x in [
self.ref_pos + 1,
self.ref_base,
self.qry_base,
self.qry_pos + 1,
self.ref_length,
self.qry_length,
self.ref_name,
self.qry_name
]])
pymummer-0.10.3/pymummer/snp_file.py 0000664 0000000 0000000 00000001012 13146565224 0017474 0 ustar 00root root 0000000 0000000 import pyfastaq
from pymummer import snp, variant
def reader(fname):
f = pyfastaq.utils.open_file_read(fname)
for line in f:
if line.startswith('[') or (not '\t' in line):
continue
yield snp.Snp(line)
pyfastaq.utils.close(f)
def get_all_variants(fname):
variants = []
fr = reader(fname)
for nucmer_snp in fr:
if len(variants) == 0 or not variants[-1].update_indel(nucmer_snp):
variants.append(variant.Variant(nucmer_snp))
return variants
pymummer-0.10.3/pymummer/syscall.py 0000664 0000000 0000000 00000001362 13146565224 0017357 0 ustar 00root root 0000000 0000000 import os
import sys
import subprocess
class Error (Exception): pass
def decode(x):
try:
s = x.decode()
except:
return x
return s
def run(cmd, verbose=False):
if verbose:
print('Running command:', cmd, flush=True)
try:
output = subprocess.check_output(cmd, shell=True, stderr=subprocess.STDOUT)
except subprocess.CalledProcessError as error:
print('The following command failed with exit code', error.returncode, file=sys.stderr)
print(cmd, file=sys.stderr)
print('\nThe output was:\n', file=sys.stderr)
print(error.output.decode(), file=sys.stderr)
raise Error('Error running command:', cmd)
if verbose:
print(decode(output))
pymummer-0.10.3/pymummer/tests/ 0000775 0000000 0000000 00000000000 13146565224 0016473 5 ustar 00root root 0000000 0000000 pymummer-0.10.3/pymummer/tests/alignment_test.py 0000664 0000000 0000000 00000042033 13146565224 0022064 0 ustar 00root root 0000000 0000000 import unittest
import os
import pyfastaq
from pymummer import alignment, snp, variant
modules_dir = os.path.dirname(os.path.abspath(alignment.__file__))
data_dir = os.path.join(modules_dir, 'tests', 'data')
class TestNucmer(unittest.TestCase):
def test_init_nucmer(self):
'''test __init__ nucmer'''
line = '\t'.join(['1', '100', '2', '200', '101', '202', '42.42', '123', '456', '-1', '0', 'ref', 'qry', '[FOO]'])
a = alignment.Alignment(line)
self.assertEqual(a.ref_start, 0)
self.assertEqual(a.ref_end, 99)
self.assertEqual(a.qry_start, 1)
self.assertEqual(a.qry_end, 199)
self.assertEqual(a.hit_length_ref, 101)
self.assertEqual(a.hit_length_qry, 202)
self.assertEqual(a.percent_identity, 42.42)
self.assertEqual(a.ref_length, 123)
self.assertEqual(a.qry_length, 456)
self.assertEqual(a.frame, -1)
self.assertEqual(a.ref_name, 'ref')
self.assertEqual(a.qry_name, 'qry')
def test_init_promer(self):
'''test __init__ promer'''
line = '\t'.join(['1', '1398', '4891054', '4892445', '1398', '1392', '89.55', '93.18', '0.21', '1398', '5349013', '1', '1', 'ref', 'qry', '[CONTAINED]'])
a = alignment.Alignment(line)
self.assertEqual(a.ref_start, 0)
self.assertEqual(a.ref_end, 1397)
self.assertEqual(a.qry_start, 4891053)
self.assertEqual(a.qry_end, 4892444)
self.assertEqual(a.hit_length_ref, 1398)
self.assertEqual(a.hit_length_qry, 1392)
self.assertEqual(a.percent_identity, 89.55)
self.assertEqual(a.ref_length, 1398)
self.assertEqual(a.qry_length, 5349013)
self.assertEqual(a.frame, 1)
self.assertEqual(a.ref_name, 'ref')
self.assertEqual(a.qry_name, 'qry')
def test_swap(self):
''' test swap'''
l_in = ['1', '100', '2', '200', '101', '202', '42.42', '123', '456', '-1', '0', 'ref', 'qry']
l_out = ['2', '200', '1', '100', '202', '101', '42.42', '456', '123', '-1', '0', 'qry', 'ref']
a_in = alignment.Alignment('\t'.join(l_in))
a_in._swap()
self.assertEqual(a_in, alignment.Alignment('\t'.join(l_out)))
a_in._swap()
self.assertEqual(a_in, alignment.Alignment('\t'.join(l_in)))
def test_qry_coords(self):
'''Test qry_coords'''
hits = ['\t'.join(['1', '100', '1', '100', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'qry']),
'\t'.join(['1', '101', '100', '1', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'qry'])
]
for h in hits:
a = alignment.Alignment(h)
self.assertEqual(pyfastaq.intervals.Interval(0,99), a.qry_coords())
def test_ref_coords(self):
'''Test ref_coords'''
hits = ['\t'.join(['1', '100', '1', '100', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref']),
'\t'.join(['100', '1', '100', '1', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref'])
]
for h in hits:
a = alignment.Alignment(h)
self.assertEqual(pyfastaq.intervals.Interval(0,99), a.ref_coords())
def test_on_same_strand(self):
'''test on_same_strand'''
self.assertTrue(alignment.Alignment('\t'.join(['1', '100', '1', '100', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref'])).on_same_strand())
self.assertTrue(alignment.Alignment('\t'.join(['100', '1', '100', '1', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref'])).on_same_strand())
self.assertFalse(alignment.Alignment('\t'.join(['1', '100', '100', '1', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref'])).on_same_strand())
self.assertFalse(alignment.Alignment('\t'.join(['100', '1', '1', '100', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref'])).on_same_strand())
def test_is_self_hit(self):
'''Test is_self_hit'''
tests = [('\t'.join(['1', '100', '1', '100', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref']), True),
('\t'.join(['1', '101', '1', '100', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref']), False),
('\t'.join(['2', '100', '1', '100', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref']), False),
('\t'.join(['1', '100', '1', '100', '100', '100', '100.00', '1000', '1000', '1', '1', 'ref', 'ref2']), False),
('\t'.join(['1', '100', '1', '100', '100', '100', '99.9', '1000', '1000', '1', '1', 'ref', 'ref']), False),
]
for t in tests:
a = alignment.Alignment(t[0])
self.assertEqual(a.is_self_hit(), t[1])
def test_reverse_reference(self):
'''Test reverse_reference'''
aln = alignment.Alignment('\t'.join(['100', '142', '1', '42', '43', '42', '100.00', '150', '100', '1', '1', 'ref', 'qry']))
expected = alignment.Alignment('\t'.join(['51', '9', '1', '42', '43', '42', '100.00', '150', '100', '1', '1', 'ref', 'qry']))
aln.reverse_reference()
self.assertEqual(expected, aln)
def test_reverse_query(self):
'''Test reverse_query'''
aln = alignment.Alignment('\t'.join(['100', '142', '1', '42', '43', '42', '100.00', '150', '100', '1', '1', 'ref', 'qry']))
expected = alignment.Alignment('\t'.join(['100', '142', '100', '59', '43', '42', '100.00', '150', '100', '1', '1', 'ref', 'qry']))
aln.reverse_query()
self.assertEqual(expected, aln)
def test_str(self):
'''Test __str__'''
l_in = ['1', '100', '2', '200', '101', '202', '42.42', '123', '456', '-1', '0', 'ref', 'qry']
# the 10th column (counting from zero) is ignored and so not output by __str__
l_out = l_in[:10] + l_in[11:]
a = alignment.Alignment('\t'.join(l_in))
self.assertEqual(str(a), '\t'.join(l_out))
def test_to_msp_crunch(self):
'''Test to_msp_crunch'''
l_in = ['100', '110', '1', '10', '10', '11', '80.00', '123', '456', '-1', '0', 'ref', 'qry']
a = alignment.Alignment('\t'.join(l_in))
expected = '8 80.00 1 10 qry 100 110 ref'
self.assertEqual(expected, a.to_msp_crunch())
def test_intersects_variant(self):
'Test intersects_variant'''
snp0 = snp.Snp('100\tA\t.\t600\t75\t77\t1\t0\t606\t1700\t1\t1\tref\tqry') #100 in ref, 600 in qry
indel = variant.Variant(snp0)
aln1 = alignment.Alignment('100\t500\t600\t1000\t501\t501\t100.00\t600\t1700\t1\t1\tref\tqry')
aln2 = alignment.Alignment('101\t500\t600\t1000\t501\t501\t100.00\t600\t1700\t1\t1\tref\tqry')
aln3 = alignment.Alignment('100\t500\t601\t1000\t501\t501\t100.00\t600\t1700\t1\t1\tref\tqry')
aln4 = alignment.Alignment('101\t500\t601\t1000\t501\t501\t100.00\t600\t1700\t1\t1\tref\tqry')
self.assertTrue(aln1.intersects_variant(indel))
self.assertFalse(aln2.intersects_variant(indel))
self.assertFalse(aln3.intersects_variant(indel))
self.assertFalse(aln4.intersects_variant(indel))
def test_qry_coords_from_ref_coord_test_bad_ref_coord(self):
'''Test qry_coords_from_ref_coord with bad ref coords'''
aln = alignment.Alignment('\t'.join(['100', '200', '1', '100', '100', '100', '100.00', '300', '300', '1', '1', 'ref', 'qry']))
with self.assertRaises(alignment.Error):
got = aln.qry_coords_from_ref_coord(98, [])
with self.assertRaises(alignment.Error):
got = aln.qry_coords_from_ref_coord(200, [])
def test_qry_coords_from_ref_coord_test_same_strand(self):
'''Test qry_coords_from_ref_coord on same strand'''
aln = alignment.Alignment('\t'.join(['100', '200', '1', '101', '100', '100', '100.00', '300', '300', '1', '1', 'ref', 'qry']))
snp0 = snp.Snp('\t'.join(['140', 'A', 'T', '40', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # snp
snp0 = variant.Variant(snp0)
snp1 = snp.Snp('\t'.join(['140', 'A', '.', '40', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from qry
snp2 = snp.Snp('\t'.join(['141', 'C', '.', '40', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from qry
del1 = variant.Variant(snp1)
del2 = variant.Variant(snp1)
self.assertTrue(del2.update_indel(snp2))
snp3 = snp.Snp('\t'.join(['150', '.', 'A', '50', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from ref
snp4 = snp.Snp('\t'.join(['150', '.', 'C', '51', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from ref
snp5 = snp.Snp('\t'.join(['150', '.', 'G', '52', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from ref
ins1 = variant.Variant(snp3)
ins2 = variant.Variant(snp3)
self.assertTrue(ins2.update_indel(snp4))
self.assertTrue(ins2.update_indel(snp5))
tests = [
(99, [], (0, False)),
(100, [], (1, False)),
(199, [], (100, False)),
(119, [del1], (20, False)),
(149, [], (50, False)),
(149, [del1], (49, False)),
(149, [del2], (48, False)),
(159, [], (60, False)),
(159, [ins1], (61, False)),
(159, [ins2], (63, False)),
(159, [del1, ins1], (60, False)),
(159, [del1, ins2], (62, False)),
(159, [del2, ins1], (59, False)),
(159, [del2, ins2], (61, False)),
(139, [del1], (39, True)),
(139, [snp0], (40, False)),
(149, [ins1], (49, True)),
]
for ref_coord, variant_list, expected in tests:
got = aln.qry_coords_from_ref_coord(ref_coord, variant_list)
self.assertEqual(expected, got)
# if we reverse the direction of hit in query and reference, should get the same answer
aln.qry_start, aln.qry_end = aln.qry_end, aln.qry_start
aln.ref_start, aln.ref_end = aln.ref_end, aln.ref_start
got = aln.qry_coords_from_ref_coord(ref_coord, variant_list)
self.assertEqual(expected, got)
aln.qry_start, aln.qry_end = aln.qry_end, aln.qry_start
aln.ref_start, aln.ref_end = aln.ref_end, aln.ref_start
def test_qry_coords_from_ref_coord_test_different_strand(self):
'''Test qry_coords_from_ref_coord on different strand'''
aln = alignment.Alignment('\t'.join(['100', '200', '101', '1', '100', '100', '100.00', '300', '300', '1', '1', 'ref', 'qry']))
snp0 = snp.Snp('\t'.join(['140', 'A', 'T', '40', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # snp
snp0 = variant.Variant(snp0)
snp1 = snp.Snp('\t'.join(['140', 'A', '.', '40', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from qry
snp2 = snp.Snp('\t'.join(['141', 'C', '.', '40', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from qry
del1 = variant.Variant(snp1)
del2 = variant.Variant(snp1)
self.assertTrue(del2.update_indel(snp2))
snp3 = snp.Snp('\t'.join(['150', '.', 'A', '50', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from ref
snp4 = snp.Snp('\t'.join(['150', '.', 'C', '51', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from ref
snp5 = snp.Snp('\t'.join(['150', '.', 'G', '52', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from ref
ins1 = variant.Variant(snp3)
ins2 = variant.Variant(snp3)
self.assertTrue(ins2.update_indel(snp4))
self.assertTrue(ins2.update_indel(snp5))
tests = [
(99, [], (100, False)),
(100, [], (99, False)),
(199, [], (0, False)),
(119, [], (80, False)),
(119, [del1], (80, False)),
(149, [], (50, False)),
(149, [del1], (51, False)),
(149, [del2], (52, False)),
(159, [], (40, False)),
(159, [ins1], (39, False)),
(159, [ins2], (37, False)),
(159, [del1, ins1], (40, False)),
(159, [del1, ins2], (38, False)),
(159, [del2, ins1], (41, False)),
(159, [del2, ins2], (39, False)),
(139, [del1], (39, True)),
(139, [snp0], (60, False)),
(149, [ins1], (49, True)),
]
for ref_coord, variant_list, expected in tests:
got = aln.qry_coords_from_ref_coord(ref_coord, variant_list)
self.assertEqual(expected, got)
# if we reverse the direction of hit in query and reference, should get the same answer
aln.qry_start, aln.qry_end = aln.qry_end, aln.qry_start
aln.ref_start, aln.ref_end = aln.ref_end, aln.ref_start
got = aln.qry_coords_from_ref_coord(ref_coord, variant_list)
self.assertEqual(expected, got)
aln.qry_start, aln.qry_end = aln.qry_end, aln.qry_start
aln.ref_start, aln.ref_end = aln.ref_end, aln.ref_start
def test_qry_coords_from_ref_coord_when_variant_not_in_nucmer_match(self):
'''Test ref_coords_from_qry_coord when variant not in nucmer match'''
aln = alignment.Alignment('1\t606\t596\t1201\t606\t606\t100.00\t606\t1700\t1\t1\tref\tqry')
snp0 = snp.Snp('127\tA\t.\t77\t75\t77\t1\t0\t606\t1700\t1\t1\tref\tqry')
indel = variant.Variant(snp0)
self.assertEqual((595, False), aln.qry_coords_from_ref_coord(0, []))
self.assertEqual((595, False), aln.qry_coords_from_ref_coord(0, [indel]))
self.assertEqual((995, False), aln.qry_coords_from_ref_coord(400, []))
self.assertEqual((995, False), aln.qry_coords_from_ref_coord(400, [indel]))
self.assertEqual((1200, False), aln.qry_coords_from_ref_coord(605, []))
self.assertEqual((1200, False), aln.qry_coords_from_ref_coord(605, [indel]))
def test_ref_coords_from_qry_coord_test_same_strand(self):
'''Test ref_coords_from_qry_coord on same strand'''
aln = alignment.Alignment('\t'.join(['1', '101', '100', '200', '100', '100', '100.00', '300', '300', '1', '1', 'ref', 'qry']))
snp0 = snp.Snp('\t'.join(['40', 'T', 'A', '140', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # snp
snp0 = variant.Variant(snp0)
snp1 = snp.Snp('\t'.join(['40', '.', 'A', '140', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from ref
snp2 = snp.Snp('\t'.join(['40', '.', 'C', '141', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from ref
del1 = variant.Variant(snp1)
del2 = variant.Variant(snp1)
self.assertTrue(del2.update_indel(snp2))
snp3 = snp.Snp('\t'.join(['50', 'A', '.', '150', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from qry
snp4 = snp.Snp('\t'.join(['51', 'C', '.', '150', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from qry
snp5 = snp.Snp('\t'.join(['52', 'G', '.', '150', 'x', 'x', '300', '300', 'x', 'x', 'ref', 'qry'])) # del from qry
ins1 = variant.Variant(snp3)
ins2 = variant.Variant(snp3)
self.assertTrue(ins2.update_indel(snp4))
self.assertTrue(ins2.update_indel(snp5))
tests = [
(99, [], (0, False)),
(100, [], (1, False)),
(199, [], (100, False)),
(119, [del1], (20, False)),
(149, [], (50, False)),
(149, [del1], (49, False)),
(149, [del2], (48, False)),
(159, [], (60, False)),
(159, [ins1], (61, False)),
(159, [ins2], (63, False)),
(159, [del1, ins1], (60, False)),
(159, [del1, ins2], (62, False)),
(159, [del2, ins1], (59, False)),
(159, [del2, ins2], (61, False)),
(139, [del1], (39, True)),
(139, [snp0], (40, False)),
(149, [ins1], (49, True)),
]
for qry_coord, variant_list, expected in tests:
got = aln.ref_coords_from_qry_coord(qry_coord, variant_list)
self.assertEqual(expected, got)
# if we reverse the direction of hit in query and qryerence, should get the same answer
aln.ref_start, aln.ref_end = aln.ref_end, aln.ref_start
aln.qry_start, aln.qry_end = aln.qry_end, aln.qry_start
got = aln.ref_coords_from_qry_coord(qry_coord, variant_list)
self.assertEqual(expected, got)
aln.ref_start, aln.ref_end = aln.ref_end, aln.ref_start
aln.qry_start, aln.qry_end = aln.qry_end, aln.qry_start
def test_ref_coords_from_qry_coord_when_variant_not_in_nucmer_match(self):
'''Test ref_coords_from_qry_coord when variant not in nucmer match'''
aln = alignment.Alignment('1\t606\t596\t1201\t606\t606\t100.00\t606\t1700\t1\t1\tref\tqry')
snp0 = snp.Snp('127\tA\t.\t77\t75\t77\t1\t0\t606\t1700\t1\t1\tref\tqry')
indel = variant.Variant(snp0)
self.assertEqual((0, False), aln.ref_coords_from_qry_coord(595, []))
self.assertEqual((0, False), aln.ref_coords_from_qry_coord(595, [indel]))
self.assertEqual((400, False), aln.ref_coords_from_qry_coord(995, []))
self.assertEqual((400, False), aln.ref_coords_from_qry_coord(995, [indel]))
self.assertEqual((605, False), aln.ref_coords_from_qry_coord(1200, []))
self.assertEqual((605, False), aln.ref_coords_from_qry_coord(1200, [indel]))
pymummer-0.10.3/pymummer/tests/coords_file_test.py 0000664 0000000 0000000 00000005072 13146565224 0022400 0 ustar 00root root 0000000 0000000 import unittest
import os
import filecmp
from pymummer import coords_file, alignment
modules_dir = os.path.dirname(os.path.abspath(coords_file.__file__))
data_dir = os.path.join(modules_dir, 'tests', 'data')
class TestCoordsFile(unittest.TestCase):
def test_coords_file(self):
'''test coords_file'''
expected = [
'\t'.join(['61', '900', '1', '840', '840', '840', '99.76', '1000', '840', '1', '1', 'test_ref1', 'test_qry1', '[CONTAINS]']),
'\t'.join(['62', '901', '2', '841', '841', '850', '99.66', '999', '839', '1', '1', 'test_ref2', 'test_qry2', '[CONTAINS]']),
'\t'.join(['63', '902', '3', '842', '842', '860', '99.56', '998', '838', '1', '1', 'test_ref3', 'test_qry3', '[CONTAINS]'])
]
expected = [alignment.Alignment(x) for x in expected]
infiles = [os.path.join(data_dir, 'coords_file_test_with_header.coords'), os.path.join(data_dir, 'coords_file_test_no_header.coords')]
for fname in infiles:
fr = coords_file.reader(fname)
alignments = [x for x in fr]
self.assertEqual(alignments, expected)
def test_convert_to_msp_crunch_no_offset(self):
'''Test convert_to_msp_crunch with no offsets'''
infile = os.path.join(data_dir, 'coords_file_test_convert_to_msp_crunch.coords')
expected = os.path.join(data_dir, 'coords_file_test_convert_to_msp_crunch.no_offset.crunch')
tmpfile = 'tmp.test_convert_to_msp_crunch_no_offset.crunch'
coords_file.convert_to_msp_crunch(infile, tmpfile)
self.assertTrue(filecmp.cmp(expected, tmpfile, shallow=False))
os.unlink(tmpfile)
def test_convert_to_msp_crunch_with_offset(self):
'''Test convert_to_msp_crunch with offsets'''
infile = os.path.join(data_dir, 'coords_file_test_convert_to_msp_crunch.coords')
ref_fai = os.path.join(data_dir, 'coords_file_test_convert_to_msp_crunch.ref.fa.fai')
qry_fai = os.path.join(data_dir, 'coords_file_test_convert_to_msp_crunch.qry.fa.fai')
expected = os.path.join(data_dir, 'coords_file_test_convert_to_msp_crunch.with_offset.crunch')
tmpfile = 'tmp.test_convert_to_msp_crunch_with_offset.crunch'
with self.assertRaises(coords_file.Error):
coords_file.convert_to_msp_crunch(infile, tmpfile, ref_fai=ref_fai)
coords_file.convert_to_msp_crunch(infile, tmpfile, qry_fai=qry_fai)
coords_file.convert_to_msp_crunch(infile, tmpfile, ref_fai=ref_fai, qry_fai=qry_fai)
self.assertTrue(filecmp.cmp(expected, tmpfile, shallow=False))
os.unlink(tmpfile)
pymummer-0.10.3/pymummer/tests/data/ 0000775 0000000 0000000 00000000000 13146565224 0017404 5 ustar 00root root 0000000 0000000 pymummer-0.10.3/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.coords 0000664 0000000 0000000 00000000723 13146565224 0030633 0 ustar 00root root 0000000 0000000 /Users/mh12/sanger-pathogens/pymummer/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.ref.fa /Users/mh12/sanger-pathogens/pymummer/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.qry.fa
NUCMER
[S1] [E1] [S2] [E2] [LEN 1] [LEN 2] [% IDY] [LEN R] [LEN Q] [FRM] [TAGS]
1 420 1 420 420 420 99.76 420 420 1 1 ref1 qry1 [IDENTITY]
1 480 1 479 480 479 99.58 480 479 1 1 ref2 qry2 [IDENTITY]
61 420 1 360 360 360 99.44 500 360 1 1 ref3 qry3 [CONTAINS]
pymummer-0.10.3/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.no_offset.crunch 0000664 0000000 0000000 00000000141 13146565224 0032577 0 ustar 00root root 0000000 0000000 418 99.76 1 420 qry1 1 420 ref1
477 99.58 1 479 qry2 1 480 ref2
357 99.44 1 360 qry3 61 420 ref3
pymummer-0.10.3/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.qry.fa 0000664 0000000 0000000 00000002422 13146565224 0030540 0 ustar 00root root 0000000 0000000 >qry1
AACTTTCATACTGTAGTTATTGGCATCGTTGTAAAATTGCTCACCACGTCGCTCGTTCAT
GATAATCTAAAGATCGCTAACGATTACTACCGGCAGCGGTTTATACGGACCAATCGTTGG
TTCATTTTAATGTAGACCCAGAAATCGACTGCATTTCTGCAGCCCGGCCCGACGTGTTGA
ACGGATGATCTTAGACAGAACGTCCTTGGGTCTATATCCGGCCACATATTTATTGGGCAG
GGGAGTCAATTGGGGGCGTACCGAAATATCGTCTTTACGAGCGTCGGTGACGCACATGAC
ATGGTCGACCCATAGCCTCAGCTTCTAGACGGTTGCACCAGCGCAAGACAAAACTCTCAA
TTTTGTCTGGGTACCGAGATTGCGGAACCGGGGATATTGTAGAGCGGTGCACACGGCCTT
>qry2
CTAGCGCAAGACCGACTCTGATTCATGGAGACAGGGCCAGACAGGGAAACGAGATTGAGC
GATGCTGTCATTTTCGTAACGAGGATTGGTCGGGGACCGAGATCGTACACGTCTCCGAGC
CCCCACAGTCGAGTACAAATGGCTTAATTTACTGACTTCTTCCTGTTACCGGCATGGTAT
GCTGAGCCTGGCCCGCTCACTATTGGATATAGCCTGTGCGCTGGCGTACCGCTGTTCTAC
CGGTTCCTCTTGAGGGTCAAAGGCCGGCTACCATCGTTAACTTATTAGCTTAGAGTAATG
TAGGTTACGTGACGCTGGCCGGTTAGCGTTTCGAAGGATCGCAGGACTATAGTCAAAACT
CGTGGACTTCTACCAGAACTATCGATGTTCACGATGACTACGTTCCTTCCGAATATTACA
GTAAGGGATAGTCATGCCGGTTTAACATCATCTGTGTGTACGCAATGCAGTTTGGCACA
>qry3
AGGTGCGACAGGATCTAACACCTGTACAGTAAGAAAGGGGCATATGATCGACCCCGGTTG
CTCGTATGATAATCCCATTATTGTTATCTGAGGATCGTTATGCGGCAGTTCTAGTCCGAT
AAAAGTTAGGTGAGTTGTGTTGGTAATCCTTCTCTAGGAGGCCTGGCGACTCCACTGAGC
CCAGCGATGGGAGAGCTGGTCCCCCCAATATCGTGACTGAATTGGTAAGGTAGATATCTC
CCAGATAGCCGCATACCGTCTGGCACCGTCGACCGAAAGAAATGTTCGCCTTGGCATGCT
CAGATTGCATCTATACTTACTTGTATAGAACTGCCCGCGCCACCCAGAAGACAAACTAAT
pymummer-0.10.3/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.qry.fa.fai 0000664 0000000 0000000 00000000067 13146565224 0031301 0 ustar 00root root 0000000 0000000 qry1 420 6 60 61
qry2 479 439 60 61
qry3 360 932 60 61
pymummer-0.10.3/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.ref.fa 0000664 0000000 0000000 00000002642 13146565224 0030505 0 ustar 00root root 0000000 0000000 >ref1
AACTTTCATACTGTAGTTATTGGCATCGTTGTAAAATTGCTCACCACGTCGCTCGTTCAT
GATAATCTAAAGATCGCTAACGATTACTACCGGCAGCGGTTTATACGGACCAATCGTTGG
TTCATTTTAATGTAGACCCAGAAATCGACTGCATTTCTGCAGCCCGGCCCGACGTGTTGA
ACGGATGATCTTAGACAGAACGTCCTTGGGTCTATATCCGGCCACATATTTATTGGGCAG
GGGTGTCAATTGGGGGCGTACCGAAATATCGTCTTTACGAGCGTCGGTGACGCACATGAC
ATGGTCGACCCATAGCCTCAGCTTCTAGACGGTTGCACCAGCGCAAGACAAAACTCTCAA
TTTTGTCTGGGTACCGAGATTGCGGAACCGGGGATATTGTAGAGCGGTGCACACGGCCTT
>ref2
CTAGCGCAAGACCGACTCTGATTCATGGAGACAGGGCCAGACAGGGAAACGAGATTGAGC
GATGCTGTCATTTTCGTAACGAGGATTGGTCGGGGACCGAGATCGTACACGTCTCCGAGC
CCCCACAGTCGAGTACAAATGGCTTAATTTACTGACTTCTTCCTGTTACCGGCATGGTAT
GCTGAGCCTGGCCCGCTCACTATTGGATATAGCCTGTGCGCTGGCGTACCGCTGTTCTAC
CGGTACCTCTTGAGGGTCAAAGGCCGGCTACCATCGTTAACTTATTAGCTTAGAGTAATG
TAGGTTACGTGACGCTGGCCGGTTAGCGTTTCGAAGGATCGCAGGACTATAGTCAAAACT
CGTGGACTTCTACCAGAACTATCGATGTTCACGATGACTACGTTCCTTCCGAATATTACA
GTATAGGGATAGTCATGCCGGTTTAACATCATCTGTGTGTACGCAATGCAGTTTGGCACA
>ref3
ATTCAACGGGTAGGGTCATCAGATTTTTAGTACGAACGAACAATTCCCCATTCAATTCCG
AGGTGCGACAGGATCTAACACCTGTACAGTAAGAAAGGGGCATATGATCGACCCCGGTTG
CTCGTATGATAATCCCATTATTGTTATCTGAGGATCGTTATGCGGCAGTTCTAGTCCGAT
CCAAGTTAGGTGAGTTGTGTTGGTAATCCTTCTCTAGGAGGCCTGGCGACTCCACTGAGC
CCAGCGATGGGAGAGCTGGTCCCCCCAATATCGTGACTGAATTGGTAAGGTAGATATCTC
CCAGATAGCCGCATACCGTCTGGCACCGTCGACCGAAAGAAATGTTCGCCTTGGCATGCT
CAGATTGCATCTATACTTACTTGTATAGAACTGCCCGCGCCACCCAGAAGACAAACTAAT
TTATTGTCGCTCAAACCTGTTTAGTTAATTCACCTTTGTAACCAGCTTACCCTCAATTGC
GTATGTAACTCCTTGGCTGC
pymummer-0.10.3/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.ref.fa.fai 0000664 0000000 0000000 00000000067 13146565224 0031242 0 ustar 00root root 0000000 0000000 ref1 420 6 60 61
ref2 480 439 60 61
ref3 500 933 60 61
pymummer-0.10.3/pymummer/tests/data/coords_file_test_convert_to_msp_crunch.with_offset.crunch 0000664 0000000 0000000 00000000152 13146565224 0033140 0 ustar 00root root 0000000 0000000 418 99.76 1 420 qry1 1 420 ref1
477 99.58 421 899 qry2 421 900 ref2
357 99.44 900 1259 qry3 961 1320 ref3
pymummer-0.10.3/pymummer/tests/data/coords_file_test_no_header.coords 0000664 0000000 0000000 00000000323 13146565224 0026150 0 ustar 00root root 0000000 0000000 61 900 1 840 840 840 99.76 1000 840 1 1 test_ref1 test_qry1 [CONTAINS]
62 901 2 841 841 850 99.66 999 839 1 1 test_ref2 test_qry2 [CONTAINS]
63 902 3 842 842 860 99.56 998 838 1 1 test_ref3 test_qry3 [CONTAINS]
pymummer-0.10.3/pymummer/tests/data/coords_file_test_with_header.coords 0000664 0000000 0000000 00000000506 13146565224 0026512 0 ustar 00root root 0000000 0000000 /path/to/ref.fa /path/to/query.fa
NUCMER
[S1] [E1] [S2] [E2] [LEN 1] [LEN 2] [% IDY] [LEN R] [LEN Q] [FRM] [TAGS]
61 900 1 840 840 840 99.76 1000 840 1 1 test_ref1 test_qry1 [CONTAINS]
62 901 2 841 841 850 99.66 999 839 1 1 test_ref2 test_qry2 [CONTAINS]
63 902 3 842 842 860 99.56 998 838 1 1 test_ref3 test_qry3 [CONTAINS]
pymummer-0.10.3/pymummer/tests/data/nucmer_test_out.coords 0000664 0000000 0000000 00000000105 13146565224 0024032 0 ustar 00root root 0000000 0000000 61 900 1 840 840 840 99.76 1000 840 1 1 test_ref test_qry [CONTAINS]
pymummer-0.10.3/pymummer/tests/data/nucmer_test_out.coords.snps 0000664 0000000 0000000 00000000142 13146565224 0025015 0 ustar 00root root 0000000 0000000 436 C . 375 2 375 1000 840 1 1 test_ref test_qry
438 . G 378 2 378 1000 840 1 1 test_ref test_qry
pymummer-0.10.3/pymummer/tests/data/nucmer_test_qry.fa 0000664 0000000 0000000 00000001540 13146565224 0023137 0 ustar 00root root 0000000 0000000 >test_qry
GTAATCAAATAATCCACCGGATGAGGTATTTTCTCATCGGGGTGACTCTAACCACATCGT
GTTTCTTCCTGAAGGCTCTAAGATGTCATGAGAACTCTTACTGTCTAGCTGAGGGGCTTG
TGCACAACACTAGGATTGTGTCTTATGCTCTATTGGACAGCGAAAACTGCTGAAATTAAC
GGGCCGTAACATACTATATTCTTCAAACCGAATTAACGTTCAGCCCCCGCTTGATTGCGA
AATTAACTGGAATGCAACACCTTGCACTGGCCGTCCTGCGGTGGTGACCCTTTGAGGTAA
ACACGTCGTCGACGCATTACAGTTGGGAGAAGCACACTCATGTTTCTAATAAAGCGCTCA
CAGACGCGACCACTATAGCTCTAAAATACATCCCTCTAAGGTTCCATCTAGAAAGTGGCC
CCCGCGACCGTCTACCGTGGTGGATGCAGGGAGTCACCTACGCGTCTTTTCGTGCTACCT
AGGCATTTTTGCACTACCTAACTCCGTATTAAGGCCTTCGGAGAGGGCCGTCCCACTTCA
ATGTGTGTGGTGGACTGTCCTCATGGGAAAAGCAAGTGTTTGACCGGTTGACACTAGTCC
CGTTTATCTTCATGGGCGGGAGCGCGCATTCGTGACGGGGACACTTCTCGCCGTTTAGCC
GGTGAGCTTATTAGGCCGATGGCGGGCCACCCTGATACGGGGGCCTATATGTCCACGAAT
ATCAATTTCTGTATAACATTGGGCGCAGAAAACAGACTGGTCCAAATAAGATGAATCTAT
AGCCCAGTGTGTTGCCTAAACGCTGAGCGAATAATTGGTCGCGCTCGGCGAGACCAGGGA
pymummer-0.10.3/pymummer/tests/data/nucmer_test_ref.fa 0000664 0000000 0000000 00000002003 13146565224 0023073 0 ustar 00root root 0000000 0000000 >test_ref
TCAAGATCGTGCCCCGTTGATATCGCTGTTGCACAGGACTTTCTCCACCCTGATACCGCA
GTAATCAAATAATCCACCGGATGAGGTATTTTCTCATCGGGGTGACTCTAACCACATCGT
GTTTCTTCCTGAAGGCTCTAAGATGTCATGAGAACTCTTACTGTCTAGCTGAGGGGCTTG
TGCACAACACTAGGATTGTGTCTTATGCTCTATTGGACAGCGAAAACTGCTGAAATTAAC
GGGCCGTAACATACTATATTCTTCAAACCGAATTAACGTTCAGCCCCCGCTTGATTGCGA
AATTAACTGGAATGCAACACCTTGCACTGGCCGTCCTGCGGTGGTGACCCTTTGAGGTAA
ACACGTCGTCGACGCATTACAGTTGGGAGAAGCACACTCATGTTTCTAATAAAGCGCTCA
CAGACGCGACCACTACTACTCTAAAATACATCCCTCTAAGGTTCCATCTAGAAAGTGGCC
CCCGCGACCGTCTACCGTGGTGGATGCAGGGAGTCACCTACGCGTCTTTTCGTGCTACCT
AGGCATTTTTGCACTACCTAACTCCGTATTAAGGCCTTCGGAGAGGGCCGTCCCACTTCA
ATGTGTGTGGTGGACTGTCCTCATGGGAAAAGCAAGTGTTTGACCGGTTGACACTAGTCC
CGTTTATCTTCATGGGCGGGAGCGCGCATTCGTGACGGGGACACTTCTCGCCGTTTAGCC
GGTGAGCTTATTAGGCCGATGGCGGGCCACCCTGATACGGGGGCCTATATGTCCACGAAT
ATCAATTTCTGTATAACATTGGGCGCAGAAAACAGACTGGTCCAAATAAGATGAATCTAT
AGCCCAGTGTGTTGCCTAAACGCTGAGCGAATAATTGGTCGCGCTCGGCGAGACCAGGGA
TTCTGGCAAGATCCTAACTCGGCCGTCAATGATGTTAAATCAACTCGGTGTGGCCCCAGC
TTCGACACCAAAAGTTGTGATCACTACATAGCGTATCTCG
pymummer-0.10.3/pymummer/tests/data/nucmer_test_write_script_no_snps.sh 0000664 0000000 0000000 00000000146 13146565224 0026626 0 ustar 00root root 0000000 0000000 nucmer -p p ref qry
delta-filter p.delta > p.delta.filter
show-coords -dTlro p.delta.filter > outfile
pymummer-0.10.3/pymummer/tests/data/nucmer_test_write_script_with_snps.sh 0000664 0000000 0000000 00000000224 13146565224 0027162 0 ustar 00root root 0000000 0000000 nucmer -p p ref qry
delta-filter p.delta > p.delta.filter
show-coords -dTlro p.delta.filter > outfile
show-snps -TClr p.delta.filter > outfile.snps
pymummer-0.10.3/pymummer/tests/data/snp_file_test_get_all_variants.snps 0000664 0000000 0000000 00000000476 13146565224 0026554 0 ustar 00root root 0000000 0000000 125 T . 124 1 124 500 497 1 1 ref1 qry1
126 A . 124 1 124 500 497 1 1 ref1 qry1
127 C . 124 1 124 500 497 1 1 ref1 qry1
386 C T 383 115 115 500 497 1 1 ref1 qry1
479 . G 480 0 22 500 504 1 1 ref2 qry2
479 . A 481 0 22 500 504 1 1 ref2 qry2
479 . T 482 0 22 500 504 1 1 ref2 qry2
479 . A 483 0 22 500 504 1 1 ref2 qry2
pymummer-0.10.3/pymummer/tests/data/snp_file_test_no_header.snps 0000664 0000000 0000000 00000000164 13146565224 0025154 0 ustar 00root root 0000000 0000000 133 G . 122 1 122 500 489 1 1 ref qry
143 . C 131 1 132 500 489 1 1 ref qry
253 T A 242 120 242 500 489 1 1 ref qry
pymummer-0.10.3/pymummer/tests/data/snp_file_test_with_header.snps 0000664 0000000 0000000 00000000335 13146565224 0025513 0 ustar 00root root 0000000 0000000 /path/to/ref.fa /path/to/qry.fa
NUCMER
[P1] [SUB] [SUB] [P2] [BUFF] [DIST] [LEN R] [LEN Q] [FRM] [TAGS]
133 G . 122 1 122 500 489 1 1 ref qry
143 . C 131 1 132 500 489 1 1 ref qry
253 T A 242 120 242 500 489 1 1 ref qry
pymummer-0.10.3/pymummer/tests/nucmer_test.py 0000664 0000000 0000000 00000010665 13146565224 0021405 0 ustar 00root root 0000000 0000000 import unittest
import os
import filecmp
from pymummer import nucmer
modules_dir = os.path.dirname(os.path.abspath(nucmer.__file__))
data_dir = os.path.join(modules_dir, 'tests', 'data')
class TestRunner(unittest.TestCase):
def test_nucmer_command(self):
'''test _nucmer_command'''
tests = [
[nucmer.Runner('ref', 'qry', 'outfile'), 'nucmer -p pre ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', breaklen=42), 'nucmer -p pre -b 42 ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', diagdiff=11), 'nucmer -p pre -D 11 ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', diagdiff=11, promer=True), 'promer -p pre ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', maxmatch=True), 'nucmer -p pre --maxmatch ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', mincluster=42), 'nucmer -p pre -c 42 ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', simplify=False), 'nucmer -p pre --nosimplify ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', promer=True), 'promer -p pre ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', promer=True, breaklen=42), 'promer -p pre -b 42 ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', promer=True, maxmatch=True), 'promer -p pre --maxmatch ref qry'],
[nucmer.Runner('ref', 'qry', 'outfile', promer=True, simplify=False), 'promer -p pre ref qry']
]
for l in tests:
self.assertEqual(l[0]._nucmer_command('ref', 'qry', 'pre'), l[1])
def test_delta_filter_command(self):
'''test _delta_filter_command'''
tests = [
[nucmer.Runner('ref', 'qry', 'outfile'), 'delta-filter infile > outfile'],
[nucmer.Runner('ref', 'qry', 'outfile', min_id=42), 'delta-filter -i 42 infile > outfile'],
[nucmer.Runner('ref', 'qry', 'outfile', min_length=43), 'delta-filter -l 43 infile > outfile'],
]
for l in tests:
self.assertEqual(l[0]._delta_filter_command('infile', 'outfile'), l[1])
def test_show_coords_command(self):
'''test _show_coords_command'''
tests = [
[nucmer.Runner('ref', 'qry', 'outfile', coords_header=False), 'show-coords -dTlro -H infile > outfile'],
[nucmer.Runner('ref', 'qry', 'outfile'), 'show-coords -dTlro infile > outfile']
]
for l in tests:
self.assertEqual(l[0]._show_coords_command('infile', 'outfile'), l[1])
def test_show_snps_command(self):
'''test _show_snps_command'''
tests = [
[nucmer.Runner('ref', 'qry', 'outfile', snps_header=False), 'show-snps -TClr -H infile > outfile'],
[nucmer.Runner('ref', 'qry', 'outfile'), 'show-snps -TClr infile > outfile'],
[nucmer.Runner('ref', 'qry', 'outfile', show_snps_C=False), 'show-snps -Tlr infile > outfile']
]
for nuc_obj, expected in tests:
self.assertEqual(nuc_obj._show_snps_command('infile', 'outfile'), expected)
def test_write_script_no_snps(self):
'''test _write_script no snps'''
tmp_script = 'tmp.script.sh'
r = nucmer.Runner('ref', 'qry', 'outfile')
r._write_script(tmp_script, 'ref', 'qry', 'outfile')
expected = os.path.join(data_dir, 'nucmer_test_write_script_no_snps.sh')
self.assertTrue(filecmp.cmp(expected, tmp_script, shallow=False))
os.unlink(tmp_script)
def test_write_script_with_snps(self):
'''test _write_script with snps'''
tmp_script = 'tmp.script.sh'
r = nucmer.Runner('ref', 'qry', 'outfile', show_snps='outfile.snps')
r._write_script(tmp_script, 'ref', 'qry', 'outfile')
expected = os.path.join(data_dir, 'nucmer_test_write_script_with_snps.sh')
self.assertTrue(filecmp.cmp(expected, tmp_script, shallow=False))
os.unlink(tmp_script)
def test_run_nucmer(self):
'''test run_nucmer'''
qry = os.path.join(data_dir, 'nucmer_test_qry.fa')
ref = os.path.join(data_dir, 'nucmer_test_ref.fa')
tmp_out = 'tmp.nucmer.out'
runner = nucmer.Runner(ref, qry, tmp_out, coords_header=False, show_snps=True, snps_header=False)
runner.run()
expected = os.path.join(data_dir, 'nucmer_test_out.coords')
self.assertTrue(filecmp.cmp(tmp_out, expected, shallow=False))
self.assertTrue(filecmp.cmp(tmp_out + '.snps', expected + '.snps', shallow=False))
os.unlink(tmp_out)
os.unlink(tmp_out + '.snps')
pymummer-0.10.3/pymummer/tests/snp_file_test.py 0000664 0000000 0000000 00000005406 13146565224 0021710 0 ustar 00root root 0000000 0000000 import unittest
import os
from pymummer import snp_file, snp, variant
modules_dir = os.path.dirname(os.path.abspath(snp_file.__file__))
data_dir = os.path.join(modules_dir, 'tests', 'data')
class TestUtils(unittest.TestCase):
def test_snp_file(self):
'''test coords_file'''
expected = [
'\t'.join(['133', 'G', '.', '122', '1', '122', '500', '489', '1', '1', 'ref', 'qry']),
'\t'.join(['143', '.', 'C', '131', '1', '132', '500', '489', '1', '1', 'ref', 'qry']),
'\t'.join(['253', 'T', 'A', '242', '120', '242', '500', '489', '1', '1', 'ref', 'qry'])
]
expected = [snp.Snp(x) for x in expected]
infiles = [os.path.join(data_dir, 'snp_file_test_with_header.snps'), os.path.join(data_dir, 'snp_file_test_no_header.snps')]
for fname in infiles:
fr = snp_file.reader(fname)
snps = [x for x in fr]
self.assertEqual(snps, expected)
def test_get_all_variants(self):
'''Test load all variants from file'''
deletion_snps = [
'\t'.join(['125', 'T', '.', '124', '1', '124', '500', '497', '1', '1', 'ref1', 'qry1']),
'\t'.join(['126', 'A', '.', '124', '1', '124', '500', '497', '1', '1', 'ref1', 'qry1']),
'\t'.join(['127', 'C', '.', '124', '1', '124', '500', '497', '1', '1', 'ref1', 'qry1']),
]
deletion_snps = [snp.Snp(x) for x in deletion_snps]
deletion_variant = variant.Variant(deletion_snps[0])
deletion_variant.update_indel(deletion_snps[1])
deletion_variant.update_indel(deletion_snps[2])
just_a_snp = '\t'.join(['386', 'C', 'T', '383', '115', '115', '500', '497', '1', '1', 'ref1', 'qry1'])
snp_variant = variant.Variant(snp.Snp(just_a_snp))
insertion_snps = [
'\t'.join(['479', '.', 'G', '480', '0', '22', '500', '504', '1', '1', 'ref2', 'qry2']),
'\t'.join(['479', '.', 'A', '481', '0', '22', '500', '504', '1', '1', 'ref2', 'qry2']),
'\t'.join(['479', '.', 'T', '482', '0', '22', '500', '504', '1', '1', 'ref2', 'qry2']),
'\t'.join(['479', '.', 'A', '483', '0', '22', '500', '504', '1', '1', 'ref2', 'qry2']),
]
insertion_snps = [snp.Snp(x) for x in insertion_snps]
insertion_variant = variant.Variant(insertion_snps[0])
for i in range(1, len(insertion_snps)):
insertion_variant.update_indel(insertion_snps[i])
variants_from_file = snp_file.get_all_variants(os.path.join(data_dir, 'snp_file_test_get_all_variants.snps'))
self.assertEqual(len(variants_from_file), 3)
self.assertEqual(variants_from_file[0], deletion_variant)
self.assertEqual(variants_from_file[1], snp_variant)
self.assertEqual(variants_from_file[2], insertion_variant)
pymummer-0.10.3/pymummer/tests/snp_test.py 0000664 0000000 0000000 00000001667 13146565224 0020716 0 ustar 00root root 0000000 0000000 import unittest
import os
from pymummer import snp
modules_dir = os.path.dirname(os.path.abspath(snp.__file__))
data_dir = os.path.join(modules_dir, 'tests', 'data')
class TestSnp(unittest.TestCase):
def test_str_no_c_option(self):
'''Test __str__ with format with no -C option'''
l_in = ['187', 'A', 'C', '269', '187', '187', '654', '853', '1', '1', 'ref_name', 'qry_name']
s = snp.Snp('\t'.join(l_in))
expected = '\t'.join(['187', 'A', 'C', '269', '654', '853', 'ref_name', 'qry_name'])
self.assertEqual(str(s), expected)
def test_str_with_c_option(self):
'''Test __str__ with format with -C option'''
l_in = ['187', 'A', 'C', '269', '187', '187', '0', '0', '654', '853', '1', '1', 'ref_name', 'qry_name']
s = snp.Snp('\t'.join(l_in))
expected = '\t'.join(['187', 'A', 'C', '269', '654', '853', 'ref_name', 'qry_name'])
self.assertEqual(str(s), expected)
pymummer-0.10.3/pymummer/tests/syscall_test.py 0000664 0000000 0000000 00000000606 13146565224 0021560 0 ustar 00root root 0000000 0000000 import unittest
import os
from pymummer import syscall
class TestSyscall(unittest.TestCase):
def test_run_fail(self):
'''Test that run raises error when command fails'''
with self.assertRaises(syscall.Error):
syscall.run('notacommandandthrowerror')
def test_run_ok(self):
'''Test run is ok on command that works'''
syscall.run('ls')
pymummer-0.10.3/pymummer/tests/variant_test.py 0000664 0000000 0000000 00000012754 13146565224 0021561 0 ustar 00root root 0000000 0000000 import unittest
import copy
import os
from pymummer import variant, snp
modules_dir = os.path.dirname(os.path.abspath(variant.__file__))
data_dir = os.path.join(modules_dir, 'tests', 'data')
class TestVariant(unittest.TestCase):
def test_init(self):
'''Test init gets correct variant type'''
lines = [
['42', 'T', 'A', '42', '42', '42', '1000', '1000', '1', '1', 'ref', 'ref'],
['242', 'G', '.', '241', '1', '241', '1000', '1000', '1', '1', 'ref', 'ref'],
['300', '.', 'G', '298', '0', '298', '1000', '1000', '1', '1', 'ref', 'ref']
]
variants = [variant.Variant(snp.Snp('\t'.join(x))) for x in lines]
expected = [variant.SNP, variant.DEL, variant.INS]
for i in range(len(lines)):
self.assertEqual(variants[i].var_type, expected[i])
def test_update_indel_no_change(self):
'''Test update_indel does nothing in the right cases'''
initial_vars = [
snp.Snp('\t'.join(['42', 'A', 'C', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', 'A', 'C', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
]
to_add = [
snp.Snp('\t'.join(['142', 'A', '.', '1000', 'x', 'x', '2000', '3000', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['142', '.', 'A', '1000', 'x', 'x', '2000', '3000', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['43', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref2', 'qry'])),
snp.Snp('\t'.join(['43', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry2'])),
snp.Snp('\t'.join(['44', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['43', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['43', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref2', 'qry'])),
snp.Snp('\t'.join(['43', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry2'])),
snp.Snp('\t'.join(['44', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
snp.Snp('\t'.join(['42', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])),
]
assert len(initial_vars) == len(to_add)
for i in range(len(initial_vars)):
var = variant.Variant(initial_vars[i])
var_original = copy.copy(var)
self.assertFalse(var.update_indel(to_add[i]))
self.assertEqual(var, var_original)
def test_update_indel_insertion(self):
'''Test update_indel extends insertions correctly'''
insertion = variant.Variant(snp.Snp('\t'.join(['42', '.', 'A', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])))
to_add = snp.Snp('\t'.join(['42', '.', 'C', '101', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry']))
expected = copy.copy(insertion)
# coords stored zero-based, so subtract 1 from the real expected coords
expected.ref_start = 41
expected.ref_end = 41
expected.ref_length = 300
expected.ref_name = 'ref'
expected.ref_base = '.'
expected.qry_start = 99
expected.qry_end = 100
expected.qry_length = 400
expected.qry_name = 'qry'
expected.qry_base = 'AC'
self.assertTrue(insertion.update_indel(to_add))
self.assertEqual(expected, insertion)
def test_update_indel_deletion(self):
'''Test update_indel extends deletions correctly'''
deletion = variant.Variant(snp.Snp('\t'.join(['42', 'A', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry'])))
to_add = snp.Snp('\t'.join(['43', 'C', '.', '100', 'x', 'x', '300', '400', 'x', 'x', 'ref', 'qry']))
expected = copy.copy(deletion)
# coords stored zero-based, so subtract 1 from the real expected coords
expected.ref_start = 41
expected.ref_end = 42
expected.ref_length = 300
expected.ref_name = 'ref'
expected.ref_base = 'AC'
expected.qry_start = 99
expected.qry_end = 99
expected.qry_length = 400
expected.qry_name = 'qry'
expected.qry_base = '.'
self.assertTrue(deletion.update_indel(to_add))
self.assertEqual(expected, deletion)
pymummer-0.10.3/pymummer/variant.py 0000664 0000000 0000000 00000005173 13146565224 0017355 0 ustar 00root root 0000000 0000000 class Error (Exception): pass
SNP = 1
DEL = 2
INS = 3
var_types = {
1: 'SNP',
2: 'DEL',
3: 'INS',
}
class Variant:
def __init__(self, snp):
'''Create a Variant object from a pymummer.snp.Snp object'''
if snp.ref_base == '.':
self.var_type = INS
self.qry_base = snp.qry_base
self.ref_base = '.'
elif snp.qry_base == '.':
self.var_type = DEL
self.qry_base = '.'
self.ref_base = snp.ref_base
elif '.' not in [snp.ref_base, snp.qry_base]:
self.var_type = SNP
self.ref_base = snp.ref_base
self.qry_base = snp.qry_base
else:
raise Error('Error constructing Variant from pymummer.snp.Snp:' + str(snp))
self.ref_start = snp.ref_pos
self.ref_end = snp.ref_pos
self.ref_length = snp.ref_length
self.ref_name = snp.ref_name
self.qry_start = snp.qry_pos
self.qry_end = snp.qry_pos
self.qry_length = snp.qry_length
self.qry_name = snp.qry_name
def __eq__(self, other):
return type(other) is type(self) and self.__dict__ == other.__dict__
def __str__(self):
return '\t'.join([
str(self.ref_start + 1),
str(self.ref_end + 1),
str(self.ref_length),
str(self.ref_name),
self.ref_base,
str(self.qry_start + 1),
str(self.qry_end + 1),
str(self.qry_length),
str(self.qry_name),
self.qry_base
])
def update_indel(self, nucmer_snp):
'''Indels are reported over multiple lines, 1 base insertion or deletion per line. This method extends the current variant by 1 base if it's an indel and adjacent to the new SNP and returns True. If the current variant is a SNP, does nothing and returns False'''
new_variant = Variant(nucmer_snp)
if self.var_type not in [INS, DEL] \
or self.var_type != new_variant.var_type \
or self.qry_name != new_variant.qry_name \
or self.ref_name != new_variant.ref_name:
return False
if self.var_type == INS \
and self.ref_start == new_variant.ref_start \
and self.qry_end + 1 == new_variant.qry_start:
self.qry_base += new_variant.qry_base
self.qry_end += 1
return True
if self.var_type == DEL \
and self.qry_start == new_variant.qry_start \
and self.ref_end + 1 == new_variant.ref_start:
self.ref_base += new_variant.ref_base
self.ref_end += 1
return True
return False
pymummer-0.10.3/setup.py 0000664 0000000 0000000 00000002344 13146565224 0015173 0 ustar 00root root 0000000 0000000 import os
import glob
import shutil
import sys
from setuptools import setup, find_packages
required_progs = ['nucmer', 'show-coords', 'show-snps', 'delta-filter']
found_all_progs = True
print('Checking MUMmer programs found in path:')
for program in required_progs:
if shutil.which(program) is None:
found_all_progs = False
found = ' NOT FOUND'
else:
found = ' OK'
print(found, program, sep='\t')
if not found_all_progs:
print('Cannot install because some programs from the MUMer package not found.', file=sys.stderr)
sys.exit(1)
setup(
name='pymummer',
version='0.10.3',
description='Wrapper for MUMmer',
packages = find_packages(),
author='Martin Hunt, Nishadi De Silva',
author_email='path-help@sanger.ac.uk',
url='https://github.com/sanger-pathogens/pymummer',
test_suite='nose.collector',
install_requires=['pyfastaq >= 3.10.0'],
tests_require=['nose >= 1.3'],
license='GPLv3',
classifiers=[
'Development Status :: 4 - Beta',
'Topic :: Scientific/Engineering :: Bio-Informatics',
'Programming Language :: Python :: 3 :: Only',
'License :: OSI Approved :: GNU General Public License v3 (GPLv3)',
],
)